To see the other types of publications on this topic, follow the link: Endoparasit.
Journal articles on the topic 'Endoparasit'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Endoparasit.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Puspitarini, Diah Ayu, Sri Subekti, and Kismiyati Kismiyati. "Identifikasi dan Prevalensi Cacing Endoparasit pada Saluran Pencernaan Kakap Merah (Lutjanus argentimaculatus) di Keramba Jaring Apung Balai Besar Perikanan Budidaya Laut, Lampung [Identification And Prevalence of Endoparasite Worms in The Gastrointestinal Tract of Red Snapper (Lutjanus argentimaculatus) In Floating Net The Centre Of Mariculture, Lampung]." Jurnal Ilmiah Perikanan dan Kelautan 10, no. 1 (June 2, 2018): 59. http://dx.doi.org/10.20473/jipk.v10i1.8549.
Full textAbstract:
AbstrakPenelitian ini bertujuan untuk mengetahui jenis dan tingkat prevalensi cacing endoparasit pada saluran pencernaan kakap merah (Lutjanus argentimaculatus) di Keramba Jaring Apung Balai Besar Perikanan Budidaya Laut Lampung. Metode yang digunakan dalam penelitian ini adalah metode survey. Pengambilan sampel sebanyak 30 ekor ikan yang berukuran 20-35 cm menggunakan metode purposive sampling. Organ yang diamati lambung dan usus, kemudian dilakukan identifikasi dan penghitungan prevalensi. Hasil dari penelitian ini menunjukkan jenis cacing endoparasit yang menginfeksi saluran pencernaan kakap merah (Lutjanus argentimaculatus) di Keramba Jaring Apung Balai Besar Perikanan Budidaya Laut Lampung adalah larva stadium tiga Anisakis physeteris (Anisakis tipe II) dan Cucullanus heterochrous. Prevalensi kakap merah yang terinfeksi endoparasit adalah 10%, terdiri dari Anisakis physeteris (Anisakis tipe II) sebesar 7% dan Cucullanus heterochrous sebesar 3%. AbstractThe purpose of the research is to know kinds and prevalence of endoparasites worm gastrointestinal red snapper (Lutjanus argentimaculatus) in floating net cages the Centre of Mariculture Lampung. The metode of the research is survey method. The sample that used is 30 fishes that size 20-35 cm used purposive sampling method. The organ that getting examination is intestine and stomach, after that do identification and counting of prevalence. The result showed kinds of endoparasite worms that infected is stage three larvae of Anisakis physeteris (Anisakis type II) and Cucullanus heterochrous. The prevalence of endoparasites in red snapper is 10% that consist from on Anisakis physeteris (Anisakis type II) 7% and Cucullanus heterochrous 3%.
2
Abdan, Muamar, Agung S. Batubara, Firman M. Nur, Derita Yulianto, Sugito Sugito, and Zainal A. Muchlisin. "Intensitas dan prevalensi ektoparasit dan endoparasit pada ikan belanak Liza macrolepis (Smith, 1846) di perairan pantai Barat-Selatan Aceh." Depik 9, no. 3 (November 30, 2020): 484–91. http://dx.doi.org/10.13170/depik.9.3.17959.
Full textAbstract:
The Largescale mullet Liza macrolepis is a common fish found in estuaries and coastal areas and the fish is used as a source of protein by coastal communities. This study aims to analyze the prevalence and intensity of parasitic infected on mullets harvested from the waters of the West - South Aceh. This research was conducted from March to April 2019 in 8 locations, namely; Estuary Aceh River, Gampong Jawa, Banda Aceh city, Coastal Ujong Pancu, Peukan Bada, Aceh Besar, Estuary Teunom River, Calang, Aceh Jaya, Estuary, and Coastal Kuala Bubon, Samatiga, West Aceh, Estuary Nagan River Langkak Kuala Tuha Nagan Raya, Estuary, and Coastal Susoh, Blang Pidie, Southwest Aceh, Estuary and Coastal Indra Damai, Kluet Selatan, South Aceh and Estuary Sua- Sua River and Ujong Umo River, Simeulue. A total of 343 samples were examined for ectoparasites and endoparasites at the Laboratory of Hatchery, Faculty of Marine and Fisheries, Syiah Kuala University. The results showed that there were seven species of parasites, infected the mullet samples namely; Ectoparasites (Cymanthoa sp., Ergasilus sp., Lernanthropus sp., Monstriloida sp., Myxobolus sp.) and Endoparasites (Nematodes and Trematodes). Prevalence value of Kota Banda Aceh was 33% ectoparasites and 28% endoparasites), Aceh Besar was 21% ectoparasites and 15% endoparasites, Aceh Jaya was 4% ectoparasites and 4% endoparasites, Southwest Aceh was 2% ectoparasites and 2% endoparasites, Simeulue was 9% ectoparasites and 9% endoparasites. It is concluded that the higher prevalence and intensity were found in fish samples from Banda Aceh and Aceh Besar, while no fish from Nagan Raya and Aceh Selatan were infected by parasites.Keywords:ParasiteCoastalEstuaryPollutant ABSTRAKIkan belanak Liza macrolepis sering dijumpai di muara dan pesisir pantai dan dijadikan sebagai sumber protein oleh masyarakat pesisir. Saat ini belum ada penelitian terkait jenis-jenis parasite yang menyerang ikan belanak di perairan Aceh, khususnya di pantai Barat Selatan Aceh. Oleh karena itu, penelitian ini bertujuan untuk menganalisis prevelensi dan intensitas parasit pada ikan belanak di perairan Barat Selatan Aceh. Penelitian dilakukan sejak Maret sampai April 2019 meliputi 8 lokasi, yaitu; Muara Krueng Aceh, Gampong Jawa Kota Banda Aceh, Ujung Pancu, Peukan Bada Aceh Besar, Muara Krueng Teunom, Calang Aceh Jaya, Muara Sungai/Pesisir Kuala Bubon, Samatiga Aceh Barat, Muara Krueng Nagan, Kuala Tuha Nagan Raya, Muara/Pesisir Susoh, Blang Pidie Aceh Barat Daya, Muara/Pesisir Indra Damai, Kluet Selatan Aceh Selatan dan Muara sungai Ujong Umo dan muara sungai Sua – Sua, tepah barat dan Simeulu Timur, Simeulu. Metode digunakan adalah preparat ulas (Smeer method). Sebanyak 343 sampel dibedah untuk dilakukan pemeriksan ektoparasit dan endoparasit di Laborarorium Pembenihan Ikan, Fakultas Kelautan dan Perikanan, Universitas Syiah Kuala. Hasil penelitian ditemukan 7 jenis parasit, ektoparasit (Cymanthoa sp., Ergasilus sp., Lernanthropus sp., Monstriloida sp., Myxobolus sp.) dan Endoparasit (Nematoda dan Trematoda). Nilai prevalensi; Kota Banda Aceh (33% ektoparasit, 28% endoparasit), Aceh Besar (21 % ektoparasit, 15% endoparasit), Aceh Jaya (4% ektoprasit dan 4%endoparasit), Aceh Barat Daya (2% ektoprasit dan 2% endoparasit) Simeulu (9% ektoparasit dan 9% endoparasit). Disimpulkan bahwa prevelensi dan intensitas parasit tertinggi dijumpai pada sampel ikan dari Banda Aceh dan Aceh Besar, sedangkan ikan sampel dari Nagan Raya dan Aceh Selatan bebas dari serangan parasit. Kata kunci:ParasitpesisirMuara sungaiPencemaran
3
Nilhakim, Lukman, Henky Irawan, and Rika Wulandari. "Identifikasi, intensitas dan prevalensi endoparasit pada ikan bawal bintang (Trachinotus blochii ) dilokasi budidaya kota tanjungpinang." Intek Akuakultur 3, no. 1 (May 18, 2019): 45–56. http://dx.doi.org/10.31629/intek.v3i1.1005.
Full textAbstract:
Intensitas parasit merupakan jumlah parasit yang menginvasi organisme pada suatu satuan ruang dan waktu, sedangkan prevalensi parasit merupakan jumlah ikan dalam populasi yang terinvasi parasite. Tujuan dari penelitian ini adalah untuk mengetahui nilai intensitas dan prevalensi akibat invasi endoparasit pada ikan bawal bintang. Metode penelitian di lakukan secara observasi atau pengamatan mikroskopis yang diawali dengan kegiatan isolasi dan di lanjutkan dengan proses identifikasi berdasarkan buku manual identifikasi. Hasil penelitian mendapatkan jenis endoparasit yang berhasil di isolasi pada organ target adalah Dragenus sp, Lecithomchirum sp, gorgorbynchus sp, ornithonyssus sp dan camalanus sp. Nilai intensitas endoparasit tertinggi di tunjukan oleh jenis parasit pada lokasi kampung kolam sebesar 11 (ind/ekor). Nilai prevalensi endoparasit tertinggi di tunjukan pada lokasi kampung kolam sebesar 30% . Penelitian meyimpulkan nilai intensitas dan prevalensi endoparasit tertinggi ditunjukaan pada lokasi kampung kolam, kelurahan sei jang, kecamatan bukit bestari, kota Tanjungpinang
4
Wirawan, I. Gusti Komang Oka, Melkianus Dedimus Same Randu, and I. Ketut Jaya. "Keragaman dan Intensitas Infeksi Endoparasit Gastrointestinal pada Sapi Bali dengan Sistem Ekstensif di Kabupaten Kupang." Jurnal Sain Veteriner 37, no. 2 (December 11, 2019): 151. http://dx.doi.org/10.22146/jsv.43185.
Full textAbstract:
Tanah Putih Village has the potential for the development of Bali cattle because it has extensive grazing land and the majority of farmers raise Bali cattle. The aim of the study was to obtain data on the diversity and intensity of gastrointestinal endoparasitic infection in Balinese cattle with an extensive breeding system in Tanah Putih Village, Kupang Timur District, Kupang Regency, East Nusa Tenggara Province. Gastrointestinal endoparasitic diversity was identify using sedimentation and flotation methods while the intensity of endoparasitic infection was carried out using McMaster method, while data on the diversity and rates of gastrointestinal endoparasitic infection were analyzed descriptively. The results of the study on the diversity of gastrointestinal endoparasites found there are five types of nematode worm eggs namely Haemonchus contortus, Oesophagostomum radiatum, Strongyloides papillosus, Bunostomum phlebotomum, and Trichostrongylus axei. Factors that support the diversity of endoparasites are feed sources, livestock populations, and grazing rotation. The average number of worm eggs found based on the total eggs per gram of faeces for Haemonchus contortus as many as 100 eggs and the other four types of worm eggs amounted to 50 eggs. The average number of eggs indicates that endoparasitic infections in these animals fall into the mild intensity category, is influenced by season, feed source, and age of livestock. The five types of gastrointestinal endoparasites found namely Haemonchus contortus, Oesophagostomum radiatum, Strongyloides papillosus, Bunostomum phlebotomum, and Trichostrongylus axei.
5
Permana, Gusti Ngurah, Jhon Harianto Hutapea, and Haryanti Haryanti. "OPTIMASI PCR (POLYMERASE CHAIN REACTION) UNTUK DETEKSI ENDOPARASIT YANG MENYERANG TELUR DAN LARVA IKAN TUNA SIRIP KUNING (Thunnus albacares)." Jurnal Riset Akuakultur 5, no. 1 (November 17, 2016): 35. http://dx.doi.org/10.15578/jra.5.1.2010.35-42.
Full textAbstract:
Endoparasit merupakan parasit yang menginfeksi dan terdapat di dalam tubuh inang, endoparasit ini telah menginfeksi telur dan larva ikan tuna sirip kuning. Tujuan dari penelitian adalah untuk mengetahui metode deteksi dan infeksi dari endoparasit ini secara molekuler dengan teknik PCR (Polymerase Chain Reaction). Telur dan larva yang terinfeksi dikumpulkan dari bak pemeliharaan untuk dianalisis. Sampel diekstraksi dengan menggunakan metode lysis bufer dan trizol. Hasil analisis menunjukkan lysis bufer memberikan pola pita yang lebih jelas dan bersih. Primer P2: 1322f (2F) CCGGAACTTTAGAGTATCGG; 1680r (2R) TCGGTTCAG ACTGA ACCAAG menghasilkan pola pita yang konsisten dan jelas dengan panjang fragmen 350 bp. Hal ini mengindikasikan bahwa endoparasit (Ichtyodinium chambelardi) menyerang telur ikan tuna di dalam bak terkontrol dan infeksinya terjadi adalah secara horisontal yang berasal dari air media pemeliharaan
6
Utama, Fahdi Putra, Kismiyati ., Gunanti Mahasri, and Putri Desi Wulansari. "IDENTIFIKASI DAN PREVALENSI CACING ENDOPARASIT PADA IKAN LAYANG DELES (Decapterus macrosoma) DI PELABUHAN PERIKANAN NUSANTARA BRONDONG, LAMONGAN." Jurnal Akuakultur Rawa Indonesia 6, no. 1 (July 7, 2018): 77–82. http://dx.doi.org/10.36706/jari.v6i1.7151.
Full textAbstract:
ABSTRACT The High Interest of public to Marine fish, create more demand of Slander Scad (Decapterus macrosoma). Slander Scad is one commodity that has economic value and high nutritional content. The Slander Scad is obtained from the catch of fishermen in the Nusantara Fishery Port Brondong, Lamongan. Fish that caught from the wild is likely to get a disease caused by infection of the endoparasites.worm. The parasites that infect Slander scad probably caused by environmental factors that could decrease immune system, causing the fish easily infected by endoparasites worm such as Anisakis. This parasite is zoonotic and can infect humans, therefore, to identify and prevalence for humans who consume fish can manage properly. The purpose of this study was to identify the species of endoparasite worms that infect Slander Scad (D. Macrosoma) in Nusantara Fishery Port of Brondong, Lamongan. The research method is using a survey method through sampling at locations directly. 75 samples of Slander Scad were examined. The main parameters observed in this study are to observe the species and the prevalence of endoparasitic worm that infected Slander scad. The result of the identification of endoparasite that infected Slander Scad were analyzed descriptively and presented in the form of figures and tables. The results showed the presence of the third-stage Anisakis simplex larvae that infect the Slander Scad in the liver, intestines, gonads, muscles in the abdominal side, in the Nusantara Fishery Port of Brondong Lamongan, East Java with a total prevalence of Anisakis simplex worm was 42.67%. Keywords: Slander Scad, Prevalence, Anisakis simplex, and zoonotic.
7
Prianggara, Alfan, Gunanti Mahasri, and Abdul Manan. "HUBUNGAN ANTARA KUALITAS AIR DENGAN PREVALENSI ENDOPARASIT PADA SALURAN PENCERNAAN IKAN NILA (Oreochromis niloticus) DI KERAMBA JARING APUNG PROGRAM URBAN FARMING DI KOTA SURABAYA." Journal of Aquaculture and Fish Health 5, no. 3 (January 16, 2019): 85. http://dx.doi.org/10.20473/jafh.v5i3.11327.
Full textAbstract:
Kendala kualitas air dalam budidaya ikan nila (Oreochromis niloticus) pada Program Urban Farming diakibatkan karena waduk maupun bozem yang digunakan merupakan perairan tergenang dan kualitas airnya tergantung darimana air itu berasal, apabila kualitas air buruk maka ikan akan stres, menjadi lemah dan mudah terserang parasit. Penelitian ini bertujuan untuk mengetahui kualitas air pada pemeliharaan ikan nila (O. niloticus), prevalensi endoparasit pada saluran pencernaan serta korelasi antara kualitas air dengan prevalensi endoparasit pada saluran pencernaan ikan nila (O. niloticus) di Keramba Jaring Apung Program Urban Farming kota Surabaya. Lokasi waduk atau bozem yang digunakan adalah Urban Farming kecamatan Wiyung, Jambangan dan Lakarsantri, kota Surabaya. Metode yang digunakan adalah metode survey. Parameter utama dalam penelitian ini adalah prevalensi endoparasit dan kualitas air. Hasil pengukuran kualitas air berkisar antara : suhu 29-300C; pH 7-8,5; kecerahan 18-30 cm; DO 4,8- 5,3 mg/l; nitrit <0,043-2,213 mg/l; nitrat <0,008-7,781 mg/l dan amoniak 0,063-0,35 mg/l. Prevalensi rata-rata endoparasit Eimeria spp. 5,71 % dan Acanthogyrus spp. 8 %. Terdapat korelasi positif antara kecerahan, amoniak dan DO dengan prevalensi Eimeria spp. serta suhu, pH, nitrat dan nitrit dengan prevalensi Acanthogyrus spp. Terdapat korelasi negatif antara suhu, pH, nitrat dan nitrit dengan prevalensi Eimeria spp. serta kecerahan, amoniak dan DO dengan prevalensi Acanthogyrus spp.
8
Mursyid, Muhammad Hipzul, Anwar Rosyidi, Wayan Wariata, and Made Sriasih. "Kasus Infestasi Endoparasit pada Kerbau (Bubalus bubalis) di Kecamatan Praya Barat Kabupaten Lombok Tengah." Jurnal Ilmu dan Teknologi Peternakan Indonesia (JITPI), Indonesian Journal of Animal Science and Technology 5, no. 2 (June 17, 2020): 93. http://dx.doi.org/10.29303/jitpi.v5i2.66.
Full textAbstract:
The purpose of this study was to determine endoparasitic infestation on Buffaloes in Praya Barat district, Central Lombok. Stools samples were taken from 61 buffaloes from 5 villages and examined at Banyumulek Animal Health Laboratory of Animal Husbandry and Animal Health Service of NTB Province using the floating and sedimentation methods to perceive the presence of parasitic eggs. The data obtained were analyzed descriptively. The results show that from 61 fecal samples analyzed, 20 samples (32.7%) were positively infected with endoparasites with a single type of infection and multi-species infection. A total of 13 samples (21.3%) were infected with Nematodes, 2 samples (3.27%) were infected with Cestode, 2 samples (3.27%) were infected with Trematode and 11 samples (18.03%) were infected with Protozoa. The degree of endoparasitic infection in buffaloes in West Praya district is included in the category of mild infection. Endoparasites that infect buffaloes in Praya Barat are coming from family Toxocaridae, Trichostrongylidae, Cooperidae, Anoplocephalidae, Strongylidae, Strongyloididae, Chabertidae, Fasciolidae and Eimeriidae. The highest prevalence for worm parasite was Toxocaridae with the percentage of 11.46%, whilst for the protozoa was the family of Eimeriidae accounted for 18.01%.
9
Moenek, Devi, Aven B. Oematan, and Novianti N. Toelle. "KERAGAMAN ENDOPARASIT GASTROINTESTINAL DAN PROFIL DARAH PADA AYAM KAMPUNG (GALLUS DOMESTICUS)." JURNAL KAJIAN VETERINER 7, no. 2 (February 14, 2020): 114–20. http://dx.doi.org/10.35508/jkv.v7i2.1983.
Full textAbstract:
Penelitian ini bertujuan untuk mengetahui keragaman jenis endoparasit gastrointestinal dan pengaruhnya terhadap profil darah ayam kampung yang meliputi jumlah eritrosit, kadar hemoglobin, Packed cell volume, dan jumlah total leukosit. Pengambilan sampel feses dan darah ayam kampung dilapangan sedangkan pemeriksaan dan identifkasi endoparasit pada feses ayam kampung serta pemeriksaan darah di laboratorium Kesehatan Hewan Program Studi Kesehatan Hewan Politani Kupang. Peubah yang diamati adalah morfologi atau ciri-ciri endoparasit dan gambaran darah terutama jumlah eritrosit, kadar hemoglobin, Packed cell volume, dan jumlah total leukosit Seluruh sampel yang terkumpul diidentifikasi menggunakan mikroskop dibantu dengan panduan kunci identifikasi dan didokumentasikan menggunakan kamera digital, dan data gambaran darah yang diperoleh akan disesuakan dengan gambaran darah normal kemudian semua data yang diperoleh, diolah secara deskriptif. Penelitian ini akan dilaksanakan didaerah Kecamatan Amarasi Kabupaten Kupang. Dari pemeriksaan ditemukan telur cacing Ascaridia galli untuk semua sampel feses dan pemeriksaan darah menunjukkan bahwa jumlah eritrosit 3.782 X 10^6/µL, kadar hemoglobin 12.16 g/L, PCV 43.18%, dan jumlah total leukosit 112.5 X 10^3/µL.
10
Pujaningsih, Retno Iswarin, Dian Wahyu Harjanti, Baginda Iskandar Moeda Tampubolon, Widianto Widianto, Ahmad Ahsan, and Wening Suri Pawestri. "Aplikasi Penambahan Kunyit dan Multinutrien Blok Plus pada Pakan Kambing Jawarandu terhadap Infestasi Endoparasit dan Konsumsi Pakan." Jurnal Ilmu Peternakan dan Veteriner Tropis (Journal of Tropical Animal and Veterinary Science) 11, no. 1 (March 30, 2021): 22. http://dx.doi.org/10.46549/jipvet.v11i1.128.
Full textAbstract:
Goat management in rural areas is still commonly done traditionally with little regard for health factors. One factor is the presence of parasitic worms in the goat's digestive tract which causes disturbed growth. The research aims to evaluate the effect of the addition of turmeric and multinutrient block plus (MNBP) in eliminating endoparasites and increasing feed intake of Jawarandu goats. The material used was 12 male Jawarandu goats weighing an average of 20 kg. A completely randomized design was used in this study with 4 treatments and 3 replications. Treatment T0: basal ration + MNBP; T1: T0 + 1% turmeric; T2: T0 + 3% turmeric; T3: T0 + 5% turmeric. The parameters observed were feed intake, weight gain, number of endoparasites and total eggs per gram of feces. Data analysis using analysis of variance significance level of 5% to determine the effect of treatment. If there is a treatment effect, it is followed by Duncan's multiple range test. The results showed a decrease in the number of endoparasites. The best treatment to induce an antibody system is T2 treatment, namely the addition of turmeric with a level of 3%. Feed intake was not significantly increasing although improving body weight gain in T2 and T3. The conclusion of the study is that the administration of MNBP and turmeric with a level of 5% has not been able to eliminate all endoparasites until the 28th day. MNBP and turmeric are useful as natural antioxidants. Increased level of turmeric can increase weight gain and immune system of goats.
Keyword: Multinutrient blocks, turmeric, Jawarandu goats, endoparasite, feed intake
11
Ahada, Atma Hiyal Ulya. "LAPORAN KASUS: Investasi Parasit Ancylostoma caninum, Trichuris vulpis dan Ctenocephalides canis Pada Anjing." Media Kedokteran Hewan 31, no. 3 (September 29, 2020): 120. http://dx.doi.org/10.20473/mkh.v31i3.2020.120-129.
Full textAbstract:
Anjing merupakan salah satu hewan peliharaan manusia yang sering terkena infeksi parasit, baik endoparasit (helminth dan protozoa) maupun ektoparasit (kutu, caplak, pinjal dan tungau). Endoparasit yang sering dilaporkan adalah kasus helminth yaitu Ancylostomiasis, Toxocariasis, Dipylidiasis, Trichuriasis dan Nekatoriasis. Sedangkan ektoparasit khusunya pinjal yang sering ditemui adalah Ctenocephalides canis. Metode yang digunakan untuk mendeteksi adanya cacing adalah pemeriksaan feses secara natif dan apung serta perhitungan Mc Master Chamber untuk mengetahui derajat keparahan infeksi cacing. Pemeriksaan pinjal dilakukan dengan mengidentifikasi preparat basah ektoparasit. Hasil pemeriksaan feses secara apung didapatkan telur cacing Ancylostoma caninum dan Trichuris vulpis. Ektoparasit yang didapat setelah pemeriksaan laboratorik adalah pinjal Ctenocephalides canis. Pengobatan yang dilakukan untuk mengatasi penyakit helminth adalah dengan pemberian obat cacing sedangkan untuk penyakit pinjal dapat dilakukan dengan pemberian obat tetes pinjal. Pencegahan dapat dilakukan dengan pemberian obat cacing secara rutin dan menjaga kebersihan kandang dan lingkungan anjing.
12
Irsya, Resti Puttama, Mairawita, and Henny Herwina. "JENIS-JENIS PARASIT PADA SAPI PERAH DI KOTA PADANG PANJANG SUMATERA BARAT." Metamorfosa: Journal of Biological Sciences 4, no. 2 (October 18, 2017): 189. http://dx.doi.org/10.24843/metamorfosa.2017.v04.i02.p09.
Full textAbstract:
Sapi perah adalah hewan ternak yang menghasilkan susu sebagai produk utamanya. Pemeliharaan sapi perah merupakan faktor penunjang suksesnya usaha ternak. Penyakit pada ternak akibat infestasi dan infeksi parasit dapat merugikan secara ekonomis, karena dapat menurunkan produktifitas dari ternak tersebut. Penelitian ini bertujuan untuk mengetahui jenis-jenis ektoparasit dan endoparasit pada sapi perah di Kota Padang Panjang serta mengetahui prevalensi masing-masing jenis. Penelitian dilakukan sejak Februari hingga Mei 2016 di tiga peternakan sapi perah di Kota Padang Panjang dan Laboratorium Taksonomi Hewan Jurusan Biologi Fakultas Matematika dan Ilmu Pengetahuan Alam Universitas Andalas. Sampel ektoparasit dan sampel feses dikoleksi dari 10 ekor sapi perah pada masing-masing peternakan, pemeriksaan sampel feses dilakukan dengan metode sentrifugasi-flotasi. Sampel ektoparasit yang didapatkan diperiksa dengan mikroskop binokuler dan diawetkan sebagai preparat permanen. Hasil penelitian didapatkan tiga jenis ektoparasit yaitu Rhipicephalus sp. (nilai prevalensi 20%), Boophilus microplus (nilai prevalensi 57%) dan Haematopinus tuberculatus (nilai prevalensi 67%). Endoparasit yang ditemukan hanya satu jenis yaitu telur Ascaris lumbricoides fertil dengan nilai prevalensi 10%.
13
Liananda, Ferry Dwi Firmansyah, Kismiyati Kismiyati, Gunanti Mahasri, and Putri Desi Wulan Sari. "IDENTIFIKASI DAN PREVALENSI CACING ENDOPARASIT PADA IKAN SWANGGI (Priacanthus macracanthus) DI PELABUHAN PERIKANAN NUSANTARA BRONDONG, LAMONGAN." Journal of Aquaculture and Fish Health 6, no. 3 (January 16, 2019): 107. http://dx.doi.org/10.20473/jafh.v6i3.11288.
Full textAbstract:
Ikan swanggi (Priacanthus macracanthus) merupakan salah satu jenis ikan laut yang memiliki kandungan protein sebesar 83,4%. Harga Ikan swanggi (P. macracanthus) mencapai Rp.9.000/kg merupakan ikan yang memiliki permintaan pasar tinggi. Ikan swanggi (P. macracanthus) yang dikonsumsi oleh masyarakat masih berasal dari tangkapan alam, dimana kualitas airnya tidak terkontrol sehingga ikan mudah terserang parasit. Penyakit yang menyerang Ikan swanggi (P. macracanthus) kemungkinan disebabkan oleh faktor kondisi lingkungan yang kurang baik sehingga menurunkan daya tahan tubuh, menyebabkan ikan mudah terinfeksi oleh cacing endoparasit seperti Anisakis simplex. Cacing ini bersifat zoonosis dan dapat menginfeksi manusia, oleh karena itu dilakukan identifikasi dan prevalensi cacing endoparasit pada ikan swanggi (P. macracanthus). Tujuan dari penelitian ini adalah untuk identifikasi dan mengetahui prevalensi spesies cacing endoparasit apa saja yang menginfeksi ikan swanggi (P. macracanthus) dari hasil tangkapan nelayan. Penelitian ini menggunakan metode survei melalui pengambilan sampel pada lokasi secara langsung. Lokasi pengambilan sampel ikan ditentukan dengan cara sengaja atau dengan metode purposive sampling (Silalahi, 2003). Metode pengambilan sampel dilakukan secara acak (random sampling) terhadap ikan swanggi (P. macracanthus) di Pelabuhan Perikanan Nusantara Brondong, Lamongan. Hasil penelitian ditemukan Cacing A. simplex pada organ otot dinding dalam abdomen, lambung, ginjal, hati, usus, dan gonad ikan swanggi (P. macracanthus). Faktor yang mempengaruhi ditemukannya Larva stadium tiga A. simplex ialah makanan dari ikan swanggi (P. macracanthus). Umumnya ikan swanggi (P. macracanthus) yang merupakan ikan karnivora memakan invertebrata (copepods atau crustacea) yang mengandung Larva stadium dua Anisakis simplex, cacing ini bersifat zoonosis. Total prevalensi cacing A. simplex yang ditemukan pada ikan swanggi (P. macracanthus) adalah 90 ekor ikan (74,99%).dan termasuk dalam kategori usually.
14
Herman, Muhammad, Gunanti Mahasri, and Sri Subekti. "IDENTIFIKASI DAN PREVALENSI CACING PADA SALURAN PENCERNAAN IKAN KEMBUNG (Rastrelliger brachysoma) DI PELABUHAN PERIKANAN NUSANTARA BRONDONG, LAMONGAN, JAWA TIMUR." Journal of Aquaculture and Fish Health 3, no. 1 (April 29, 2019): 13. http://dx.doi.org/10.20473/jafh.v3i1.12985.
Full textAbstract:
Tingginya minat masyarakat terhadap ikan laut, mengakibatkan meningkatnya permintaan terhadap ikan kembung (Rastrelliger brachysoma). Ikan kembung merupakan salah satu komoditas yang memiliki nilai ekonomis dan nilai gizi yang cukup tinggi. Ikan kembung tersebut didapatkan dari hasil tangkap para nelayan di wilayah pesisir laut Jawa dan sekitarnya. Akan tetapi ikan ini bisa saja terserang oleh penyakit akibat infeksi dari endoparasit yang disebabkan cacing. Penyakit yang menyerang ikan kembung kemungkinan disebabkan faktor lingkungan menurun sehingga menurunkan daya tahan tubuh, menyebabkan ikan mudah terinfeksi oleh cacing endoparasit seperti halnya Anisakis. Cacing tersebut bersifat zoonosis dan dapat menginfeksi manusia, oleh karena itu dilakukan identifikasi dan prevalensi agar manusia yang mengkonsumsi dapat mengelola ikan dengan benar. Tujuan dari penelitian ini adalah untuk identifikasi dan mengetahui prevalensi cacing apa saja yang menginfeksi ikan kembung (Rastrelliger brachysoma) dari hasil tangkapan nelayan di Pelabuhan Perikanan Nusantara Brondong, Lamongan. Hasil penelitian dari identifikasi ditemukan larva Anisakis simplex stadium tiga yang menginfeksi di bagian mukosa dan bagian lumen usus ikan kembung, di wilayah Pelabuhan Perikanan Nusantara Brondong, Lamongan dengan total prevalensi cacing Anisakis simplex sebesar 9.6%.
15
Hartono, Hartono, Endang Suprihati, Erma Safitri, Nunuk Dyah Retno Lastuti, Mufasirin Mufasirin, and Kusnoto Kusnoto. "Identification of Gastrointestinal Endoparasite in Bawean Deer (Axis kuhlii) and Spotted Deer (Axis axis) at Bratang Flora Park – Surabaya." Journal of Parasite Science 3, no. 2 (September 12, 2019): 53. http://dx.doi.org/10.20473/jops.v3i2.16518.
Full textAbstract:
The purpose of this study is to identify the endoparasites of Spotted Bawean Deer (Axis kuhlii) and Deer (Axis axis ) at Surabaya Flora Park. The research was conducted in December 2018 - January 2019 used total 60 specimen of sample faeces, consist of 30 sample of bawean deers faeces and 30 sample of spoted deers faeces, the samples analyzed at the Department of Parasitology Veterinary, Faculty of Veterinary Medicine, Universitas Airlangga. The results of the study found positive endoparasites on examination, samples of Bawean deer faeces (Axis kuhlii) and Spotted deer faeces(Axis axis) in Baratang Flora Park Surabaya found that 26 positive samples from 60 samples were obtained. Positive endoparasitic samples are protozoa at the stage of oocyst, namely Eimeria sp. 6 (10%) samples, worm eggs from the Nematoda class, Haemonchus sp. 20 (33.33%) and whereas endoparasites from other stages and classes were not found. The results of the analysis used Chi-Square test and showed no significantly differences degree of gastrointestinal endoparasite infection of Bawean deer (Axis kuhlii) and Spotted deer (Axis axis) (p>0.05).
16
Kismiyati, Rahayu Kusdarwati, Mohammad Faizal Ulkhaq,. "Studi Identifikasi Dan Prevalensi Endoparasit Pada Saluran Pencernaan Ikan Kerapu Tikus (Cromileptes altivelis) Di Keramba Jaring Apung Unit Pengelola Budidaya Laut Situbondo, Jawa Timur [Prevalence Study And Identification Of Endoparasites On Humpback Grouper Gastrointestinal (Cromileptes altivelis) In Floating Net Cage Marine Culture Management Unit Situbondo, East Java]." Jurnal Ilmiah Perikanan dan Kelautan 4, no. 1 (January 24, 2019): 93. http://dx.doi.org/10.20473/jipk.v4i1.11591.
Full textAbstract:
Abstract Humpback grouper (Cromileptes altivelis) or also known as polkadot grouper is one of the excellent fish commodities in Indonesia which has trading value reached $ 90-150/kg. As a consumed fish, humpback grouper are needed for beverage at luxuries restaurant and hotel in the world. As major export commodities in Indonesia, since the 1990's the techniques of grouper cultivation in float net rats are enhanced to fulfill international market demand. Humpback grouper fish cultivation techniques in float net cages cannot be separated from the problems in any cultivate activities, one of the causes is a disease and one of the diseases that rushed humpback grouper is parasite. The disadvantages that caused by the parasite is fish’ weight loss. The purpose of this study is to determine the types of endoparasites that attacked the digestive system of humpback grouper (Cromileptes altivelis) in float net cages and also to discuss the prevalences of endoparasites that attack the digestive of humpback grouper (Cromileptes altivelis) in float net cages. The method of this research is descriptive. The sampling was done in once for 60 fishes with the length range of fish is around 15-20 cm and 4 months old from the float net. The number of each fishes samples that were taken 5-10% from the total of population, where the number of humpback grouper populations in each raft float net are 200 fishes. The main parameters that observed in this study were endoparasites identification species that attack the digestive system of humpback grouper (Cromileptes altivelis) in float net cages and the prevalence rates for each endoparasites. The supporting parameters in this study were the water quality in float net cages which includes temperature, pH and salinity are measured during the sample taken. The results showed that 60 samples taken from four float nets 6 fishes were positive infected endoparasitic of trematodes and nematodes, besides 4 fishes are positive infected worms Echinostoma which belong to the class of Trematodes and 2 fishes infected worms Camallanus carangis that belongs to the class Nematoda. The prevalence values for each of the worm are 6.67% for Echinostoma and 3.33% for Camallanus carangis. The research concern the identification and prevalence of endoparasites in Humpback grouper at hatchery is needed to early finding out the attack of endoparasites and to break the flow of endoparasitic spreading.
17
Febrina, Melinda, Mohammad Faizal Ulkhaq, Hayu Widyadi, Darmawan Setia Budi, and Suciyono Suciyono. "Karakterisasi parasit pada komoditas perikanan di Balai Karantina Ikan, Pengendalian Mutu, dan Keamanan Hasil Perikanan Semarang, Jawa Tengah." Depik 9, no. 3 (January 6, 2021): 510–15. http://dx.doi.org/10.13170/depik.9.3.17693.
Full textAbstract:
Parasite is one of the infectious disease pathogens in fish which can cause secondary infection by bacteria, fungi and viruses. Therefore, fish quarantine activities are needed to prevent disease transmission and are carried out by the fish quarantine center. This study aimed to characterize the types of parasites that infect fish commodities that will be trafficked at the Fish Quarantine Center, Quality Control and Safety of Fishery Products in Semarang, Central Java. Parasitic examination was carried out using the original microscopic method by scraping the mucus, gills and internal organs, then characterizing it morphologically. The results showed that the infected parasites in fish samples included ectoparasites (Trichodina, Gyrodactylus, Dactylogyrus, Chilodonella, and Argulus) and endoparasites (Anisakis).Keywords:ParasitesFishery CommodityBKIPMHP SemarangABSTRAKParasit merupakan salah satu patogen penyebab penyakit infeksius yang dapat memicu terjadinya infeksi sekunder oleh bakteri, jamur maupun virus. Oleh sebab itu, perlu dilakukan tindakan karantina ikan untuk mencegah terjadinya penyebaran penyakit yang dilakukan oleh balai karantina ikan. Penelitian ini bertujuan untuk mengkarakterisasi jenis parasit yang menginfeksi komoditas ikan yang akan dilalulintaskan di Balai Karantina Ikan, Pengendalian Mutu dan Keamanan Hasil Perikanan Semarang, Jawa Tengah. Metode penelitian yang digunakan yaitu pemeriksaan secara mikroskopis menggunakan metode natif/langsung pada lendir, insang dan organ dalam ikan, dilakukan karakterisasi secara morfologis. Hasil penelitian menunjukkan bahwa sampel ikan terinfeksi parasit dari golongan ektoparasit (Trichodina, Gyrodactylus, Dactylogyrus, Chilodonella, and Argulus) dan endoparasit (Anisakis).Kata kunci:ParasitKomoditas Perikanan BKIPMHP Semarang
18
Đurđević, Biljana, Ivan Pavlović, Marko Pajić, Milena Samojlović, Miloš Pelić, Jelena Petrović, and Vladimir Polaček. "THE FIRST STUDY OF THE ENDOPARASITIC FAUNA OF MUTE SWANS (CYGNUS OLOR) IN THE NORTHERN PART OF SERBIA." Archives of Veterinary Medicine 13, no. 1 (August 10, 2020): 69–81. http://dx.doi.org/10.46784/e-avm.v13i1.100.
Full textAbstract:
In the Northern part of Serbia, which is part of Pannonian Basin, mute swan (Cygnus olor) population has notably increased over the last few decades. Like other birds from Anatidae family, mute swans are a host of numerous endoparasite species. The aim of this study was to acquire the data on identification and prevalence of endoparasites in mute swans in the Republic of Serbia, as that information is lacking. Individual faecal samples of sixty-eight adult mute swans were examined for the presence of endoparasites. Coprological examination was performed using flotation and sedimentation technique with saturated ZnSO4 solution. The samples were collected from December 2016 to March 2017, during epizootic of highly pathogenic avian influenza H5N8 in the Republic of Serbia. Dead mute swans were collected from twelve different locations in the Northern part of Serbia. Altogether, 39.7% of the examined fecal samples contained different parasites. The endoparasitic fauna was divers and included 3 species of nematodes, 2 cestodes species, one trematode and one protozoan species. Nematodes were the most prevalent helminthes and among these the most frequent nematode species found was Heterakis dispar (17.6%), followed by Echinuria uncinata (5,8%) and Ascaridia spp. (4,4%). Four mixed infections were found, where double infection was the most prevalent. No endoparasites were found in faecal samples of mute swans collected from the locations Sombor and Titel. As this study covers a small population of mute swans, more detailed studies need to be carried out on a larger population in order to gain an insight into the diversity and prevalence of endoparasites in the Republic of Serbia.
19
Eliyani, Yuke. "EKTOPARASIT DALAM PERSPEKTIF PERIKANAN BUDIDAYA." Jurnal Kebijakan Perikanan Indonesia 8, no. 2 (January 10, 2017): 77. http://dx.doi.org/10.15578/jkpi.8.2.2016.77-84.
Full textAbstract:
Pengembangan sektor perikanan budidaya di Indonesia harus terus dilakukan mengingat hampir 70% produksi ikan berasal dari sektor ini. Dalam pengembangannya, salah satu faktor yang harus diperhatikan adalah masalah kesehatan ikan, terutama yang berhubungan dengan hama dan penyakit termasuk di dalamnya ektoparasit. Meskipun tidak mematikan ikan secara langsung, ektoparasit sangat berbahaya bagi ikan karena menjadi pintu pembuka masuknya patogen yang berbahaya bagi kehidupan ikan, baik dari jenis virus, bakteri, jamur maupun dari jenis endoparasit. Identifikasi jenis dan keberadaan ektoparasit merupakan upaya awal untuk penanggulangan maupun antisipasi agar tidak terjadi wabah ketika gejala awal sudah diketahui. Upaya lain adalah penanggulangan ketika parasit ini telah menginfeksi yang kegiatannya dapat dilakukan melalui penggunakan bahan kimia, fitokimia, fitofarmaka, maupun dengan manipulasi lingkungan dan pakan.In Indonesia, 70 percent of fish production is contributed by aquaculture activities. It is therefore necessary to prioritize this activity to sustain the share of fish and fisheries activities to Indonesian economy. Keeping the fish always in healthy condition and prevention them from diseases and parasites such as ectoparasite are important factors in aquaculture. Ectoparasite not only indirectly causing fish loss but they are also very dangerous in opening the invasion of fish pathogens (viruses, bacteria, fungi, or endoparasites). It is then necessary to identify ectoparasite as soon as early symptoms are detected so that further negative impacts could be avoided. When the parasites have already attacked, a couple of treatment could be implemented: chemical poisons, phytochemicals or other natural agents, and also applying environment and feed manipulations.
20
Widhowati, Dyah, Rochiman Sasmita, Olan Rahayu Puji Astuti Mussa, and Helda Asniyani Benu. "INFEKSI ENDOPARASIT PADA KUCING DOMESTIK (Felis domesticus) DI PASAR TRADISIONAL KECAMATAN SAWAHAN KOTA SURABAYA." VITEK : Bidang Kedokteran Hewan 9 (November 2, 2020): 38–43. http://dx.doi.org/10.30742/jv.v9i0.67.
Full textAbstract:
Toxoplasma gondii is an intracellular parasite of the protozoan group and is obligate parasite with definitive host is a cat and other family felidae, Toxoplasma gondii can cause Toxoplasmosis and is categorized as one of zoonotic diseases. This study aims to determine the Toxoplasma gondii infection in domestic cats (Felis domesticus) in the traditional markets of Sawahan sub-district, Surabaya City. This study used a faecal sample of 46 domestic cats in the traditional markets of the Sawahan sub-district consisting of 20 female cats, 10 male cats, and 16 kittens. Then examined at the Laboratory of Parasitology, Faculty of Veterinary Medicine, Wijaya Kusuma University. The examination was carried out by the native method using eosin 2% and the floating method using saturated sugar and observed under a microscope with a magnification of 100x-400x. The results showed there were no cats infected with Toxoplasma gondii but found 3 endoparasites namely Ancylostoma sp 23.9%, Toxocara cati 41.3% and Isospora rivolta 4.3%.
21
Yufa, Marta, Mairawita Mairawita, and Henny Herwina. "IDENTIFICATION AND PREVALENCE OF ENDOPARASITE IN GOAT IN PADANG, WEST SUMATERA." Metamorfosa: Journal of Biological Sciences 5, no. 1 (March 30, 2018): 94. http://dx.doi.org/10.24843/metamorfosa.2018.v05.i01.p14.
Full textAbstract:
Kambing merupakan hewan ternak yang banyak dikonsumsi oleh masyrakat di Kota Padang. Pertumbuhan populasi kambing belum sebanding dengan angka permintaan yang terus meningkat, hal ini disebabkan umumnya kambing ini dipelihara secara tradisional dalam skala kepemilikan kecil sehingga pemeliharaannya kurang diperhatikan dan dapat menyebabkan kambing mudah terserang oleh parasit. Penelitian ini bertujuan untuk mengetahui jenis-jenis parasit pada kambing di Kota Padang serta mengetahui prevalensi masing-masing jenis. Penelitian ini dilakukan sejak bulan April hingga Mei 2016 di lima lokasi di Kota Padang dan Laboratorium Taksonomi Hewan Jurusan Biologi Fakultas Matematika dan Ilmu Pengetahuan Alam Universitas Andalas. Sampel feses dikoleksi dari 25 ekor kambing, pemeriksaan sampel feses dilakukan dengan metode sentrifugasi-flotasi. Hasil penelitian didapatkan dua jenis endoparasit yaitu: Trichostrongylus sp. (nilai prevalensi 64%) dan jenis tidak teridentifikasi (Unidentified sp.) dari famili Taeniidae (nilai prevalensi 16%).
22
Fitri, Dian Yusnia, Alfiana Laili Dwi Agustin, Kholik Kholik, and Maratun Janah. "Deteksi Koksidiosis pada Ayam Layer di Sesaot, Kecamatan Narmada, Kabupaten Lombok Barat." Media Kedokteran Hewan 32, no. 3 (September 7, 2021): 97. http://dx.doi.org/10.20473/mkh.v32i3.2021.97-104.
Full textAbstract:
Koksidiosis merupakan penyakit yang di sebabkan oleh protozoa spesies Eimeria spp. yang dapat menginfeksi ayam. Eimeria sp adalah spesies yang paling patogen dan menyebabkan diare berdarah pada ayam. Satu kendala yang dirasakan oleh peternak di sana adalah adanya penyakit berak darah pada ayam layer di Desa Sesaot kecamatan Narmada Lombok Barat. Tujuan penelitian untuk mengetahui adanya endoparasit koksidiosis pada ayam layer yang dipelihara di Sesaot kecamatan Narmada Lombok Barat sebagai langkah untuk melakukan pengendalian terhadap koksidiosis. Sejumlah 9 sampel diambil dari ayam yang menunjukkan gejala klinis terinfeksi koksidia, yaitu diare berdarah. Sampel feses diambil secara aseptis, kemudian dibawa ke Laboratorium Equine Clinical Skills Centre Universitas Pendidikan Mandalika. Sampel yang sudah ada di laboratoirum diperiksa menggunakan metode Pengapungan. Berdasarkan hasil pemeriksaan, terdapat satu sampel positif terinfeksi Eimeria spp. dari total 9 sampel yang diidentifikasi.
23
Baia, Raimundo Rosemiro Jesus, Alexandro Cezar Florentino, Luís Maurício Abdon Silva, and Marcos Tavares-Dias. "Patterns of the parasite communities in a fish assemblage of a river in the Brazilian Amazon region." Acta Parasitologica 63, no. 2 (June 26, 2018): 304–16. http://dx.doi.org/10.1515/ap-2018-0035.
Full textAbstract:
AbstractThis paper characterizes the pattern of ectoparasite and endoparasite communities in an assemblage of 35 sympatric fish from different trophic levels in a tributary from the Amazon River system, northern Brazil. In detritivorous, carnivorous, omnivorous and piscivorous hosts, the species richness consisted of 82 ectoparasites and endoparasites, but protozoan ectoparasites such asIchthyophthirius multifiliis,Piscinoodinium pillulareandTripartiellasp. were dominant species predominated, such that they were present in 80% of the hosts. The taxon richness was in the following order: Monogenea > Nematoda > Digenea > Crustacea > Protozoa > Acanthocephala = Cestoda > Hirudinea. Among the hosts, the highest number of parasitic associations occurred inSatanoperca jurupari,Aequidens tetramerus,Hoplerythrinus unitaeniatus,Hoplosternum littorale,Cichlasoma amazonarum,Chaetobranchus flavescens,Squaliforma emarginata,Chaetobranchopsis orbicularisandHoplias malabaricus. A weak positive correlation between ectoparasite abundance and length of the hosts was observed. Ectoparasite communities of detritivorous, carnivorous and omnivorous hosts were similar, but these differed from the communities of piscivorous hosts. Larval endoparasite species with low host specificity were the main determinants of the parasite infracommunity structure of the fish assemblage. Fish assemblage had few species of helminth that were specialist endoparasites, while many were parasites at the larval stage, infecting intermediate and paratenic hosts. Finally, carnivorous and omnivorous hosts harbored endoparasite communities that were more heterogeneous than those of detritivorous and piscivorous hosts. This result lends supports to the notion that the feeding habits of the host species are a significant factor in determining the endoparasites fauna.
24
TORRES, VIVIANA DE OLIVEIRA, EVA RAMONA PEREIRA SOARES, LUAN DIAS LIMA, SANDRO MARCIO LIMA, LUIS HUMBERTO DA CUNHA ANDRADE, and WILLIAM FERNANDO ANTONIALLI-JUNIOR. "Morphophysiological and cuticular chemical alterations caused by Xenos entomophagus endoparasites in the social wasp Polistes ferreri (Hymenoptera, Vespidae)." Parasitology 143, no. 14 (August 30, 2016): 1939–44. http://dx.doi.org/10.1017/s0031182016001529.
Full textAbstract:
SUMMARYSocial wasps can face many challenges during their colony cycle, including the presence of parasites. The order Strepsiptera is among the main parasites of the wasp genus Polistes. The aim of this study was to evaluate the effect of an endoparasite species on the host Polistes ferreri, with the hypothesis that females of this social wasp would undergo morphophysiological alterations as well as changes in their cuticular chemical profile caused by the obligate endoparasite. On average, parasitism was found in 10% of the colonies studied. All the parasitized females showed filamentous ovarioles without developing oocytes, which indicates a physiological castration. Moreover, the endoparasites present in the gaster of females caused its volume to increase, and the presence of endoparasites changed the cuticular chemical profiles of females, confirming our hypothesis. It is likely that this parasitism effect could hamper the maintenance of wasp colonies.
25
Raley, Ainsley, Rebecca Price, William Seddon, and Karen Lee Keller. "Gastrointestinal Parasites in Road-Killed Raccoons and Opossums in Western Maryland." Journal of Student Research 1, no. 3 (September 17, 2012): 28–30. http://dx.doi.org/10.47611/jsr.v1i3.117.
Full textAbstract:
Opossums (Didelphis virginiana) and raccoons (Procyon lotor) harbor several types of endoparasites, including various nematode and cestode species. The purpose of this study was to identify endoparasites from the gastrointestinal tract of road-killed opossums and raccoons collected in Fall 2011 in Allegany and Garrett counties in Maryland. A total of 2 opossums and 3 raccoons were collected and dissected and several endoparasitic worms were removed. Sex of each worm was determined and eggs were removed from selected females for examination. Two nematode species were identified in the opossum: Physaloptera turgida was found in the stomach; and Cruzia americana was found in the intestine. One nematode species was identified in the raccoon: Baylisascaris procyonis was found in the intestine. Also, approximately 12 damaged proglottids from a tapeworm were found in the intestine of 1 raccoon, but definitive identification of the species was not possible. Our results are similar to previous studies which have found these same nematodes in opossums and raccoons, although recent reports of these species in Western Maryland have not been reported. Endoparasite species are usually specific to their definitive host; however, B. procyonis is considered a zoonotic agent because accidental ingestion of eggs can cause visceral larval migrans in humans. Even though our sample size was too small to assign any statistical significance to our data, the fact remains that B. procyonis poses a serious risk to human health and further studies to determine the number of raccoons and other animals infected in Western Maryland may be warranted.
26
Filzah, Syafitri, Tengku Said Raza'i, and Rika Wulandari. "Silver Pompano’s (Trachinotus blochii) Identification and Prevalence of Endoparasite in Teluk Bintan’s Culture Area." Intek Akuakultur 2, no. 2 (October 28, 2018): 70–77. http://dx.doi.org/10.31629/intek.v2i2.546.
Full textAbstract:
The aim of this study were to identify the type of endoparasites and the internal organ prevalence invasion on silver pompano (Tracinhotus blochii). This study was conducted by in vitro. The procedures consist of the random fish sampling was about 5% in 3 culture area, then the purification of endoparasite done by isolation technique. The process of endoparasites identification based on the manual identification by Kabata (1985) and Rigby (1998). This study obtained one genus of Camallanus in the intestine with a 4,4% prevalence.
27
Yáñez-Meza, Andrea, Carlos Landaeta-Aqueveque, Nicol Quiroga, and Carezza Botto-Mahan. "Helminthic infection in three native rodent species from a semiarid Mediterranean ecosystem." Revista Brasileira de Parasitologia Veterinária 28, no. 1 (March 2019): 119–25. http://dx.doi.org/10.1590/s1984-29612019014.
Full textAbstract:
Abstract Helminth parasites are still not a well-known component of animal biodiversity. In this study, we describe and compare the endoparasite assemblages of three native rodent species from a semiarid Mediterranean ecosystem. A total of eight species of gastrointestinal helminth parasites were detected. The endoparasitic communities of the rodents Phyllotis darwini (5 species), Octodon degus (4 species), and Abrothrix olivaceus (3 species) were described in terms of their prevalence and mean abundance. In addition, endoparasite records by rodent species were submitted to rarefaction analyses to verify sampling robustness and used to compare richness and similarity among rodent species. O. degus presented the highest prevalence and parasitic load, but was of low diversity, while P. darwini presented the highest diversity, but had a low prevalence rate. Conversely, A. olivaceus presented the lowest prevalence and diversity. This study contributes to the existing knowledge of the endoparasitic fauna of rodent species from semiarid Mediterranean zones.
28
BELLAY, S., E. F. DE OLIVEIRA, M. ALMEIDA-NETO, M. A. R. MELLO, R. M. TAKEMOTO, and J. L. LUQUE. "Ectoparasites and endoparasites of fish form networks with different structures." Parasitology 142, no. 7 (March 16, 2015): 901–9. http://dx.doi.org/10.1017/s0031182015000128.
Full textAbstract:
SUMMARYHosts and parasites interact with each other in a variety of ways, and this diversity of interactions is reflected in the networks they form. To test for differences in interaction patterns of ecto- and endoparasites we analysed subnetworks formed by each kind of parasites and their host fish species in fish–parasite networks for 22 localities. We assessed the proportion of parasite species per host species, the relationship between parasite fauna composition and host taxonomy, connectance, nestedness and modularity of each subnetwork (n = 44). Furthermore, we evaluated the similarity in host species composition among modules in ecto- and endoparasite subnetworks. We found several differences between subnetworks of fish ecto- and endoparasites. The association with a higher number of host species observed among endoparasites resulted in higher connectance and nestedness, and lower values of modularity in their subnetworks than in those of ectoparasites. Taxonomically related host species tended to share ecto- or endoparasites with the same interaction intensity, but the species composition of hosts tended to differ between modules formed by ecto- and endoparasites. Our results suggest that different evolutionary and ecological processes are responsible for organizing the networks formed by ecto- and endoparasites and fish.
29
Alifuddin, M., Yani Hadiroseyani, and I. Ohoiulun. "Parasites in Fresh Water Ornamental Fish (Cupang, Guppy and Rainbow Fish)." Jurnal Akuakultur Indonesia 2, no. 2 (August 1, 2007): 93. http://dx.doi.org/10.19027/jai.2.93-100.
Full textAbstract:
<p>Parasite inventory on some fresh water ornamental fish was done by survey methode. Parasites found from cupang fish namely Trichodinid (Ciliophora), <em>Dactylogyrus </em>sp. and <em>Gyrodaclylus </em>sp. (Platyhelminthes), Acanthocephala and cystic form; in guppy fish Trichodinid (Ciliophora), <em>Gyrodaclylus </em>sp. (Platyhelminthes) and <em>Lerneae </em>sp. (Crustasea); on rainbowg found Trichodinid (Ciliophora), <em>Dactylogyrus </em>sp., <em>Gyrodaclylus </em>sp. (Platyhelminthes), Acanthocephala, <em>Lerneae </em>sp. (Krustasea) and cystic form. Parasites found known as ecto, meso and endoparasites. From this study, there is correlation between parastes present with length fish.</p> <p>Key word : Fish water ornamental fish, fish parasites</p> <p> </p> <p>ABSTRAK</p> <p>Inventarisi parasit telah dilakukan dengan metode survey pada ikan hias air tawar yakni, ikan cupang <em>(Betta splendens </em>Regan), ikan gapi <em>(Poecilia reticulata </em>Peters) dan ikan rainbow <em>(Melanotaenia macculochi </em>Ogilby). Pada ikan cupang ditemukan parasit Trichodinid (Ciliophora), <em>Dactylogyrus </em>sp. dan <em>Gyrodaclylus </em>sp. (Platy-helminthes), Acanthocephala dan kiste); pada ikan gapi ditemukan Trichodinid (Ciliophora), <em>Gyrodaclylus </em>sp. (Platyhelminthes) dan <em>Lerneae </em>sp. (Krustasea); pada ikan rainbowg ditemukan parasit Trichodinid (Ciliophora), <em>Dactylogyrus </em>sp., <em>Gyrodaclylus </em>sp. (Platyhelminthes), Acanthocephala, <em>Lerneae </em>sp. <em>{Krustasea) </em>dan kista. Parasit yang ditemukan tergolong ekto, meso dan endoparasit. Dari penelitian ini terlihat adanya hubungan keberadaan parasit dengan ukuran panjang ikan.</p> Kata kunci: Ikan hias air tawar, parasit ikan
30
UCHANG, FELLICIA INCHING, YANG LEE, FREDDY KUOK SAN YEO, and YEE LING CHONG. "Fish Endoparasites from Streams near Paddy Fields in Serian and Padawan, Western Sarawak." Trends in Undergraduate Research 2, no. 1 (June 28, 2019): a7–14. http://dx.doi.org/10.33736/tur.1547.2019.
Full textAbstract:
The fish health status and parasitic infection in paddy fields are understudied in Borneo. This study was done to compare the prevalence and abundance of parasites on freshwater fishes in the upstream and downstream rivers of paddy fields. Parasite study on freshwater fishes was done by collecting live fish samples using ten minnow traps with baits at each site in Serian and Padawan, Sarawak, from October 2017 until March 2018. A total of 120 freshwater fishes were examined during this study period. Cold anaesthesia was applied on live samples prior to ectoparasite and endoparasite microscopic screening, which involved scraping of outer body mucous and removal of fish intestines, respectively. No ectoparasites were recovered from the fish samples. A total of 19 (15.83%) fishes from Cyprinids were infected with endoparasites. From these, 58 individuals of endoparasites were recovered. Two groups of parasites, namely Nematoda (Cucullanus sp.) and Trematoda (unidentified), were recovered from the fish intestines. From this study, there was a significant difference between the upstream fishes and downstream fishes in their endoparasite infection at both Triboh Village (p = 0.035) and Annah Rais Village (p = 1.445 × 10-6) using two samples t-test. The endoparasite abundance in fish was higher in the streams where there was less human disturbance. This study may serve as a baseline study on the parasitic infections of freshwater fishes in streams near paddy fields or other agricultural area in Sarawak.
31
Hamzah, Nono Hartanto, Srinawati, Jumriadi, Alfa Astiana Afandi, and Herawati. "Performa dan Infeksi Patogen Penyebab Penyakit Pada Udang Tambak Yang Menggunakan Pakan FSBM." SIGANUS: Journal of Fisheries and Marine Science 1, no. 2 (March 29, 2020): 62–68. http://dx.doi.org/10.31605/siganus.v1i2.654.
Full textAbstract:
Bungkil kedelai atau juga biasa disebut soya bean meal (SBM) adalah bahan sisa setelah pengekstraksian minyak kedelai. Bungkil kedelai dengan kandungan protein kasar yang kadarnya cukup tinggi yakni 44%-45 % ini juga kaya asam amino esensial dan merupakan sumber lisin, metionin, isoleusin, leusin, arginine, glisin, dan treonin. Tujuan dari penelitian ini adalah untuk mengetahui performa dan infeksi pathogen penyebab penyakit pada udang tambak menggunakan pakan FSBM. Penelitian ini dilaksanakan pada Februari sampai dengan Mei 2018 bertempat di BPBAP Takalar. Parameter yang diamati berat udang, panjang udang, berat hepatopankreas, prevalensi parasit, total bakteri, total vibrio. Pengolahan data dilakukan secara kuantatif dan kualitatif menggunakan uji regresi. Berdasarkan hasil bahwa infeksi parasit (endoparasit) jenis Zoothamnium sp terjadi pada lima pekan setelah penebaran udang di tambak. Tidak ditemukan adanya nekrosi pada kaki renang. Keberadaan bakteri vibrio dalam tubuh udang masih dalam jumlah yang normal. Tidak ditemukan adanya kematian udang. Infeksi virus jenis IMNV mulai dideteksi pada pekan ke delapan dengan kategori sangat ringan. Proses desinfektan kolam tambak dan aplikasikan probiotik sesuai karakteristik tambak dan udang sangat direkomendasikan
32
Madel, Günter. "Beiträge zur Morphologie und Biologie von Meteorus fragilis Wesm. (Hym. Brac.) - ein Endoparasit des Mondvogels Phalera bucephala L. (Lep., Notodontidae)." Zeitschrift für Angewandte Entomologie 53, no. 1-4 (August 26, 2009): 1–47. http://dx.doi.org/10.1111/j.1439-0418.1963.tb02880.x.
Full text
33
Krasnov, Boris R., Kerstin Junker, Simon Wood, Edward A. Ueckermann, Gert J. Venter, Luther van der Mescht, Heloise Heyne, and David S. Jacobs. "Compositional turnover in ecto- and endoparasite assemblages of an African bat, Miniopterus natalensis (Chiroptera, Miniopteridae): effects of hierarchical scale and host sex." Parasitology 147, no. 14 (September 1, 2020): 1728–42. http://dx.doi.org/10.1017/s0031182020001602.
Full textAbstract:
AbstractWe studied the compositional turnover in infracommunities and component communities of ecto- and endoparasites infesting a bat, Miniopterus natalensis (Chiroptera, Miniopteridae), across seven sampling sites using the zeta diversity metric (measuring similarity between multiple communities) and calculating zeta decline and retention rate (both scales) and zeta decay (component communities). We asked whether the patterns of zeta diversity differ between (a) infracommunities and component communities; (b) ecto- and endoparasites and (c) subsets of communities infecting male and female bats. The pattern of compositional turnover differed between infracommunities and component communities in endoparasites only. The shape of zeta decline for infracommunities indicated that there were approximately equal probabilities of ecto- and endoparasitic species to occur on/in any bat individual within a site. The shape of zeta decline for component communities suggested the stochasticity of ectoparasite turnover, whereas the turnover of endoparasites was driven by niche-based processes. Compositional turnover in component communities of ectoparasites was more spatially dependent than that of endoparasites. Spatial independence of compositional turnover in endoparasites was due to subcommunities harboured by female bats. We conclude that the patterns of compositional turnover in infracommunities were similar in ecto- and endoparasites, whereas the patterns of turnover in component communities differed between these groups.
34
Spasojević Kosić, Ljubica, Vesna Lalošević, Stanislav Simin, and Ljiljana Kuruca. "ENDOPARASITES IN HUNTING DOGS IN VOJVODINA." Archives of Veterinary Medicine 5, no. 2 (December 26, 2012): 3–10. http://dx.doi.org/10.46784/e-avm.v5i2.165.
Full textAbstract:
Concerning infectious diseases in hunting dogs, parasites represent an important etiological agent. Among zoonotic diseases, parasitosis, and in particular, helminthosis can cause serious public health concern. This study was performed to investigate infestations with endoparasites in hunting dogs. A total of 43 faecal samples from owned hunting dogs were collected, and were examined for the presence of endoparasites. The overall prevalence of endoparasitic infestation was 65, 15% and six species were found: Trichuris vulpis (44.19%), Ancylostoma caninum (27.91%), Capillaria spp. (16.28%), Isospora spp. (11.63%), Toxocara canis (9.30%), Toxascaris leonina (2.32%). The prevalence of endoparasites with zoonotic potential was 39.53%. These data are of importance for veterinarians in clinical practice, dealing with antiparasitic treatment and choosing appropriate antiparasitic drug for hunting dogs. Due to this, veterinarians should play an important role in helping to prevent or minimize zoonotic transmission of the parasites.
35
Hutapea, Jhon Harianto, Gusti Ngurah Permana, and Ananto Setiadi. "PEMELIHARAAN INDUK IKAN TUNA SIRIP KUNING, Thunnus albacares DALAM BAK TERKONTROL." Jurnal Riset Akuakultur 5, no. 1 (November 17, 2016): 79. http://dx.doi.org/10.15578/jra.5.1.2010.79-90.
Full textAbstract:
Intensifikasi penangkapan ikan tuna baik yang langsung dipasarkan maupun dibesarkan dalam usaha budidaya, berpengaruh negatif terhadap kelestarian populasi ikan ini di alam. Dengan demikian upaya perbenihan secara buatan perlu dilakukan untuk mengurangi tekanan terhadap populasi alam. Balai Besar Riset Perikanan Budidaya Laut, Gondol telah merintis perbenihan ikan tuna sirip kuning (Thunnus albacares) sejak tahun 2003 bekerjasama dengan Overseas Fishery Cooperation Foundation (OFCF) Jepang. Induk ikan tuna telah berhasil dibesarkan dan dipijahkan dalam bak beton bervolume 1.500 m3 secara terkontrol, dengan sistem pergantian air semi tertutup. Pakan yang diberikan berupa ikan layang dan cumi-cumi sekitar 2,5% biomassa per hari. Pemijahan pertama terjadi pada bulan Oktober tahun 2004, ukuran induk diperkirakan lebih dari 9,138 kg atau panjang cagak lebih dari 82 cm dengan perkiraan umur sekitar 2 tahun. Puncak pemijahan terjadi pada tahun 2005 dan 2006 dengan frekuensi pemijahan masing-masing lebih dari 100 kali. Pemeliharaan induk ikan tuna dengan kepadatan 0,66 kg/m3 belum dapat dikatakan sebagai kepadatan maksimum dan peningkatan kematian cenderung akibat ruang gerak yang semakin sempit seiring dengan pertumbuhan induk. Namun demikian kendala yang ditemukan dalam pemeliharaan induk adalah kematian akibat menabrak dinding bak sedangkan kendala dalam pemeliharaan larva adalah serangan endoparasit pada telur
36
Ayuningtyas, Ayuningtyas, and Muhammad Tri Aji. "PREVALENSI DAN INTENSITAS PARASIT LELE ( Clarias sp.) KOLAM BUDIDAYA KELOMPOK “MINO NGREMBOKO”, DESA GRABAG, KECAMATAN GRABAG, KABUPATEN PURWOREJO." Journal of Aquaculture Science 6, no. 1 (April 28, 2021): 1. http://dx.doi.org/10.31093/joas.v6i1.124.
Full textAbstract:
Infeksi parasit pada budidaya ikan dapat memicu terjadinya infeksi primer akibat penurunan imunitas ikan sehingga memudahkan mikroorganisme lain baik bakteri maupun virus untuk masuk ke dalam tubuh ikan. Penelitian ini bertujuan untuk mengetahui, menghitung prevalensi dan intensitas parasit yang ditemukan di tambak lele kelompok tani ikan "Mino Ngremboko" di Desa Grabag Kecamatan Grabag Kabupaten Purworejo. Penelitian ini menggunakan metode kerokan dengan menelaah insang, lendir dari kulit, sirip dan saluran pencernaan pada benda kaca yang kemudian diamati secara mikroskopis menggunakan mikroskop cahaya perbesaran 10-40x. Parasit yang ditemukan adalah ektoparasit yang terdiri dari 6 spesies; Trichodina sp., Tetrahymena sp., Gyrodactylus sp., Dinoflagelata, Epistylis sp., dan Dactylogyrus sp. Tidak ditemukan parasit dari kelompok endoparasit dan hematozoa. Prevalensi tertinggi adalah Dactylogyrus sp. dengan angka prevalensi 54% dan terendah adalah Dinoflagella dengan angka prevalensi 10%. Intensitas parasit tertinggi dan terendah adalah Epistylis sp. (18,0 ind./ ikan terinfeksi) dan Dactylogyrus sp. (2,8 ind./ ikan yang terinfeksi), masing-masing. Dapat disimpulkan bahwa tingkat infeksi parasit pada tambak kelompok pembudidaya ikan berada pada tingkat normal/biasa berdasarkan kriteria prevalensi William dan Bunkley.Kata kunci: Ikan lele, Identifikasi Parasit, Prevalensi, Intensitas, Mino Ngremboko.
37
Barron, G. L. "A new genus of the Hyphomycetes endoparasitic in bdelloid rotifers with conidia that lodge in the mastax." Canadian Journal of Botany 69, no. 3 (March 1, 1991): 503–6. http://dx.doi.org/10.1139/b91-068.
Full textAbstract:
Haptospora is described as a new genus of the Hyphomycetes endoparasitic in rotifers. The genus is distinguished by conidia that have a doughnut-shaped modification at the base. This structure appears to have a function in lodging the conidium in the mastax of the host. The conidiogenous cells are phialides, each with a membranous collarette. Two species of Hyphomycetes, described previously as Phialophora endoparasitica and P. tribrachispora, are transferred to Haptospora, and a third species, Haptospora appendiculata, is described as new. Key words: Phialophora, Haptospora, endoparasite, rotifer.
38
Hanafiah, Muhammad, Hoky Deora Alfiansyah, and Arman Sayuti. "Identifikasi Parasit pada Biawak Air (Varanus salvator)." Jurnal Sain Veteriner 36, no. 1 (October 15, 2018): 24. http://dx.doi.org/10.22146/jsv.38475.
Full textAbstract:
This research has purposes to identify parasites as well as to reward determining the prevalence of parasites on water monitor lizard (Varanus salvator) was captured in Banda Aceh. As many as 50 water monitor lizard were used this research and examined at the Laboratory of Parasitology, Faculty of Veterinary Medicine University of Syiah Kuala. Examination of ectoparasites on the surface of the body was done by direct examination. Endoparasit examination carried out by observation in blood using the blood smear and centrifugation techniques microhematocrit (mHCT), while fecal examination using flotation method, Borray sedimentation and digestive tract surgery digestive tract surgery if obtained at least 3 types of helminth eggs (1 cestodes, 1 nematodes, and 1 trematodes). Results of observation on blood is no parasites were found. Observations on the skin was obtained ectoparasites Amblyomma sp. with a prevalence rate of 100% category always. Observations of feces obtained Ascaris sp. with a prevalence rate of 74% category usualy and Stronyloides spp. with a prevalence rate of 8% category sometimes. Based on these results it can be concluded that the parasites that can infest the water monitor lizard (Varanus salvator) is Amblyomma sp, Ascaris sp, and Stronyloides spp. with variant prevalence rates.
39
LI, XUANKUN, DAVID YUAN, JUANITA RODRIGUEZ, and DAVID K. YEATES. "Sand wasp (Hymenoptera: Crabronidae) parasites emerging from mud wasp nests (Hymenoptera: Sphecidae)—a reliable host record of Thraxan Yeates & Lambkin (Diptera: Bombyliidae: Anthracinae) with description of the pupal exuviae of three Thraxan species." Zootaxa 4609, no. 1 (May 22, 2019): 149. http://dx.doi.org/10.11646/zootaxa.4609.1.7.
Full textAbstract:
Two female Thraxan sp. (Diptera: Bombyliidae: Anthracinae) emerged from parasitised Pison simillimum Smith (Hymenoptera: Crabronidae) larvae found inside a Sceliphron formosum Smith (Hymenoptera: Sphecidae) mud wasps nest. Thraxan sp. larvae are endoparasites of P. simillimum larvae. The endoparasite pupates inside the host larva, kills it, and emerges free of the host body. We describe and illustrate the pupal exuviae of the newly found species and two known species, T. luteus Yeates & Lambkin and T. misatulus Yeates & Lambkin, and we compare these pupal exuviae to those of Anthrax Scopoli.
40
Oliveira, Elisa Junqueira, Rodrigo Pelicioni Savegnago, Luara Afonso de Freitas, Anielly Paula Freitas, Suellen Rodrigues Maia, Flávia Fernanda Simili, Lenira El Faro, Ricardo Lopes Dias da Costa, Mário Luiz Santana Júnior, and Claudia Cristina Paro de Paz. "Estimates of genetic parameters and cluster analysis for worm resistance and resilience in Santa Inês meat sheep." Pesquisa Agropecuária Brasileira 53, no. 12 (December 2018): 1338–45. http://dx.doi.org/10.1590/s0100-204x2018001200006.
Full textAbstract:
Abstract: The objective of this work was to estimate genetic parameters for traits related to resistance to endoparasites in Santa Inês sheep, for a possible inclusion in sheep breeding programs, as well as to evaluate the additive genetic pattern of the animals using cluster analyzes, in order to assess whether there are groups within the population that can be used as candidates for selection for resistance to endoparasites. The studied traits were: Famacha score, fecal egg counts (FEC), packed cell volume (PCV), total plasma protein (TPP), body condition score (BCS), and body weight (BW). Heritability estimates ranged from 0.17 (0.05) for TPP to 0.31 (0.07) for BCS. The cluster analyzes based on the breeding values identified four clusters. Famacha and BCS can be recommended as selection criteria for resistance to hematophagous endoparasites because they can respond to selection and are easy to be measured. Animals from cluster 1 have great potential as candidates for selection because of their additive genetic pattern, taking into account body weight and endoparasite resistance due to higher breeding values for BW, BCS, PCV, and TPP and lower breeding values for Famacha and FEC.
41
Ardhiani, Nurin, Endang Suprihati, Aditya Yudhana, and Faisal Fikri. "Gastrointestinal Endoparasite Infection on Red Foot (Chelonoidis carbonaria) in Surabaya City Based on Fecal Examination." Journal of Parasite Science 5, no. 1 (September 15, 2021): 31. http://dx.doi.org/10.20473/jops.v5i1.29963.
Full textAbstract:
Infectious disease which caused by parasite is the most serious problem in tortoise breeding. This study identifies gastrointestinal endoparasites infection on Red Foot (Chelonoidis carbonaria) during November 2020 to February 2021 in Surabaya City. Fecal samples from a tortoise, a total of 14 tortoises were collected and examined by native, sedimentation and floatation methods for parasitic eggs and oocyst. Fecal samples for this research were collected from breeding farm in Surabaya City. Data obtained from this study were presented descriptively and analyzed by Chi-Square test. Based on examination results, the occurrence of gastrointestinal endoparasite infection on Red foot was recorded at 100% from the total samples. The gastrointestinal parasites were identified as helminths and protozoa namely which is dominately by Tachygonetria spp. (14%), Angusticaecum spp. (3%), and Balantidium coli (2%) respectively. The provision of deworming medication as a curative measure by the owner is carried out regularly and continuously on tortoises that are positively infected with gastrointestinal endoparasites and prevention can be done by paying attention to the management and cleanliness of the cage to prevent potential transmission of endoparasites from the environment to the tortoise.
42
Silva, Nayara Emanuelle Matos e., Heder José D'Ávila Lima, Jean Kaique Valentim, Fernandes Jesuino Mukissaí Tossué, Tatiana Marques Bittencourt, and Jonatan Mikhail Del Solar Velarde. "Banana leaf in the diet of laying hens in cage free system." Acta Scientiarum. Animal Sciences 41, no. 1 (June 14, 2019): 46908. http://dx.doi.org/10.4025/actascianimsci.v41i1.46908.
Full textAbstract:
The aim of this research was evaluate the productive performance, egg quality and the endoparasites presence on Carijo laying hens in Cage Free system, fed with two experimental diets, one of them supplemented with fresh banana leaf in natura. Were used 196 laying hens with twenty-four weeks of age, distributed in a completely randomized design with 14 boxes, two experimental diets and seven replicates, by treatment with fourteen birds per experimental unit. The variables analyzed were: feed intake; egg production; egg mass: feed conversion per egg mass; feed conversion per dozen eggs; egg weight; albumen weight; yolk weight; shell weight; yolk percentage; albumen percentage shell percentage; yolk pigmentation and the presence of endoparasites. No influence (p > 0.05) were found, for performance and egg production, in Carijo laying hens fed supplemented with banana leaf in natura. For the treatment with inclusion of banana leaf, yolk pigmentation were superior (p < 0.05) when compared to control diet, producing eggs with more yolks orange color. In respect to endoparasite analysis, there was significant effect (p < 0.05) in the percentage of infections present in excretas. Among the treatments evaluated, the one with banana leaf supplementation reduced in 26.54% the endoparasites presence. The inclusion of banana leaf in the diet of Carijo laying hens does not affect performance and eggs quality and decreases the amount of endoparasites of the genus Strogyloides spp.
43
Baumans, V., R. Havenaar, and H. Van Herck. "The use of repeated treatment with Ivomec and Neguvon spray in the control of murine fur mites and oxyurid worms." Laboratory Animals 22, no. 3 (July 1, 1988): 246–49. http://dx.doi.org/10.1258/002367788780746359.
Full textAbstract:
In a previous study, a single external treatment with Ivomec appeared to be more effective than Neguvon treatment. In this study the anti-endoparasitic qualities of external application of Ivomec were investigated, together with the effectiveness of a combined Neguvon and Ivomec treatment. After 3 treatments, all mice were mite- and worm-free: they remained free of ectoparasites until 18 weeks after the last treatment; eggs of endoparasites reappeared 9 weeks after the last treatment.
44
GONZÁLEZ, M. T., and M. E. OLIVA. "Is the nestedness of metazoan parasite assemblages of marine fishes from the southeastern Pacific coast a pattern associated with the geographical distributional range of the host?" Parasitology 136, no. 4 (February 6, 2009): 401–9. http://dx.doi.org/10.1017/s0031182009005575.
Full textAbstract:
SUMMARYNested structure is a pattern originally described in island biogeography to characterize how a set of species is distributed among a set of islands. In parasite communities, nestedness has been intensively studied among individual fish from a locality. However, nested patterns among parasite assemblages from different host populations (localities) have scarcely been investigated. We recorded the occurrence of parasites in 9 fish species widely distributed along the southeastern Pacific coast to determine whether the ecto- and endoparasite assemblages of marine fishes show a nested structure associated with host distributional range. Nestedness was tested using Brualdi-Sanderson index of discrepancy (BR); and 5 null models incorporated in a‘Nestedness’programme (Ulrich, 2006). The ecto- and endoparasite richness do not show similar patterns of latitudinal gradients among fish hosts, with 33–66% of analysed ectoparasite assemblages, and 25–75% of endoparasite assemblages showing nested structures through the host distributional range. For ectoparasites, species richness gradients and nested structure (when present) might be associated with decreased host densities or could reflect negative environmental conditions in the distributional border of the host species, whereas for endoparasites might be caused by geographical breaks of prey or changes in prey availability (intermediate hosts). The sampled extension of the distributional range of the host species, as well as the lack of specificity of some parasites, could influence the detection of nestedness.
45
Hanssen, Sveinn Are, Christian Sonne, Jan Ove Bustnes, Lisbeth Schnug, Sophie Bourgeon, Manuel Ballesteros, Igor Eulaers, et al. "Anti-parasite treatment and blood biochemistry in raptor nestlings." Canadian Journal of Zoology 95, no. 9 (September 2017): 685–93. http://dx.doi.org/10.1139/cjz-2016-0040.
Full textAbstract:
We investigated the effects of parasite removal on various blood clinical–chemical variables (BCCVs). BCCVs are indicators of health, reflecting, e.g., homeostasis of liver, kidney function, and bone metabolism. The study was conducted in Norway on chicks of two predatory birds: White-tailed Eagle (Haliaeetus albicilla (L., 1758)) and Northern Goshawk (Accipiter gentilis (L., 1758)). Chicks were treated against both endoparasites (internal parasites) and ectoparasites (external parasites). We treated against ectoparasites by spraying nests with pyrethrins. Within nests, chicks were randomly treated with either an anti-helminthic medication (fenbendazole) or sterile water (controls). Treatment against either ectoparasites or endoparasites led to higher levels of the bone and liver enzyme alkaline phosphatase. Bilirubin levels were lower when treated against ectoparasites, whereas bile acids were higher. Anti-endoparasite treatment led to higher creatinine levels. In Northern Goshawks, treating against endoparasites led to higher urea levels and lower potassium levels. Treatment against ectoparasites increased uric acid and urea levels and reduced bilirubin levels and protein:creatinine ratios. In conclusion, anti-parasite treatments led to changes in several BCCVs, suggesting differences in nutrient absorption and physiological state of chicks that are possibly related to the costs of parasitism, but maybe also to the parasite treatment itself.
46
Dorigo, TA, T. Maia-Carneiro, M. Almeida-Gomes, CC Siqueira, D. Vrcibradic, M. Van Sluys, and CFD Rocha. "Diet and helminths of Enyalius brasiliensis (Lacertilia, Iguania, Leiosauridae) in an Atlantic Rainforest remnant in southeastern Brazil." Brazilian Journal of Biology 74, no. 1 (February 2014): 199–204. http://dx.doi.org/10.1590/1519-6984.07612.
Full textAbstract:
Our study aimed to add information about the diet and endoparasites of Enyalius brasiliensis from an Atlantic Rainforest remnant in the state of Rio de Janeiro, southeastern Brazil. Regarding diet, E. brasiliensis consumed arthropods, with caterpillars and beetles being the most important preys. Regarding helminth parasites, overall prevalence was low (9.5%), with 238 nematodes of the genus Physaloptera found in the stomach of one specimen and one nematode of the genus Rhabdias inside the lung of another. Our results corroborate the observations of previous studies that indicate that lizards of the genus Enyalius tend to feed mainly on relatively large-bodied arthropods and to harbour depauperate endoparasite fauna.
47
HASTRITER, MICHAEL W., and SARAH E. BUSH. "Maabella gen. nov. (Streblidae: Ascodipterinae) from Guangxi Province, China and Vietnam with notes on preservation of Ascodipterinae." Zootaxa 1176, no. 1 (April 21, 2006): 27. http://dx.doi.org/10.11646/zootaxa.1176.1.3.
Full textAbstract:
Endoparasitic Ascodipterinae (Streblidae) were collected from bats from southeast China and northern Vietnam. Among this material, the new genus and species Maabella stomalata is described. The dealate females of this new taxon from China were attached over the joints of the wings of Rhinolophus affinis Horsfield and Rhinolophus macrotis Blyth. They were also removed from the wings of Rhinolophus paradoxalophus (Bourret) and R. macrotis from Vietnam. Clarification of the relationships of the streblid genera Ascodipteron Adensamer, 1896, Maabella, and Paraascodipteron Advani and Vazirani, 1981 is discussed. Techniques are presented for the preparation and preservation of these small obligate parasites.Key words: Ascodipteron, bat flies, endoparasite, neosome, Paraascodipteron, Rhinolophus
48
Pradana, Dandi, Rahayu Kusdarwati, and Sudarno Sudarno. "HUBUNGAN ANTARA KUALITAS AIR DENGAN PREVALENSI ENDOPARASIT PADA SALURAN PENCERNAAN IKAN NILA (Oreochromis niloticus) DI KERAMBA JARING APUNG PROGRAM URBAN FARMING DI KOTA SURABAYA." Journal of Aquaculture and Fish Health 6, no. 3 (January 16, 2019): 115. http://dx.doi.org/10.20473/jafh.v6i3.11289.
Full textAbstract:
Aspergillus terreus adalah jamur yang menyebabkan penyakit aspergillosis. Ikan yang terinfeksi menunjukkan bercak putih abu-abu di atas tubuh. Perdarahan ulkus diamati pada insang dan kulit. Infeksi menyebabkan kematian ikan. Penggunaan bahan kimia untuk mengendalikan serangan jamur dapat membahayakan ikan, lingkungan dan manusia yang memakannya. Penggunaan tanaman obat merupakan cara yang aman untuk menghambat dan membunuh pertumbuhan jamur serta ramah lingkungan. Salah satunya yaitu menggunakan ekstrak bawang putih (Allium sativum). Tujuan penelitian ini yaitu untuk mengetahui konsentrasi minimum ekstrak bawang putih sebagai antijamur terhadap pertumbuhan Aspergillus terreus in vitro. Percobaan dilakukan di Balai Karantina Juanda Kelas I Surabaya pada bulan Juni - Juli 2015. Metode yang digunakan dalam penelitian ini adalah metode difusi cakram kertas. Analisis yang digunakan dalam penelitian ini adalah statistik deskriptif. Hasil penelitian dengan menggunakan ekstrak bawang putih konsentrasi 50% sampai 90% tidak menghasilkan zona bening di sekitar kertas, hal itu sama dengan kontrol negatif. Pada konsentrasi 100% tidak menunjukkan jamur tumbuh pada medium Sabouraud Dextrose Agar (SDA). Ini sama dengan kontrol positif. Kesimpulan dari penelitian ini bahwa daun kemangi tidak menunjukkan aktivitas antijamur dalam menghambat pertumbuhan jamur Aspergillus terreus.
49
Grandón-Ojeda, Alexandra, José Osvaldo Valdebenito, Lucila Moreno, John Mike Kinsella, Sergey Mironov, Armando Cicchino, Carlos Barrientos, and Daniel González-Acuña. "Gastrointestinal and external parasitism in the Magellanic Horned Owl Bubo magellanicus (Strigiformes: Strigidae) in Chile." Revista Brasileira de Parasitologia Veterinária 27, no. 2 (June 14, 2018): 161–68. http://dx.doi.org/10.1590/s1984-296120180013.
Full textAbstract:
Abstract To describe the parasitic community of the Magellanic Horned Owl, Bubo magellanicus (Aves, Strigiformes), 19 carcasses from central Chile were analyzed. Ectoparasites were collected through plumage inspection, while endoparasites were collected through traditional techniques of parasitological necropsy. Sixteen owls were infected with at least one species of ectoparasite (84.21%) or endoparasite (31.58%). Eleven of 19 birds (57.89%) harbored feather mites of the three species Pandalura cirrata (42.11%), Glaucalges attenuatus (47.37%), and Kramerella sp. (10.53%), whereas 16 individuals (84.21%) harbored the chewing louse Strigiphilus chilensis. Only six birds (31.58%) were infected with helminths; the nematodes Capillaria tenuissima (26.32%) and Dispharynx nasuta (5.26%); the acanthocephalan Centrorhynchus spinosus (5.26%); and the trematode Neodiplostomum sp. (5.26%). Apart from S . chilensis, all parasites comprised new records for B . magellanicus.
50
Hidayati, Nurul, Muttaqien Bakri, Rusli Rusli, Yudha Fahrimal, Muhammad Hambal, and Razali Daud. "IDENTIFIKASI PARASIT PADA IKAN TONGKOL (Euthynnus affinis) DI TEMPAT PELELANGAN IKAN LHOKNGA ACEH BESAR (Identification of Parasites in Mackerel (Euthynnus affinis) at Fish Auction in Lhoknga Aceh Besar)." Jurnal Medika Veterinaria 10, no. 1 (May 29, 2016): 5. http://dx.doi.org/10.21157/j.med.vet..v10i1.4027.
Full textAbstract:
The objective of this study was to identify parasites that infect mackerel fish (Euthynnus affinis) at fish auction in Lhoknga, Aceh Besar. Fifteen mackerel fish collected from fish auction in Lhoknga were examined at Parasitology Laboratory, Faculty of Veterinary Medicine Syiah Kuala University Banda Aceh to observe the presence of ectoparasites and endoparasites. The ectoparasite examination was conducted by observation of the external body part and then examined under microscope, while endoparasite examination conducted by observation of inner surface of digestive tract. The data showed that two types parasites infested the mackerel fish at fish auction in Lhoknga were Anisakis simplex and Neobenedia melleni. A total of 87% mackerel fish was infested with A. simplex and 7% was infested with N. melleni.