Journal articles on the topic 'Extraction et purification'

D301 resin was used to separate and purify total anthraquinones in Radix et Rhizoma Rhei. It was found that the optimized dynamic adsorption conditions is pH7.0, flow velocity of 1.0 BV/h and extracting solution with concentration of 0.3g/mL and optimized dynamic elution conditions is hydrochloric acid with concentration of 0.15mol/L, 75% ethanol, and flow velocity of 1.0 BV/h. Under the above conditions,the average adsorption rate and desorption rate are respectively 89.75% and 91.15%, indicating that extraction efficiency of total anthracenone of emodin is relatively high and that the technology enjoys strong stability.

Taxus cuspidata S. et Z. is an excellent natural source of bioactive polysaccharides and has various biological activities. The objective of this study was to evaluate the effect of antidiabetic and antitumor activities of polysaccharides from Taxus cuspidata branches and leaves (TCBL) and to determine the optimum extraction technology of TCBL using a low-temperature and high-efficiency enzyme and ultrasound-assisted coupled extraction (EUCE) method. Optimal technology parameters were determined as follows: an extraction temperature of 51 °C, an extraction time of 33 min, a ratio of material to liquid of 1:19 (g:mL), and an enzyme concentration of 0.10 mg·mL−1. Under the optimized conditions, the polysaccharide yield from TCBL obtained by EUCE was 4.78% ± 0.18%. The four purified polysaccharides (Pe1, Pe2, Pe3, Pe4) from TCBL are mainly composed of arabinose, galactose, glucose, a small amount of xylose, and mannose. This composition was assessed by HPIC analysis. The antidiabetic activity and antitumor activity of polysaccharides from TCBL were assayed in vitro. Among the four purified polysaccharides from TCBL, purified Pe4 had the highest inhibitory capacity against α-glucosidase, and its IC50 value was 123.0 µg·mL−1. Pe1 had the highest antitumor capacity against MCF7 cells and HepG2 cells, with IC50 values of 169.0 and 132.0 µg·mL−1. Pe4 had the highest antitumor effect on human cervical cancer cells (Hela), and its IC50 value was 89.9 µg·mL−1. Pe4 polysaccharide demonstrated a good α-glucosidase inhibitory activity and antitumor capacity against Hela cells. Therefore, Pe4 polysaccharide from TCBL is a beneficial source of potential inhibitors of type II diabetes and human cervical cancer activity.

AbstractHere, we introduce a new radiocarbon (14C) extraction line operating at the University of Bern, which was designed and built for the extraction of in situ 14C from meteorites. With this system, we achieved two important developments compared to other systems. First, using the MICADAS gas-interface system, 14C can directly be measured from the collected CO2 gas, i.e., without graphitization of the sample. Second, meteorite sample masses as low as ~0.05 g can be used for high precision and reproducibility. Prior to extraction in an oxygen atmosphere held at a pressure of ~20–30 mbar in an iridium crucible at 1600°C for 40 min, samples were preheated for 1 h in a constant oxygen flow at 500°C and continuous pumping. Gas purification followed the method described previously (e.g., Hippe et al. 2009). While the blank levels for preheated samples are low (<2×104 14C atoms), the blanks for non-preheated samples are high, therefore those results cannot be used. We also report preliminary results for the L-chondrite JaH 073. The terrestrial age of 17.7±0.4 ka is in good agreement with previous results for the same sample of this meteorite, confirming that the extraction line, the gas purification system, and the AMS measurements are all reliable.

<p>Genomic analysis of plants relies on high quantity and quality of pure DNA. Extraction and purification of DNA from woody and medicinal plants, such as fruit trees present a great challenge due to accumulation of a large amount of co-purify with DNA, including polysaccharides, polyphenols and proteins. Therefore, it is necessary to optimize the extraction protocols to reduce these compounds to the lowest level. A study was conducted to compare six DNA extraction and precipitation methods for genomic analysis in<em> Ziziphus spina-christi</em> (L.) plant tissues. The results showed significant differences in DNA contents among the six methods. Quantity and quality of extracted genomic DNAs were compared by employing the spectrophotometer, Nano-Drop, agarose gel electrophoresis, digestion by restriction enzymes and polymerase chain reaction (PCR) methods and molecular marker such as RAPD and ISSR. The method of Vroh Bi et al., provided the best results (208.89 ng/μL) in terms of quantity and quality of DNA, and Doyle and Doyle method as second method for leaves sample were chosen. According to the results, the method of Bi et al. is recommended for DNA extraction from plant tissues having high level of polysaccharides and phenol compounds.</p>

The DNA extraction is one of the first steps and plays animportant role in study on genome of any species on earth. Depending on the purpose and object of study, DNA can be extracted from various tissues.For plants, DNA is usually extracted from the leaves, seeds and young buds, in which these tissues are the best DNA source and can be extracted easily. However, the collection of sample from mature trees, which are generally tall, isdifficult and need more facilities. Consequently, it leads to be limited for the study scope.The proposed solutionis to use a wood tissue instead ofthe leaves, seeds and young due to they are easily collected. The problem is very difficult to extract high quality DNA from the wood tissue (Verbylaite et al., 2010). However, if the extraction of DNA from wood tissue would besuccessful, it would open up many research directions and could turn techniques that seemed unfeasible before into the effective solution. Extracting and analyzing DNA from dried wood and processed wood could be developed to explore the possibility of identifying the species and theirorigin. This could be greatly useful for determining the legality of wood log and wood products, and for deterring trade in illegal wood products (Tsumura et al.,2011). Currently, there are some commercialized kits, enabling DNA extraction from wood more easily,e.g. DNeasy Plant Mini Kit (Qiagen), Nucleospin Plant II (Macherey-Nagel), Genomic DNA Purification Kit (Fermentas) and innuPREP Plant DNA Kit (Analytik Jena). However, the commercial Kitsare expensive. Meanwhile, there are some cheaper methods, applying for DNA extraction from wood successfully, such as SDS method (Edwards et al.,1991; Goodwin and Lee, 1993), protein precipitation protocol (Dellaporta et al., 1983; Fang et al., 1992), especially CTAB method, obtaining with a high DNA concentration (Doyle J and Doyle H., 1987). The DNA extracted by CTAB protocol is less pure; however, they are still suitable to use in molecular biology. The objective of this work was to optimize the conditions of CTAB protocol for DNA extraction from wood. The two parameters centrifugation time and volume ratio of isopropanol to solutions containing DNA that affect the yield and quality DNA were explored using the response surface methodology (RSM). The central composite design (CCD) was used to obtain the experimental design matrix. This approach has limited number of actual experiments performed where as allowing probing into possible interaction between these parameters studied and their effect on quantity and quality DNA.

The optimal operational and process parameters were determined for the enzymatic hydrolysis and ultrasound-assisted extraction (EHUE) method of flavonoids extracted from Taxus cuspidata branches and leaves (TCBL), and the biological activity of obtained flavonoids was evaluated. According to single factor and central composite design experiments, the optimum key experimental parameters for EHUE were that pectinase enzyme concentration was 0.10 mg·mL-1, enzymatic hydrolysis temperature was 48 °C, and enzymolysis time was 39 min. The yield of flavonoids from TCBL under the optimized conditions was 5.23% ± 0.18%. Four purified flavonoid compounds from TCBL extract were identified as 1) (E)-1-methoxy-2-O-(p-coumaroyl)-myo-inositol, 2) catechin, 3) epicatechin, and 4) quercetin-3-O-glucoside. Among the 4 compounds, compounds 2 and 3 showed higher antioxidant capacities, α-amylase, and α-glucosidase inhibitory activities. The statistical analysis showed that epicatechin and catechin were potent antioxidants and active agents for inhibiting type II diabetes. In addition, all 4 compounds exerted clear antitumor activity against MCF-7, Hela, and HepG2 cells. Especially, compound 4 had highest antitumor capacity against MCF-7 and Hela, while compound 1 was best at suppressing the proliferation of HepG2 cells.

La domestication de Lippia multiflora, plantes aux multiples vertus en pharmacopée et médecine est un enjeu de taille en Côte d’Ivoire. Cependant, l’insuffisance de semences, due au faible taux de germination des graines, limite l’extension de sa culture. La présente étude avait pour objectif l’extraction, la purification et la caractérisation morpho-physiologique des graines de Lippia multiflora Moldenke (Verbenaceae). Il s’agissait plus spécifiquement de déterminer la pureté spécifique, le nombre de graines par unité de masse, le diamètre moyen et le taux d’humidité ; le taux de germination des graines de L. multiflora. Aussi, il s’est agi d’étudier l’impact du milieu sur le pouvoir germinatif des graines et de faire un suivi post-germination des plants en milieu réel. Après extraction des graines, des mesures physiques et des tests de germination ont permis de déterminer les caractéristiques morpho-physiologiques de celles-ci. L’étude a montré que le lot de graine étudié a une pureté spécifique de 70%, les graines ont un diamètre moyen de 0,34± 0.1 mm, une teneur en eau de 14±5.4 % et un taux de germination de 42,25%. Les tests de germination après un séjour prolongé dans divers milieux, révèlent qu’un milieu réfrigéré (7° C) confère une plus longue viabilité aux graines. Le suivi post-germination au champ montre une évolution régulière de la hauteur des plants, passant en moyenne de 2,58 cm à 8,8 cm au bout de 3 mois. Sur la même période, le nombre moyen de feuille varie de 4,03 à 21.Mots clés : Lippia multiflora, graine, caractérisation, germination, suivi post-germination. English Title: Morpho-physiological qualities and evaluation of the germination behavior of seeds of the savannah tea tree (Lippia multiflora Moldenke)The domestication of Lippia multiflora, plants with multiple virtues in pharmacopoeia and medicine is a major challenge in Côte d'Ivoire. However, the lack of seed, due to the low germination rate, limits the extension of its cultivation. The purpose of this study was the extraction, purification and morpho-physiological characterization of the seeds of Lippia multiflora Moldenke (Verbenaceae). More specifically, it involved determining the specific purity, the number of seeds per unit mass, the average diameter and the humidity rate; the germination rate of L. multiflora seeds. Also, it was a question of studying the impact of the environment on the germination power of seeds and of making a post-germination follow-up of the plants in real environment. After the seeds extraction, physical measurements and germination tests were carried out to determine the morpho-physiological characteristics. Results showed that the seed lot studied has a specific purity of 70%, an average diameter of 0.34 0.1 mm, a water content of 14 5.4% and a germination rate of 42.25%. Germination tests after a prolonged stay in various environments reveal that a refrigerated area (7 °C) confers a longer viability to the seeds. Post-germination monitoring in the field shows a steady increase in plant height from an average of 2.58 cm to 8.8 cm after 3 months. Over the same period, the average number of sheets varies from 4.03 to 21.Keywords: Lippia multiflora, seed, characterization, germination, post-germination monitoring.

<p>Literature data and own research results on the technology for isolating natural sesquiterpene lactones such as arglabin, alantolactone, artemisinin, grosheimin, isoalantolactone, parthenolide, santonin and potential possibilities of their use as renewable material for obtaining new compounds as well as biologically active derivatives are generalized in this review. Sesquiterpene lactones from plants are promising sources for the development and practical application of new original medical products possessing antitumor, anti-inflammatory, antimalarial, antiulcer, antiviral and immune-stimulating action. The technology for isolating sesquiterpene lactones is based on the extraction of raw plant material by different organic solvents with the subsequent chromatographic purification. The effective and environmentally safe technology for isolation and purification of sesquiterpene lactone arglabin from <em>Artemisia glabella</em> Kar. et Kir. by the СО₂-extraction method is developed. Thereat, it was experimentally determined that the method for isolating arglabin from CO₂ extract of <em>Artemisia glabella</em> Kar. et Kir. using centrifugal partition chromatography is effective for preparative isolation of the active substance and its manufacturing application. It is practically important to obtain water-soluble derivatives of biologically active sesquiterpene lactones and also to use the nanotechnology achievements for directed transportation of a molecule of the medicine in the human body thereby reducing toxicity of an active component. Promising direction is chemical modification of molecules in sesquiterpene lactones which are renewable material for obtaining new derivatives, thanks to which it becomes possible to solve two problems at the same time. Firstly, these researches help to obtain derivatives with higher biological activity or improved physical and chemical properties. Secondly, these researches enable us to disclose the mechanism of action of different medicines within the framework of “structure-activity” correlation. The article presents the literature data and own results on chemical modification of sesquiterpene lactones of alantolactone, arglabin, artemisinin, grosheimin, isoalantolactone, parthenolide and santonin. Various reactions on functional groups of these molecules were used to obtain a number of new derivatives of sesquiterpene lactones containing haloid-, pyrazole-, triazole-, amino-, dialkylamino-, hydroxy-, dialkyl phosphonate- and cyclopropane groups, which have shown high physiological activity.</p>

Tomato yellow leaf curl virus (TYLCV) of the family Geminiviridae is a serious production constraint to tomato (3). In the southeastern United States the virus has been largely confined to Florida. The disease appeared in the southern most Georgia county (Decatur) in 1998, at an incidence rate of less than 1% (2). During the fall of 1999, tomato plants showing symptoms indicative of TYLCV were observed in commercial fields in Grady, Colquitt, and Lowndes counties and the experimental plots of the Coastal Plain Experiment Station in two locations in Tift County, GA. The 12-acre commercial field in Grady County had a disease incidence of 15%. In Tift County, in both experimental plots (≈5 miles apart), TYLCV incidence ranged from 15 to 20%. Bemisia argentifolii populations in southern Georgia, based on the observed high incidence of silverleaf symptoms in squash and the intensity of adult migrations during August and September, were the highest in more than 5 years. TYLCV infection was verified by polymerase chain reaction (PCR) amplification with degenerate primers (5′-GCC CAC ATY GTC TTY CCN GT-3′ and 5′ -GGC TTY CTR TAC ATR GG-3′) specific to the DNA A component (4). A simplified and faster DNA extraction procedure was used to obtain PCR-ready templates. Leaf tissue was homogenized in 300 μl of extraction buffer (1), followed by one phenol and one chloroform/ isoamyl alcohol (24:1) extraction. The supernatant was purified using a QiaPrep MiniPrep purification kit (Qiagen, Valencia, CA) and was used in PCR amplification. The procedure yielded highly consistent PCR-quality template. The resulting ≈1.3-kb PCR product was cloned in pGEM-T vector (Promega Corp., Madison, WI) and completely sequenced. Sequence comparisons indicated 98% identity with known TYLCV isolates from Spain (GenBank Accession no. AJ223505), the Dominican Republic (GenBank Accession no. AF024715), and Israel (GenBank Accession no. X15656). Using PCR followed by restriction digestion analysis, three symptomatic plants from one field each in Colquitt and Lowndes counties were TYLCV positive. The higher incidence of TYLCV in the Georgia counties of Tift and Grady and its concurrent occurrence in Colquitt and Lowndes counties indicates its rapid spread in the southeastern United States. References:(1) I. B. Dry et al. J. Gen. Virol. 74:147, 1993. (2) M. T. Momol et al. Plant Dis. 83:487, 1999. (3) J. E. Polston et al. Plant Dis. 83:984, 1999. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Sphaeropsis sapinea (Fr.) Dyko & Sutton is an opportunistic pathogen of various Pinus spp., causing severe shoot blight and dieback. Some isolates of S. sapinea display characteristics such as reduced virulence, reduced growth rate, lack of pigmentation, altered colony morphology, and suppressed conidiation. South African isolates of S. sapinea displaying a range of growth patterns, including reduced growth rate and atypical morphology, were screened for the presence of double-stranded RNA (dsRNA). They were also tested for relative virulence in pathogenicity tests. Double-stranded RNA was isolated by means of phenol extraction and cellulose chromatographic purification. A single species of dsRNA (± 4.3 kilobase pairs in size) was obtained from two slow-growing isolates and two isolates with more regular growth. The virulence of these dsRNA-containing isolates was tested on mature Pinus patula Schlecht. et Cham. trees. Although reduced virulence was positively correlated with slower growth in vitro, the presence of dsRNA could not be linked to either of these characteristics.Key words: double-stranded RNA, hypovirulence, Sphaeropsis sapinea.

We present a method for the extraction of dissolved organic carbon (DOC) from water. The method is adapted from Burr et al. (2001) using the basic steps: 1) sample filtration; 2) acidification to liberate and remove dissolved inorganic carbon (DIC); 3) evaporation of the sample to isolate salts that include trace quantities of carbon; 4) combustion of the salts; and 5) purification of the CO2. Two significant improvements have been made to the earlier method. The first is to use wet oxidation with potassium permanganate to oxidize organics in place of the combustion step and the second is the development of a reduction/oxidation purification procedure to remove sulfur and nitrogen oxides that may form during the oxidation step. Wet oxidation has a practical advantage over the previous method because it proceeds at low temperature (70 °C). The original method required quartz vessels to oxidize the salts at 900 °C. At this temperature, salts in the samples formed gases that interfered with the isolation of CO2 and the quartz vessels degraded with each combustion, affecting their structural integrity. The expensive quartz vessels could only be used for a limited number of samples, whereas Pyrex vessels used for wet oxidation are inexpensive and can be used indefinitely.The blank fraction modern carbon (f) and its mass dependence for the refined technique was determined from repeat analyses of salicylic acid produced from petrochemicals. For samples with a mass m above 0.5 mg, F = 0.0083 ± 0.0011. For samples below 0.5 mg, the blank follows a 1/m dependence as observed for other accelerator mass spectrometry (AMS) 14C measurements (Donahue et al. 1990). The reproducibility of the method is demonstrated using repeat measurements from a variety of samples, including a sample measured with the former high-temperature 900 °C combustion technique. The virtues of the wet oxidation method are that it is economical, produces a low blank, and provides good reproducibility.

AbstrakToddalia asiatica merupakan tumbuhan perdu yang tersebar di Afrika, Asia, Madagascar, dan Australia (Hu et al., 2015). Senyawa metabolit sekunder yang ditemukan tumbuhan Toddalia asiatica L. adalah alkaloid. Ekstraksi senyawa alkaloid dari tumbuhan Toddalia asiatica L. dengan cara maserasi menggunakan pelarut metanol pada suhu kamar. Proses isolasi dilakukan melalui fraksinasi dan pemurnian menggunakan kromatografi kolom gravitasi, dan kromatografi radial. Hasil isolasi yang didapatkan merupakan senyawa alkaloid turunan furokuinolin yaitu skimmianin. Struktur senyawa alkaloid turunan furokuinolin yang diketahui melalui analisa hasil spektroskopi UV, IR, 1D NMR (1H-NMR dan 13C-NMR), serta 2D NMR (HMBC dan HMQC) dan uji aktivitas antikanker terhadap sel kanker murin leukemia P-388. Kata kunci : Alkaloid turunan furokuinolin, skimmianin, Toddalia asiatica L., antikanker AbstractToddalia asiatica L. is a bushy plant that spreads in Africa, Asia, Madagascar, and Australia (Hu et al., 2015). The secondary metabolite compound found in Toddalia asiatica L. is alkaloid. Extraction of alkaloid compounds from Toddalia asiatica L. by maceration using methanol at room temperature. The isolation process is diluted by fractionation and purification using column chromatography of gravity and radial chromatography. The result of isolation is an alkaloid compound derived furokuinolin, skimmianin. The structure of alkaloid compounds derived from furokuinolin known through spectroscopic analysis including UV, IR, 1D NMR (1H-NMR and 13C-NMR), and 2D NMR (HMBC and HMQC) and the anticancer activity test against the cancer cells murine P-388.Key word : Alkaloid compound derived furokuinolin, skimmianin, Toddalia asiatica L., anticancer

Peach trees (Prunus persica L.) with yellowing symptoms on leaves were found in December (summer season) of 2005 in commercial fields in Colonia Caroya, Córdoba, Argentina. This symptom resembled Peach latent mosaic viroid (PLMVd). The viroid-affected trees usually showed vein banding and yellowing symptoms on leaves, fruit suture splitting, delays in budding, flowering and fruit ripening, reduced foliage density, and a spindly appearance. PLMVd is mainly transmitted by the propagation of infected budwood and to a lesser extent by pruning tools and aphids (1). Extraction and partial purification of nucleic acids was made from symptomatic leaves (2) collected during the indicated summer season from seven peach trees from commercial plots. Preliminary identification of the viroid was made by dot-blot hybridization with a PLMVd probe (provided by R. Flores). The positive plants were tested also by reverse transcription (RT)-PCR with PLMVd primers RF-43 (5′-CTGGATCACACCCCCCTCGGAACCAACCGCT-3′) and RF-44 (5′-TGTGATCCAGGTACCGCCGTAGAAACT-3′), which amplify the complete genome. All identified positive samples yielded the correct sized PCR product and four were cloned and sequenced. This local sequence (GenBank Accession No. EU429320) had 97% nucleotide sequence identity with a reported PLMVd sequence (GenBank Accession No. M83545), confirming the identity of the local pathogen as Peach latent mosaic viroid. This result suggests that the source of the pathogen may have been infected budwood introduced from Europe. To our knowledge, this is the first report of this viroid in Argentina. References: (1) R. Flores et al. Mol. Plant Pathol. 7:209, 2006. (2) V. Pallás et al. J. Gen. Virol. 68:3201, 1987.

Minerals able to colour in blue (and green in combination with yellow pigments) are limited in number and geologically. After presenting a short history of the use of cobalt as a colouring agent of glass, glaze and enamel in the Western/Mediterranean, Islamic and Asian worlds since Antiquity, we will present the different forms (dissolved ions, natural and synthetic crystalline phases/pigments) of cobalt and associated elements regarding primary (transition metals) and secondary geological deposits (transition metals and/or arsenic, bismuth, silver). Attempts to identify the origin of cobalt have been made by many authors considering the associated elements but without considering the important modifications due to different processing of the raw materials (extraction/purification/formulation). We review the information available in the ancient reports and present literature on the use of cobalt, its extraction and production from the ores, the different geological sources and their relationship with associated elements (transition metals, bismuth, arsenic, and silver) and with technological/aesthetic requirements. (Partial) substitution of cobalt with lapis lazuli is also addressed. The relative application of non-invasive mobile Raman and pXRF analytical instruments, to detect mineral phases and elements associated with/replacing cobalt is addressed, with emphasis on Mamluk, Ottoman, Chinese, Vietnamese and Japanese productions. The efficiency of Ni-Zn-As diagram proposed by Gratuze et al. as a classification tool is confirmed but additionally, CoO-Fe2O3−MnO and CoO-NiO-Cr2O3 diagrams are also found as very efficient tools in this research. The relationship between the compositional data obtained from the artefacts and historical questions on the origin and date of their production are discussed in order to obtain a global historical view. The need of a better knowledge of (ancient) deposits of cobalt ores and the evolution of cobalt ore processing with time and place is obvious.

Antisense technology has shown that neither polygalacturonase nor pectin methylesterase alone are responsible for tomato fruit softening, leading to the likelihood that other enzymes or factors are important. Our laboratory recently found that α and β-galactosidase from avocado fruit solubilized tomato fruit pectin in vitro. Previously, Pressey (Plant Physiol. 1983,71:132) found that the activity of one of three α-galactosidase isozymes from tomato fruit increased during ripening and was capable of degrading cell wall galactan, suggesting a role for the enzyme in fruit softening. Increased β-galactosidase activity was observed in a number of other fruit during ripening. In the present study, NaCl extraction of tomato pericarp yielded relatively high levels of cc- and β-galactosidase activity. At least two isozymes of each were resolved during Mono-Q HPLC α-Galactosidase was further purified by additional Mono Q and Superose 12 gel filtration HPLC. Gel filtration and SDS-PAGE yielded an apparent molecular weight of 44 kD. The partially pure α-galactosidase had a specific activity of 294 μmol product/min per mg protein, a Km of 317 μm, a pl of 5.0, and a pH optimum of 5.5. Activity was inhibited 67% by α-d-galactose. Preliminary results show that β-galactosidase can also be purified by the same techniques. Following further purification, the isozymes will be sequenced and cloned. A second approach being used in an attempt to identify cDNA clones for the α- and β-galactosidase genes from tomato fruit involves using heterologous cDNA clones from guar (Overbeeke et al., 1989; Plant Molecular Biology 13:541-550) and carnation (Raghothama et al., 1991; Plant Molecular Biology 17:61-71), respectively, to screen a ripening tomato fruit cDNA library. Basic molecularbiological techniques will be used to elucidate the role of these enzymes in tomato fruit ripening.

ABSTRACT Recovery of mRNA from environmental samples for measurement of in situ metabolic activities is a significant challenge. A robust, simple, rapid, and effective method was developed for simultaneous recovery of both RNA and DNA from soils of diverse composition by adapting our previous grinding-based cell lysis method (Zhou et al., Appl. Environ. Microbiol. 62:316–322, 1996) for DNA extraction. One of the key differences is that the samples are ground in a denaturing solution at a temperature below 0°C to inactivate nuclease activity. Two different methods were evaluated for separating RNA from DNA. Among the methods examined for RNA purification, anion exchange resin gave the best results in terms of RNA integrity, yield, and purity. With the optimized protocol, intact RNA and high-molecular-weight DNA were simultaneously recovered from 19 soil and stream sediment samples of diverse composition. The RNA yield from these samples ranged from 1.4 to 56 μg g of soil−1 dry weight), whereas the DNA yield ranged from 23 to 435 μg g−1. In addition, studies with the same soil sample showed that the DNA yield was, on average, 40% higher than that in our previous procedure and 68% higher than that in a commercial bead milling method. For the majority of the samples, the DNA and RNA recovered were of sufficient purity for nuclease digestion, microarray hybridization, and PCR or reverse transcription-PCR amplification.

Aim: This study aimed to investigate the antiviral activity of Pterois volitans phospholipase A2 (PV-PLA2) from Indonesia to human immunodeficiency virus (HIV). Materials and Methods: Fresh venomous fin parts of wild PV specimens were collected from Java Sea waters. Then, it washed using phosphate buffer pH 7.0 and immersed in phosphate buffer pH 7.0 0.01 m containing CaCl2 0.001 m for 24 h. The immersed fin then allowed for extraction process by sonicating for 2×8 min with 80% pulse and 20 kHz output with temperature controlling to avoid denaturation. The crude venom (CV) extracted from the fin is allowed for purification by 80% ethanol (ET) precipitation and ammonium sulfate fractionation method. The purified PV-PLA2 then analyzed using Lowry's method, Marinette's method, sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and 3-(4, 5-dimethyl thiazol-2yl)-2, 5-diphenyl tetrazolium bromide assay. After determining the purest and safest sample of six samples analyzed, the chosen sample then tested into simian retrovirus-2 (SRV2)-A549 culture (48×104 cells/mL at 1-4 ppm), and compared to the CV sample (1-4 ppm) and lamivudine (100 ppm). The culture then is analyzed using a quantitative real time-polymerase chain reaction to find out the copy number of SRV-2 virus in each culture. Results: The protein's activity, concentration, and purity analysis revealed that the PV-PLA2 purified using ammonium sulfate fractionation has the highest activity (1.81 times higher than the CV at 80% fractionation) and has higher purity than the sample from ET fractionation. The testing of the sample purified using ammonium sulfate fractionation at 80% saturation level shown that it has a 97.78% inhibition level toward SRV2-A549 culture at 4 ppm. However, in comparison to lamivudine which has 99.55% inhibition level at 100 ppm, it needs much lower concentration to achieve the same result. Conclusion: The significant inhibition of SRV2-A549 culture shown that the PV-PLA2 extracted from PV venom has the potential to become anti-HIV substances. It would be worthwhile to further evaluate the antiretroviral activity of PV-PLA2 in the in vivo studies.

1030 Background: Combining a CDK4/6 inhibitor (CDK4/6i) with endocrine therapy (ET) in advanced, hormone receptor (HR)-positive, HER2-negative breast cancer (BC) doubles median progression-free survival, but eventually drug resistance and disease progression occur. For most patients, the mechanism of resistance is unknown. Exosomes are membrane-bound extracellular vesicles that contain lipids, proteins, and nucleic acids, and are released from tumors as a form of intercellular communication. Exosomes can be recovered from plasma, and analysis of their cargo provides a dynamic read-out of biological pathways that are activated in cancer cells. Proteomic analysis of plasma exosomes may provide insight into mechanisms of resistance that emerge during treatment with CDK4/6i-ET. Methods: The Big Ten Cancer Research Consortium conducted a single arm, phase II trial of palbociclib plus tamoxifen as first line therapy for advanced, HR+/HER2- BC (NCT02668666). Whole blood was collected in Streck tubes from study participants (n = 49) at baseline, at disease progression, and at time points during study treatment. Plasma was separated and stored at -80C within 48 hours of collection. Exosomes were isolated from thawed plasma using commercially available kits and ultracentrifugation. Exosome extraction and purification was optimized for protein recovery. Purified exosomes were processed for proteomic analysis and labeled with TMT10 (tandem mass tag 10plex) and quantified with the QExactive HF mass spectrometer. Ultrasensitive mass spectrometry provided deep proteomic coverage of exosomal proteins and detected various post-translational modifications (PTM). Data were analyzed with a pipeline developed in our lab using an improved SEQUEST/ProLuCID database search engine and Percolator data filtering toolchain. Exosome protein expression was determined at baseline, at best response and at the time of progression. Results: With our ultrasensitive proteomic method, we detected more than 500 exosome proteins from as little as 100 ng of purified exosomes. A significant enrichment of exosome specific markers was observed when comparing patient samples with healthy donor samples. Enrichment of surface glycoproteins (e.g. CD44) was seen in BC patient samples, as in previous reports. Ultrasensitive proteomics also detected PTM including phosphorylation, methylation, oxidation, deamidation, and glycosylation. Differential proteomic and PTM profiles comparing samples collected from responding patients at baseline vs. at progression will be presented. Conclusions: Our innovative method provided an unparalleled portrait of the proteomic landscape of plasma exosomes during treatment with CDK4/6i-ET. This powerful approach may provide novel insights into mechanisms of resistance that emerge during treatment. This study was funded by Pfizer. Clinical trial information: NCT02668666 .

In 2003, greenhouse-grown tomato crops (Lycopersicon esculentum Mill.) in the Canary Islands (Spain) were observed showing an initial yellowing in defined areas at the base of the leaflet that later developed into necrotic spots or an extensive necrotic area progressing from the base to tip. Fruits were also affected, showing necrotic areas and often developing cracking. Generally, the plants that were affected seemed to be burnt, their growth was reduced, and the production level was seriously damaged. Similar symptoms have been observed in Murcia (Spain) since 2001, which have been recently associated with Tomato torrado virus (ToTV) infection (2). Twenty-two tomato samples showing “torrado disease” symptoms were collected from different greenhouses between 2003 and 2006 in Las Palmas (Canary Islands, Spain). To verify the identity of the disease, double-antibody sandwich (DAS)-ELISA was performed on leaf and fruit extracts of symptomatic plants using polyclonal antibodies specific to Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted from the 22 tomato samples with the RNAwiz Extraction kit (Ambion, Huntingdon, United Kingdom) and tested using one-step reverse-transcription (RT)-PCR with the SuperScript Platinum Taq kit (Invitrogen Life Technologies, Barcelona, Spain) with primers specific to PepMV (1) and ToTV (2). All analyses included healthy tomato plants as negative controls. Five of the twenty-two tomato samples were positive for PepMV and negative for the other viruses tested by serological analysis. However, all 22 samples were positive in RT-PCR performed with the primers specific to ToTV segment RNA2. The RT-PCR assay to detect ToTV produced an amplicon of the expected size (580 bp). No amplification product was observed when healthy plants or a water control were used as a template in the RT-PCR reaction. The ToTV RT-PCR product was purified (High Pure PCR Product Purification kit, Roche Diagnostics, Mannheim, Germany) and sequenced. BLAST analysis of one sequence (GenBank Accession No. EF436286) showed 99% identity to ToTV RNA2 sequence (GenBank Accession No. DQ388880). To our knowledge, this is the first report of ToTV in the Canary Islands. References: (1) I. Pagán et al. Phytopathology 96:274, 2006. (2) M. Verbeek et al. Online Publication. doi:10.1007/s00705-006-0917-6. Arch. Virol., 2007.

At present, the principal bacterial disease of citrus in Brazil is Huanglongbing, caused by the alpha-proteobacterium ‘Candidatus Liberibacter spp.’ (although a phytoplasma of the 16SrIX group is also associated with this disease [4]). While there is a wide diversity of phytoplasmas in crop species in Brazil (3), there have been no reports of symptoms associated with phytoplasma in Brazilian citrus. Asymptomatic infections of citrus cannot be excluded as a possibility and such plants could serve as a reservoir of phytoplasma inoculum. The aim of this study was to assess the presence of phytoplasma in asymptomatic Citrus aurantifolia (acid lime) in Brazil. Thirty-three leaf samples (young leaves from the upper canopies) were randomly collected from different plants in the states of Minas Gerais (n = 23), Santa Catarina (n = 2), and São Paulo (n = 8). Two additional samples of C. limonia (‘Rangpur’ lime) and one of C. latifolia (‘Persian’ or ‘Tahiti’ lime) were collected in Minas Gerais. Total DNA extraction was performed using NucleoSpin Plant II Kit (Macherey-Nagel) according to the manufacturer's recommendations. PCR was carried out with a universal P1/P7 primer set followed by nested primers R16F2n/R16R2 (2). Additionally, direct PCR was performed using primers specific for phytoplasma immune-dominant membrane protein IMP3F/IMP3R (1). ‘Rangpur’ and ‘Tahiti’ lime were not infected with phytoplasma. Of the C. aurantifolia samples, 52% were positive for phytoplasma in the direct and nested PCR assays. The numbers of positive samples in Minas Gerais, Santa Catarina, and São Paulo states were 12, 1, and 4, respectively. Of these, five were selected for DNA purification and 1,246-bp fragments were ligated to the pGEM T-easy vector (Promega) and partial 16Sr DNA was sequenced. Nucleotide sequences of Brazilian phytoplasma strains BR:MG:FNS10:2011, BR:MG:FNS53:2011, BR:SP:FNS73:2011, BR:SC:FNS86:2011, and BR:MG:FNS126:2012 (GenBank Accession Nos. KJ158173, KJ158174, KJ158175, KJ158176, and KJ158177, respectively) were subjected to RFLP analyses. The 16S rDNA RFLP in silico patterns for the five strains were identical to each other and to Cactus witches'-broom phytoplasma (16SrII-C subgroup, AJ293216). In addition, the highest similarity coefficient (5) and nucleotide sequence identity of Brazilian phytoplasma strains were 0.99 and 99%, respectively, with Cactus witches'-broom phytoplasma. PCR-RFLP analyses using the enzymes Bstu I, EcoR I, and Hpa II were consistent with RFLP in silico results, showing the same pattern as the 16SrII-C subgroup. Phylogenetic analyses based on 16S rDNA sequences (1,246 bp) demonstrated that all the Brazilian strains grouped in the same clade with other representative sequences from the 16S rDNAII group. To confirm the absence of any macroscopic symptoms, morphological characteristics of 10 uninfected and 10 phytoplasma-infected plants randomly selected from a single field in Minas Gerais were analyzed. There were no significant differences in leaf area, stalk diameter, or numbers of leaves, flowers, or fruits per branch. To our knowledge, this is the first report of the 16SrII-C subgroup phytoplasma associated with C. aurantifolia in Brazil, and the first report of asymptomatic citrus plants infected with phytoplasma. References: (1) N. Askari et al. J. Microbiol. Biotechnol. 21:81, 2011. (2) I. M. Lee et al. Phytopathology 84:559, 1994. (3) H. G. Montano et al. Bull. Insectol. 60:129, 2007. (4) D. C. Teixeira et al. Phytopathology 98:977, 2008. (5) Y. Zhao et al. Meth. Mol. Biol. 938:329, 2013.

Abstract Gene expression microarrays had been used to classify known tumor types and various hematological malignancies (Yeoh et al, Cancer Cell 2002; Kohlmann et al, Genes Chromosomes Cancer 2003), enforcing the objective that microarray analysis could be introduced soon in the routine classification of cancer (Haferlach et al, Blood 2005). However, there’re still doubts about gene expression experiments performance in clinical laboratory diagnosis. For instance, the quality of starting material is a major concern in microarray technology and there are no data on the variation in gene expression profiles ensuing from different RNA extraction procedures. Here, as part of the internal multicenter MILE Study program, we assess the impact of different RNA preparation methods on gene expression data, analyzing 27 patients representative of nine different subtypes of pediatric acute leukemias. We compared the three currently most used protocols to isolate RNA for routine diagnosis (PCR assays) and microarray experiments. They are named as method A: lysis of mononuclear leukemia cells, followed by lysate homogeniziation, followed by total RNA isolation; method B: TRIzol RNA isolation, and method C: TRIzol RNA isolation followed by total RNA purification step. The methods were analyzed in triplicates for each sample (24) and additional three samples were performed in technical replicates of three data sets for each preparation (HG-U133 Plus 2.0). Method A results in better total RNA quality as demonstrated by 3′/5′ GAPD ratios and by RNA degradation plots. High comparability of gene expression data is found between samples in the same leukemia subclasses and collected with different RNA preparation methods thus demonstrating that sample preparation procedures do not impair the overall signal distribution. Unsupervised analyses showed clustering of samples first by each patient’s replicate conditions, then by leukemia type, and finally by leukemia lineage. In fact, B-ALL samples are clustered together, separately from T-ALL and AML, demonstrating that clustering reflects biological differences between leukemias and that the RNA isolation method is a secondary effect. Also, supervised cluster analyses highlight that samples are grouped depending on intra-lineage features (i.e. chromosomal aberrations) thus confirming the clustering organizations as reported in recent gene expression profiling studies of acute leukemias. Our study shows that biological features of pediatric acute leukemia classes largely exceed the variations between different total RNA sample preparation protocols. However, technical replicates analyses reveal that gene expression data from method A have the lowest degree of variation, are more reproducible and more precise as compared to the other two methods. Furthermore, compared to methods B and C, method A produces more differentially expressed probe sets between distinct leukemia classes and is therefore considered the more robust RNA isolation procedure for gene expression experiments using high-density microarray technology. We therefore conclude that method A (initial homogenization of the leukemia cell lysate followed by total RNA isolation) combined with a standardized microarray analysis protocol is highly reproducible and contributes to robustness of gene expression data and that this procedure is most practical for a routine laboratory use.

Sweet potato chlorotic stunt virus (SPCSV) is the whitefly-transmitted component of the sweet potato virus disease (SPVD), a devastating disease originally described in Africa (4). Two isolates designated as G-01 and T-03 were obtained in North Carolina in July 2001 and October 2003, respectively, from plants of cv. Beauregard exhibiting symptoms typical of SPVD, including stunting, leaf narrowing and distortion, vein clearing, and chlorotic mosaic. Sap extract from symptomatic plants tested positive for SPCSV by nitrocellulose immuno-dot blot, using monoclonal antibodies specific for SPCSV obtained from the International Potato Center. Total RNA was extracted from 100 mg of symptomatic leaf tissue by using the PureLink Total RNA Purification System Kit from Invitrogen (Carlsbad, CA) with a minor modification (adding 2% PVP-40 and 1% 2-mercaptoethanol to the extraction buffer) (1). Results were confirmed by reverse transcription (RT)-PCR using primers CP1 and CP3 and HSP70-A/HSP70-B (2), corresponding to the capsid protein and ‘heat shock’ protein genes, respectively. HSP70 amplicons were cloned using the TOPO TA Cloning Kit (Invitrogen) and sequenced. At the nucleotide level, viral sequences from clones from both isolates were an average 99.4% similar to West Africa and 77.9% to East Africa sequences of SPCSV from Genbank (1). Although the isolates were collected from different fields, viral sequences generated from clones for T-03 and G-01 differed by only six nucleotides and were identical at the amino acid level. The neighbor-joining phylogenetic tree constructed using the HSP70 gene fragment (39 nt) delineated two major clusters with two subpopulations each: Cluster 1, “East Africa”, consisted of East Africa and Peru subpopulations; Cluster 2, “West Africa”, consisted of Argentina-Brazil and USA-West Africa subpopulations (1). In addition, SPCSV isolates from East Africa and West Africa clusters were sufficiently distant phylogenetically to suggest that they may correspond to two different criniviruses, with an average similarity between the populations of 78.14% and an average within the populations above 89%. Hudson's tests confirmed the presence of genetically distinct SPCSV groups with high statistical significance (1). Two groups (Peru and East Africa) were differentiated in the East Africa cluster, and three groups (Argentina-Brazil, USA, and West Africa) were differentiated in the West Africa cluster, suggesting that the USA population is not a recent introduction. Although SPCSV was previously reported in the United States, the source was a single accession of cv. White Bunch from the USDA Sweetpotato Germplasm Repository (3). Sweet potato feathery mottle virus (SPFMV) (family Potyviridae, genus Potyvirus), the other component of SPVD, was also detected in both cultivars. To our knowledge, this is the first report of SPCSV in sweetpotato fields in the United States. References: (1) J. A. Abad et al. Phytopathology (Abstr.) 96(suppl.):S1, 2006. (2) T. Alicai et al. Plant Pathol. 48:718, 1999. (3) G. Pio-Ribeiro et al. Plant Dis. 80:551, 1996. (4) G. A. Schaefer and E. R. Terry. Phytopathology 66:642, 1977.

Diseases caused by Fusarium spp. are probably the most important factors affecting the yield and grain quality of maize (Zea mays L.) in Poland. While Fusarium stalk rot problems were reported to be stable in all regions, ear rot tends to increase. This tendency probably results from warmer climate and conservation tillage techniques combined with maize- and wheat-dominated rotation systems increasingly practiced in these regions. Maize kernel samples were harvested from trials conducted with hybrids moderately resistant and susceptible to ear rot in three locations in 2011 (12 samples) and in seven locations in 2012 (20 samples) from regions of Poland where maize for seed production is grown for many years. For each sample, 56 kernels (1,792 total) were subjected to the investigation of fungal colonization as following: surface-disinfected in alcohol (15 sec), rinsed with distilled water, dried, placed on the water agar in petri plates, incubated 7 to 12 days at 22°C, and sub-cultured using the single spore technique on SNA. Pure cultures were grown on SNA at 22°C for 10 days to produce macroconidia of uniform size and form, as well as on PDA (1). The presence of Fusarium spp. was determined based on the SCAR-PCR markers and the translation elongation factor (tef-1α) sequence analyses (4). All samples were contaminated by Fusarium spp. at level ranging from 17.3 to 40.5% of kernels (444 strains were isolated). F. verticillioides was the most frequent species. The frequencies of F. temperatum (a recently described species closely related to F. subglutinans [3]) ranged from 2.3 to 54.3%, F. subglutinans from 0 to 37.9%, F. verticillioides 41.0 to 90.0%, and F. proliferatum from 0 to 11.5% of the total Fusarium strain number. After extraction and purification, Fusarium mycotoxins were detected using HPLC method. The majority of maize kernel samples contained fumonisins B1 to B3. Zearalenone and deoxynivalenol were not detected or their levels were below limit detections. Aggressiveness of 10 representative isolates (3 each of F. temperatum, F. verticillioides, and F. subglutinans, and 1 F. proliferatum) was evaluated under field conditions after kernel inoculation. Susceptible and moderate resistant inbreed lines were used. The experimental design consisted of a factorial arrangement with two factors and three replicates (7 plants per replicate). To produce inoculum, isolates were grown on a liquid SNA medium. After 2 weeks, cultures were filtered through cheesecloth and conidial concentrations were adjusted to ~106 spores ml−1. Inoculation of each ear was conducted 10 to 12 days after silking time using 1.5 ml of spore suspension. Control plants were inoculated with distilled water. Visual evaluation of ear rot severity was scored during harvesting time as the percentage of the ear area covering by mycelium (2). Differences of aggressiveness between genotypes, Fusarium spp., and isolates were statistically significant; ear area covered by mycelium ranged from 3.57 to 26.95% for F. temperatum, from 10.10 to 41.39% for F. subglutinans, from 5.90 to 14.33% for F. verticillioides, and from 9.57 to 17.14% for F. proliferatum. To our knowledge, this is the first report of F. temperatum causing ear rot of maize in Poland. References: (1) J. F. Leslie et al. Page 388 in: The Fusarium Laboratory Manual. Blackwell Publishing, Oxford, 2006. (2) L. M. Reid et al. Can. J. Plant Pathol. 19:185, 1997. (3) J. Scauflaire et al. Mycologia 103:586, 2011. (4) Ł. Stępień et al. J. Appl. Genet. 54:367, 2013.

Precipitation of hydrous Fe and Mn oxides was investigated in 12 plants, constructed for purification of groundwater from excess Fe and Mn. The re-infiltration method was applied in 7 plants and the slow sand filtration in 5 plants (Hatva et al., 1985; Hatva 1987, this symposium) Water was analysed for aquatic chemistry and for the speciation of Fe, Mn, Zn and Cu. The distribution and mode of occurrence of the elements in the precipitates were studied by successive extraction and dissolution kinetics techniques. The mineralogy of the oxidic Fe and Mn precipitates was studied using XRD techniques. The results suggest the presence of Fe(II), Mn and Zn in groundwater mainly in cationic form. Cu was in colloidal and organically bound forms. The precipitation of hydrous Fe and Mn oxides from groundwater is affected by chemical and microbiological factors. The oxidation of Fe(II) took place mainly chemically with increasing O2 content, pH and Eh of the water. Ferrihydrite, a poorly ordered oxidic Fe mineral was the dominant product. Environmentally controlled colloidal and surface chemical properties of the precipitating species enhanced the precipitation causing sorption and scavenging of Si and cations. Owing to the relatively high Si content (over 4 mg Si/l) of groundwater in Finland and the interaction of Si and Fe the crystallization of lepidocrocite that is formed in Si-free systems was inhibited and ferrihydrate was formed instead. 15-20% of total Fe and above 50% of total Mn were in sorbed form in the precipitates. Only 15-20% of Mn was in sorbed form in the precipitates that contained MnO2 minerals, vernadite and birnessite (in two plants). The oxidation of Mn(II) appeared to involve microbial catalysis because it was adversely influenced by high pH and copper sulphate. The freshly precipitated MnO4 strongly sorbed and scavenged heavy metals (e.g., Ag, Sn, Ni, Co, Zn and Cu). Cations (Ca2+, Mg2+, K+ and Na+) were sorbed by the hydrous Fe oxides at high pH (above 7) whereas Cu tended to be sorbed at low pH levels. Gallionella was the dominant type of bacteria in the raw water and the bacterial density was low. In the filtration basins Leptothrix, Siderocapsa and Ochrobium were the typical microorganisms. The bacterial density was highest in the upper part of the sand in the infiltration basins and the bacteria were covered by Fe (and Mn) precipitate encrustations.

Xiphinema species are migratory ectoparasitic nematodes that feed on an extensive range of hosts and several species are vectors of nepoviruses. These long nematodes are readily distinguished from most other plant parasitic nematodes by a long stylet with forked odontostyle and flanged odontophore. In May of 2005, a sample from the rhizosphere of Carpinus betulus and Acer platanoides in a forest near Silnicna, South Moravia yielded a population of Xiphinema dentatum Sturhan, 1978. X. dentatum previously has been reported to be associated with several forest and grassland species in Germany, the former Yugoslavia, and Slovakia. Specimens were extracted from soil by decanting-sieving. A few female specimens were stored at –20°C in 1 M NaCl, and the rest of the specimens were heat killed, fixed in triethanolamine formalin, and mounted in anhydrous glycerin. In 2007, nematodes from permanent slides were identified by morphological and morphometrical characters (3): female body C shaped in fixed specimens, lip region offset by a depression, reproductive system amphidelphic with the presence of well developed pseudo Z-organ, and tail broadly convex-conoid to regularly hemispherical; main average morphometric of females were body length 3.6 mm, total stylet length 220 μm, vulva position 46%, and tail ratio 0.66. Identification of these nematodes was further verified by sequencing cytochrome oxidase subunit 1 (cox1) of mtDNA and D2/D3 expansion segments of large subunit rDNA. Two individual female specimens from NaCl storage were transferred to 0.5-ml Eppendorf tubes containing 0.25 M NaOH. Total genomic DNA was prepared by a rapid technique (4). The cox1 gene was amplified using forward primer COIF (5′-GAT TTT TTG GKC ATC CWG ARG-3′) and reverse primer COIR (5′-CWA CAT AAT AAG TAT CAT G-3′) (2). D2/D3 expansion segments of large subunit of rDNA were amplified using forward primer D2A (5′-ACA AGT ACC GTG AGG GAA AGT TG -3′) and reverse primer D3B (5′-TCG GAA GGA ACC AGC TAC TA-3′) (1). The regions were sequenced in both directions after purification of PCR products from gel slices with a Qiagen gel extraction kit (Qiagen, Hilden, Germany). The sequences of two individual females were identical. The sequences were deposited in GenBank (Accession Nos. EU781537 [cox1] and EU781538 [D2/D3]). The length of cox1 was 393 bp and D2/D3 was 786 bp. The obtained sequences were compared by BLAST in NCBI. The cox1 gene sequence is not available in GenBank for X. dentatum, but the best BLAST hits were logically obtained with Xiphinema species. BLAST results of D2/D3 sequence showed strong similarities (99.6%) with X. dentatum Accession No. AY601627 and only a three nucleotide difference was observed in the beginning of the 5′ end. To our knowledge, this is the first report of X. dentatum associated with deciduous forest trees in the Czech Republic. Forests are the main terrestrial ecosystems and rich in species diversity and are of great importance as natural resources. Therefore, information on these plant parasitic nematodes from forests would be useful because they are a component of the continental forest diversity. References: (1) P. De Ley et al. Nematology 2:591, 1999. (2) Y. He et al. J. Mol. Evol. 61:819, 2005. (3) P. A. A. Loof and M. Luc. Syst. Parasitol. 16:35, 1990. (4) J. M. Stanton. Australas. Plant Pathol. 27:112, 1998.

Peonies (Paeonia sp.) are highly valued for their large showy flowers in home gardens and commercially in the cut flower industry. In 2007, scattered peony (Paeonia lactiflora ‘Sarah Bernhardt’) plants cultivated on small plots at the University of Alaska Experimental Station in Fairbanks displayed distinct leaf ringspot patterns. Symptoms were more severe during the cooler months of the growing season (June and September), with symptom remission in the intervening warmer months. Leaf samples from six symptomatic plants were collected in July and from 20 symptomatic plants in September and assayed for viruses. Leaf samples (1 g) were assayed with a general protocol for plant virus extraction and partial purification with differential centrifugation followed by protein detection on stained sodium dodecyl sulfate-polyacrylamide gel electrophoresis (1). No distinct proteins indicative of viral coat protein(s) were detected. Tomato spotted wilt virus (TSWV) and Tobacco rattle virus (TRV), known pathogens of peony, were then specifically targeted. Total RNA was extracted from each sample with an RNeasy Plant Mini kit (Qiagen Inc., Valencia, CA) and used as the template for reverse transcription (RT)-PCR with random primers. TSWV was not detected by RT-PCR with tospovirus group-specific primers (Agdia, Inc., Elkhart, IN). A nested set of primers designed from the TRV 16-kDa protein gene on RNA1 (4) amplified an ~600-bp fragment from one of the symptomatic plants. This DNA was directly sequenced (GenBank Accession No. FJ357572) and BLAST searches in GenBank revealed as much as 95% nucleotide (nt) identity with TRV accessions J04347 and X03685. Additional primer pairs specific for TRV (2) amplified overlapping fragments with expected sizes of ~818, ~515, and ~290 bp from the 29- and 16-kDa protein genes on the 3′-end of RNA1 that were directly sequenced. Assembly of these sequences in Sequencher 4.8 (Gene Codes Corp., Ann Arbor, MI) resulted in a 1,422-nt sequence (Accession No. FJ357571) and Clustal X analysis (3) showed 93 to 94% nt identity to TRV isolates, -ORY (AF034622), -PpK20 (AF314165), -Pp085 (AJ586803), and -SYM (D00155). Mechanical inoculation of partially purified virions from the confirmed TRV-infected peony plant to Nicotiana benthamiana gave no symptoms to occasional ringspots, faintly curled leaves, and chlorotic blotches on N. tabacum ‘Samsun’, and local lesions on Chenopodium amaranticolor. TRV infection of these hosts was confirmed by RT-PCR. With electron microscopy, rod-shaped particles similar to TRV with a distinct central canal characteristic of TRV were seen occasionally only from inoculated N. benthamiana. On the basis of the biological and molecular data, we have determined the virus in the peony to be an isolate of TRV, tentatively named TRV-Peony. TRV was confirmed in only one other peony based on a sequenced 290-nt PCR fragment with 95% identity with the sequence from the other TRV-infected peony. Lack of TRV detection in the other symptomatic peonies was possibly due to low viral concentrations and interfering plant substances. Documentation of TRV in peonies is especially important to help avoid distribution of virus-infected vegetative propagation material. To our knowledge, this is the first report of TRV in this host in Alaska, but also of this virus in Alaska. References: (1) L. C. Lane. Methods Enzymol. 118:687, 1986. (2) D. J. Robinson. J. Phytopathol. 152:286, 2004. (3) J. D. Thompson et al. Nucleic Acids Res. 24:4882, 1997. (4) F. Van Der Wilk et al. Eur. J. Plant Pathol.100:109, 1994.

Potato spindle tuber viroid (PSTVd) has a quarantine status in the EU whereas Tomato apical stunt viroid (TASVd) is listed in the EPPO Alert list. During 2007 to 2012 surveys for the presence of PSTVd in 299 ornamental plants of the family Solanaceae (including Solanum jasminoides, S. rantonnetti, Brugmansia sp. and Petunia sp.) were carried out in Poland. The availability of a Pospiviroid genus-specific primer pair (1), which allows for the detection of the most prevalent viroids in ornamental plants by RT-PCR, has facilitated surveys of ornamental plants for pospiviroids. Fifteen S. rantonnetti and twenty-one S. jasminoides plants were sampled randomly and tested. Samples originated from seven different Polish provinces. Total RNA extraction was performed from plant leaves using Master Pure RNA Purification Kit (Epicentre). The obtained RNAs were further used for RT-PCR amplification using SuperScript One-Step RT-PCR System with PlatinumTaq DNA Polymerase (Invitrogen) kit according to the manufacturer's instructions. The Pospiviroid genus-specific primer set Vir1 5′CTTCAGTTGTTTCCACCGGGTAG 3′ /Vir2 5′TTCCTGTGGTGCACTCCTGACC 3′ (1), was used to amplify a 262-bp RT-PCR product. In addition, three positive samples were tested using PSTVd specific primers 3H1 5′ ATCCCCGGGGAAACCTGGAGCGAAC3′ /2H1 5′CCCTGAAGCGCTCCTCCGAG 3′ (2,4) that amplified the 360-bp product. The presence of RT-PCR products of the expected size was confirmed in two S. jasminoides samples using both primer pairs. One positive sample of S. jasminoides in the testing season 2007/2008 was collected in Zachodniopomorskie Province. The second sample was collected in 2009 in the Lubuskie region. The obtained products were cloned into pGEM-Teasy vector and sequenced using M13F and M13R primers. The sequence comparison using MEGA5 software (3) revealed that both isolates were identical to each other and shared 98 to 100% sequence identity with other PSTVd isolates described to date. The obtained sequence was deposited in the GenBank database (Accession No. KC707563). In addition, in 20 samples of Solanaceae spp. collected in 2012, the presence of an RT-PCR product of 262 bp, typical for Pospiviroids, was shown in one sample of S. rantonnetti collected in Lubuskie Province. Sequencing of the PCR product identified TASVd, and the sequence has been deposited in GenBank (KC707564). Sap derived from PSTVd- and TASVd-positive samples was used to mechanically inoculate tomato plants (variety Moneymaker). In total, 25 plants were inoculated with PSTVd and 25 with TASVd. After 3 weeks, most of the tomato plants displayed growth reduction and distortion. Inoculated tomato plants were sampled and tested by RT-PCR for the presence of viroids and all obtained products were subjected to sequencing. The obtained sequences were identical with original ones. The viroids detected in the two Solanum sp. appeared to be efficiently transmitted to tomato, as 80% of the inoculated plants tested positive by RT-PCR. These results suggest that ornamental plants might act as a source of inocula for tomato or potato crops even if they do not display any visible symptoms. TASVd-infected S. rantonnetti was introduced to Poland from the Netherlands, while the origin of the PSTVd positive S. jasminoides is uncertain. Official eradication measures were imposed due to the detection of viroids in ornamental plants in Poland. References: (1) R. A. Mumford et al. OEPP/EPPO Bulletin 30:431, 2000. (2) OEPP/EPPO Bulletin PM 7/33(1), 34:257, 2004. (3) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011. (4) H. L. Weidemann and U. Buchta. Potato Res. 41:1, 1998.

Brilliant cresyl blue (BCB) staining determines the activity of glucose-6-phosphate dehydrogenase (G6PDH), an enzyme in which activity decreases as the oocytes reach their growth phase. We have previously shown in lamb the effectiveness of this stain in selecting the largest and most competent oocytes to develop up to the blastocyst stage (Catala et al. 2011 Reproduction 142, 517–527). The aim of this study was to analyse the expression of 4 genes related to oocyte quality in BCB-selected oocytes. The 4 genes analyzed in this study were selected after a literature review in which they were associated with a better oocyte quality or embryo development; 2 of these genes were related to cell cycle: nuclear auto-antigenic sperm protein (NASP) and histone H2A (H2A.Z), and 2 genes with enzymatic functions: peroxiredoxin (PRDX1) and elongation factor-A1 (EEF1A1). Oocytes were recovered after slicing the surface of lamb ovaries (3 to 5 months old) obtained from a local slaughterhouse. Oocytes with more than 3 compact cumulus layers and homogenic cytoplasm were selected and exposed to 13 µM BCB during 1 h before IVM and classified according to oocyte coloration: oocytes with blue cytoplasm or grown oocytes (BCB+) and oocytes not coloured or growing oocytes (BCB–). Cumulus–oocyte complexes were then matured in conventional TCM199 medium supplemented with 10% fetal bovine serum and hormones during 24 h in a controlled atmosphere. Groups of 15 denuded oocytes (3 replicates) were taken before (0 h) and after maturation (24 h) and stored at –80°C in 100 mL of Trizol until use. After RNA extraction following manufacturer’s protocol (Promega, Madison, WI, USA), reverse transcription was performed by extended cDNA using Oligo (dT) primers during 5 min at 70°C and 1 h at 65°C using superscript III (200 U mM–1; Invitrogen). Relative qualitative PCR analyses were performed in duplicate using SYBR Green Fluorophore kit (Bio-Rad, Hercules, CA, USA). The specificity of each PCR product was determined by a melting curve analysis and the amplicon size determination by an agarose gel. A standard curve was also included, consisting of corresponding plasmid DNA fragments from 1 pg to 0.1 fg, purified with QIAquick PCR Purification Kit (Qiagen, Valencia, CA, USA). Correlation coefficients and PCR efficiencies were considered between 85 and 100%. Finally, the results for mRNA were normalized according to the relative concentration of the internal and external gene (luciferase and 18S, respectively). The statistical analysis was performed by One-way ANOVA in GraphPad Prism v 3 (GraphPad Software, San Diego, CA, USA). The analysis of gene expression showed no differences in relation to BCB classification. The only difference we found is a significant decrease (P ≤ 0.05) in the RE of PRDX observed in matured oocytes compared with immature ones. In conclusion, the expression of the mRNA expression of NASP, H2A.Z, PRDX1, and EEF1A1 were not affected by oocyte quality.

Abstract Introduction. - In the Nord-Pas-de-Calais region (northern France), the mining activity linked to the coal extraction resulted in the existence of many mine spoils. Most of the time, the choice of the mine spoil location has been made without knowing the potential contamination of the aquifers contained in the underlying formations by substances which can be solubilized and released in relation with the weathering of these mine spoils. The aim of this study is to determine the possible role of the mine spoils in the sulfate mineralization of the chalk aquifer. Previous works [Bernard, 1979; Droz, 1985] allow to consider several possible sources of sulfate in the coal basin: the dissolution of evaporitic minerals present in the Carboniferous limestones Formation which can locally contaminate per ascensum the chalk aquifer; the dissolution of gypsum contained in the Tertiary formations (Argiles de Louvil, Sables d'Ostricourt); sulfates of anthropic origin linked to the waste water discharge and/or to the agricultural practices; finally, the weathering of mine spoils which leads to the oxydation of the pyrite contained in the Carboniferous shales, and can release sulfate ions that may be transferred to the aquifer. Two sites have been selected 30 km to the south of Lille: site 1 lies directly on the Senonian-Turonian chalk while site 2 lies on the sandy-clayey Tertiary formations overlying the chalk formations (fig. 1-3). Geology and hydrogeology. - The waters have been sampled within the chalk aquifer (fig. 2). This water table forms the main resource in drinking water, currently exploited. The chalk aquifer is a free water table except where the Tertiary formations make this water table confined, as is the case for site 2. The recharge of the chalk aquifer is made by the percolation of the impluvium through the microporosity of the chalk with an infiltration velocity of 0.5 to 0.7 m per year [Vachier et al., 1979]. The chalk aquifer flow is schematically SW-NE to the Orchies basin (fig. 1). This flow is caused by the piezometric depression in the Orchies basin linked to industrial pumpage. Since the decrease of these pumpages, we can observe a rise of the chalk aquifer piezometric level evaluated to 10 m in the studied area. Material and methods. - Rock samples have been collected on the surface of the two sites and below it at site 1. Mineralogical analyses have been carried out on the bulk fraction as on the clayey fraction, the elementary analysis of total carbon and total sulphur has also been performed. Two water sampling surveys have been carried out on 19 sites. Sampling has been made from piezometers which reach the chalk aquifer and that are placed close to the mine spoils but also in a radius of 5 to 10 km around. Chemical and isotopic analyses have been made on the waters sampled at hydraulic upstream and dowstream of the mine spoils. In situ measurements have been carried out during the sampling. Piezometric levels have been taken at all the sampling sites. Results and discussion. - The carbon and sulphur contents have shown a superficial leaching of these elements on the mine spoils (fig. 9). The use of isotopic geochemistry and in particular the sulphur isotopes as tracers of the sulfate origin has permitted to identify two contribution sources at the two sites: a "mine spoil" source with a delta 34 S weakly negative (delta 34 S = -2,8 per mil, -3,9 per mil) which corresponds to the oxidation of sulfides contained by the Carboniferous shales and another source (delta 34 S = -20 per mil) corresponding to the gypsum of the "Sables d'Ostricourt" which is present only at site 2 (fig. 7, 10 & 11). This study has revealed the different behaviour of the two sites: for site 1, with a free water-table zone, the mine spoil leaching carries sulfate ions directly to the table whereas in the second site, with a confined aquifer zone, a part of the sulfate ions are reduced once exported to the table (the redox potential presents negative values; fig. 6). This bacterial reduction is made possible by the organic carbon leaching concomitant to the sulphur leaching on the mine spoils. This carbon contribution has been confirmed by the 14 C activity analysis: 14 C activity is characteristic of the chalk aquifer waters at the upstream of the mine spoil and noticeably lower downstream, this decrease can be linked to the "dead carbon" supply from the mine spoils (fig. 8). This organic carbon is involved in bacterially-mediated sulfate reduction (2CH 2 O + SO 4 (super 2-) --&gt; 2HSO 3 (super -) + H (super +) + HS (super -) ). Conclusion. - Both studied mine spoils release sulfate ions to the Chalk aquifer, in response to the weathering and leaching of their surficial part. Using an isotope study-grounded approach, the influence of the mine spoils upon the sulfate enrichment of the water table can be distinguished from that of Cenozoic formations sometimes present between the chalk aquifer and the mine spoil basis. No other sulfate source seems to be involved in the studied area. Together with sulfate ions, the mine spoils export dissolved organic carbon. Both chemical species sustain bacterial activity (sulfate reducers) that develops where the water table is made confined by overlying, almost impervious, Cenozoic deposits. In that case, reducing conditions in the aquifer decrease the amount of sulfate ions present. Thus the simultaneous supply of sulfate and carbon by the mine spoils leads to a self-purification process where the aquifer is confined.

Rhamnogalacturonase (RGase) is a new fungal enzyme which degrades the highly branched regions of apple fruit cell wall pectin by cleaving the glycosyl linkage between rhamnosyl and galacturonosyl residues (Schols et al., 1990. Carhohydr. Res. 206:105.). This enzyme, if present in fruit, could play a significant role in fruit softening. Partial purification of RGase was accomplished from a fungal enzyme preparation (Pectinex Ultra SP-L, NOVO Ferment) produced from Aspergillus niger. The crude enzyme hydrolyzed chelator-soluble pectin from red ripe tomato fruit. Methylation linkage analysis of the product suggested that an increase in terminal-rhamnosyl residues accompanied pectin hydrolysis, indicative of RGase activity. Cross-linked alginate, hydroxyapatite, and DEAE-Sephadex chromatography were used to partially purify RGase. Polygalacturonase was efficiently removed using the alginate column. Crude pectin obtained from mature-green tomato fruit cell wall by extracting with 0.5 M imidazole buffer (pH 7) and 50 mM Na-carbonate was incubated with pure polygalacturonase and the residue hydrolyzed with 0.1 N trifluoroacetic acid. This modified pectin was used as a substrate to investigate the presence of RGase in tomato and other fruit.

Abstract Exome sequencing is widely used and established to detect tumor-specific sequence variants such as point mutations and small insertions/deletions. Beyond single nucleotide resolution, sequencing data can also be used to identify changes in sequence coverage between samples enabling the detection of copy number alterations (CNAs). Somatic CNAs represent gain or loss of genomic material in tumor cells like aneuploidies (e.g. monosomies and trisomies), duplications, or deletions. In order to test the feasibility of somatic CNA detection from exome data, we analyzed 13 acute myeloid leukemia (AML) patients with known cytogenetic alterations detected at diagnosis (n=8) and/or at relapse (n=11). Corresponding remission exomes from all patients were available as germline controls resulting in 19 comparisons of paired leukemia and remission exome data sets. Exome sequencing was performed on a HiSeq 2500 instrument (Illumina) with mean target coverage of >100x. Exons with divergent coverage were detected using a linear regression model on mean exon coverage, and CNAs were called by an exact segmentation algorithm (Rigaill et al. 2012, Bioinformatics). For all samples, cytogenetic information was available either form routine chromosomal analysis or fluorescent in situ hybridization (FISH). Blast count were known for all but one AML sample (n=19). Copy number-neutral cytogenetic alterations such as balanced translocations were excluded from the comparative analysis. By CNA-analysis of exomes we were able to detect chromosomal aberrations consistent with routine cytogenetics in 18 out of 19 (95%) AML samples. In particular, we confirmed 2 out of 2 monosomies (both -7), and 9 out of 10 trisomies (+4, n=1; +8, n=8; +21, n=1), e.g. trisomy 8 in figure 1A. Partial amplifications or deletions of chromosomes were confirmed in 10 out of 10 AML samples (dup(1q), n=3; dup(8q), n=1; del(5q), n=3; del(17p), n=1; del(20q), n=2), e.g. del(5q) in figure 1B. In the one case with inconsistent findings of chromosomal aberrations between exome and cytogenetic data there was a small subclone harboring the alteration described in only 4 out of 21 metaphases (19%). To assess the specificity of our CNA approach, we analyzed the exomes of 44 cytogenetically normal (CN) AML samples. Here we did not detect any CNAs larger than 5 Mb in the vast majority of these samples (43/44, 98%), only one large CNA was detected indicating a trisomy 8. Estimates of the clone size were highly correlated between CNA-analysis of exomes and the parameters from cytogenetics and cytomorphology (p=0.0076, Fisher's exact test, Figure 1C). In CNA-analysis of exomes, we defined the clone size based on the coverage ratio: . Clone size estimation by cytogenetics and cytomorphology was performed by calculating the mean of blast count and abnormal metaphase/interphase count. Of note, clones estimated by CNA-analysis of exomes tended to be slightly larger. This may result from purification by Ficoll gradient centrifugation prior to DNA extraction for sequencing and/or the fact that the fraction of cells analyzed by cytogenetics does not represent the true size of the malignant clone accurately because of differences in the mitotic index between normal and malignant cells. Overall, there was a high correlation between our CNA analysis of exome sequencing data and routine cytogenetics including limitations in the detection of small subclones. Our results confirm that high throughput sequencing is a versatile, valuable, and robust method to detect chromosomal changes resulting in copy number alterations in AML with high specificity and sensitivity (98% and 95%, respectively). Figure 1. (A) Detection of trisomy 8 with an estimated clone size of 100% (B) Detection of deletion on chromosome 5q with an estimated clone size of 90% (C) Correlation of clone size estimation by routine diagnostics and exome sequencing (p=0.0076) Figure 1. (A) Detection of trisomy 8 with an estimated clone size of 100%. / (B) Detection of deletion on chromosome 5q with an estimated clone size of 90%. / (C) Correlation of clone size estimation by routine diagnostics and exome sequencing (p=0.0076) Figure 2. Figure 2. Disclosures No relevant conflicts of interest to declare.

Green gram (Vigna radiata) is considered the chief legume in Pakistan. Thus, current study was conducted to examine the ameliorating effect of phytohormones pre-treatments under salt stress on proteome profile of green gram by sodium-dodecyl-sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). The soluble green gram seedlings proteins were resolved on 4% stacking and 12% resolving gels. The SDS-PAGE resolved 24 polypeptide bands ranging from 200 to 17kDa. Among these, 12 out of 24 bands of proteins were essentials house-keeping or growth proteins of green grams. While, 120, 114.6, 51.8, 29.1, and 22.8 kDa bands were over-expressed under 50 to 350mM salt with phytohormones treatments. The others 104.5 kDa, 99.8 kDa, 95.3 kDa, 91.0 kDa, 55 kDa, 46 kDa, and 17kDa bands were related to the GAᴣ, IAA, and SA induced tolerance. Overall 120 kDa, 114.6 kDa, 104.5 kDa, 99.8, 95.3 kDa, 51.8 kDa, 29.1 kDa and 22.8kDa bands were first time identified in the current study. The information retrieved from NCBI protein database, the resolved peptides were principally belonging to 7S and 8S vicilin, 2S, 8S, 11S, and 16.5S globulins. It is determined that seed priming with SA enhanced tolerance in green gram by rapidly synthesizing stress alleviating peptides.Key word: Cluster analysis, dendrogram, mungbean, salt stress, SDS-PAGEINTRODUCTIONVarious world-wide health concerning organization recommended the use of high graded plant protein such as legumes to prevent the risk of metabolic disorder (Hou et al., 2019). Legumes are most important protein crop on the earth. Among the legumes, the green gram is the major pulses. Its seeds are rich in superior quality storage protein, which account 85% of the total protein while, another 15% have not been broadly studied (Yi-Shen et al., 2018). The soluble storage protein comprises of 60% globulins, 25% albumin and 15% prolamins. Globulins are further divided into 3.4% basic-type (7S), 7.6% legumin-type (11S), and 89% vicilin-type (8S) (Mendoza et al., 2001; Itoh et al., 2006). Other than proteins, the green gram seeds also contain starch, fiber, phenolic compound, saponins, vitamins, calcium zinc, potassium, folate, magnesium, manganese and very low in fat that made it meager man’s meat (Hou et al., 2019). It is also a good source of green manure and fodder (El-Kafafi et al., 2015). Its root has ability to fix 30 to 50 Kg/ha atmospheric nitrogen in the soil which is essential for maintaining soil fertility (Chadha, 2010). The green gram is the valuable and the major Rabi pulse crop of Pakistan. Its cultivation area in 2016-2017 was about 179,000 hectares with seed yield of 130,000 tones. In comparison during 2017-2018, it was cultivated on 161,800 hectares land with 118,800 tones seed yield (GOP, 2018). One of the reasons of this 9% decrease in both land and productivity is the shortage of irrigated land due to soil salinity. The salinity induce oxidative bust in the mungbean cells, caused by responsive oxygen species (ROS) such as hydrogen peroxide, singlet oxygen, hydroxyl radical and superoxide radical. The ROS create hindrance in various metabolic processes of plant via interacting with macromolecules like proteins (Alharby et al., 2016). However, phytohormones like gibberellic acid (GAᴣ), indole acetic acid (IAA), and salicylic acid (SA) take part in the biosynthesis of salt tolerance proteins under salinity. These salt tolerance proteins acclimate plants under salinity stress. Application of biotechnology plays a significant role in agriculture (Khan et al., 2017). Therefore, production of particular proteins under salt stress is a specific response of cell which can be analyzed by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE). SDS-PAGE is the simple, valid, and cost-effective biochemical marker (Mushtaq et al., 2018). This marker has been widely used to determine the extent of evolutionary variations in crops (El-Kafafi et al., 2015).OBJECTIVES The present study was directed first time with the aim to investigate the toxic effect of sodium chloride (0-350 mM) and stress acclimation by pre-treatment of GAᴣ, IAA, and SA on the proteome profile of NM-92 cultivar of a Pakistani green gram.MATERIALS AND METHODSThe present study was replicated thrice in the plant laboratory of Department of Genetics, Faculty of Science, and University of Karachi. The seeds of mung bean cultivar NM-92 were acquired from National Agricultural Research Centre (NARC), Islamabad. These freshly collected 15 seedsˉ1 treatment / replication were divided into two sets. The first was named as sodium chloride (SC) stress treatments were imbibed in sterile distilled water (DW) whereas, second set soaked in gibberellic acid (GAᴣ) (BDH Chemicals, England), indole acetic acid (IAA) (Fluka, Switzerland), and salicylic acid (SA) (J.T. Baker, Holland) in the separate beaker for 24 hours under dark condition. After 24 hours, given ample time to both the sets at room temperature. After recovery, all 20 treatments were sown in the 150 X 30 mm sized petri-dishes containing 0, 50, 150, 250, and 350 millimolar (mM) sodium chloride solution (Fisher Scientific, UK) for 72 hours.Protein extraction: Protein extraction was done by taking 0.3g of seedlings in an ice chilled mortar and crushed by adding 600µL 0.2 M Tris-HCl buffer having pH 7.5 contained 5% SDS (w/v) and 5% 2-mercaptoethanol (v/v). The homogenate was incubated at 0oC for 30 min., boiled in the water bath for 3 min. at 100oC. Samples were centrifuged in Heraeus Biofuge D-37520, Germany for 30 min. at 8000 rpm. The protein supernatant was saved at below 0°C for quantitative and qualitative determination with minor modifications. The total soluble protein content of the samples was estimated via “Bovine Serum Albumin (BSA) standard curve” and explicit in µg protein milligramˉ1 fresh weight of mung seedlings.Bovine serum albumin standard curve (2000 μg/mL): Total protein standard curve was made by dissolving 0.05g of Bovine Serum Albumin (BSA) in 25mL of distilled water. Ten serial dilutions were made from 0.1 mL to 1mL by BSA solution then performed Lowry. A standard curve of total proteins was plotted by taking BSA absorbance at Y-axis and 2000 μg BSA / mL at X-axisSample preparation for SDS-PAGE: For qualitative assessment of total proteins; the 35μL of saved protein supernatant was combined with 15μL of sample diluting buffer (SDB). The SDB was made up of 0.0625 M Tris-HCl pH 6.8 with 2% of SDS, 10% of glycerol, 0.003% of bromophenol blue dye and 5% of 2-mercaptoethanol. Boil the 50μL protein SDB supernatant at 100oC in water bath for 3 min., centrifuged at 6000 rpm for 4 min. The supernatant was loaded on SDS-PAGE gel with the given formulae. The SDS- PAGE: Total proteins were fractionated via SDS-PAGE with 4% stacking and 12% resolving gel. The resolving gel of 12% was made by taking 6mL solution A, 1.8 mL 3 M Tris 1 M HCl buffer pH 8.8, 144μL 10% SDS, 5.74 mL sterile distilled water, 720μL 1.5% ammonium persulphate (APS) in deionized water and 10μL TEMED. While, stacking was composed of 1.25mL of solution A, 2.5mL of 0.5M Tris 1M HCl buffer pH 6.8, 100μL 10% SDS, 1.8 mL of distilled water, 500μL 1.5% APS and 12μL TEMED. Solution A was prepared by conjoining 30% acrylamide and 0.8% N, N’-methylene-bisacrylamide in deionized water. To avoid polymerization in the beaker; the prepared solution was quickly poured into the 3 mm thick gel plates after adding TEMED. The stacking was lined over resolving gel, then combs were inserted between the gel plates of SCIE-PLAS TV-100 separation system, UK, and allowed to polymerize for ½ an hour. After polymerization gel was placed in the tank which were filled with Tris-Glycine buffer (electrode buffer) pH 8.4 then combs were removed. The electrode buffer contained 0.3% Tris, 1.41% Glycine and 0.1% SDS in 2000mL d/w. The gel was pre-run for 15 min. at 60 volts and 120 mA currents. The prepared SDS-PAGE samples were loaded in wells with BlueStepTM Broad Range Protein Marker, AMRESCO, USA as standard and run at 60 volts & 120 mA for about 45 min. When samples entered in resolving gel, and then gave 100 volts and 200 mA currents for around 2.5 hours. Furthermore, electrophoresis was carried out at a constant watt.The Gel was washed with 30% ethanol on Uni Thermo Shaker NTS-1300 EYELA, Japan at the constant shaking for 30 min. Then gels were placed in 10% glacial acetic acid in 50% methanol solution (Fixative) for 24 hours. SDS Gel was stained until protein bands were visible thereat placed as 5% of Methanol in 7.5% acetic acid glacial solution to destain the bands background. SDS-PAGE stain composed of 0.125% coomassie brilliant blue R-250 dissolved in 40% of Methanol and 7% acetic acid glacial solution. The stain was stirred on Magnetic stirrer & hot plate M6/1, Germany for 6-10 hours before used. Photographs were taken by Sanyo digital camera VPC-T1284BL and bands were scored through numbering pattern. Gels preserved in 10% acetic acid solution at 4°C.Interpretation of bands and data analysis: The total soluble protein bands relative mobility calculated by below formulae and Dendrogram was constructed via SPSS v. 20Where,F=(Migrated distance of protein band)/(Migrated distance of dye front)Slop=(Log MW of protein marker lower limit band–log〖MW of protein marker upper limit band )/(RF protein marker lower limit band –RF of protein marker upper limit band)RESULTS:The total soluble proteins extracted from green gram were perceived by SDS-PAGE Blue StepTm broad range biochemical markers. The protein-based marker was used to evaluate the toxic effect of sodium chloride along with pre-treatments of GAᴣ, IAA, and SA on proteome assay. In the current work, seedlings total soluble proteome resolved 24 polypeptide bands ranging from 200 to 17.1 kDa were recognized by using SDS-PAGE. The figure 1 showed Dendrogram assay, which classified the 20 treatments of SC, GAᴣ, IAA and SA into two major clusters where, the cluster I was the largest one (figure 1). Cluster I consisted of 15 treatments that further divided into I-A, and I-B. The pre-treatments of SC50+SA, SC150+SA, SC250+SA, and SC350+IAA were grouped together into C-1 of sub-cluster I-A. The C-2 of sub-cluster I-A, pre-treatment SC350+SA was most diverse among 20 treatments. The C-1 treatments showed 99% homology when compared with each other while, it was 97% similar with C-2. The sub-cluster I-B comprised another 10 treatments, SC0+GAᴣ, SC50+GAᴣ, SC150+GAᴣ, SC250+GAᴣ, SC350+GAᴣ, SC0+IAA, SC50+IAA, SC150+IAA, SC250+IAA, and SC0+SA that were also 99% similar for total proteins. Sub-cluster I-B pre-treatments was exhibiting 94% homology with the sub-cluster I-A. The second cluster was the smallest one that was divided into two sub-clusters, II-A and II-B. The II-A was comprised of SC50, SC150, and SC250 while, sub-cluster II-B consisted of SC0 and SC350. Within each sub-cluster, pre-treatments expressed 99% homology whereas, II-A was 97 different from II-B. Furthermore, cluster I showed 75% similarities with cluster II (figure 1). The seedlings storage proteome profile of green gram was shown in table 1.The results showed that 120kDa, 114.6 kDa, 51.8 kDa, 29.1 kDa and 22.8 kDa proteins bands were not induced at 0 mM SC, GAᴣ, IAA, and SA. The table 1 depicted the presence of 120 kDa and 114.6 kDa bands only at 350 mM SC level with all phytohormones treatments. Similarly, 51.8 kDa protein bands were appearing at 150SC, 250SC and 350SC stress with phytohormones. Based on the information collected from the NCBI protein database, this peptide was related to the 8S globulin alpha subunits. The two other, 7S globulins sub-units having 29.1kDa and 22.8 kDa molecular weights bands were synthesized under 50mM, 150mM, 250mM, 350mM SC stress with phytohormones. Concerning protein polypeptide of molecular weight 104.5 kDa, 99.8 kDa, 91.0 kDa, 55.0 kDa, and 46.0 kDa, those were induced by GAᴣ, IAA and SA at 0 to 350 mM SC. While, 17kDa protein band was appearing in SA, and IAA treated samples and 95.3kDa band was only present in SA treatment. Other 12 protein bands were present in all treatments proved as house-keeping proteins of green gram (table 1).DISCUSSIONThe SDS-PAGE profiling for proteome is the reliable and applied biochemical approach that has been used as biochemical marker in various crop differentiation, and characterization. In the current study, first time SDS-PAGE was utilized to investigate the impact of GAᴣ, IAA, and SA pre-soaking on green gram under salt toxicity. The salt toxicity adversely affects all seed, seedling, and plant metabolic process (Parveen et al., 2016). At salt toxicity, the endogenous GAᴣ, IAA, and SA levels markedly decrease (El-Khallal et al., 2009). In such condition, exogenous application of GAᴣ, IAA, and SA enhance seedlings survival rate by increasing synthesis of seed storage proteins. Likewise, our Dendrogram characterization based on 20 treatments showed significant diversity under 0 to 350 mM SC stress. The salicylic acid treatments were grouped together except SC0+SA treatment, exhibiting a close relationship, which proved its acclimating role under salt stress. These findings will help plant breeder toward enhancing food quality and quantity of green gram in future breeding programme on saline sodic land.The SDS-PAGE assay revealed 200. kDa, 109.4 kDa, 77 kDa, 68 kDa, 49 kDa, 38 kDa, 33 kDa, 26 kDa, 24 kDa, 22 kDa, 21 kDa and 19 kDa fractions as essential green gram proteins. Among these, 68 kDa, 49 kDa, 33 kDa, 26 kDa, 24 kDa and 21 kDa peptides were seed biotinylated isoform protein (Riascos et al., 2009), putative NADH-ubiquinone oxidoreductase subunit H (Gostinčar et al., 2019), heat shock protein 33 (Hamidian et al., 2015), globulin protein, seed coat / maturation protein (Dhaubhadel et al., 2005), and protein for dimerization. While, 22 kDa proteins belonged to the class of prolamin alpha zein Z1C1_2, Z1C1_4, and Z1C1_8 precursors, and 19kDa peptide was related with Z1A1_2, Z1A2_2, and Z1B_6 precursors (Miclaus et al., 2011). Further, the 91 kDa peptide is sucrose synthase SS1 protein, and 77kDa protein is the NADPH-cytochrome P450 reductase (Wang et al., 2004). Also, the phosphatase-associated two other proteins having 46 and 55 kDa molecular weight were reported earlier in Mucuna pruriens. Hameed et al. (2012) and Malviya et al. (2008) found 55 and 46kDa peptides as 7S vicilin small sub-units and 17kDa as 11S globulins sub-unit in the studied Vigna radiata. Some other molecular weight proteome such as 68 kDa and 49kDa are 7S vicilin, 33kDa is 8S vicilin, 38 and 26kDa 8S globulins, 24kDa 11S globulins, and 22kDa 16.5S globulins. These proteins required for germination and seed establishment of green gram plant (Hameed et al., 2012).The vast accumulation of 23kDa and 22kDa peptides under salt stress by salicylic acid, were reported previously in the mangrove Bruguiera parviffora and Zea mays (El-Khallal et al., 2009). Correspondingly, El-Kafafi et al. (2015) reported the presence of 115kDa, 23kDa, and 22kDa bands in the salt tolerant lines of green gram. These proteomes induced under salt stress may play a pivotal part in the stress acclimation and osmotic adjustment. Similarly, the induction of 104 kDa and 100kDa MW polypeptide by SC stress in the salt tolerant genotypes of green gram indicated the functional role of phytohormones in various metabolic and defense response El-Kafafi et al. (2015); Alharby et al. (2016), El-Khallal et al. (2009), Qados (2010). Ali et al. (2007), Alharby et al. (2016), and El-Kafafi et al. (2015) observed 17kDa, 26kDa, 33kDa and 77kDa bands involving in salt tolerance and can be considered as a positive biochemical marker for salt stress. Further, 26 kDa MW peptide also functions as osmotin under the salt stress that involved in enhancing the accumulation of glycine betaine and proline in the cells. Hence, proteome assay of green gram showed that GAᴣ, IAA, and SA could regulate the expression of salt stress proteins that are anticipated to play a crucial part in the salt tolerance mechanism. Likewise, the involvement of phytohormones in the induction of changes in the proteome profile pattern was attributed to their part in managing cell division by regulating some genes of apical meristems.CONCLUSIONFinally, the results revealed the presence of the ten new bands with MW of 200kDa, 120 kDa, 114.6 kDa, 109.4kDa, 104.5kDa, 99.8kDa, 95.3kDa, 51.8kDa, 29.1kDa and 22.8kDa have not reported previously under salt stress with phytohormones treatments in green gram. Furthermore, it was observed that phytohormones alleviate the negative impact of salt stress on green gram by enhancing synthesis of salt defense polypeptides. Hence, higher accumulation of proteins was observed in salicylic acid treated seedlings. Thus, present work recommended the pre-soaking of phytohormones to overcome the toxic impact of sodium chloride on green gram. Further research is needed on a biomolecular level to reveal the mechanism of signalling pathways under sever salt stress.CONFLICT OF INTERESTBoth authors have declared that no disagreement of interest regarding this research.REFERENCES Alharby, H. F., E. M. Metwali, M. P. Fuller and A. Y. Aldhebiani, 2016. The alteration of mRNA expression of sod and gpx genes, and proteins in tomato (Lycopersicon esculentum Mill) under stress of Nacl and/or ZnO nanoparticles. Saudi journal of biological sciences, 23(6): 773-781.Ali, A., M. Mageed, I. Ahmed and S. Mariey, 2007. Genetic and molecular studies on barley salt tolerance. In: African crop science conference proceedings. pp: 669-682.Chadha, M., 2010. Short duration mungbean: A new success in South Asia. Asia-Pacific association of agricultural research institutions.Dhaubhadel, S., K. Kuflu, M. C. Romero and M. Gijzen, 2005. A soybean seed protein with carboxylate-binding activity. Journal of experimental botany, 56(419): 2335-2344.El-Kafafi, E.-S. H., A. G. Helal, S. F. El Hafnawy and R. Flaah, 2015. Characterization and evaluation of some mungbean genotypes for salt tolerance. World applied science journal, 33(3): 360-370.El-Khallal, S. M., T. A. Hathout, A. Ahsour and A.-A. A. Kerrit, 2009. Brassinolide and salicylic acid induced antioxidant enzymes, hormonal balance and protein profile of maize plants grown under salt stress. Research journal of agriculture biological sciences, 5(4): 391-402.GOP, 2018. Pakistan economic survey from 2017 to 2018. Ministry of Finance. Islamabad. Government of Pakistan. Accessed 18-8-2019, http://www.finance.gov.pk/su rvey/chapters18/02-Agriculture.pdf.Gostinčar, C., M. Turk, J. Zajc and N. Gunde‐Cimerman, 2019. Fifty aureobasidium pullulans genomes reveal a recombining polyextremotolerant generalist. Environmental microbiology, 21(10): 3638-3652.Hameed, A., M. Qureshi, M. Nawaz and N. Iqbal, 2012. Comparative seed storage protein profiling of mung bean genotypes. Pakistan jouranl of botany, 44(6): 1993-1999.Hamidian, M., J. Hawkey, K. E. Holt and R. M. Hall, 2015. Genome sequence of Acinetobacter baumannii strain d36, an antibiotic-resistant isolate from lineage 2 of global clone 1. Genome announced, 3(6): e01478-01415.Hou, D., L. Yousaf, Y. Xue, J. Hu, J. Wu, X. Hu, N. Feng and Q. Shen, 2019. Mung bean (vigna radiata l.): Bioactive polyphenols, polysaccharides, peptides, and health benefits. Nutrients, 11(6): 1238.Itoh, T., R. N. Garcia, M. Adachi, Y. Maruyama, E. M. Tecson-Mendoza, B. Mikami and S. J. A. C. S. D. B. C. Utsumi, 2006. Structure of 8sα globulin, the major seed storage protein of mung bean. Acta crystallographica section D: Biological crystallography, 62(7): 824-832.Khan, F. F., K. Ahmad, A. Ahmed and S. Haider, 2017. Applications of biotechnology in agriculture-review article. World journal of biology biotechnology, 2(1): 139-142.Malviya, N., S. Nayak and D. Yadav, 2008. Characterization of total salt soluble seed storage proteins of grain legumes using sds-page. Bulletin de ressources phytogénétiques(156): 50.Mendoza, E. M. T., M. Adachi, A. E. N. Bernardo and S. Utsumi, 2001. Mungbean [Vigna radiata (L.) wilczek] globulins: Purification and characterization. Journal of agricultural food chemistry, 49(3): 1552-1558.Miclaus, M., J.-H. Xu and J. Messing, 2011. Differential gene expression and epiregulation of alpha zein gene copies in maize haplotypes. PLoS genetics, 7(6).Mushtaq, F., S. A. Jatoi, S. S. Aamir and S. U. Siddiqui, 2018. Genetic variability for morphological attributes and seed protein profiling in chili (Capsicum annuum L.). Pakistan jouranl of botany, 50(4): 1661-1668.Parveen, A.-u.-H. M., J. Akhtar and S. M. Basra, 2016. Interactive effect of salinity and potassium on growth, biochemical parameters, protein and oil quality of soybean genotypes. Pakistan journal of agricultural sciences, 53(01): 69-78.Qados, A., 2010. Effect of arginine on growth, nutrient composition, yield and nutritional value of mung bean plants grown under salinity stress. Nature, 8: 30-42.Riascos, J., W. Burks, L. Pons, A. Weissinger and S. Weissinger, 2009. Identification of a soybean seed biotinylated protein as a novel allergen. Journal of allergy cinical Immunology, 123(2): S24.Wang, S. Y., J. H. Wu, T. Ng, X. Y. Ye and P. F. Rao, 2004. A non-specific lipid transfer protein with antifungal and antibacterial activities from the mung bean. Peptides, 25(8): 1235-1242.Yi-Shen, Z., S. Shuai and R. FitzGerald, 2018. Mung bean proteins and peptides: Nutritional, functional and bioactive properties. Food nutrition research, 62.

Sweet basil (Ocimum basilicum) is an herbaceous aromatic annual plant of the family Lamiaceae grown for its flavoring and fragrances that can be used fresh or dried. In South Africa, sweet basil is grown on a commercial scale. Downy mildew has recently been reported as one of the most destructive diseases of sweet basil in Switzerland, France, and Italy (1–3). The identity of the downy mildew species infecting sweet basil has been controversial and has been indicated as Peronospora lamii, a presumably undescribed (unnamed) Peronospora species, as well as a few species of which the status as distinct species is mostly unclear or doubtful (1). The distinction between P. lamii and the unnamed Peronospora species has been based on their sporangial dimensions, with P. lamii having sporangial dimensions with a length and width range of 16 to 26 × 15 to 23 μm (average 21 × 18 μm) and the unnamed Peronospora species having sporangial dimensions of 20 to 35 × 15 to 25 μm (average 28 × 22 μm) (1) or 23 to 36 × 18 to 29 μm (average 29 × 23 μm) (2). Additionally, internal transcribed spacer (ITS) sequence data has also been used to show that P. lamii and the unnamed Peronospora species on basil are not similar (1). In the Western Cape Province of South Africa, a sweet basil sample was received at the Stellenbosch University Plant Disease Clinic in 2005 from a grower in the region who experienced almost 50% crop failure under greenhouse-grown conditions. Initial symptoms were chlorotic leaves that subsequently developed a brown sporulation on the abaxial side. Microscopic observations of the brown sporulation were consistent with a Peronospora species. The sporangiophores branched two to five times with lengths ranging from 130 to 290 μm (average 194 μm). Sporangiophores terminated with dichotomously branched denticels bearing single detachable sporangia. Sporangia measured 26 to 34 × 20 to 28 μm (average 30 × 24 μm) and were elliptical and brown. The sporangia were similar in shape, color, and size range as that previously reported for a unnamed Peronospora species on sweet basil (1,2). Sequence analyses were also conducted on two isolates by first extracting DNA from spores that were washed from leaves using the Wizard SV genomic DNA purification system (Promega, Madison, WI), followed by polymerase chain reaction (PCR) amplification and sequencing of the ITS1, 5.8S, and ITS2 regions using primers ITS6 and ITS4 (4). The sequences of the two isolates were identical (GenBank Accession No. DQ479408). BLAST analyses of the sequences revealed a 99% similarity to the unnamed Peronospora species that was isolated from sweet basil in Switzerland and Italy (1). The sequences of the South African isolates only had low homology to P. lamii. To our knowledge, this is the first report of a Peronospora species on sweet basil in South Africa that on the basis of morphology and ITS sequence data is similar to the unnamed Peronospora species recently described in Switzerland and Italy on sweet basil (1). References: (1) L. Belbahri et al. Mycol. Res. 109:1276, 2005. (2) A. Garibaldi et al. Plant Dis. 88:312, 2004. (3) A. Garibaldi et al. Plant Dis. 89:683, 2005. (4) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds., Academic Press, San Diego, 1990.

Uncommon, viruslike symptoms (yellowing, line patterns, leaf deformation, and necrosis), were observed in spinach fields in the Marathon area, Greece in 2004. Seedlings from the same seed lot, grown in the greenhouse, also developed the same viruslike symptoms, indicating that the causal agent(s) of the disorder is seed-transmissible. Spinach seedlings of the same variety but a different lot and herbaceous indicators (Chenopodium quinoa, C. amaranticolor, Sonchus oleraceus, and Nicotiana benthamiana) were mechanically inoculated with infected material. Spinach developed yellowing or necrotic spots whereas indicators showed variety of symptoms including mosaic, vein banding, and necrotic lesions. Virus purifications, double-stranded RNA extractions, cloning, and sequencing (2,3) followed by a combination of molecular (reverse transcription [RT]-PCR and immunocapture RT-PCR) and serological (ELISA) techniques with antisera provided by Dr. Avgelis were performed as described (4), verifying the presence of two viruses in the diseased seedlings: Sowbane mosaic virus (SoMV), a sobemovirus, was present in spinach and indicators with mottling and leaf deformation, whereas Olive mild mosaic virus (OMMV), a necrovirus, was present in plants with necrotic spots. All RT-PCR products amplified with primers SoMV-F (5′-CAAATGGTCTTGGTCAGCAGTC)/SoMV-R (5′-GCATACGCTCGACGATCTG) and OMMV-F (5′-CAAACCCAGCCTGTGTTCGATG)/OMMV-R (5′-CATCAGTTTGGTAATCCATTGA) were sequenced and found to confirm the other results. The SoMV-spinach isolate polyprotein gene sequence (GenBank Accession No. DQ450973) has 95% sequence identity with the type isolate from C. quinoa (GenBank Accession No. GQ845002), whereas the OMMV-spinach isolate (GenBank Accession No. JQ288895) has 92% sequence identity with the OMMV type isolate from olive (GenBank Accession No. AY616760). SoMV has been found to naturally infect spinach in the Netherlands (1) and, to our knowledge, this is the first report on spinach in Greece. The presence of OMMV in spinach is, to our knowledge, the first report worldwide. Its natural host range is limited to olive, tulip, and now spinach. OMMV might be transmitted by Olpidium spp. and may, according to data of its close relatives, persist in the soil for several decades. Pollen- and seedborne viruses (PSVs) like sobemoviruses and necroviruses are of particular importance for a crop like spinach where crop increase takes place in small, seed production-designated areas. If a PSV spreads in such an area it has the potential to become a major problem for the industry, especially when it remains undetected. Infected seed can be shipped worldwide with PSVs, causing diseases and becoming endemic in areas where they were absent. For this reason and the fact that field losses can exceed 50%, rigorous monitoring for the presence of SoMV and OMMV in seed fields is essential to minimize the possibility of the viruses moving to new areas. References: (1) L. Bos and N. Huijberts. Eur. J. Plant Pathol. 102:707, 1996. (2) S. M. Girgis et al., Eur. J. Plant Pathol. 125:203, 2009, (3) I. E. Tzanetakis et al. J. Virol. Methods 124:73, 2005. (4) I. E. Tzanetakis et al. Virus Res. 121:199, 2006.

Environments containing significant concentration of NaCl such as salt lakes harbor extremophiles microorganisms which have a great biotechnology interest. To explore the diversity of Bacteria in Chott Tinsilt (Algeria), an isolation program was performed. Water samples were collected from the saltern during the pre-salt harvesting phase. This Chott is high in salt (22.47% (w/v). Seven halophiles Bacteria were selected for further characterization. The isolated strains were able to grow optimally in media with 10–25% (w/v) total salts. Molecular identification of the isolates was performed by sequencing the 16S rRNA gene. It showed that these cultured isolates included members belonging to the Halomonas, Staphylococcus, Salinivibrio, Planococcus and Halobacillus genera with less than 98% of similarity with their closest phylogenetic relative. The halophilic bacterial isolates were also characterized for the production of biosurfactant and industrially important enzymes. Most isolates produced hydrolases and biosurfactants at high salt concentration. In fact, this is the first report on bacterial strains (A4 and B4) which were a good biosurfactant and coagulase producer at 20% and 25% ((w/v)) NaCl. In addition, the biosurfactant produced by the strain B4 at high salinity (25%) was also stable at high temperature (30-100°C) and high alkalinity (pH 11).Key word: Salt Lake, Bacteria, biosurfactant, Chott, halophiles, hydrolases, 16S rRNAINTRODUCTIONSaline lakes cover approximately 10% of the Earth’s surface area. The microbial populations of many hypersaline environments have already been studied in different geographical regions such as Great Salt Lake (USA), Dead Sea (Israel), Wadi Natrun Lake (Egypt), Lake Magadi (Kenya), Soda Lake (Antarctica) and Big Soda Lake and Mono Lake (California). Hypersaline regions differ from each other in terms of geographical location, salt concentration and chemical composition, which determine the nature of inhabitant microorganisms (Gupta et al., 2015). Then low taxonomic diversity is common to all these saline environments (Oren et al., 1993). Halophiles are found in nearly all major microbial clades, including prokaryotic (Bacteria and Archaea) and eukaryotic forms (DasSarma and Arora, 2001). They are classified as slight halophiles when they grow optimally at 0.2–0.85 M (2–5%) NaCl, as moderate halophiles when they grow at 0.85–3.4 M (5–20%) NaCl, and as extreme halophiles when they grow at 3.4–5.1 M (20–30%) NaCl. Hyper saline environments are inhabited by extremely halophilic and halotolerant microorganisms such as Halobacillus sp, Halobacterium sp., Haloarcula sp., Salinibacter ruber , Haloferax sp and Bacillus spp. (Solomon and Viswalingam, 2013). There is a tremendous demand for halophilic bacteria due to their biotechnological importance as sources of halophilic enzymes. Enzymes derived from halophiles are endowed with unique structural features and catalytic power to sustain the metabolic and physiological processes under high salt conditions. Some of these enzymes have been reported to be active and stable under more than one extreme condition (Karan and Khare, 2010). Applications are being considered in a range of industries such as food processing, washing, biosynthetic processes and environmental bioremediation. Halophilic proteases are widely used in the detergent and food industries (DasSarma and Arora, 2001). However, esterases and lipases have also been useful in laundry detergents for the removal of oil stains and are widely used as biocatalysts because of their ability to produce pure compounds. Likewise, amylases are used industrially in the first step of the production of high fructose corn syrup (hydrolysis of corn starch). They are also used in the textile industry in the de-sizing process and added to laundry detergents. Furthermore, for the environmental applications, the use of halophiles for bioremediation and biodegradation of various materials from industrial effluents to soil contaminants and accidental spills are being widely explored. In addition to enzymes, halophilic / halotolerants microorganisms living in saline environments, offer another potential applications in various fields of biotechnology like the production of biosurfactant. Biosurfactants are amphiphilic compounds synthesized from plants and microorganisms. They reduce surface tension and interfacial tension between individual molecules at the surface and interface respectively (Akbari et al., 2018). Comparing to the chemical surfactant, biosurfactant are promising alternative molecules due to their low toxicity, high biodegradability, environmental capability, mild production conditions, lower critical micelle concentration, higher selectivity, availability of resources and ability to function in wide ranges of pH, temperature and salinity (Rocha et al., 1992). They are used in various industries which include pharmaceuticals, petroleum, food, detergents, cosmetics, paints, paper products and water treatment (Akbari et al., 2018). The search for biosurfactants in extremophiles is particularly promising since these biomolecules can adapt and be stable in the harsh environments in which they are to be applied in biotechnology.OBJECTIVESEastern Algeria features numerous ecosystems including hypersaline environments, which are an important source of salt for food. The microbial diversity in Chott Tinsilt, a shallow Salt Lake with more than 200g/L salt concentration and a superficies of 2.154 Ha, has never yet been studied. The purpose of this research was to chemically analyse water samples collected from the Chott, isolate novel extremely or moderate halophilic Bacteria, and examine their phenotypic and phylogenetic characteristics with a view to screening for biosurfactants and enzymes of industrial interest.MATERIALS AND METHODSStudy area: The area is at 5 km of the Commune of Souk-Naâmane and 17 km in the South of the town of Aïn-Melila. This area skirts the trunk road 3 serving Constantine and Batna and the railway Constantine-Biskra. It is part the administrative jurisdiction of the Wilaya of Oum El Bouaghi. The Chott belongs to the wetlands of the High Plains of Constantine with a depth varying rather regularly without never exceeding 0.5 meter. Its length extends on 4 km with a width of 2.5 km (figure 1).Water samples and physico-chemical analysis: In February 2013, water samples were collected from various places at the Chott Tinsilt using Global Positioning System (GPS) coordinates of 35°53’14” N lat. and 06°28’44”E long. Samples were collected randomly in sterile polythene bags and transported immediately to the laboratory for isolation of halophilic microorganisms. All samples were treated within 24 h after collection. Temperature, pH and salinity were measured in situ using a multi-parameter probe (Hanna Instruments, Smithfield, RI, USA). The analytical methods used in this study to measure ions concentration (Ca2+, Mg2+, Fe2+, Na+, K+, Cl−, HCO3−, SO42−) were based on 4500-S-2 F standard methods described elsewhere (Association et al., 1920).Isolation of halophilic bacteria from water sample: The media (M1) used in the present study contain (g/L): 2.0 g of KCl, 100.0/200.0 g of NaCl, 1.0 g of MgSO4.7HO2, 3.0 g of Sodium Citrate, 0.36 g of MnCl2, 10.0 g of yeast extract and 15.0 g agar. The pH was adjusted to 8.0. Different dilutions of water samples were added to the above medium and incubated at 30°C during 2–7 days or more depending on growth. Appearance and growth of halophilic bacteria were monitored regularly. The growth was diluted 10 times and plated on complete medium agar (g/L): glucose 10.0; peptone 5.0; yeast extract 5.0; KH2PO4 5.0; agar 30.0; and NaCl 100.0/200.0. Resultant colonies were purified by repeated streaking on complete media agar. The pure cultures were preserved in 20% glycerol vials and stored at −80°C for long-term preservation.Biochemical characterisation of halophilic bacterial isolates: Bacterial isolates were studied for Gram’s reaction, cell morphology and pigmentation. Enzymatic assays (catalase, oxidase, nitrate reductase and urease), and assays for fermentation of lactose and mannitol were done as described by Smibert (1994).Optimization of growth conditions: Temperature, pH, and salt concentration were optimized for the growth of halophilic bacterial isolates. These growth parameters were studied quantitatively by growing the bacterial isolates in M1 medium with shaking at 200 rpm and measuring the cell density at 600 nm after 8 days of incubation. To study the effect of NaCl on the growth, bacterial isolates were inoculated on M1 medium supplemented with different concentration of NaCl: 1%-35% (w/v). The effect of pH on the growth of halophilic bacterial strains was studied by inoculating isolates on above described growth media containing NaCl and adjusted to acidic pH of 5 and 6 by using 1N HCl and alkaline pH of 8, 9, 10, 11 and 12 using 5N NaOH. The effect of temperature was studied by culturing the bacterial isolates in M1 medium at different temperatures of incubation (4°C–55°C).Screening of halophilic bacteria for hydrolytic enzymes: Hydrolase producing bacteria among the isolates were screened by plate assay on starch, tributyrin, gelatin and DNA agar plates respectively for amylase, lipase, protease and DNAse activities. Amylolytic activity of the cultures was screened on starch nutrient agar plates containing g/L: starch 10.0; peptone 5.0; yeast extract 3.0; agar 30.0; NaCl 100.0/250.0. The pH was 7.0. After incubation at 30 ºC for 7 days, the zone of clearance was determined by flooding the plates with iodine solution. The potential amylase producers were selected based on ratio of zone of clearance diameter to colony diameter. Lipase activity of the cultures was screened on tributyrin nutrient agar plates containing 1% (v/v) of tributyrin. Isolates that showed clear zones of tributyrin hydrolysis were identified as lipase producing bacteria. Proteolytic activity of the isolates was similarly screened on gelatin nutrient agar plates containing 10.0 g/L of gelatin. The isolates showing zones of gelatin clearance upon treatment with acidic mercuric chloride were selected and designated as protease producing bacteria. The presence of DNAse activity on plates was determined on DNAse test agar (BBL) containing 10%-25% (w/v) total salt. After incubation for 7days, the plates were flooded with 1N HCl solution. Clear halos around the colonies indicated DNAse activity (Jeffries et al., 1957).Milk clotting activity (coagulase activity) of the isolates was also determined following the procedure described (Berridge, 1952). Skim milk powder was reconstituted in 10 mM aqueous CaCl2 (pH 6.5) to a final concentration of 0.12 kg/L. Enzyme extracts were added at a rate of 0.1 mL per mL of milk. The coagulation point was determined by manual rotating of the test tube periodically, at short time intervals, and checking for visible clot formation.Screening of halophilic bacteria for biosurfactant production. Oil spread Assay: The Petridis base was filled with 50 mL of distilled water. On the water surface, 20μL of diesel and 10μl of culture were added respectively. The culture was introduced at different spots on the diesel, which is coated on the water surface. The occurrence of a clear zone was an indicator of positive result (Morikawa et al., 2000). The diameter of the oil expelling circles was measured by slide caliber (with a degree of accuracy of 0.02 mm).Surface tension and emulsification index (E24): Isolates were cultivated at 30 °C for 7 days on the enrichment medium containing 10-25% NaCl and diesel oil as the sole carbon source. The medium was centrifuged (7000 rpm for 20 min) and the surface tension of the cell-free culture broth was measured with a TS90000 surface tensiometer (Nima, Coventry, England) as a qualitative indicator of biosurfactant production. The culture broth was collected with a Pasteur pipette to remove the non-emulsified hydrocarbons. The emulsifying capacity was evaluated by an emulsification index (E24). The E24 of culture samples was determined by adding 2 mL of diesel oil to the same amount of culture, mixed for 2 min with a vortex, and allowed to stand for 24 h. E24 index is defined as the percentage of height of emulsified layer (mm) divided by the total height of the liquid column (mm).Biosurfactant stability studies : After growth on diesel oil as sole source of carbone, cultures supernatant obtained after centrifugation at 6,000 rpm for 15 min were considered as the source of crude biosurfactant. Its stability was determined by subjecting the culture supernatant to various temperature ranges (30, 40, 50, 60, 70, 80 and 100 °C) for 30 min then cooled to room temperature. Similarly, the effect of different pH (2–11) on the activity of the biosurfactant was tested. The activity of the biosurfactant was investigated by measuring the emulsification index (El-Sersy, 2012).Molecular identification of potential strains. DNA extraction and PCR amplification of 16S rDNA: Total cellular DNA was extracted from strains and purified as described by Sambrook et al. (1989). DNA was purified using Geneclean® Turbo (Q-BIO gene, Carlsbad, CA, USA) before use as a template in polymerase chain reaction (PCR) amplification. For the 16S rDNA gene sequence, the purified DNA was amplified using a universal primer set, forward primer (27f; 5′-AGA GTT TGA TCM TGG CTC AG) and a reverse primer (1492r; 5′-TAC GGY TAC CTT GTT ACG ACT T) (Lane, 1991). Agarose gel electrophoresis confirmed the amplification product as a 1400-bp DNA fragment.16S rDNA sequencing and Phylogenic analysis: Amplicons generated using primer pair 27f-1492r was sequenced using an automatic sequencer system at Macrogene Company (Seoul, Korea). The sequences were compared with those of the NCBI BLAST GenBank nucleotide sequence databases. Phylogenetic trees were constructed by the neighbor-joining method using MEGA version 5.05 software (Tamura et al., 2011). Bootstrap resembling analysis for 1,000 replicates was performed to estimate the confidence of tree topologies.Nucleotide sequence accession numbers: The nucleotide sequences reported in this work have been deposited in the EMBL Nucleotide Sequence Database. The accession numbers are represented in table 5.Statistics: All experiments were conducted in triplicates. Results were evaluated for statistical significance using ANOVA.RESULTSPhysico-chemical parameters of the collected water samples: The physicochemical properties of the collected water samples are reported in table 1. At the time of sampling, the temperature was 10.6°C and pH 7.89. The salinity of the sample, as determined in situ, was 224.70 g/L (22,47% (w/v)). Chemical analysis of water sample indicated that Na +and Cl- were the most abundant ions (table 1). SO4-2 and Mg+2 was present in much smaller amounts compared to Na +and Cl- concentration. Low levels of calcium, potassium and bicarbonate were also detected, often at less than 1 g/L.Characterization of isolates. Morphological and biochemical characteristic feature of halophilic bacterial isolates: Among 52 strains isolated from water of Chott Tinsilt, seven distinct bacteria (A1, A2, A3, A4, B1, B4 and B5) were chosen for further characterization (table 2). The colour of the isolates varied from beige, pale yellow, yellowish and orange. The bacterial isolates A1, A2, A4, B1 and B5 were rod shaped and gram negative (except B5), whereas A3 and B4 were cocci and gram positive. All strains were oxidase and catalase positive except for B1. Nitrate reductase and urease activities were observed in all the bacterial isolates, except B4. All the bacterial isolates were negative for H2S formation. B5 was the only strain positive for mannitol fermentation (table 2).We isolated halophilic bacteria on growth medium with NaCl supplementation at pH 7 and temperature of 30°C. We studied the effect of NaCl, temperature and pH on the growth of bacterial isolates. All the isolates exhibited growth only in the presence of NaCl indicating that these strains are halophilic. The optimum growth of isolates A3 and B1 was observed in the presence of 10% NaCl, whereas it was 15% NaCl for A1, A2 and B5. A4 and B4 showed optimum growth in the presence of 20% and 25% NaCl respectively. A4, B4 and B5 strains can tolerate up to 35% NaCl.The isolate B1 showed growth in medium supplemented with 10% NaCl and pH range of 7–10. The optimum pH for the growth B1 was 9 and they did not show any detectable growth at or below pH 6 (table 2), which indicates the alkaliphilic nature of B1 isolate. The bacterial isolates A1, A2 and A4 exhibited growth in the range of pH 6–10, while A3 and B4 did not show any growth at pH greater than 8. The optimum pH for growth of all strains (except B1) was pH 7.0 (table 2). These results indicate that A1, A2, A3, A4, B4 and B5 are neutrophilic in nature. All the bacterial isolates exhibited optimal growth at 30°C and no detectable growth at 55°C. Also, detectable growth of isolates A1, A2 and A4 was observed at 4°C. However, none of the bacterial strains could grow below 4°C and above 50°C (table 2).Screening of the halophilic enzymes: To characterize the diversity of halophiles able to produce hydrolytic enzymes among the population of microorganisms inhabiting the hypersaline habitats of East Algeria (Chott Tinsilt), a screening was performed. As described in Materials and Methods, samples were plated on solid media containing 10%-25% (w/v) of total salts and different substrates for the detection of amylase, protease, lipase and DNAse activities. However, coagulase activity was determined in liquid medium using milk as substrate (figure 3). Distributions of hydrolytic activity among the isolates are summarized in table 4.From the seven bacterial isolates, four strains A1, A2, A4 and B5 showed combined hydrolytic activities. They were positive for gelatinase, lipase and coagulase. A3 strain showed gelatinase and lipase activities. DNAse activities were detected with A1, A4, B1 and B5 isolates. B4 presented lipase and coagulase activity. Surprisingly, no amylase activity was detected among all the isolates.Screening for biosurfactant producing isolates: Oil spread assay: The results showed that all the strains could produce notable (>4 cm diameter) oil expelling circles (ranging from 4.11 cm to 4.67 cm). The average diameter for strain B5 was 4.67 cm, significantly (P < 0.05) higher than for the other strains.Surface tension and emulsification index (E24): The assimilation of hydrocarbons as the sole sources of carbon by the isolate strains led to the production of biosurfactants indicated by the emulsification index and the lowering of the surface tension of cell-free supernatant. Based on rapid growth on media containing diesel oil as sole carbon source, the seven isolates were tested for biosurfactant production and emulsification activity. The obtained values of the surface tension measurements as well as the emulsification index (E24) are shown in table 3. The highest reduction of surface tension was achieved with B5 and A3 isolates with values of 25.3 mN m−1 and 28.1 mN m−1 respectively. The emulsifying capacity evaluated by the E24 emulsification index was highest in the culture of isolate B4 (78%), B5 (77%) and A3 (76%) as shown in table 3 and figure 2. These emulsions were stable even after 4 months. The bacteria with emulsification indices higher than 50 % and/or reduction in the surface tension (under 30 mN/m) have been defined as potential biosurfactant producers. Based on surface tension and the E24 index results, isolates B5, B4, A3 and A4 are the best candidates for biosurfactant production. It is important to note that, strains B4 and A4 produce biosurfactant in medium containing respectively 25% and 20% (w/v) NaCl.Stability of biosurfactant activities: The applicability of biosurfactants in several biotechnological fields depends on their stability at different environmental conditions (temperatures, pH and NaCl). For this study, the strain B4 appear very interesting (It can produce biosurfactant at 25 % NaCl) and was choosen for futher analysis for biosurfactant stability. The effects of temperature and pH on the biosurfactant production by the strain B4 are shown in figure 4.biosurfactant in medium containing respectively 25% and 20% (w/v) NaCl.Stability of biosurfactant activities: The applicability of biosurfactants in several biotechnological fields depends on their stability at different environmental conditions (temperatures, pH and NaCl). For this study, the strain B4 appear very interesting (It can produce biosurfactant at 25 % NaCl) and was chosen for further analysis for biosurfactant stability. The effects of temperature and pH on the biosurfactant production by the strain B4 are shown in figure 4. The biosurfactant produced by this strain was shown to be thermostable giving an E-24 Index value greater than 78% (figure 4A). Heating of the biosurfactant to 100 °C caused no significant effect on the biosurfactant performance. Therefore, the surface activity of the crude biosurfactant supernatant remained relatively stable to pH changes between pH 6 and 11. At pH 11, the value of E24 showed almost 76% activity, whereas below pH 6 the activity was decreased up to 40% (figure 4A). The decreases of the emulsification activity by decreasing the pH value from basic to an acidic region; may be due to partial precipitation of the biosurfactant. This result indicated that biosurfactant produced by strain B4 show higher stability at alkaline than in acidic conditions.Molecular identification and phylogenies of potential isolates: To identify halophilic bacterial isolates, the 16S rDNA gene was amplified using gene-specific primers. A PCR product of ≈ 1.3 kb was detected in all the seven isolates. The 16S rDNA amplicons of each bacterial isolate was sequenced on both strands using 27F and 1492R primers. The complete nucleotide sequence of 1336,1374, 1377,1313, 1305,1308 and 1273 bp sequences were obtained from A1, A2, A3, A4, B1, B4 and B5 isolates respectively, and subjected to BLAST analysis. The 16S rDNA sequence analysis showed that the isolated strains belong to the genera Halomonas, Staphylococcus, Salinivibrio, Planococcus and Halobacillus as shown in table 5. The halophilic isolates A2 and A4 showed 97% similarity with the Halomonas variabilis strain GSP3 (accession no. AY505527) and the Halomonas sp. M59 (accession no. AM229319), respectively. As for A1, it showed 96% similarity with the Halomonas venusta strain GSP24 (accession no. AY553074). B1 and B4 showed for their part 96% similarity with the Salinivibrio costicola subsp. alcaliphilus strain 18AG DSM4743 (accession no. NR_042255) and the Planococcus citreus (accession no. JX122551), respectively. The bacterial isolate B5 showed 98% sequence similarity with the Halobacillus trueperi (accession no. HG931926), As for A3, it showed only 95% similarity with the Staphylococcus arlettae (accession no. KR047785). The 16S rDNA nucleotide sequences of all the seven halophilic bacterial strains have been submitted to the NCBI GenBank database under the accession number presented in table 5. The phylogenetic association of the isolates is shown in figure 5.DICUSSIONThe physicochemical properties of the collected water samples indicated that this water was relatively neutral (pH 7.89) similar to the Dead Sea and the Great Salt Lake (USA) and in contrast to the more basic lakes such as Lake Wadi Natrun (Egypt) (pH 11) and El Golea Salt Lake (Algeria) (pH 9). The salinity of the sample was 224.70 g/L (22,47% (w/v). This range of salinity (20-30%) for Chott Tinsilt is comparable to a number of well characterized hypersaline ecosystems including both natural and man-made habitats, such as the Great Salt Lake (USA) and solar salterns of Puerto Rico. Thus, Chott Tinsilt is a hypersaline environment, i.e. environments with salt concentrations well above that of seawater. Chemical analysis of water sample indicated that Na +and Cl- were the most abundant ions, as in most hypersaline ecosystems (with some exceptions such as the Dead Sea). These chemical water characteristics were consistent with the previously reported data in other hypersaline ecosystems (DasSarma and Arora, 2001; Oren, 2002; Hacěne et al., 2004). Among 52 strains isolated from this Chott, seven distinct bacteria (A1, A2, A3, A4, B1, B4 and B5) were chosen for phenotypique, genotypique and phylogenetique characterization.The 16S rDNA sequence analysis showed that the isolated strains belong to the genera Halomonas, Staphylococcus, Salinivibrio, Planococcus and Halobacillus. Genera obtained in the present study are commonly occurring in various saline habitats across the globe. Staphylococci have the ability to grow in a wide range of salt concentrations (Graham and Wilkinson, 1992; Morikawa et al., 2009; Roohi et al., 2014). For example, in Pakistan, Staphylococcus strains were isolated from various salt samples during the study conducted by Roohi et al. (2014) and these results agreed with previous reports. Halomonas, halophilic and/or halotolerant Gram-negative bacteria are typically found in saline environments (Kim et al., 2013). The presence of Planococcus and Halobacillus has been reported in studies about hypersaline lakes; like La Sal del Rey (USA) (Phillips et al., 2012) and Great Salt Lake (Spring et al., 1996), respectively. The Salinivibrio costicola was a representative model for studies on osmoregulatory and other physiological mechanisms of moderately halophilic bacteria (Oren, 2006).However, it is interesting to note that all strains shared less than 98.7% identity (the usual species cut-off proposed by Yarza et al. (2014) with their closest phylogenetic relative, suggesting that they could be considered as new species. Phenotypic, genetic and phylogenetic analyses have been suggested for the complete identification of these strains. Theses bacterial strains were tested for the production of industrially important enzymes (Amylase, protease, lipase, DNAse and coagulase). These isolates are good candidates as sources of novel enzymes with biotechnological potential as they can be used in different industrial processes at high salt concentration (up to 25% NaCl for B4). Prominent amylase, lipase, protease and DNAase activities have been reported from different hypersaline environments across the globe; e.g., Spain (Sánchez‐Porro et al., 2003), Iran (Rohban et al., 2009), Tunisia (Baati et al., 2010) and India (Gupta et al., 2016). However, to the best of our knowledge, the coagulase activity has never been detected in extreme halophilic bacteria. Isolation and characterization of crude enzymes (especially coagulase) to investigate their properties and stability are in progress.The finding of novel enzymes with optimal activities at various ranges of salt concentrations is of great importance. Besides being intrinsically stable and active at high salt concentrations, halophilic and halotolerant enzymes offer great opportunities in biotechnological applications, such as environmental bioremediation (marine, oilfiel) and food processing. The bacterial isolates were also characterized for production of biosurfactants by oil-spread assay, measurement of surface tension and emulsification index (E24). There are few reports on biosurfactant producers in hypersaline environments and in recent years, there has been a greater increase in interest and importance in halophilic bacteria for biomolecules (Donio et al., 2013; Sarafin et al., 2014). Halophiles, which have a unique lipid composition, may have an important role to play as surface-active agents. The archae bacterial ether-linked phytanyl membrane lipid of the extremely halophilic bacteria has been shown to have surfactant properties (Post and Collins, 1982). Yakimov et al. (1995) reported the production of biosurfactant by a halotolerant Bacillus licheniformis strain BAS 50 which was able to produce a lipopeptide surfactant when cultured at salinities up to 13% NaCl. From solar salt, Halomonas sp. BS4 and Kocuria marina BS-15 were found to be able to produce biosurfactant when cultured at salinities of 8% and 10% NaCl respectively (Donio et al., 2013; Sarafin et al., 2014). In the present work, strains B4 and A4 produce biosurfactant in medium containing respectively 25% and 20% NaCl. To our knowledge, this is the first report on biosurfactant production by bacteria under such salt concentration. Biosurfactants have a wide variety of industrial and environmental applications (Akbari et al., 2018) but their applicability depends on their stability at different environmental conditions. The strain B4 which can produce biosurfactant at 25% NaCl showed good stability in alkaline pH and at a temperature range of 30°C-100°C. Due to the enormous utilization of biosurfactant in detergent manufacture the choice of alkaline biosurfactant is researched (Elazzazy et al., 2015). On the other hand, the interesting finding was the thermostability of the produced biosurfactant even after heat treatment (100°C for 30 min) which suggests the use of this biosurfactant in industries where heating is of a paramount importance (Khopade et al., 2012). To date, more attention has been focused on biosurfactant producing bacteria under extreme conditions for industrial and commercial usefulness. In fact, the biosurfactant produce by strain B4 have promising usefulness in pharmaceutical, cosmetics and food industries and for bioremediation in marine environment and Microbial enhanced oil recovery (MEOR) where the salinity, temperature and pH are high.CONCLUSIONThis is the first study on the culturable halophilic bacteria community inhabiting Chott Tinsilt in Eastern Algeria. Different genera of halotolerant bacteria with different phylogeneticaly characteristics have been isolated from this Chott. Culturing of bacteria and their molecular analysis provides an opportunity to have a wide range of cultured microorganisms from extreme habitats like hypersaline environments. Enzymes produced by halophilic bacteria show interesting properties like their ability to remain functional in extreme conditions, such as high temperatures, wide range of pH, and high salt concentrations. These enzymes have great economical potential in industrial, agricultural, chemical, pharmaceutical, and biotechnological applications. Thus, the halophiles isolated from Chott Tinsilt offer an important potential for application in microbial and enzyme biotechnology. In addition, these halo bacterial biosurfactants producers isolated from this Chott will help to develop more valuable eco-friendly products to the pharmacological and food industries and will be usefulness for bioremediation in marine environment and petroleum industry.ACKNOWLEDGMENTSOur thanks to Professor Abdelhamid Zoubir for proofreading the English composition of the present paper.CONFLICT OF INTERESTThe authors declare that they have no conflict of interest.Akbari, S., N. H. Abdurahman, R. M. Yunus, F. Fayaz and O. R. Alara, 2018. Biosurfactants—a new frontier for social and environmental safety: A mini review. Biotechnology research innovation, 2(1): 81-90.Association, A. P. H., A. W. W. Association, W. P. C. Federation and W. E. Federation, 1920. Standard methods for the examination of water and wastewater. American Public Health Association.Baati, H., R. Amdouni, N. Gharsallah, A. Sghir and E. Ammar, 2010. Isolation and characterization of moderately halophilic bacteria from tunisian solar saltern. Current microbiology, 60(3): 157-161.Berridge, N., 1952. Some observations on the determination of the activity of rennet. Analyst, 77(911): 57b-62.DasSarma, S. and P. Arora, 2001. Halophiles. Encyclopedia of life sciences. Nature publishishing group: 1-9.Donio, M. B. S., F. A. Ronica, V. T. Viji, S. Velmurugan, J. S. C. A. Jenifer, M. Michaelbabu, P. Dhar and T. Citarasu, 2013. Halomonas sp. Bs4, a biosurfactant producing halophilic bacterium isolated from solar salt works in India and their biomedical importance. SpringerPlus, 2(1): 149.El-Sersy, N. A., 2012. Plackett-burman design to optimize biosurfactant production by marine Bacillus subtilis n10. Roman biotechnol lett, 17(2): 7049-7064.Elazzazy, A. M., T. Abdelmoneim and O. Almaghrabi, 2015. Isolation and characterization of biosurfactant production under extreme environmental conditions by alkali-halo-thermophilic bacteria from Saudi Arabia. Saudi journal of biological Sciences, 22(4): 466-475.Graham, J. E. and B. Wilkinson, 1992. Staphylococcus aureus osmoregulation: Roles for choline, glycine betaine, proline, and taurine. Journal of bacteriology, 174(8): 2711-2716.Gupta, S., P. Sharma, K. Dev and A. Sourirajan, 2016. Halophilic bacteria of lunsu produce an array of industrially important enzymes with salt tolerant activity. Biochemistry research international, 1: 1-10.Gupta, S., P. Sharma, K. Dev, M. Srivastava and A. Sourirajan, 2015. A diverse group of halophilic bacteria exist in lunsu, a natural salt water body of Himachal Pradesh, India. SpringerPlus 4(1): 274.Hacěne, H., F. Rafa, N. Chebhouni, S. Boutaiba, T. Bhatnagar, J. C. Baratti and B. Ollivier, 2004. Biodiversity of prokaryotic microflora in el golea salt lake, Algerian Sahara. Journal of arid environments, 58(3): 273-284.Jeffries, C. D., D. F. Holtman and D. G. Guse, 1957. Rapid method for determining the activity of microorgan-isms on nucleic acids. Journal of bacteriology, 73(4): 590.Karan, R. and S. Khare, 2010. Purification and characterization of a solvent‐stable protease from Geomicrobium sp. Emb2. Environmental technology, 31(10): 1061-1072.Khopade, A., R. Biao, X. Liu, K. Mahadik, L. Zhang and C. Kokare, 2012. Production and stability studies of the biosurfactant isolated from marine Nocardiopsis sp. B4. Desalination, 3: 198-204.Kim, K. K., J.-S. Lee and D. A. Stevens, 2013. Microbiology and epidemiology of Halomonas species. Future microbiology, 8(12): 1559-1573.Lane, D., 1991. 16s/23s rRNA sequencing in nucleic acid techniques in bacterial systematics. Stackebrandt e., editor;, and goodfellow m., editor. Chichester, UK: John Wiley & Sons.Morikawa, K., R. L. Ohniwa, T. Ohta, Y. Tanaka, K. Takeyasu and T. Msadek, 2009. Adaptation beyond the stress response: Cell structure dynamics and population heterogeneity in Staphylococcus aureus. Microbes environments, 25: 75-82.Morikawa, M., Y. Hirata and T. J. B. e. B. A.-M. Imanaka, 2000. A study on the structure–function relationship of lipopeptide biosurfactants. Biochimica et biophysica acta, 1488(3): 211-218.Oren, A., 2002. Diversity of halophilic microorganisms: Environments, phylogeny, physiology, and applications. Journal of industrial microbiology biotechnology, 28(1): 56-63.Oren, A., 2006. Halophilic microorganisms and their environments. Springer science & business media.Oren, A., R. Vreeland and L. Hochstein, 1993. Ecology of extremely halophilic microorganisms. The biology of halophilic bacteria, 2(1): 1-8.Phillips, K., F. Zaidan, O. R. Elizondo and K. L. Lowe, 2012. Phenotypic characterization and 16s rDNA identification of culturable non-obligate halophilic bacterial communities from a hypersaline lake, la sal del rey, in extreme south texas (USA). Aquatic biosystems, 8(1): 1-5.Post, F. and N. Collins, 1982. A preliminary investigation of the membrane lipid of Halobacterium halobium as a food additive 1. Journal of food biochemistry, 6(1): 25-38.Rocha, C., F. San-Blas, G. San-Blas and L. Vierma, 1992. Biosurfactant production by two isolates of Pseudomonas aeruginosa. World Journal of microbiology biotechnology, 8(2): 125-128.Rohban, R., M. A. Amoozegar and A. Ventosa, 2009. Screening and isolation of halophilic bacteria producing extracellular hydrolyses from howz soltan lake, Iran. Journal of industrial microbiology biotechnology, 36(3): 333-340.Roohi, A., I. Ahmed, N. Khalid, M. Iqbal and M. Jamil, 2014. Isolation and phylogenetic identification of halotolerant/halophilic bacteria from the salt mines of Karak, Pakistan. International journal of agricultural and biology, 16: 564-570.Sambrook, J., E. F. Fritsch and T. Maniatis, 1989. Molecular cloning: A laboratory manual, 2nd edn. Cold spring harbor laboratory, cold spring harbor, New York.Sánchez‐Porro, C., S. Martin, E. Mellado and A. Ventosa, 2003. Diversity of moderately halophilic bacteria producing extracellular hydrolytic enzymes. Journal of applied microbiology, 94(2): 295-300.Sarafin, Y., M. B. S. Donio, S. Velmurugan, M. Michaelbabu and T. Citarasu, 2014. Kocuria marina bs-15 a biosurfactant producing halophilic bacteria isolated from solar salt works in India. Saudi journal of biological sciences, 21(6): 511-519.Smibert, R., 1994. Phenotypic characterization. In methods for general and molecular bacteriology. American society for microbiology: 611-651.Solomon, E. and K. J. I. Viswalingam, 2013. Isolation, characterization of halotolerant bacteria and its biotechnological potentials. International journal scientific research paper publication sites, 4: 1-7.Spring, S., W. Ludwig, M. Marquez, A. Ventosa and K.-H. Schleifer, 1996. Halobacillus gen. Nov., with descriptions of Halobacillus litoralis sp. Nov. and Halobacillus trueperi sp. Nov., and transfer of Sporosarcina halophila to Halobacillus halophilus comb. Nov. International journal of systematic evolutionary microbiology, 46(2): 492-496.Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei and S. Kumar, 2011. Mega5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular biology evolution, 28(10): 2731-2739.Yakimov, M. M., K. N. Timmis, V. Wray and H. L. Fredrickson, 1995. Characterization of a new lipopeptide surfactant produced by thermotolerant and halotolerant subsurface Bacillus licheniformis bas50. Applied and environmental microbiology, 61(5): 1706-1713.Yarza, P., P. Yilmaz, E. Pruesse, F. O. Glöckner, W. Ludwig, K.-H. Schleifer, W. B. Whitman, J. Euzéby, R. Amann and R. Rosselló-Móra, 2014. Uniting the classification of cultured and uncultured bacteria and archaea using 16s rRNA gene sequences. Nature reviews microbiology, 12(9): 635-645

Molecular imprinting is a well established technology that mimics biological recognition systems using artificial materials. This involves synthesizing a nanostructured polymeric host in the presence of a target molecule to generate complementary binding sites that are selective for a molecule of interest. The technique offers a platform for developing simple and inexpensive systems with a vast array of applications such as; chromatography, separation, catalysts purification, solid phase extraction, biosensors, medical diagnostics and drug delivery. Elevated levels of some proteins in the blood can lead to a number of medical conditions. Incorporating these polymers into a device for blood purification to remove such molecules can be used as a means to combat these problems. Protein imprinting was studied from a novel perspective using protein coated micro crystals (PCMCs). PCMCs are nanostructured particles made via a rapid 1-step process developed by Moore et al. (2001). The use of a novel PCMCs strategy in molecular imprinting has allowed the retention of selected protein native conformation in organic media and the creation of access pores lined with nanocavities which facilitate protein extraction and re-introduction into the imprinted polymer. This technique has enabled us to overcome many of the challenges faced when using conventional imprinting methodology, such as protein insolubility in aprotic solvents, protein insolubility in aprotic solvents, protein denaturation and aggregation as a result of polymerization conditions and the permanent entrapment of the protein template in the cross linked polymer network.

Garlic (Allium sativum L.) is an economically important spice and vegetable crop grown throughout the world. Garlic viral disease complex caused by multiple virus infections is an important constraint in exploiting the potential yield of garlic. Among these viral pathogens, allexivirus (family Alphaflexiviridae) is the genus of viruses known for their degenerative effect on garlic yield. Their coexistence with other viruses, particularly potyviruses, has an adverse effect on garlic yield and quality (Perotto et al. 2010). During Sept 2018, while screening garlic germplasm accessions for the presence of allexiviruses, symptoms like foliar mosaic and curling were observed on accession G-204, planted at an experimental plot of ICAR-DOGR, Pune, India. A total of five samples comprised of five randomly selected G-204 garlic plants were collected from the experimental plot. Each sample contained leaves from the top, middle, and bottom portion of the individual garlic plants. These samples were subjected to RNA extraction using the RNeasy Plant Mini Kit (Qiagen, Germany) followed by reverse transcription (RT) using the Transcriptor cDNA synthesis kit (Roche Diagnostics, GmbH, Germany). The extracted RNA was then tested for allexiviruses such as garlic virus A (GarV-A), garlic virus B (GarV-B), garlic virus C (GarV-C), garlic virus D (GarV-D), and garlic virus X (GarV-X) by polymerase chain reaction (PCR) (Gawande et al. 2015; Roylawar et al. 2019; Baranwal et al. 2011; Gieck et al. 2009). Leaf samples tested through RT-PCR were found positive for garlic viruses GarV-A, GarV-B, GarV-C, GarV-D, and GarV-X. Allexiviruses other than GarV-B had been previously reported in India and hence further tests were conducted to confirm GarV-B infection. RT-PCR using primers, CF 5’- ATGGGAGACAGGTCGCAA-3’ and CR5’- CTAAAATGTAAGCATGAGCGGT-3’ designed specific to the coat protein yielded a 735-bp amplicon from all five G-204 plants. The amplified product was purified using QIAquick PCR Purification Kit (Qiagen, Germany) and cloned in pJET1.2 vector (Thermo Scientific, Lithuania). Two clones containing the CP gene were bidirectionally sequenced, and a consensus sequence was submitted to GenBank (MN650206). BLASTn results indicated that this consensus sequence showed 97.96% nucleotide (KP657919.1) and 100% amino acid sequence (AKN19940.1) identity with the CP sequence of GarV-B isolate from Poland. The presence of GarV-B was confirmed by enzyme-linked immunosorbent assay (ELISA) using a double-antibody sandwich ELISA kit (Arsh Biotech, Delhi, India) as per the manufacturer’s protocol. An absorbance of reaction was read using a microplate reader at 405 nm. The mean OD values of negative and positive controls were 0.034 and 0.373, respectively. The OD values of five samples tested ranged from 0.210 to 0.296 indicating a positive reaction for GarV-B. To assess the presence of GarV-B in the available genetic stock, we tested 30 garlic germplasm accessions for GarV-B using RT-PCR. Out of these, 17 accessions were found positive for GarV-B. GarV-B has been reported from many countries (Gieck et al. 2009). This is the first report of GarV-B from India. Globally, allexiviruses are known for their adverse impact on garlic production (Oliveira et al. 2014). GarV-B together with other viruses can be a potential threat to garlic production in India. Further, detailed evaluations are needed to study the impact of GarV-B on garlic production in India.

Aloe vera (L.) Burm. f. is a tropical evergreen perennial in the family Liliaceae. Native to the Arabian Peninsula, it is sold in Pennsylvania as an ornamental and for its medical and topical purposes due to its high levels of amino acids, anthraquinones, saponins, and vitamins A, B, C, E (Sahu et al. 2013). In February 2020, at an ornamental plant nursery in Lancaster County, Pennsylvania, 5 out of 15 mature A. vera plants in 15 cm pots showed symptoms and signs of rust on the leaves, exhibiting dark-brown erumpent pycnial spots with a chlorotic band surrounding the infected tissue that turned necrotic after three days of incubation at 20°C. Only the telial stage was present. Sori (n=25) were rounded, concentrically arranged, 0.2-3.7 mm, and covered by a brown epidermis. Teliospores (n=40) were amphigenous, orange-brown, globose to ellipsoidal, measuring (29.2) 30.4-36.1 (39.5) × (27.4) 27.6-30.1 (30.5) µm, with a wall thickness of 4-5 µm, and a persistent hyaline pedicel ranging from 5 to 57.1 µm in length and 5.2 to 9.3 µm in width. These measurements were comparable to the descriptions of Uromyces aloes previously reported from India (teliospore size 25-42.5 x 20-30 µm, wall thickness 3-5 µm, and pedicel size 25-95 x 5-6.25 µm), and South Africa (teliospore size 30-44 x 24-32 µm, wall thickness 4-6 µm, and pedicel size 6-20 µm) (Maier et al. 2007; Soni et al. 2011). Based on these morphological traits and the plant host, the causal agent was identified as Uromyces aloes (Cooke) Magnus (Pucciniaceae, Uredinales). The sample was also independently identified as U. aloes by the USDA APHIS PPQ Beltsville lab (Interception # APEMD200552555001) based on morphological characteristics. Teliospores were harvested with a sterile pin, transferred to a 1.5 ml tube with DNA extraction buffer (100 mM Tris-HCL, 10 mM EDTA, 1 M KCl, pH 8) and macerated using a plastic mini-pestle. The DNA was precipitated using isopropanol, washed with 70% ethanol, and reconstituted in 50 µl of PCR-grade water. The segment of the internal transcribed spacer region (ITS) was amplified using ITS4/ITS5 primers (White et al. 1990). The nuclear ribosomal small subunit (18S) was amplified with rust specific primers Rust18S-R (Aime 2006) and NS1 (White et al. 1990). The nuclear ribosomal large subunit (28S) was amplified with primers LR0R and LR7 (Vilgalys et al. 1990). Amplified PCR products were cleaned using ExoSap (Affymetrix, Santa Clara, CA) or QIAquick PCR Purification Kit (Qiagen, Valencia, CA) and sequenced at Penn State Genomics Core Facility. The nucleotide sequences were trimmed, analyzed, and aligned using Geneious 11.1.5 software (Biomatters, Auckland, NZ). The resulting 692-bp segment of the ITS, 1,633-bp segment of the 18S, and the 1,324-bp segment of the 28S regions were deposited in the GenBank database under accession numbers MT136509, MZ146345, and MZ146342, respectively. Based on GenBank BLAST analysis, a 529-bp fragment of our 28S product was found to share 98.87% (523/529) identity with U. aloes isolate WM3290 (DQ917740) from South Africa, with three nucleotide differences and three gaps between the two strains. Comparisons among ITS and 18S sequences could not be made because no ITS or 18S sequence data from U. aloes has previously been deposited in GenBank. To our knowledge, this is the first report of U. aloes from A. vera in the United States. Infected plants were confined inside a greenhouse and have been destroyed. Since the plants were purchased from either Ontario, Canada or Florida, the extent of infection in the United States is unknown.

Direct PCR allows the amplification of DNA from animal or plant tissue samples without the need for DNA extraction and purification steps. For this procedure, dry tissue is homogenized, dissolved in water and subsequently amplified, thus, its successful application largely depends on the absence of PCR inhibitors. Although this method has been successfully applied in barcoding approaches of invertebrates, it has not yet been attempted in metabarcoding approaches. We used nonbiting midges (Diptera: Chironomidae) to test if amplicons produced by direct PCR could be used for next-generation sequencing. To access whether direct PCR is applicable for a variety of chironomid species, we tested 236 adult specimens randomly selected from emergence traps of an artificial pond mesocosm. We used ground tissue, corresponding to 0.1% of the specimens’ biomass, and a direct PCR protocol following Wong et al. (2014) for amplification. In total, 98 % of the samples were successfully amplified and we found a diverse community comprised of 20 different genera. In order to compare direct PCR and ´traditional´ DNA isolation-PCR, we created mock communities (14 species) and used both approaches for the amplification of a 421 bp COI fragment. After a second PCR for indexing and adapter ligation, samples were sequenced on an Illumina sequencer. We found only slightly lower recovery rates for mock communities with the direct PCR approach compared to traditional protocols. These recovery rates were further improved for both methods when an equal biomass (ca. 0.006 mg) of chironomid specimens was used. With our approach, it was possible to detect species which constituted only 1% of the entire biomass of a sample. Generally, direct PCR did not have a large effect on sequence read abundance. However, read abundance varied strongly between species. We are currently investigating whether this was caused by primer bias or an artifact of differently degraded tissue. This study is a proof of principle that the amplicons produced by direct PCR can be used for next-generation sequencing, with possible applications for future biomonitoring projects and portable laboratory technologies. We are currently using this technique to monitor a large-scale chironomid community experiment (artificial pond mesocosm facility) covering weekly samples taken over two summer half-years.

Background: The aims of this study were the temporal analysis of salivary biomarkers of cellular damage and oxidative stress following of lower third molar surgical removal from healthy patient and without postoperative complications. Material and Methods: Three whole unstimulated saliva samples were collected from each of 17 patients (8 men, 9 women) before surgery, 1 and 7 days after lower third molar surgical removal using the expectoration (or 'spit') method. Salivary flow rate (SFR), pH, buffer capacity (BC) were measured, immediately after collection. The samples were centrifuged and the supernatants were stored in aliquots at -80°C until analysis. Salivary thiobarbituric reacting substances (TBARs), total antioxidant capacity (TAC), haemoglobin (Hb), total protein (TP), uric acid (UA), acid phosphatase (ACP), tartrate-resistant acid phosphatase (TRAP), alkaline phosphatase (ALP), aspartate aminotransferase (AST), alanine aminotransferase (ALT), and lactate dehydrogenase (LDH) were measured by spectrophotometric method. Results: There were no significant differences between pre- and post-surgical SFR, pH, BC, or TP. One day after extraction were detected a significant increases in Hb, TBARs, ACP, TRAP, ALP, AST, ALT, and LDH activities, and decreases of UA and TAC levels were observed. Seven days after extraction, only AST (higher) remained increased compared to pre-surgical levels. Conclusions: The surgical removal of impacted lower third molars increases salivary biomarkers of cellular damage and oxidative stress, and decreases the TAC in the early postoperative. Considering these issues, our data open new perspectives of a possible use of these parameters as biomarkers for screening and monitoring of patients vulnerable to the development of postoperative complications.Descriptors: Saliva; Biomarkers; Oral Surgical Procedures; Oxidative Stress; Enzymes; Thiobarbituric Acid Reactive Substances.ReferencesMajid OW, Mahmood WK. Effect of submucosal and intramuscular dexamethasone on postoperative sequelae after third molar surgery: comparative study. Br J Oral Maxillofac Surg. 2011;49(8):647-52.Larjava H. Oral wound healing : cell biology and clinical management. Oxford: Wiley-Blackwell; 2012. XVI, 408 p.pMohn CE, Steimetz T, Surkin PN, Fernandez-Solari J, Elverdin JC, Guglielmotti MB. Effects of saliva on early post-tooth extraction tissue repair in rats. Wound Repair Regen. 2015;23(2):241-50.Ozmeric N, Mollaoglu N, Elgun S, Devrim E. Impact of chlorhexidine mouth rinse use on postextraction infection via nitric oxide pathway. Inflamm Res. 2010;59(6):437-41.Dos Santos DR, Souza RO, Dias LB, Ribas TB, de Oliveira LCF, Sumida DH et al. The effects of storage time and temperature on the stability of salivary phosphatases, transaminases and dehydrogenase. Arch Oral Biol. 2018;85:160-65.Dabra S, China K, Kaushik A. Salivary enzymes as diagnostic markers for detection of gingival/periodontal disease and their correlation with the severity of the disease. J Indian Soc Periodontol. 2012;16(3):358-64.Cesco Rde T, Ito IY, de Albuquerque RF Jr. Levels of aspartate aminotransferase (AST) in saliva of patients with different periodontal conditions. J Clin Periodontol. 2003;30(8):752-55.Cunha-Correia AS, Hernandes Neto A, Pereira AF, Aguiar SM, Nakamune AC. Enteral nutrition feeding alters antioxidant activity in unstimulated whole saliva composition of patients with neurological disorders. Res Dev Disabil. 2014;35(6):1209-15.Nagler RM, Klein I, Zarzhevsky N, Drigues N, Reznick AZ. Characterization of the differentiated antioxidant profile of human saliva. Free Radic Biol Med. 2002;32(3):268-77.Miricescu D, Totan A, Calenic B, Mocanu B, Didilescu A, Mohora M et al. Salivary biomarkers: relationship between oxidative stress and alveolar bone loss in chronic periodontitis. Acta Odontol Scand. 2014;72(1):42-7.Bansal N, Gupta ND, Bey A, Sharma VK, Gupta N, Trivedi H. Impact of nonsurgical periodontal therapy on total antioxidant capacity in chronic periodontitis patients. J Indian Soc Periodontol. 2017;21(4):291-95.Wang Y, Andrukhov O, Rausch-Fan X. Oxidative stress and antioxidant system in periodontitis. Front Physiol. 2017;8:910.Cutando A, Arana C, Gomez-Moreno G, Escames G, Lopez A, Ferrera MJ et al. Local application of melatonin into alveolar sockets of beagle dogs reduces tooth removal-induced oxidative stress. J Periodontol. 2007;78(3):576-83.Bassoukou IH, Nicolau J, dos Santos MT. Saliva flow rate, buffer capacity, and pH of autistic individuals. Clin Oral Investig. 2009;13(1):23-7.Kamodyova N, Banasova L, Jansakova K, Koborova I, Tothova L, Stanko P et al. Blood contamination in saliva: impact on the measurement of salivary oxidative stress markers. Dis Markers. 2015;2015:479251.Hartree EF. Determination of protein: a modification of the Lowry method that gives a linear photometric response. Anal Biochem. 1972;48(2):422-27.Granjeiro JM, Taga EM, Aoyama H. Purification and characterization of a low-molecular-weight bovine kidney acid phosphatase. An Acad Bras Cienc. 1997;69(4):451-60.Henry RJ, Chiamori N, Golub OJ, Berkman S. Revised spectrophotometric methods for the determination of glutamic-oxalacetic transaminase, glutamic-pyruvic transaminase, and lactic acid dehydrogenase. Tech Bull Regist Med Technol 1960;30:149-66.Huijgen HJ, Sanders GT, Koster RW, Vreeken J, Bossuyt PM. The clinical value of lactate dehydrogenase in serum: a quantitative review. Eur J Clin Chem Clin Biochem. 1997;35(8):569-77.Buege JA, Aust SD. Microsomal lipid peroxidation. Methods Enzymol. 1978;52:302-10.Benzie IF, Strain JJ. The ferric reducing ability of plasma (FRAP) as a measure of "antioxidant power": the FRAP assay. Anal Biochem. 1996;239(1):70-6.Trivedi RC, Rebar L, Berta E, Stong L. New enzymatic method for serum uric acid at 500 nm. Clin Chem. 1978;24(11):1908-11.Shaila M, Pai GP, Shetty P. Salivary protein concentration, flow rate, buffer capacity and pH estimation: A comparative study among young and elderly subjects, both normal and with gingivitis and periodontitis. J Indian Soc Periodontol. 2013;17(1):42-6.Hosseini-Yekani A, Nadjarzadeh A, Vossoughi M, Reza JZ, Golkari A. Relationship between physicochemical properties of saliva and dental caries and periodontal status among female teachers living in Central Iran. J Int Soc Prevent Community Dent. 2018;8(1):48-55.Jafari SM, Motamedi MH, Jafari M, Tabeshfar S, Jafari M, Naghizadeh MM. Impacted lower third molars: Can preoperative salivary pH influence postoperative pain? Natl J Maxillofac Surg. 2010;1(2):123-26.Kejriwal S, Bhandary R, Thomas B, Kumari S. Estimation of levels of salivary mucin, amylase and total protein in gingivitis and chronic periodontitis patients. J Clin Diagn Res. 2014;8(10):ZC56-60.Gutierrez-Corrales A, Campano-Cuevas E, Castillo-Dali G, Serrera-Figallo MA, Torres-Lagares D, Gutierrez-Perez JL. Relationship between salivary biomarkers and postoperative swelling after the extraction of impacted lower third molars. Int J Oral Maxillofac Surg. 2017;46(2):243-49.Hannig C, Spitzmuller B, Hannig M. Transaminases in the acquired pellicle. Arch Oral Biol. 2009;54(5):445-48.Hannig C, Spitzmuller B, Miller M, Hellwig E, Hannig M. Intrinsic enzymatic crosslinking and maturation of the in situ pellicle. Arch Oral Biol. 2008;53(5):416-22.Rodriguez PG, Felix FN, Woodley DT, Shim EK. The role of oxygen in wound healing: a review of the literature. Dermatol Surg. 2008;34(9):1159-69.