Academic literature on the topic 'F.N.D.I.R. (Organization : France)'

Abstract. Motherhood, listed by the World Health Organization as a period of fragility and vulnerability, involves significant changes at the individual, family and social level. Becoming a mother entails a number of risk factors to take into account. It is therefore necessary to carry out studies on general populations not suffering from psychopathological disorders to better understand these risk factors linked to motherhood. This study was carried out in France with a nonconsulting population in the postnatal phase ( N = 30) using the Rorschach test, as it presents numerous advantages to appreciate the psychic and corporeal transformations linked to birth. The quantitative results of the test were compared with recently updated norms ( De Tychey et al., 2012 ). Eight values of the psychogram remained normative (F%, F+%, W%, Dd%, M, C, H%, P) reflecting the characteristics of a general population; conversely, eight other values of the psychogram (R, D%, S%, A%, RC%, m, E, Anguish Index%) differed significantly from general population norms. These results increase knowledge to help appreciate the complexity of the psychic processes at work during the postnatal period, and to prevent psychopathological disorders. It is thus possible to distinguish these disorders from those that are transitory and classically linked to the upheaval caused by the onset of motherhood.

With the aim of understanding the insertion of higher education into a new context of organization of society and State, which is managed according to the New Public Management, this work presents a comparative historical study of the organization of French and Brazilian higher education. It is concluded that the French adherence to the New Public Management is based on the knowledge economy, while the Brazilian one is based on State size reduction along the lines of the Washington Consensus; in addition, higher education institutions in both countries are organized to participate in competitions: in France, the international competition promoted by rankings, and in Brazil, the market competition.ResumoCom o objetivo de compreender a inserção do ensino superior dentro de um novo contexto de organização da sociedade e do Estado, gerido pela Nova Gestão Pública, o trabalho apresenta um estudo histórico comparativo da organização do ensino superior brasileiro e o francês. Conclui-se que a adesão francesa à Nova Gestão Pública tem como norte a economia do conhecimento, e a brasileira, a redução do Estado nos moldes do Consenso de Washington; e que as instituições de ensino superior nos dois países são organizadas para participarem de concorrências: na França, a internacional promovida pelos ranqueamentos, no Brasil, a mercantil.Palavras-chave: Ensino superior brasileiro, Ensino superior francês, Nova gestão pública, Universidade.Keywords: Brazilian higher education, French higher education, New public management, University.ReferencesAEBISCHER, S. Réinventer l'école, réinventer l'administration. Une loi pédagogique et managériale au prisme de ses producteurs. Politix, n. 98, n.2 p. 57-83 2012/2.AERES. Repères historiques. Agence d’évaluation de la recherche et de l’enseignement supérieur. Disponível em: <www.aeres-evaluation.fr/Agence/Presentation/Reperes-historiques>. Acesso em: 17 nov. 2016.AMARAL, N. C. O vínculo avaliação-regulação-financiamento nas IES brasileiras: desafios para a gestão institucional. Revista Brasileira de Política e Administração da Educação, v.27, n.1 p. 95-108, jan./abr. 2011.ATTALI, J. Rapport Pour un modèle européen d’enseignement supérieur. Paris: Ministère de l'éducation nationale, de la recherche et de la technologie, 1998.AUST, Jérôme ; CRESPY, Cécile, Napoléon renversé ? Institutionnalisation des Pôles de recherche et d'enseignement supérieur et réforme du système académique français. Revue française de science politique : Paris 2009/5 (Vol. 59), p. 915-938.BARREYRO, G. B.; ROTHEN, J. C. Para uma história da avaliação da educação superior brasileira: análise dos documentos do PARU, CNRES, GERES e PAIUB. Avaliação. Campinas - Sorocaba/SP, v.13, n.1, p. 131-152, mar 2008.BARREYRO, G. B.; ROTHEN, J. C. O Nupes e a avaliação da educação superior: concepções, propostas e posicionamentos públicos. In: CATANI, A. M.; SILVA JR., J. R.; MENEGHEL, S. A cultura da universidade pública brasileira. São Paulo: Xamã, 2011.BARROSO, H. M.; FERNANDES, I. R. Mantenedoras educacionais privadas: Histórico, organização e situação jurídica. Rio de Janeiro: Observatório Univesitário, 2007.BEZES, P. Réinventer l’État: Les réformes de l’administration française (1962-2008). Paris: Presses Universitaires de France, 2009.BOLTANSKI, L.; CHIAPELLO, È. Le nouvel esprit du capitalisme. Paris: Gallimar, 2011.BRESSER-PEREIRA, L. C. A crise da América Latina: consenso de Washington ou crise fiscal? Pesquisa e Planejamento Econômico. Brasília, v. 21. n.1, p. 3-23, abr 1991.BRESSER-PEREIRA, L. C. Plano Diretor da Reforma do Aparelho do Estado. Brasília. 1995.BRUNETIÈRE, J.-R. Les indicateurs de la loi organique relative aux lois de finances (LOLF): une occasion de débat démocratique? Revue française d'administration publique, v. 117 n. 1, p. 95-111, 2006/1.CALLON, M. Éléments pour une sociologie de la traduction la domestication des coquilles Saint-Jacques et des marins-pêcheurs dans la baie de Saint-Brieuc. L’année sociologique, v. n. 36, p. 170-208, 1986.CASTRO, A. M. D. A.; PEREIRA, R. L. D. A. Contratualização no ensino superior: um estudo à luz da Nova Gestão Pública. Acta Scientiarum. Maringá, v. 36, n. 2, p. 287-296. jul.- dez. 2014.CATANI, A. M.; HEY, A. P.; GILIOLI, R. D. S. P. PROUNI: democratização do acesso às Instituições de Ensino Superior? Educar. Curitiba, n. 28, p. 125-140, 2006.CDEFI, Conférence de Directeurs des Écoles Françaises. Les écoles Françaises d’ingénieurs: trois siècles d’histoire, sd. Disponível em: <www.cdefi.fr/files/files/Historique%20des%20%C3%A9coles%20fran%C3%A7aises%20d%27ing%C3%A9nieurs.pdf.>. Acesso em: 11 octobre 2016.CHARLE, C. Les Universités entre démocratie et élites de la IIIe à la V République. In: LEMIÈRE, J. L’université: situation actuelle. Paris: L’Harmattan, 2015.CHARLE, C.; VERGER, J. Histoire des universités: XIIe – XXIe siècle. Paris: PFU, 2012.CIP, Comité d’initiative et de propositions. Rapport des Etats Généraux de la recherche. Paris, 2004.CNPQ. A criação. Disponível em www.cnpq.br/web/guest/a-criacao/ acesso 10/10/2017CONVERT, B. ; GUGENHEIM, F. ; JACUBOWSKI, S.. La « professionnalisation » de l’université, trente ans avant la loi LRU : l’exemple de l’université de Lile. in Thierry Chevaillier et Christine Musselin (dir.), Réformes d’hier et réformes d’aujourd’hui : l’enseignement supérieur recomposé. Rennes : Presses Universitaires de Rennes, 2014. P. 61 – 80.CONSEIL EUROPEEN. Conseil Européen Lisbonne 23 et 24 mars 2000: conclusions de la présidence. Lisbone, p. 41. 2000.CROCHE, S. Qui pilote le processus de Bologne? Education et sociétés, v.18, n. 2, p. 203-217, 2006.CROCHE, S. Évolution d'un projet d'Europe sans Bruxelles: Le cas du processus de Bologne. Education et sociétés, v. 24, n. 2, p. 11-27, 2009.CUNHA, L. A. A universidade brasileira nos anos oitenta: sintomas de regressão institucional. Em aberto. Brasília, ano 8, n 43, p. 3-9, jul./set. 1989.CUNHA., L. A. A universidade temporã: o ensino superior da Colônia à Era de Vargas. Rio de Janeiro: Civilização Brasileira, 1980.DÉCLARATION DE BOLOGNE. L’espace européen de l’enseignement supérieur. Bologne. 1999.DEROUET, J. L. Entre la récupération des savoirs critiques et la construction des standards du management libéral : bougés, glissements et déplacements dans la circulation des savoirs entre recherche, administration et politique en France de 1975 à 2005. Revue Française de Pédagogie, Paris, v. n. 154, p. 5-18, jan/fev 2006.DURHAM, E. Educação superior pública e privada. São Paulo: NUPES, 2003.ENQA. European Association for Quality Assurance in Higher Education. Standards and Guidelines for Quality Assurance in the European Higher Education Area. 3ed. Helsinki. 2009.EUR-LEX. Glossaire des synthèses: Méthode ouverte de coordination. Disponível em: <http://eur-lex.europa.eu/summary/glossary/open_method_coordination.html?locale=fr>. Acesso em: 21 out. 2017.EYRAUD, C.; MIRI, M. E.; PEREZ, P. Les enjeux de quantification dans la LOLF. Le cas de l'enseignement supérieur. Revue Française de Socio-Économie, 2011. p. 147-168. vol. 7, no. 1, p. 147-168, 2011,FÁVERO, M. D. L. D. A. A universidade brasileira: em busca de sua identidade. Petrópolis: Vozes, 1977.FIFA. Status de la FIFA. Zurich: FIFA, 2016.FRANCE. Loi relative à la création de l'Université, 10 mai 1806. Disponível em: <www.inrp.fr/edition-electronique/lodel/dictionnaire-ferdinand-buisson/document.php?id=3762 >. Acesso em: 07 jun. 2016.FRANCE. Loi relative à la constitution des universités. 10 Juillet 1896. Disponível em: <fr.wikisource.org/wiki/Loi_du_10_juillet_1896_relative_%C3%A0_la_constitution_des_universit%C3%A9s >. Acesso em: 06 out. 2016.FRANCE. Loi n.84-52 sur l’enseignement supérieur. 26 Janvier 1984. Disponível em: <www.legifrance.gouv.fr/affichTexte.do?cidTexte=JORFTEXT000000692733>>. Acesso em: 13 ago. 2016.FRANÇE. Loi n°89-486 d'orientation sur l'éducation. 10 juillet 1989. Disponível em: <www.education.gouv.fr/cid101274/loi-d-orientation-sur-l-education-n-89-486-du-10-juillet-1989.html>. Acesso em: 17 nov 2016.FRANCE. Code de la recherche Modifications du code de la recherche prenant en compte le Projet de loi de programme pour la recherche. Texte définitif adopté le 4 avril 2006. 2006. Disponível em: <www.sg.cnrs.fr/daj/textes/reglementation/docs/code_recherche_consolide_0504.pdf >. Acesso em: 17 nov 2016.FURTADO, C. Formação econômica do Brasil. São Paulo: Nacional, 1972.GERMANO, J. W. Estado Militar e educação no Brasil: 1964-1965. 2ª. ed. São Paulo: Cortez, 1994.GOULARD, F. L’enseignement supérieur en France, état des lieux et propositions. La Documentation française. Paris: Ministère de l'enseignement supérieur et de la recherche, 2007.GUILLAUME, J. Université – Les universités de l’ancien régime. In: BUISSON, F. Nouveau dictionnaire de pédagogie et d’instruction primaire. 1911. Disponível em: <www.inrp.fr/edition-electronique/lodel/dictionnaire-ferdinand-buisson/document.php?id=3764>. Acesso em: 07 jun. 2016.JANET, M. Le Gouvernement des universités au Québec et en France : Conceptions de l’autonomie et mouvements vers un pilotage stratégique. In: CHEVAILLIER, T.; MUSSELIN, C. Réformes d’hier et réformes d’aujourd’hui, l’enseignement supérieur recomposé. Rennes: Presses Universitaires de Rennes, 2014. p. p. 21-49.LEHER, R. Projetos e modelos de autonomia e privatização das universidades públicas. Revista da ADUEL. Londrina, p. 7-20 set. 2003.LEITE, R. D. R. Análise do Conflito entre a Norma Constitucional (artigo 217) e Norma Internacional (artigo 61, Estatuto FIFA). 2008. Disponível em https://universidadedofutebol.com.br/analise-do-conflito-entre-a-norma-constitucional-artigo-217-e-norma-internacional-artigo-61-estatuto-fifa/ acesso em 20/10/2017MELLO, J. M. C. D. O capitalismo tardio: contribuição à revisão crítica da formação e desenvolvimento da economia brasileira. São Paulo: Brasiliense, 1998.MUSSELIN, C. La longe marche des universités françaises. Paris: Presses Universitaires de France, 2001.NORMAND, R. The Changing Epistemic Governance of European Education: The fabrication of the Homo Academicus Europeanus, Cham (ZG)/Switzerland: Springer, 2016. 247 p.OGIEN, Al. « La valeur sociale du chiffre. La quantification de l'action publique entre performance et démocratie », Revue Française de Socio-Économie. Paris, 2010/1 (n° 5), p. 19-40.PAIN, A. Por uma universidade no Rio de Janeiro. In: SCHWARTZMAN, S. Universidades e Instituições Científicas no Rio de Janeiro. Brasília: CNPq, 1982.PECRESSE, V. Opération Campus: rénovation de 10 projets de campus. Communiqué - 6.02.2008. Disponível em: <www.enseignementsup-recherche.gouv.fr/cid20924/operation-campus-renovation-de-10-projets-de-campus.html>. Acesso em: 21 out. 2017.PICARD, J. F.; PRADOURA. La longue marche vers le CNRS (1901 – 1945). Cahiers pour l’histoire du CNRS (1988 - 1), 2009. Disponível em: <www.histcnrs.fr/pdf/cahiers-cnrs/picard-pradoura-88.pdf>. Acesso em: 21 out. 2017.PROST, A. Éducation société et politiques: une histoire de l’enseignement en France, de 1945 à nous jours. Sueil: Paris, 1992.RAMUNI, G. Le CNRS : principal enjeu de la politique scientifique. La revue pour l’histoire du CNRS, Paris, n. 1, nov. 1999. 1-21.RAVINET, P. La coordination européenne « à la bolognaise »: réflexions sur l'instrumentation de l'espace européen d'enseignement supérieur. Revue française de science politique, V. 61 n. 1, p. 23-49, 2011.ROMANELLI, O. D. O. História da educação no Brasil: 1930-1973. 3a. ed. Petrópolis/RJ: Vozes, 1982.ROTHEN, J. C. O vestibular do Provão. Avaliação. Campinas, v. 8 n 1, p. 27-37, 2003.ROTHEN, J. C. Funcionário intelectual do Estado: um estudo de epistemologia política do Conselho Federal de Educação. 2004. 270f. Tese (Doutorado em Educação) - Unimep. Piracicaba.ROTHEN, J. C. A universidade brasileira na Reforma Francisco Campos de 1931. Revista Brasileira de História da Educação, v. 17, p. 141-160, mai/out 2008.ROTHEN, J. C. et al. A divulgação da avaliação da educação na imprensa escrita: 1995-2010. Avaliação. Campinas: Sorocaba, v. 20, n. 3, p. 634-664, nov. 2015.SALEM, T. Do Centro D. Vital à Universidade Católica. In: SCHWARTZMA, S. Universidades e Instituições Científicas no Rio de Janeiro. Brasília: CNPq, 1982.SAMPAIO, H. O setor privado de ensino superior no Brasil: continuidades e transformações. Revista Ensino Superior Unicamp. Campinas, n. 4, p. 28-43, out. 2011.SARKOZY, Nicolas. Lettre de mission de M. Nicolas Sarkozy, Président de la République, adressée à Mme Valérie Pécresse, ministre de l'enseignement supérieur et de la recherche, sur les priorités en matière d'enseignement supérieur et de recherche, le 5 juillet 2007. Disponible en discours.vie-publique.fr/notices/077002458.html.SAVIANI, D. Ensino público e algumas falas sobre universidade. São Paulo: Cortez, 1984.SGUISSARDI, V. A avaliação defensiva no “modelo CAPES de avaliação” – É possível conciliar avaliação educativa com processos de regulação e controle do Estado? Perspectiva. Florianópolis, v. 24, n. 1, p. 49-88, jan/un. 2006a.SGUISSARDI, V. Universidade no Brasil: dos modelos clássicos aos modelos de ocasião? In: MOROSINI, M. A universidade no Brasil: concepções e modelos. Brasília: INEP, 2006b.SGUISSARDI, V. Estudo diagnóstico da política de expansão da (e acesso à) educação superior no Brasil. 2002-2012. OEI. Brasília, p. 191. 2014.SILVA JR., J. D. R.; KATO, F. B. G.; FERREIRA, L. R. O papel da CAPES e do CNPq após a reforma do Estado Brasileiro: Indução de pesquisa e da produção de conhecimento. In: ALMEIDA, M. D. L. P. D.; CATANI, A. M. Educação superior iberoamericana: uma análise para além das perspectivas mercadológicas da produção de conhecimento. Buenos Aires: CLACSO, 2015.VASCONCELLOS, M. Enseignement supérieur en France. Paris: La découverte, 2006.VIE PUBLIQUE. Les autorités administratives indépendantes, 2012. Disponível em: <http://www.vie-publique.fr/decouverte-institutions/institutions/administration/organisation/etat/aai/qu-est-ce-qu-autorite-administrative-independante-aai.html>. Acesso em: 21 out. 2017.

Introdução: A queilite actínica (QA) é uma desordem potencialmente maligna associada à exposição crônica à luz solar como principal fator etiológico. A QA tem como principal sítio de acometimento o vermelhão do lábio inferior, apresentando características clínicas marcantes. Porém, a análise histopatológica desta lesão merece um enfoque especial pelas características bastante expressivas para o potencial de malignidade. Assim, para essa análise, são elencados dois sistemas principais: o sistema da Organização Mundial da Saúde (OMS), e o binário. Objetivo: Realizar uma revisão da literatura para demonstrar os pontos avaliados e o valor preditivo dos sistemas de gradação histológica em QA. Metodologia: Trata-se de um estudo de revisão bibliográfica, utilizando artigos da base de dados da SCIELO e PUBMED, encontrados com o uso dos descritores: “actinic cheilitis”, “WHO system”, “binary system”, “oral potentially malignant disorders”, “histological features in actinic cheilitis”, fazendo uso do operador booleano “AND”. Conclusão: Diante da revisão realizada, percebeu-se a importância da adoção dos sistemas de gradação histológica da OMS, e o binário para uma análise minuciosa de lesões de QA, que apresentam potencial de malignidade. Ademais, constatou-se o favorecimento do sistema binário na redução da subjetividade entre os patologistas quanto à gradação das avaliações histopatológicas. Descritores: Queilite; Patologia Bucal; Neoplasias Labiais; Classificação; Diagnóstico. Referências Lopes MLDS, Silva Junior FLS, Lima KC, Oliveira PT, Silveira EJD. Clinicopathological profile and management of 161 cases of actinic cheilitis. An Bras Dermatol. 2015;90(4):347-50. Arnaud RR, Soares MSM, Paiva MAF, Figueiredo CRLV, Santos MGC, Lira CC. Queilite actínica: avaliação histopatológica de 44 casos. Rev Odontol UNESP. 2014;43(6):384-89. Pilati S, Bianco BC, Vieira D, Modolo F. Histopathologic features in actinic cheilitis by the comparison of grading dysplasia systems. Oral Dis. 2017 Mar;23(2):219-224. Pilati S, Bianco BC, Vieira D, Modolo F. Histopathologic features in actinic cheilitis by the comparison of grading dysplasia systems. Oral Dis. 2017;23(2):219-24. Maia HCM, Pinto ANS, Pereira JS, Medeiros AMC, Silveira EJD, Miguel MCC. Lesões orais potencialmente malignas: correlações clínico-patológicas. Einstein. 2016;14(1): 35-40. Savage NW, McKay C, Faulkner C. Actinic cheilitis in dental practice. Aust Dent J. 2010; 55(Suppl 1):78-84. Vieira RA, Minicucci EM, Marques ME, Marques SA. Actinic cheilitis and squamous cell carcinoma of the lip: clinical, histopathological and immunogenetic aspects. An Bras Dermatol. 2012; 87(1):105-14. Dancyger A, Heard V, Huang B, Suley C, Tang D, Ariyawardana A. Malignant transformation of actinic cheilitis: A systematic review of observational studies. J Investig Clin Dent. 2018; 9(4):e12343. de Santana Sarmento DJ, da Costa Miguel MC, Queiroz LM, Godoy GP, da Silveira EJ. Actinic cheilitis: clinicopathologic profile and association with degree of dysplasia. Int J Dermatol. 2014; 53(4):466-72. Wood NH, Khammissa R, Meyerov R, Lemmer J, Feller L. Actinic cheilitis: a case report and a review of the literature. Eur J Dent. 2011; 5(1):101-6. Mello FW, Melo G, Modolo F, Rivero ER. Actinic cheilitis and lip squamous cell carcinoma: Literature review and new data from Brazil. J Clin Exp Dent. 2019;11(1):e62-9. Warnakulasuriya S, Johnson NW, van der Waal I. Nomenclature and classification of potentially malignant disorders of the oral mucosa. J Oral Pathol Med. 2007;36(10):575-80. Paiva MAF, Soares MSM, Figueiredo CRLV, Luna AH, Oliveira VEN, Brasil Júnior O. Associação entre displasia e inflamação em queilite actínica. J Bras Patol Med Lab. 2012; 48(6):455-58. Warnakulasuriya S, Reibel J, Bouquot J, Dabelsteen E. Oral epithelial dysplasia classification systems: predictive value, utility, weaknesses and scope for improvement. J Oral Pathol Med. 2008;37(3):127-33. Câmara PR, Dutra SN, Takahama Júnior A, Fontes K, Azevedo RS. A comparative study using WHO and binary oral epithelial dysplasia grading systems in actinic cheilitis. Oral Dis. 2016; 22(6):523-9. Kujan O, Oliver RJ, Khattab A, Roberts SA, Thakker N, Sloan P. Evaluation of a new binary system of grading oral epithelial dysplasia for prediction of malignant transformation. Oral Oncol. 2006;42(10):987-93. Nagata G, Santana T, Queiroz A, Caramez RH, Trierveiler M. Evaluation of epithelial dysplasia adjacent to lip squamous cell carcinoma indicates that the degree of dysplasia is not associated with the occurrence of invasive carcinoma in this site. J Cutan Pathol. 2018. doi: 10.1111/cup.13270. Mello FW, Miguel AFP, Dutra KL, Porporatti AL, Warnakulasuriya S, Guerra ENS, Rivero ERC. Prevalence of oral potentially malignant disorders: A systematic review and meta-analysis. J Oral Pathol Med. 2018;47(7):633-40. Izumo T. Oral premalignant lesions: from the pathological viewpoint. Int J Clin Oncol. 2011;16(1):15-26. Kujan O, Khattab A, Oliver RJ, Roberts SA, Thakker N, Sloan P. Why oral histopathology suffers inter-observer variability on grading oral epithelial dysplasia: an attempt to understand the sources of variation. Oral Oncol. 2007; 43(3):224-31. El-Naggar AK, Chan JKC, Grandis JR, Takata T, Slootweg PJ. World Health Organization Classification of Head and Neck Tumours. WHO/IARC Classification of Tumours 2017; 4th ed. Lyon, France: IARC Press. R SA, B N P, Hegde U, K U, G S, G K, Sil S. Inter- and Intra-Observer Variability in Diagnosis of Oral Dysplasia. Asian Pac J Cancer Prev. 2017;18(12):3251-54. Olinici D, Cotrutz CE, Mihali CV, Grecu VB, Botez EA, Stoica L, Onofrei P, Condurache O, Dimitriu DC. The ultrastructural features of the premalignant oral lesions. Rom J Morphol Embryol. 2018;59(1):243-48.

Akinyele, T.A., 2011. Assessment of the antibacterial properties of n-Hexane extract of Cocos Nucifera and its interactions with some Conventional antibiotics. Masters Dissertation. University of Fort Hare, Alice. Alan´ıs, A.D., Calzada, F, Cervantes J.A., Torres, J., and Ceballos, G.M. 2005. Antibacterial properties of some plants used in Mexican traditional medicine for the treatment of gastrointestinal disorders, Journal of Ethnopharmacology. 100, 153–157. Alviano, W.S., Alviao, D.S., Diniz, C.G., Antoniolli, A.R., Alviano, C.S., Frias, L.M. 2008. In vitro antioxidant potential of medicinal plant extracts and their activities against oral bacteria based on Brazilian folk medicine. Arch Oral Biol. 53:545-552. Arora, R, Chawla, R, Marwah, R, Arora, P, Sharma R.K., Kaushik, V, Goel, R, Kaur, A, Silambarasan, M, Tripathi, R.P., and Bhardwaj, J.R. 2011. Corporation. Evidence-Based Complementary and Alternative Medicine. Hindawi Publishing. Bakhru, H.K. 2000. Foods That Heal. Orient Paper Backs, New Delhi. Batovska, I.D., Todorova, I.T., Tsvetkova I.V., and Najdenski H.M. 2009. Antibacterial Study of the Medium Chain Fatty Acids and Their 1- Monoglycerides: Individual Effects and Synergistic Relationships. Polish Journal of Microbiology. 58: 43- 47. Bolling, B.W., McKay, D.L., Blumberg, J.B. 2010. The phytochemical composition and antioxidant actions of tree nuts. Asia Pac J Clin Nutr; 19: 117-23. Conrado S. Dayrit. 2000. Read at the XXXVII Cocotech Meeting, Chennai, India Deb Mandal M, Mandal. S 2011. Coconut (Cocos nucifera L.: Arecaceae): In health promotion and disease Prevention. Asian Pacific Journal of Tropical Medicine, 241-247. Dyana, J.P., and Kanchana, G. 2012. Preliminary Phytochemical Screening of Cocos Nucifera L. Flowers, International Journal of Current Pharmaceutical Research, Vol 4, Issue 3. Effiong, G.S., Ebong, P.E., Eyong, E.U., Uwah, A.J., and Ekong, U.E. 2010. Amelioration of Chloramphenicol Induced Toxicity in Rats by Coconut Water, Journal of Applied Sciences Research, 6(4): 331-335. Esquenazi D, Wigg M.D, Miranda M.M.F.S., Rodrigues H.M., Tostes J.B.F., Rozental S, da Silva A.J.R. and Alviano, C.S 2002. Antimicrobial and antiviral activities of polyphenolics fromCocos nucifera Linn. (Palmae) husk fiber extract. Research in Microbiology 153: 647–652. Food and Agricultural Organization of the United Nations, Economic and Social Department. Statistics division (September 2, 2010). FAOSTAT- Production- Crops [Selected annual data]. Retrieved April 14, 2011 from the FAOSTAT database. Ifesan, B.O.T., Fashakin, J.F., Ebosele, F, and Oyerinde, A.S. 2013. Antioxidant and Antimicrobial Properties of Selected Plant Leaves, European Journal of Medicinal Plants 3(3): 465-473. Krishnamoorthy, M. and Arjun, P. 2012. Probiotic and antimicrobial activity of bacteria from fermented toddy of Cocos nucifera, J. Acad. Indus. Res. Vol. 1(3). Mandal S.M., Dey, S, Mandal, M, Sarkar, S, Maria-Neto, S. and Franco, O.L. 2009. Identification and structural insights of three novel antimicrobial peptides isolated from green coconut water. Peptides. 30. 633-637. Mariselvam, R, Ranjitsingh, A.J.A., Nandhini, U.R.A. and Kalirajan, K. 2013. Antihelmintic and antibacterial activity of Cocos nucifera tree inflorances crude extract. IJSID, 3 (2), 311-316. Mehlhorn H, Al-Quraishy S, Al-Rasheid KAS, Jatzlau A, and Abdel-Ghaffar F. Addition of a combination of onion (Allium cepa) and coconut (Cocos nucifera) to food of sheep stops Gastrointestinal Helminthic infections. Parasitol Res (2011) 108:1041–1046. Mendonça-Filho R.R, Rodrigues I.A, Alviano D.S, Santos A.L.S, Soares R.M.A, Alviano C.S, Lopes A H.C.S., Rosa M.S. 2004. Leishmanicidal activity of polyphenolic-rich extract from husk fiber of Cocos nucifera Linn. (Palmae) Research in Microbiology 155: 136–143. Mukherjee PK, Kumar SN and Heinrich M (2008). Plant Made Pharmaceuticals (PMPs)- Development of Natural Health Products from Bio-Diversity. Indian J. Pharm Educ. Res 42(2), 113-121. Nakatsuji, T, Kao M.C., Fang, J.Y., Zouboulis, C.C., Zhang, L, Gallo R.L. and Huang C.M. 2009. Antimicrobial Property of Lauric Acid against Propionibacterium acnes: Its Therapeutic Potential for Inflammatory Acne Vulgaris, Journal of Investigative Dermatology, Volume 129. NMCE. Report on Copra. National Multi-Commodity Exchange of India Limited; 2007, 1-14. O’Neil, C.E., Keast, D.R., Nicklas, T.A. and Fulgoni V.L. 2012. Out of-hand nut consumption is associated with improve nutrient intake and health risk markers in US children and adults: National Health and Nutrition Examination Survey 1999-2004. Nutr Res 32: 185–194. Ogbolu D.O., Oni AA, Daini OA, and A.P. Oloko 2007. In Vitro Antimicrobial Properties of Coconut Oil on Candida Species in Ibadan, Nigeria, J Med Food 10 (2), 384–387. Pushpan R, Kumari H, Nishteswar K and N Vishwanathan. 2013. Preliminary Phytochemcial Screening of Narikelapushpa (Flower of Cocos nucifera L.) Global Journal of Traditional Medicinal Systems, 2(2): 1-3. Singla R.K., Jaiswal N, Bhat V and Hitesh Jagani 2011. Antioxidant & Antimicrobial Activities of Cocos Nucifera Linn. (Arecaceae) Endocarp Extracts Indo Global Journal of Pharmaceutical Sciences; 1(4): 354-361. Taheri J.B., Espineli F.W., Lu H, Asayesh M, Bakshi M, Nakhostin M.R 2010. Antimicrobial effect of coconut flour on oral microflora: An in vitro study. Res J Biol Scs. 5(6): 456-459. Thaweboon S, Nakaparksin J, Thaweboon B.2011. Effect of Oil-Pulling on Oral Microorganisms in Biofilm Models, Asia Journal of Public Health, Vol. 2 No. 2. Venkataraman S, Ramanujam T.R, Venkatasubbu V.S. 1980. Antifungal activity of the alcoholic extract of coconut shell—Cocos nucifera Linn. J. Ethnopharmacol. 2: 291–293. Verma V, Bhardwaj A, Rathi S. and Raja R.B 2012. A Potential Antimicrobial Agent from Cocos nucifera mesocarp extract; Development of a New Generation Antibiotic. ISCA Journal of Biological Sciences. Vol. 1(2), 48-54.

The aim of this study was to describe the international academic mobility experienced by the Fishing Engineering students in other countries. The data was collected through an electronic semi-structured questionnaire hosted on an electronic platform by Google. A total of nine students answered the questionnaire, in which they chose countries such as France, Spain, Ireland, Canada, the United States and Australia to study abroad in. The student’s satisfaction with the Science without Borders Program (SwB) was extremely positive, where all the interviewees stated that they had learned the language from the hosting country. In relation to the negative aspects, 67% of the interviewees pointed out that they struggled to understand the language in the beginning of the academic mobility, and 78% of the students said that they missed their families during the student mobility period. In conclusion, the academic mobility performed by students from the Fishing Engineering course was rated as excellent, and as a unique and an enriching opportunity, both in professional and personal aspects.ResumoO trabalho teve como objetivo discutir sobre a mobilidade acadêmica vivenciada por estudantes de Engenharia de Pesca em outros países. A coleta de dados foi feita através de um questionário eletrônico semiestruturado, hospedado em uma plataforma eletrônica de formulários da Google. Um total de nove discentes respondeu ao questionário, realizando a mobilidade na França, Espanha, Irlanda, Canadá, Estados Unidos e Austrália. A satisfação dos estudantes com o Programa Ciência sem Fronteiras (CsF) foi positiva, todos os entrevistados afirmaram terem aprendido o idioma do país que escolheram. Em relação aos aspectos negativos, 67% dos entrevistados apontaram que tiveram dificuldades no entendimento do idioma do país no início da mobilidade acadêmica e 78% sentiram saudade da família no período da mobilidade. Concluindo, a mobilidade acadêmica realizada por discentes do Curso de Engenharia de Pesca foi classificada como excelente, sendo uma experiência única e enriquecedora tanto pelo lado profissional, quanto pessoal.Palavras-chave: Educação, Aprendizado, Internacionalização, Programa Ciência sem Fronteiras.Keywords: Education, Learning, Internationalization.ReferencesALTBACH, P. G. Comparative Higher Education: Knowledge, the University, and Development. Hong Kong: University of Hong Kong, p. 240, 1998.ANDRADE, B. P. S. O “Ciência sem Fronteiras” pelo olhar da comunidade acadêmica: O caso da Unifal-mg e da Unifei. 2018. 185f. Dissertação (Mestrado em Divulgação Científica e Cultural). Universidade Estadual de Campinas, Instituto de Estudos de Linguagem, Campinas, SP, 2018. AVEIRO, T. M. M. O programa Ciência sem Fronteiras como ferramenta de acesso à mobilidade internacional. Tear: Revista de Educação Ciência e Tecnologia, Canoas, v.3, n.2, 2014.BEINE, M.; NOEL, R.; RAGOT, L. Determinants of the international mobility of students. Economics of Education Review, mar. 2014. BETT, D. B. Jovens universitários e intercâmbio acadêmico. 2012. 34f. Monografia (Especialização em Psicologia terminalidade em Terapia Cognitiva e Comportamental). Universidade Federal do Rio Grande do Sul, Instituto de Psicologia, Porto Alegre, 2012.BRASIL. Decreto n.° 7.642, de 13 de dezembro de 2011, Institui o Programa Ciência sem Fronteiras. Diário Oficial da República Federativa do Brasil, Brasília, DF, n. 239, p. 7, seção1, 14 dez. 2011a.BRASIL. Ministério da Ciência, Tecnologia e Inovação. Ministério da Educação. Conselho Nacional de Desenvolvimento Científico e Tecnológico Coordenação de Aperfeiçoamento de Pessoal de Nível Superior. Programa Ciência sem Fronteiras: um programa especial de mobilidade internacional em ciência, tecnologia e inovação. Documento Conjunto CAPES-CNPq. Julho, 2011b. 67p. Disponível em: http://www.capes.gov.br/images/stories/download/ Ciencia-sem Fronteiras_DocumentoCompleto_julho2011.pdfBRASIL. Ministério Da Ciência Tecnologia e Inovação. Estratégia Nacional de Ciência, Tecnologia e Inovação 2012 – 2015: Balanço das Atividades Estruturantes de 2011. Brasília, DF, 2012. Disponível em: https://livroaberto.ibict.br/218981.pdf . Acesso em: 25 abr. 2018.BRASIL. Programa Ciência sem Fronteiras. Dados Chamadas Graduação Sanduíche 2011-2014. Brasília, 2014. Disponível em: http://www.cienciasemfronteiras.gov.br/web/csf/dados-chamadas-graduacao-sanduiche. Acesso em: 21 abr. 2018.BRASIL. Programa Ciência sem Fronteiras. Painel de Controle do Programa 2016. Disponível em: http://www.cienciasemfronteiras.gov.br/web/csf/painel-de-controle . Acesso em: 18 jul. 2018.BRUNO, R. C. et al. Mobilidade internacional para educação superior: perfil sociodemográfico e educacional de imigrantes. Almanaque Multidisciplinar de Pesquisa, Universidade Unigranrio, ano III, v.1, n.1, 2016.COMISSÃO DE CIÊNCIA E TECNOLOGIA, COMUNICAÇÃO E INFORMÁTICA. Senado Federal. Relatório. Brasília. 2015. Disponível em: http://legis.senado.leg.br/sdleg-getter/documento/download/9f8bccb3-c880-408c-9667-96582f07fa84 Acesso em: 20 maio 2018.CORREIA-LIMA, M. C.; RIEGEL, V. Mobilidade acadêmica made in South: refletindo sobre as motivações de estudantes brasileiros e colombianos. Magis Revista Internacional de Investigación en Educación, v.8, n.16, p.109-132, 2015. DOI: http://dx.doi.org/10.11144/Javeriana.m8-16.mamsCRUZ, V. X. A. PROGRAMA CIÊNCIA SEM FRONTEIRAS: Uma avaliação da política pública de internacionalização do ensino superior sob a perspectiva do Paradigma Multidimensional. Dissertação (Mestrado em Administração Pública). 2016. 209f. Universidade Federal de Goiás, Faculdade de Ciências e Tecnologia – FCT, Goiânia, GO, 2016.CUTTI, L. et al. Programa Ciência sem Fronteiras: relato de experiências. Revista Eletrônica de Educação, v.11, n.3, p.1020-1033, set./dez., 2017. DOI: http://dx.doi.org/10.14244/198271991897 DALMOLIN, I. S. et al. Intercâmbio acadêmico cultural internacional: uma experiência de crescimento pessoal e científico. Rev Bras Enferm, Brasília, v. 66, n.33. p. 442-447, 2013.FERREIRA, I.G.; CARREIRA, L. B.; BOTELHO, N. M. Mobilidade internacional na graduação em medicina: relato de experiência. ABCS Health Sci., v. 42, n.2, p.115-119, 2017. DOI: http://dx.doi.org/10.7322/abcshs.v42i2.1013INSTITUTE FOR INTERNATIONAL EDUCATION – IIE. Open Doors Report 2015: Fast Facts New York, 2015. Disponível em: https://www.iie.org/Research-and-Insights/Open-Doors/Fact-Sheets-and-Infographics/Fast-Facts. Acesso em: 15 nov. de 2017.INSTITUTE OF INTERNATIONAL EDUCATION – IIE. International student totals by place of origin, 2012/13 – 2015/16. Open Doors Report on International Educational Exchange, 2016. Disponível em: https://www.iie.org/Research-and-Insights/Open-Doors/Data/International-Students/Places-of-Origin. Acesso em: 15 nov. de 2017.INSTITUTE OF INTERNATIONAL EDUCATION – IIE. Open Doors Report 2017: Fast Facts Disponível em: https://www.iie.org/Research-and-Insights/Open-Doors/Fact-Sheets-and-Infographics/Fast-Facts. Acesso em: 01 ago. 2018.INTERNATIONAL TRADE ADMINISTRATION – ITA. 2016 Top Markets Report Education: Brazil Country Case Study. Disponível em: https://www.trade.gov/topmarkets/pdf/Education_Brazil.pdf. Acesso em: 15 nov. de 2017.KNIGHT, J. Internationalization remodeled: definition, approaches, and rationales. Journal of Studies in International Education, v. 1, p. 5-31, 2004.LIMA, M. C.; RIEGEL, V. A influência da mobilidade acadêmica sobre a formação dos jovens. UniRitter, Negócios e Talentos, v.2 , n.11, 2013.MAJID, S. et al. Motivations for studying abroad and adjustment challenges faced by international students in Singapore. Acad. J. Educ. Res., v.5, n.8, p. 223-235, 2017. DOI: http://dx.doi.org/10.15413/ajer.2017.0712MANÇOS, G. R.; COELHO, F. S. Internacionalização da Ciência Brasileira: subsídios para avaliação do programa Ciência sem Fronteiras. Revista Brasileira de Políticas Públicas e Internacionais, p.73, 2017.MARANHÃO, C. M. S.; DUTRA, C. I.; MARANHÃO, R. K. Internacionalização do ensino superior: um estudo sobre barreiras e possibilidades. Administração: Ensino e Pesquisa, Rio de Janeiro, v. 18, n. 1, p. 09–38, jan-abr 2017. DOI: http://dx.doi.org/10.13058/raep.2017.v18n1.458MARQUES, F. Experiência encerrada. Revista Pesquisa Fapesp, ed. 256, 27-29, jun. 2017. Disponível em http://revistapesquisa.fapesp.br/2017/06/19/experiencia-encerrada . Acesso em: 21 nov. 2017.MARTINS, V.; MONTAGUE, A.; SILVA, P. B. Cooperação internacional para mobilidade estudantil: o caso da Umesp e da Zuyd. Revista de Educação do Cogeime, ano 26, n. 50, jan/jun 2017.MOROSINI, M. C.; AMARAL, G. M. Avaliação da mobilidade acadêmica universitária: A perspectiva dos alunos intercambistas. In: SIMPÓSIO AVALIAÇÃO DA EDUCAÇÃO SUPERIOR, 2015, Porto Alegre. Anais... Porto Alegre, 17 e 18 set. 2015. OLIVEIRA, A. L.; FREITAS, M. E. Motivações para mobilidade acadêmica internacional: a visão de alunos e professores universitários. Educação em Revista, Belo Horizonte, v.32, n.03, p. 217-246, jul/set 2016. DOI: http://dx.doi.org/10.1590/0102-4698148237PEREIRA, V. Relatos de uma viagem: uma análise feita pelos bolsistas sobre o programa Ciência Sem Fronteiras. Revista Perspectivas do Desenvolvimento: um enfoque multidimensional, v. 03, no 4, jul. 2015.PROLO, I.; VIEIRA, R. C. O programa Ciência sem Fronteiras e as Universidades Brasileiras: Uma política pública a celebrar? In: Seminários em Administração (SEMEAD), XX, 2017, LOCAL. Anais..., nov. 2017. ISSN 2177-3866.SÁ, C. M. The Rise and Fall of Brazil’s Science Without Borders. International Higher Education, n.85, p.17-18, 2016. STALLIVIERI, L. As dinâmicas de uma nova linguagem intercultural na mobilidade acadêmica internacional. 2009. 235f. Tese (Doutorado em Línguas Modernas). Universidade Del Salvador, Buenos Aires, Argentina, 2009.SANTOS, S. R. et al. Turismo e intercâmbio: contribuições para a formação discente nos cursos de graduação das instituições de ensino superior de São Luís, Maranhão. Cultur, ano 08, n. 2, jul. 2014.SEHNEM, P. R.; LUNA, J. M. F. Os egressos do Programa Ciência sem Fronteiras pela percepção dos seus professores. Revista Eletrônica de Educação, v. 12, n. 1, p. 104-119, jan./abr., 2018. DOI: http://dx.doi.org/10.14244/198271991919UNITED NATIONS ORGANIZATION FOR EDUCATION, SCIENCE AND CULTURE (UNESCO). Recueil des donneés mondiales sur l'éducation: statistiques comparées sur l'éducation dans le monde. Montreal: Unesco, 2009. Dispo­nível em: http://www.uis.unesco.org/Library/Documents/ged09-fr.pdf Acesso em: 01 abri 2019.e3633105

Background: The World Health Organization (WHO) has approved the use of two new drugs, namely Bedaquiline (Bdq) and Delamanid (Dlm), for treatment of Drug Resistant Tuberculosis (DR-TB). One of the concerns raised with the use of these drugs was QT-interval prolongation. This condition could be serious and life threatening. Hence, knowing the magnitude and its management is very important. This case series identifies the incidence and discusses the management of clinically significant QT-interval prolongation amongst a cohort of patients who have been on these medicines. Materials and Methods: Patients with reports of high grade QT-Interval prolongation (i.e. Grade-3 and Grade-4) were identified from the cohort of 265 patients enrolled on bedaquiline and/or delamanid and discussion is made on the pattern, severity and management of each cases identified. Results: Only 4 (1.5%) out of all 265 patients enrolled on Bedaquiline and/or Delamanid have developed high grade QT-Interval prolongation. And all are managed without permanent discontinuation of both drugs. Conclusion: The Incidence of clinically significant QTcF-interval prolongation among DR-TB patients taking bedaquiline and /or delamanid in Lesotho is low. And almost all cases can be managed with more frequent Electrocardiogram (ECG) monitoring and management of other possible causes of QT-interval prolongation without the need to stop one or both drugs permanently.

Les relations entre la France et la Yougoslavie pendant la p?riode o? cette derni?re ?tait dirig?e par Tito, ?taient marqu?es d?abord par l?aide yougoslave aux in?surg?s alg?riens, et ensuite par le refus de g?n?rale De Gaule de rencontrer le pr?sident Yougoslave. L?aide aux FLN alg?rien s?inscrivait dans la politique de non-alignement de Tito dont un aspect important ?tait la coop?ration avec les pays musulmans dans le Tiers Mondes, facilit? en partie par les liens mis en place entre les pays musulmans et les Musulmans Yougoslaves. G?n?ral De Gaule, consid?rait le sort que Tito avait r?serv? ? g?n?ral Mihailovic comme inacceptable, et estimait en plus que la f?d?ra?tion yougoslave en tant que telle est une structure ?tatique plus que fragile.

Rhamnus alaternus L. (evergreen buckthorn), family Rhamnaceae, is a small, hardy shrub from Mediterranean regions grown for its ornamental persistent green or variegated foliage. Chlorotic oak leaf or ringspot symptoms on R. alaternus leaves have been observed in southern France (Bellegarde, Gard department in 1998; Fanjaux, Aude department in 2000; and Saint-Jean-Cap-Ferrat, Alpes-Maritimes department in 2002). Samples from these three localities revealed the presence of Alfalfa mosaic virus (AMV) due to (i) the symptoms observed in an inoculated diagnostic host range previously described (1), (ii) observation of typical bullet-shaped virion particles of different sizes with transmission electron microscopy, (iii) nonpersistent transmission to Nicotiana tabacum cv. Xanthi-nc by Myzus persicae, and (iv) positive reaction in double-antibody sandwich-enzyme-linked immunosorbent assays (DAS-ELISA) to antibodies raised against AMV (gift of G. Marchoux). In addition, in Fanjaux, Viburnum tinus L. plants located close to the infected R. alaternus plants were also infected by AMV and exhibited typical intense calico mosaics (3). The close species, R. frangula L., was previously identified as a natural host for AMV in Italy (2). Following isolation from local lesions on Vigna unguiculata, the Fanjaux isolate was grown in cv. Xanthi-nc plants, where it induced a severe mosaic and stunting of the plants, and inoculated to 2-year-old virus-free R. alaternus plants either mechanically or with M. persicae (10 plants each). Plants were subsequently kept in an insect-proof greenhouse. At 8 and 12 months postinoculation, only one aphid-inoculated plant showed symptoms on young leaves and was AMV-positive in DAS-ELISA, while no mechanically infected plants were infected. This low infection level together with the rare observation of symptoms in natural conditions suggest that R. alaternus is not frequently infected by AMV. References: (1) L. Cardin and B. Moury. Plant Dis. 84:594, 2000. (2) F. Marani and L. Giunchedi. Acta Hortic. 59:97, 1976. (3) N. Plese and D. Milicic. Phytopathol. Z. 72:219, 1971.

Dothistroma needle blight (DNB), also known as red band needle blight, is an important fungal disease of Pinus spp. that occurs worldwide. On the basis of molecular and morphological studies of the anamorphic stage, Barnes et al. (1) showed that two closely related species were involved in DNB: Dothistroma septosporum (Dorog.) Morelet and D. pini Hulbary. D. septosporum (teleomorph: Mycosphaerella pini Rostr.) has a worldwide distribution and is reported as the species that caused past epidemics of DNB. This species is reported on more than 80 different pine species, and Pinus radiata D. Don (Monterey pine) is classified as a highly or moderately susceptible species, depending on the published sources (4). D. pini (telemorph: unknown) was initially found on needles of P. nigra J. F. Arnold collected from 1964 to 2001 in the north central United States (Minnesota, Nebraska, and Michigan). It was subsequently found in Ukraine and southwestern Russia, where it has been associated with the emergence of DNB on P. nigra subsp. pallasiana (Lamb.) Holmboe, in Hungary on P. nigra, and in Russia on P. mugo Turra (1). In France, D. pini was reported for the first time on P. nigra, and was sometimes found in association with D. septosporum on the same needles (3). Later on, a more intensive survey of DNB was launched in France and 216 stands of Pinus sp. were studied. D. septosporum and D. pini were detected in 133 and 123 stands, respectively. Both species co-occurred in 40 stands but D. pini was only found on P. nigra (subsp. laricio and austriaca) (2). Up to now, D. pini was therefore only reported on European pine species, mainly on the different allopatric subspecies belonging to the black pine complex and on one occasion on P. mugo, which belongs to the same section and subsection as P. nigra. In March 2011, typical symptoms of DNB (needles with orangey-red brown distal ends, dark red bands, and green bases; small and black fruit bodies within the bands) were observed in a 50- to 60-year old P. radiata stand of ~3 ha located in Pyrénées Atlantiques close to the Spanish border (1°36′08″ W, 43°19′51″ N). The density of pine was relatively low and patches of natural regeneration were present. Although nearly all of the trees showed DNB symptoms, less than 50% of their needles were affected by the disease. In this stand, needles showing typical DNB symptoms were randomly taken from four pines and mixed together to form a single sample for analysis. Total DNA was extracted from symptomatic needle pieces. The presence of D. pini was confirmed by a specific multiplex real-time PCR analysis using the D. pini-specific primers/probe combination DPtef-F1-/R1/-P1 (3), and by sequencing a D. pini-specific amplicon generated by another conventional PCR (3) using DPtef-F/DPtef-R primers (GenBank Accession KC853059) (3). D. septosporum was not detected in the sample. To our knowledge, this is the first report worldwide of D. pini on P. radiata, a pine species largely planted in Spain and in the Southern Hemisphere. This is also the first report of this pathogen on a non-European pine species. The original native range and the host range of D. pini remain unknown and there is currently no data about host preferences or aggressiveness on different pine species. References: (1) I. Barnes et al. For. Pathol. 41:361, 2011. (2) B. Fabre et al. Phytopathology 102:47, 2012. (3) R. Ioos et al. Phytopathology 100:105, 2010. (4) M. Watt et al. For. Ecol. Manage. 257:1505, 2009.

Pelargonium zonate spot virus (PZSV) was first isolated from tomato in southern Italy in 1982 (1) and later was also reported from Spain (3) and France (2). Infected tomato plants showed stunting, malformation, yellow rings and line patterns on the leaves, and concentric chlorotic ringspots on the stems. In June of 2006, more than 100 tomato (Lycopersicon esculentum Mill.) plants exhibiting symptoms similar to PZSV were observed in seven acres of tomato fields in Yolo County, California. The causal agent was mechanically transmitted to several indicator species. Symptoms on infected plants included local lesions on Beta macrocarpa, Chenopodium amaranticolor, C. capitatum, C. quinoa, Cucumis melo, Cucurbita pepo, and Tetragonia expansa, and systemic infection on Capsicum annuum, Chenopodium murale, L. esculentum, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum, Physalis floridana, and P. wrightii. Two field-infected tomato plants and one each of the mechanically inoculated host plant were positive with double-antibody sandwich (DAS)-ELISA using a commercial PZSV IdentiKit (Neogen Europe Ltd., Ayr, Scotland, UK). Partially purified virions stained with 2% uranyl acetate contained spherical to ovate particles. The particle diameters ranged between 25 and 35 nm. Published sequences of PZSV (GenBank Accession Nos. NC_003649 for RNA1, NC_003650 for RNA2, and NC_003651 for RNA3) were used to design three sets of primer pairs specific for PZSV RNA1 (R1-F: 5′ TGGCTGGCTTTTTCCGAACG 3′ and R1-R: 5′ CCTAATCTGTTGGTCCGAACTGTC 3′), RNA2 (R2-F: 5′ GCGTGCGTATCATCAGAAATGG 3′ and R2-R: 5′ ATCGGGAGCAG AGAAACACCTTCC 3′), and RNA3 (R3-F: 5′ CTCACCAACTGAAT GCTCTGGAC 3′ and R3-R: 5′ TGGATGCGTCTTTCCGAACC 3′) for reverse transcription (RT)-PCR tests. Total nucleic acids were extracted from field-infected tomato plants and partially purified virions for RT-PCR. RT-PCR gave DNA amplicons of the expected sizes. The DNA amplicons were gel purified and sequenced. The sequenced amplicons had 92, 94, and 96% nt sequence identity to PZSV RNA1, RNA2, and RNA3, respectively. The symptomatology, serology, particle morphology, and nucleotide sequences confirm the presence of PZSV in a tomato field in California. To our knowledge, this is the first report of the occurrence of PZSV in the United States. References: (1) D. Gallitelli. Ann. Appl. Biol. 100:457, 1982. (2) K. Gebre-Selassie et al. Plant Dis. 86:1052, 2002. (3) M. Luis-Arteaga et al. Plant Dis. 84:807, 2000.