Journal articles on the topic 'F.N.D.I.R. (Organization : France)'

Abstract. Motherhood, listed by the World Health Organization as a period of fragility and vulnerability, involves significant changes at the individual, family and social level. Becoming a mother entails a number of risk factors to take into account. It is therefore necessary to carry out studies on general populations not suffering from psychopathological disorders to better understand these risk factors linked to motherhood. This study was carried out in France with a nonconsulting population in the postnatal phase ( N = 30) using the Rorschach test, as it presents numerous advantages to appreciate the psychic and corporeal transformations linked to birth. The quantitative results of the test were compared with recently updated norms ( De Tychey et al., 2012 ). Eight values of the psychogram remained normative (F%, F+%, W%, Dd%, M, C, H%, P) reflecting the characteristics of a general population; conversely, eight other values of the psychogram (R, D%, S%, A%, RC%, m, E, Anguish Index%) differed significantly from general population norms. These results increase knowledge to help appreciate the complexity of the psychic processes at work during the postnatal period, and to prevent psychopathological disorders. It is thus possible to distinguish these disorders from those that are transitory and classically linked to the upheaval caused by the onset of motherhood.

With the aim of understanding the insertion of higher education into a new context of organization of society and State, which is managed according to the New Public Management, this work presents a comparative historical study of the organization of French and Brazilian higher education. It is concluded that the French adherence to the New Public Management is based on the knowledge economy, while the Brazilian one is based on State size reduction along the lines of the Washington Consensus; in addition, higher education institutions in both countries are organized to participate in competitions: in France, the international competition promoted by rankings, and in Brazil, the market competition.ResumoCom o objetivo de compreender a inserção do ensino superior dentro de um novo contexto de organização da sociedade e do Estado, gerido pela Nova Gestão Pública, o trabalho apresenta um estudo histórico comparativo da organização do ensino superior brasileiro e o francês. Conclui-se que a adesão francesa à Nova Gestão Pública tem como norte a economia do conhecimento, e a brasileira, a redução do Estado nos moldes do Consenso de Washington; e que as instituições de ensino superior nos dois países são organizadas para participarem de concorrências: na França, a internacional promovida pelos ranqueamentos, no Brasil, a mercantil.Palavras-chave: Ensino superior brasileiro, Ensino superior francês, Nova gestão pública, Universidade.Keywords: Brazilian higher education, French higher education, New public management, University.ReferencesAEBISCHER, S. Réinventer l'école, réinventer l'administration. Une loi pédagogique et managériale au prisme de ses producteurs. Politix, n. 98, n.2 p. 57-83 2012/2.AERES. Repères historiques. Agence d’évaluation de la recherche et de l’enseignement supérieur. Disponível em: <www.aeres-evaluation.fr/Agence/Presentation/Reperes-historiques>. Acesso em: 17 nov. 2016.AMARAL, N. C. O vínculo avaliação-regulação-financiamento nas IES brasileiras: desafios para a gestão institucional. Revista Brasileira de Política e Administração da Educação, v.27, n.1 p. 95-108, jan./abr. 2011.ATTALI, J. Rapport Pour un modèle européen d’enseignement supérieur. Paris: Ministère de l'éducation nationale, de la recherche et de la technologie, 1998.AUST, Jérôme ; CRESPY, Cécile, Napoléon renversé ? Institutionnalisation des Pôles de recherche et d'enseignement supérieur et réforme du système académique français. Revue française de science politique : Paris 2009/5 (Vol. 59), p. 915-938.BARREYRO, G. B.; ROTHEN, J. C. Para uma história da avaliação da educação superior brasileira: análise dos documentos do PARU, CNRES, GERES e PAIUB. Avaliação. Campinas - Sorocaba/SP, v.13, n.1, p. 131-152, mar 2008.BARREYRO, G. B.; ROTHEN, J. C. O Nupes e a avaliação da educação superior: concepções, propostas e posicionamentos públicos. In: CATANI, A. M.; SILVA JR., J. R.; MENEGHEL, S. A cultura da universidade pública brasileira. São Paulo: Xamã, 2011.BARROSO, H. M.; FERNANDES, I. R. Mantenedoras educacionais privadas: Histórico, organização e situação jurídica. Rio de Janeiro: Observatório Univesitário, 2007.BEZES, P. Réinventer l’État: Les réformes de l’administration française (1962-2008). Paris: Presses Universitaires de France, 2009.BOLTANSKI, L.; CHIAPELLO, È. Le nouvel esprit du capitalisme. Paris: Gallimar, 2011.BRESSER-PEREIRA, L. C. A crise da América Latina: consenso de Washington ou crise fiscal? Pesquisa e Planejamento Econômico. Brasília, v. 21. n.1, p. 3-23, abr 1991.BRESSER-PEREIRA, L. C. Plano Diretor da Reforma do Aparelho do Estado. Brasília. 1995.BRUNETIÈRE, J.-R. Les indicateurs de la loi organique relative aux lois de finances (LOLF): une occasion de débat démocratique? Revue française d'administration publique, v. 117 n. 1, p. 95-111, 2006/1.CALLON, M. Éléments pour une sociologie de la traduction la domestication des coquilles Saint-Jacques et des marins-pêcheurs dans la baie de Saint-Brieuc. L’année sociologique, v. n. 36, p. 170-208, 1986.CASTRO, A. M. D. A.; PEREIRA, R. L. D. A. Contratualização no ensino superior: um estudo à luz da Nova Gestão Pública. Acta Scientiarum. Maringá, v. 36, n. 2, p. 287-296. jul.- dez. 2014.CATANI, A. M.; HEY, A. P.; GILIOLI, R. D. S. P. PROUNI: democratização do acesso às Instituições de Ensino Superior? Educar. Curitiba, n. 28, p. 125-140, 2006.CDEFI, Conférence de Directeurs des Écoles Françaises. Les écoles Françaises d’ingénieurs: trois siècles d’histoire, sd. Disponível em: <www.cdefi.fr/files/files/Historique%20des%20%C3%A9coles%20fran%C3%A7aises%20d%27ing%C3%A9nieurs.pdf.>. Acesso em: 11 octobre 2016.CHARLE, C. Les Universités entre démocratie et élites de la IIIe à la V République. In: LEMIÈRE, J. L’université: situation actuelle. Paris: L’Harmattan, 2015.CHARLE, C.; VERGER, J. Histoire des universités: XIIe – XXIe siècle. Paris: PFU, 2012.CIP, Comité d’initiative et de propositions. Rapport des Etats Généraux de la recherche. Paris, 2004.CNPQ. A criação. Disponível em www.cnpq.br/web/guest/a-criacao/ acesso 10/10/2017CONVERT, B. ; GUGENHEIM, F. ; JACUBOWSKI, S.. La « professionnalisation » de l’université, trente ans avant la loi LRU : l’exemple de l’université de Lile. in Thierry Chevaillier et Christine Musselin (dir.), Réformes d’hier et réformes d’aujourd’hui : l’enseignement supérieur recomposé. Rennes : Presses Universitaires de Rennes, 2014. P. 61 – 80.CONSEIL EUROPEEN. Conseil Européen Lisbonne 23 et 24 mars 2000: conclusions de la présidence. Lisbone, p. 41. 2000.CROCHE, S. Qui pilote le processus de Bologne? Education et sociétés, v.18, n. 2, p. 203-217, 2006.CROCHE, S. Évolution d'un projet d'Europe sans Bruxelles: Le cas du processus de Bologne. Education et sociétés, v. 24, n. 2, p. 11-27, 2009.CUNHA, L. A. A universidade brasileira nos anos oitenta: sintomas de regressão institucional. Em aberto. Brasília, ano 8, n 43, p. 3-9, jul./set. 1989.CUNHA., L. A. A universidade temporã: o ensino superior da Colônia à Era de Vargas. Rio de Janeiro: Civilização Brasileira, 1980.DÉCLARATION DE BOLOGNE. L’espace européen de l’enseignement supérieur. Bologne. 1999.DEROUET, J. L. Entre la récupération des savoirs critiques et la construction des standards du management libéral : bougés, glissements et déplacements dans la circulation des savoirs entre recherche, administration et politique en France de 1975 à 2005. Revue Française de Pédagogie, Paris, v. n. 154, p. 5-18, jan/fev 2006.DURHAM, E. Educação superior pública e privada. São Paulo: NUPES, 2003.ENQA. European Association for Quality Assurance in Higher Education. Standards and Guidelines for Quality Assurance in the European Higher Education Area. 3ed. Helsinki. 2009.EUR-LEX. Glossaire des synthèses: Méthode ouverte de coordination. Disponível em: <http://eur-lex.europa.eu/summary/glossary/open_method_coordination.html?locale=fr>. Acesso em: 21 out. 2017.EYRAUD, C.; MIRI, M. E.; PEREZ, P. Les enjeux de quantification dans la LOLF. Le cas de l'enseignement supérieur. Revue Française de Socio-Économie, 2011. p. 147-168. vol. 7, no. 1, p. 147-168, 2011,FÁVERO, M. D. L. D. A. A universidade brasileira: em busca de sua identidade. Petrópolis: Vozes, 1977.FIFA. Status de la FIFA. Zurich: FIFA, 2016.FRANCE. Loi relative à la création de l'Université, 10 mai 1806. Disponível em: <www.inrp.fr/edition-electronique/lodel/dictionnaire-ferdinand-buisson/document.php?id=3762 >. Acesso em: 07 jun. 2016.FRANCE. Loi relative à la constitution des universités. 10 Juillet 1896. Disponível em: <fr.wikisource.org/wiki/Loi_du_10_juillet_1896_relative_%C3%A0_la_constitution_des_universit%C3%A9s >. Acesso em: 06 out. 2016.FRANCE. Loi n.84-52 sur l’enseignement supérieur. 26 Janvier 1984. Disponível em: <www.legifrance.gouv.fr/affichTexte.do?cidTexte=JORFTEXT000000692733>>. Acesso em: 13 ago. 2016.FRANÇE. Loi n°89-486 d'orientation sur l'éducation. 10 juillet 1989. Disponível em: <www.education.gouv.fr/cid101274/loi-d-orientation-sur-l-education-n-89-486-du-10-juillet-1989.html>. Acesso em: 17 nov 2016.FRANCE. Code de la recherche Modifications du code de la recherche prenant en compte le Projet de loi de programme pour la recherche. Texte définitif adopté le 4 avril 2006. 2006. Disponível em: <www.sg.cnrs.fr/daj/textes/reglementation/docs/code_recherche_consolide_0504.pdf >. Acesso em: 17 nov 2016.FURTADO, C. Formação econômica do Brasil. São Paulo: Nacional, 1972.GERMANO, J. W. Estado Militar e educação no Brasil: 1964-1965. 2ª. ed. São Paulo: Cortez, 1994.GOULARD, F. L’enseignement supérieur en France, état des lieux et propositions. La Documentation française. Paris: Ministère de l'enseignement supérieur et de la recherche, 2007.GUILLAUME, J. Université – Les universités de l’ancien régime. In: BUISSON, F. Nouveau dictionnaire de pédagogie et d’instruction primaire. 1911. Disponível em: <www.inrp.fr/edition-electronique/lodel/dictionnaire-ferdinand-buisson/document.php?id=3764>. Acesso em: 07 jun. 2016.JANET, M. Le Gouvernement des universités au Québec et en France : Conceptions de l’autonomie et mouvements vers un pilotage stratégique. In: CHEVAILLIER, T.; MUSSELIN, C. Réformes d’hier et réformes d’aujourd’hui, l’enseignement supérieur recomposé. Rennes: Presses Universitaires de Rennes, 2014. p. p. 21-49.LEHER, R. Projetos e modelos de autonomia e privatização das universidades públicas. Revista da ADUEL. Londrina, p. 7-20 set. 2003.LEITE, R. D. R. Análise do Conflito entre a Norma Constitucional (artigo 217) e Norma Internacional (artigo 61, Estatuto FIFA). 2008. Disponível em https://universidadedofutebol.com.br/analise-do-conflito-entre-a-norma-constitucional-artigo-217-e-norma-internacional-artigo-61-estatuto-fifa/ acesso em 20/10/2017MELLO, J. M. C. D. O capitalismo tardio: contribuição à revisão crítica da formação e desenvolvimento da economia brasileira. São Paulo: Brasiliense, 1998.MUSSELIN, C. La longe marche des universités françaises. Paris: Presses Universitaires de France, 2001.NORMAND, R. The Changing Epistemic Governance of European Education: The fabrication of the Homo Academicus Europeanus, Cham (ZG)/Switzerland: Springer, 2016. 247 p.OGIEN, Al. « La valeur sociale du chiffre. La quantification de l'action publique entre performance et démocratie », Revue Française de Socio-Économie. Paris, 2010/1 (n° 5), p. 19-40.PAIN, A. Por uma universidade no Rio de Janeiro. In: SCHWARTZMAN, S. Universidades e Instituições Científicas no Rio de Janeiro. Brasília: CNPq, 1982.PECRESSE, V. Opération Campus: rénovation de 10 projets de campus. Communiqué - 6.02.2008. Disponível em: <www.enseignementsup-recherche.gouv.fr/cid20924/operation-campus-renovation-de-10-projets-de-campus.html>. Acesso em: 21 out. 2017.PICARD, J. F.; PRADOURA. La longue marche vers le CNRS (1901 – 1945). Cahiers pour l’histoire du CNRS (1988 - 1), 2009. Disponível em: <www.histcnrs.fr/pdf/cahiers-cnrs/picard-pradoura-88.pdf>. Acesso em: 21 out. 2017.PROST, A. Éducation société et politiques: une histoire de l’enseignement en France, de 1945 à nous jours. Sueil: Paris, 1992.RAMUNI, G. Le CNRS : principal enjeu de la politique scientifique. La revue pour l’histoire du CNRS, Paris, n. 1, nov. 1999. 1-21.RAVINET, P. La coordination européenne « à la bolognaise »: réflexions sur l'instrumentation de l'espace européen d'enseignement supérieur. Revue française de science politique, V. 61 n. 1, p. 23-49, 2011.ROMANELLI, O. D. O. História da educação no Brasil: 1930-1973. 3a. ed. Petrópolis/RJ: Vozes, 1982.ROTHEN, J. C. O vestibular do Provão. Avaliação. Campinas, v. 8 n 1, p. 27-37, 2003.ROTHEN, J. C. Funcionário intelectual do Estado: um estudo de epistemologia política do Conselho Federal de Educação. 2004. 270f. Tese (Doutorado em Educação) - Unimep. Piracicaba.ROTHEN, J. C. A universidade brasileira na Reforma Francisco Campos de 1931. Revista Brasileira de História da Educação, v. 17, p. 141-160, mai/out 2008.ROTHEN, J. C. et al. A divulgação da avaliação da educação na imprensa escrita: 1995-2010. Avaliação. Campinas: Sorocaba, v. 20, n. 3, p. 634-664, nov. 2015.SALEM, T. Do Centro D. Vital à Universidade Católica. In: SCHWARTZMA, S. Universidades e Instituições Científicas no Rio de Janeiro. Brasília: CNPq, 1982.SAMPAIO, H. O setor privado de ensino superior no Brasil: continuidades e transformações. Revista Ensino Superior Unicamp. Campinas, n. 4, p. 28-43, out. 2011.SARKOZY, Nicolas. Lettre de mission de M. Nicolas Sarkozy, Président de la République, adressée à Mme Valérie Pécresse, ministre de l'enseignement supérieur et de la recherche, sur les priorités en matière d'enseignement supérieur et de recherche, le 5 juillet 2007. Disponible en discours.vie-publique.fr/notices/077002458.html.SAVIANI, D. Ensino público e algumas falas sobre universidade. São Paulo: Cortez, 1984.SGUISSARDI, V. A avaliação defensiva no “modelo CAPES de avaliação” – É possível conciliar avaliação educativa com processos de regulação e controle do Estado? Perspectiva. Florianópolis, v. 24, n. 1, p. 49-88, jan/un. 2006a.SGUISSARDI, V. Universidade no Brasil: dos modelos clássicos aos modelos de ocasião? In: MOROSINI, M. A universidade no Brasil: concepções e modelos. Brasília: INEP, 2006b.SGUISSARDI, V. Estudo diagnóstico da política de expansão da (e acesso à) educação superior no Brasil. 2002-2012. OEI. Brasília, p. 191. 2014.SILVA JR., J. D. R.; KATO, F. B. G.; FERREIRA, L. R. O papel da CAPES e do CNPq após a reforma do Estado Brasileiro: Indução de pesquisa e da produção de conhecimento. In: ALMEIDA, M. D. L. P. D.; CATANI, A. M. Educação superior iberoamericana: uma análise para além das perspectivas mercadológicas da produção de conhecimento. Buenos Aires: CLACSO, 2015.VASCONCELLOS, M. Enseignement supérieur en France. Paris: La découverte, 2006.VIE PUBLIQUE. Les autorités administratives indépendantes, 2012. Disponível em: <http://www.vie-publique.fr/decouverte-institutions/institutions/administration/organisation/etat/aai/qu-est-ce-qu-autorite-administrative-independante-aai.html>. Acesso em: 21 out. 2017.

Introdução: A queilite actínica (QA) é uma desordem potencialmente maligna associada à exposição crônica à luz solar como principal fator etiológico. A QA tem como principal sítio de acometimento o vermelhão do lábio inferior, apresentando características clínicas marcantes. Porém, a análise histopatológica desta lesão merece um enfoque especial pelas características bastante expressivas para o potencial de malignidade. Assim, para essa análise, são elencados dois sistemas principais: o sistema da Organização Mundial da Saúde (OMS), e o binário. Objetivo: Realizar uma revisão da literatura para demonstrar os pontos avaliados e o valor preditivo dos sistemas de gradação histológica em QA. Metodologia: Trata-se de um estudo de revisão bibliográfica, utilizando artigos da base de dados da SCIELO e PUBMED, encontrados com o uso dos descritores: “actinic cheilitis”, “WHO system”, “binary system”, “oral potentially malignant disorders”, “histological features in actinic cheilitis”, fazendo uso do operador booleano “AND”. Conclusão: Diante da revisão realizada, percebeu-se a importância da adoção dos sistemas de gradação histológica da OMS, e o binário para uma análise minuciosa de lesões de QA, que apresentam potencial de malignidade. Ademais, constatou-se o favorecimento do sistema binário na redução da subjetividade entre os patologistas quanto à gradação das avaliações histopatológicas. Descritores: Queilite; Patologia Bucal; Neoplasias Labiais; Classificação; Diagnóstico. Referências Lopes MLDS, Silva Junior FLS, Lima KC, Oliveira PT, Silveira EJD. Clinicopathological profile and management of 161 cases of actinic cheilitis. An Bras Dermatol. 2015;90(4):347-50. Arnaud RR, Soares MSM, Paiva MAF, Figueiredo CRLV, Santos MGC, Lira CC. Queilite actínica: avaliação histopatológica de 44 casos. Rev Odontol UNESP. 2014;43(6):384-89. Pilati S, Bianco BC, Vieira D, Modolo F. Histopathologic features in actinic cheilitis by the comparison of grading dysplasia systems. Oral Dis. 2017 Mar;23(2):219-224. Pilati S, Bianco BC, Vieira D, Modolo F. Histopathologic features in actinic cheilitis by the comparison of grading dysplasia systems. Oral Dis. 2017;23(2):219-24. Maia HCM, Pinto ANS, Pereira JS, Medeiros AMC, Silveira EJD, Miguel MCC. Lesões orais potencialmente malignas: correlações clínico-patológicas. Einstein. 2016;14(1): 35-40. Savage NW, McKay C, Faulkner C. Actinic cheilitis in dental practice. Aust Dent J. 2010; 55(Suppl 1):78-84. Vieira RA, Minicucci EM, Marques ME, Marques SA. Actinic cheilitis and squamous cell carcinoma of the lip: clinical, histopathological and immunogenetic aspects. An Bras Dermatol. 2012; 87(1):105-14. Dancyger A, Heard V, Huang B, Suley C, Tang D, Ariyawardana A. Malignant transformation of actinic cheilitis: A systematic review of observational studies. J Investig Clin Dent. 2018; 9(4):e12343. de Santana Sarmento DJ, da Costa Miguel MC, Queiroz LM, Godoy GP, da Silveira EJ. Actinic cheilitis: clinicopathologic profile and association with degree of dysplasia. Int J Dermatol. 2014; 53(4):466-72. Wood NH, Khammissa R, Meyerov R, Lemmer J, Feller L. Actinic cheilitis: a case report and a review of the literature. Eur J Dent. 2011; 5(1):101-6. Mello FW, Melo G, Modolo F, Rivero ER. Actinic cheilitis and lip squamous cell carcinoma: Literature review and new data from Brazil. J Clin Exp Dent. 2019;11(1):e62-9. Warnakulasuriya S, Johnson NW, van der Waal I. Nomenclature and classification of potentially malignant disorders of the oral mucosa. J Oral Pathol Med. 2007;36(10):575-80. Paiva MAF, Soares MSM, Figueiredo CRLV, Luna AH, Oliveira VEN, Brasil Júnior O. Associação entre displasia e inflamação em queilite actínica. J Bras Patol Med Lab. 2012; 48(6):455-58. Warnakulasuriya S, Reibel J, Bouquot J, Dabelsteen E. Oral epithelial dysplasia classification systems: predictive value, utility, weaknesses and scope for improvement. J Oral Pathol Med. 2008;37(3):127-33. Câmara PR, Dutra SN, Takahama Júnior A, Fontes K, Azevedo RS. A comparative study using WHO and binary oral epithelial dysplasia grading systems in actinic cheilitis. Oral Dis. 2016; 22(6):523-9. Kujan O, Oliver RJ, Khattab A, Roberts SA, Thakker N, Sloan P. Evaluation of a new binary system of grading oral epithelial dysplasia for prediction of malignant transformation. Oral Oncol. 2006;42(10):987-93. Nagata G, Santana T, Queiroz A, Caramez RH, Trierveiler M. Evaluation of epithelial dysplasia adjacent to lip squamous cell carcinoma indicates that the degree of dysplasia is not associated with the occurrence of invasive carcinoma in this site. J Cutan Pathol. 2018. doi: 10.1111/cup.13270. Mello FW, Miguel AFP, Dutra KL, Porporatti AL, Warnakulasuriya S, Guerra ENS, Rivero ERC. Prevalence of oral potentially malignant disorders: A systematic review and meta-analysis. J Oral Pathol Med. 2018;47(7):633-40. Izumo T. Oral premalignant lesions: from the pathological viewpoint. Int J Clin Oncol. 2011;16(1):15-26. Kujan O, Khattab A, Oliver RJ, Roberts SA, Thakker N, Sloan P. Why oral histopathology suffers inter-observer variability on grading oral epithelial dysplasia: an attempt to understand the sources of variation. Oral Oncol. 2007; 43(3):224-31. El-Naggar AK, Chan JKC, Grandis JR, Takata T, Slootweg PJ. World Health Organization Classification of Head and Neck Tumours. WHO/IARC Classification of Tumours 2017; 4th ed. Lyon, France: IARC Press. R SA, B N P, Hegde U, K U, G S, G K, Sil S. Inter- and Intra-Observer Variability in Diagnosis of Oral Dysplasia. Asian Pac J Cancer Prev. 2017;18(12):3251-54. Olinici D, Cotrutz CE, Mihali CV, Grecu VB, Botez EA, Stoica L, Onofrei P, Condurache O, Dimitriu DC. The ultrastructural features of the premalignant oral lesions. Rom J Morphol Embryol. 2018;59(1):243-48.

Akinyele, T.A., 2011. Assessment of the antibacterial properties of n-Hexane extract of Cocos Nucifera and its interactions with some Conventional antibiotics. Masters Dissertation. University of Fort Hare, Alice. Alan´ıs, A.D., Calzada, F, Cervantes J.A., Torres, J., and Ceballos, G.M. 2005. Antibacterial properties of some plants used in Mexican traditional medicine for the treatment of gastrointestinal disorders, Journal of Ethnopharmacology. 100, 153–157. Alviano, W.S., Alviao, D.S., Diniz, C.G., Antoniolli, A.R., Alviano, C.S., Frias, L.M. 2008. In vitro antioxidant potential of medicinal plant extracts and their activities against oral bacteria based on Brazilian folk medicine. Arch Oral Biol. 53:545-552. Arora, R, Chawla, R, Marwah, R, Arora, P, Sharma R.K., Kaushik, V, Goel, R, Kaur, A, Silambarasan, M, Tripathi, R.P., and Bhardwaj, J.R. 2011. Corporation. Evidence-Based Complementary and Alternative Medicine. Hindawi Publishing. Bakhru, H.K. 2000. Foods That Heal. Orient Paper Backs, New Delhi. Batovska, I.D., Todorova, I.T., Tsvetkova I.V., and Najdenski H.M. 2009. Antibacterial Study of the Medium Chain Fatty Acids and Their 1- Monoglycerides: Individual Effects and Synergistic Relationships. Polish Journal of Microbiology. 58: 43- 47. Bolling, B.W., McKay, D.L., Blumberg, J.B. 2010. The phytochemical composition and antioxidant actions of tree nuts. Asia Pac J Clin Nutr; 19: 117-23. Conrado S. Dayrit. 2000. Read at the XXXVII Cocotech Meeting, Chennai, India Deb Mandal M, Mandal. S 2011. Coconut (Cocos nucifera L.: Arecaceae): In health promotion and disease Prevention. Asian Pacific Journal of Tropical Medicine, 241-247. Dyana, J.P., and Kanchana, G. 2012. Preliminary Phytochemical Screening of Cocos Nucifera L. Flowers, International Journal of Current Pharmaceutical Research, Vol 4, Issue 3. Effiong, G.S., Ebong, P.E., Eyong, E.U., Uwah, A.J., and Ekong, U.E. 2010. Amelioration of Chloramphenicol Induced Toxicity in Rats by Coconut Water, Journal of Applied Sciences Research, 6(4): 331-335. Esquenazi D, Wigg M.D, Miranda M.M.F.S., Rodrigues H.M., Tostes J.B.F., Rozental S, da Silva A.J.R. and Alviano, C.S 2002. Antimicrobial and antiviral activities of polyphenolics fromCocos nucifera Linn. (Palmae) husk fiber extract. Research in Microbiology 153: 647–652. Food and Agricultural Organization of the United Nations, Economic and Social Department. Statistics division (September 2, 2010). FAOSTAT- Production- Crops [Selected annual data]. Retrieved April 14, 2011 from the FAOSTAT database. Ifesan, B.O.T., Fashakin, J.F., Ebosele, F, and Oyerinde, A.S. 2013. Antioxidant and Antimicrobial Properties of Selected Plant Leaves, European Journal of Medicinal Plants 3(3): 465-473. Krishnamoorthy, M. and Arjun, P. 2012. Probiotic and antimicrobial activity of bacteria from fermented toddy of Cocos nucifera, J. Acad. Indus. Res. Vol. 1(3). Mandal S.M., Dey, S, Mandal, M, Sarkar, S, Maria-Neto, S. and Franco, O.L. 2009. Identification and structural insights of three novel antimicrobial peptides isolated from green coconut water. Peptides. 30. 633-637. Mariselvam, R, Ranjitsingh, A.J.A., Nandhini, U.R.A. and Kalirajan, K. 2013. Antihelmintic and antibacterial activity of Cocos nucifera tree inflorances crude extract. IJSID, 3 (2), 311-316. Mehlhorn H, Al-Quraishy S, Al-Rasheid KAS, Jatzlau A, and Abdel-Ghaffar F. Addition of a combination of onion (Allium cepa) and coconut (Cocos nucifera) to food of sheep stops Gastrointestinal Helminthic infections. Parasitol Res (2011) 108:1041–1046. Mendonça-Filho R.R, Rodrigues I.A, Alviano D.S, Santos A.L.S, Soares R.M.A, Alviano C.S, Lopes A H.C.S., Rosa M.S. 2004. Leishmanicidal activity of polyphenolic-rich extract from husk fiber of Cocos nucifera Linn. (Palmae) Research in Microbiology 155: 136–143. Mukherjee PK, Kumar SN and Heinrich M (2008). Plant Made Pharmaceuticals (PMPs)- Development of Natural Health Products from Bio-Diversity. Indian J. Pharm Educ. Res 42(2), 113-121. Nakatsuji, T, Kao M.C., Fang, J.Y., Zouboulis, C.C., Zhang, L, Gallo R.L. and Huang C.M. 2009. Antimicrobial Property of Lauric Acid against Propionibacterium acnes: Its Therapeutic Potential for Inflammatory Acne Vulgaris, Journal of Investigative Dermatology, Volume 129. NMCE. Report on Copra. National Multi-Commodity Exchange of India Limited; 2007, 1-14. O’Neil, C.E., Keast, D.R., Nicklas, T.A. and Fulgoni V.L. 2012. Out of-hand nut consumption is associated with improve nutrient intake and health risk markers in US children and adults: National Health and Nutrition Examination Survey 1999-2004. Nutr Res 32: 185–194. Ogbolu D.O., Oni AA, Daini OA, and A.P. Oloko 2007. In Vitro Antimicrobial Properties of Coconut Oil on Candida Species in Ibadan, Nigeria, J Med Food 10 (2), 384–387. Pushpan R, Kumari H, Nishteswar K and N Vishwanathan. 2013. Preliminary Phytochemcial Screening of Narikelapushpa (Flower of Cocos nucifera L.) Global Journal of Traditional Medicinal Systems, 2(2): 1-3. Singla R.K., Jaiswal N, Bhat V and Hitesh Jagani 2011. Antioxidant & Antimicrobial Activities of Cocos Nucifera Linn. (Arecaceae) Endocarp Extracts Indo Global Journal of Pharmaceutical Sciences; 1(4): 354-361. Taheri J.B., Espineli F.W., Lu H, Asayesh M, Bakshi M, Nakhostin M.R 2010. Antimicrobial effect of coconut flour on oral microflora: An in vitro study. Res J Biol Scs. 5(6): 456-459. Thaweboon S, Nakaparksin J, Thaweboon B.2011. Effect of Oil-Pulling on Oral Microorganisms in Biofilm Models, Asia Journal of Public Health, Vol. 2 No. 2. Venkataraman S, Ramanujam T.R, Venkatasubbu V.S. 1980. Antifungal activity of the alcoholic extract of coconut shell—Cocos nucifera Linn. J. Ethnopharmacol. 2: 291–293. Verma V, Bhardwaj A, Rathi S. and Raja R.B 2012. A Potential Antimicrobial Agent from Cocos nucifera mesocarp extract; Development of a New Generation Antibiotic. ISCA Journal of Biological Sciences. Vol. 1(2), 48-54.

The aim of this study was to describe the international academic mobility experienced by the Fishing Engineering students in other countries. The data was collected through an electronic semi-structured questionnaire hosted on an electronic platform by Google. A total of nine students answered the questionnaire, in which they chose countries such as France, Spain, Ireland, Canada, the United States and Australia to study abroad in. The student’s satisfaction with the Science without Borders Program (SwB) was extremely positive, where all the interviewees stated that they had learned the language from the hosting country. In relation to the negative aspects, 67% of the interviewees pointed out that they struggled to understand the language in the beginning of the academic mobility, and 78% of the students said that they missed their families during the student mobility period. In conclusion, the academic mobility performed by students from the Fishing Engineering course was rated as excellent, and as a unique and an enriching opportunity, both in professional and personal aspects.ResumoO trabalho teve como objetivo discutir sobre a mobilidade acadêmica vivenciada por estudantes de Engenharia de Pesca em outros países. A coleta de dados foi feita através de um questionário eletrônico semiestruturado, hospedado em uma plataforma eletrônica de formulários da Google. Um total de nove discentes respondeu ao questionário, realizando a mobilidade na França, Espanha, Irlanda, Canadá, Estados Unidos e Austrália. A satisfação dos estudantes com o Programa Ciência sem Fronteiras (CsF) foi positiva, todos os entrevistados afirmaram terem aprendido o idioma do país que escolheram. Em relação aos aspectos negativos, 67% dos entrevistados apontaram que tiveram dificuldades no entendimento do idioma do país no início da mobilidade acadêmica e 78% sentiram saudade da família no período da mobilidade. Concluindo, a mobilidade acadêmica realizada por discentes do Curso de Engenharia de Pesca foi classificada como excelente, sendo uma experiência única e enriquecedora tanto pelo lado profissional, quanto pessoal.Palavras-chave: Educação, Aprendizado, Internacionalização, Programa Ciência sem Fronteiras.Keywords: Education, Learning, Internationalization.ReferencesALTBACH, P. G. Comparative Higher Education: Knowledge, the University, and Development. Hong Kong: University of Hong Kong, p. 240, 1998.ANDRADE, B. P. S. O “Ciência sem Fronteiras” pelo olhar da comunidade acadêmica: O caso da Unifal-mg e da Unifei. 2018. 185f. Dissertação (Mestrado em Divulgação Científica e Cultural). Universidade Estadual de Campinas, Instituto de Estudos de Linguagem, Campinas, SP, 2018. AVEIRO, T. M. M. O programa Ciência sem Fronteiras como ferramenta de acesso à mobilidade internacional. Tear: Revista de Educação Ciência e Tecnologia, Canoas, v.3, n.2, 2014.BEINE, M.; NOEL, R.; RAGOT, L. Determinants of the international mobility of students. Economics of Education Review, mar. 2014. BETT, D. B. Jovens universitários e intercâmbio acadêmico. 2012. 34f. Monografia (Especialização em Psicologia terminalidade em Terapia Cognitiva e Comportamental). Universidade Federal do Rio Grande do Sul, Instituto de Psicologia, Porto Alegre, 2012.BRASIL. Decreto n.° 7.642, de 13 de dezembro de 2011, Institui o Programa Ciência sem Fronteiras. Diário Oficial da República Federativa do Brasil, Brasília, DF, n. 239, p. 7, seção1, 14 dez. 2011a.BRASIL. Ministério da Ciência, Tecnologia e Inovação. Ministério da Educação. Conselho Nacional de Desenvolvimento Científico e Tecnológico Coordenação de Aperfeiçoamento de Pessoal de Nível Superior. Programa Ciência sem Fronteiras: um programa especial de mobilidade internacional em ciência, tecnologia e inovação. Documento Conjunto CAPES-CNPq. Julho, 2011b. 67p. Disponível em: http://www.capes.gov.br/images/stories/download/ Ciencia-sem Fronteiras_DocumentoCompleto_julho2011.pdfBRASIL. Ministério Da Ciência Tecnologia e Inovação. Estratégia Nacional de Ciência, Tecnologia e Inovação 2012 – 2015: Balanço das Atividades Estruturantes de 2011. Brasília, DF, 2012. Disponível em: https://livroaberto.ibict.br/218981.pdf . Acesso em: 25 abr. 2018.BRASIL. Programa Ciência sem Fronteiras. Dados Chamadas Graduação Sanduíche 2011-2014. Brasília, 2014. Disponível em: http://www.cienciasemfronteiras.gov.br/web/csf/dados-chamadas-graduacao-sanduiche. Acesso em: 21 abr. 2018.BRASIL. Programa Ciência sem Fronteiras. Painel de Controle do Programa 2016. Disponível em: http://www.cienciasemfronteiras.gov.br/web/csf/painel-de-controle . Acesso em: 18 jul. 2018.BRUNO, R. C. et al. Mobilidade internacional para educação superior: perfil sociodemográfico e educacional de imigrantes. Almanaque Multidisciplinar de Pesquisa, Universidade Unigranrio, ano III, v.1, n.1, 2016.COMISSÃO DE CIÊNCIA E TECNOLOGIA, COMUNICAÇÃO E INFORMÁTICA. Senado Federal. Relatório. Brasília. 2015. Disponível em: http://legis.senado.leg.br/sdleg-getter/documento/download/9f8bccb3-c880-408c-9667-96582f07fa84 Acesso em: 20 maio 2018.CORREIA-LIMA, M. C.; RIEGEL, V. Mobilidade acadêmica made in South: refletindo sobre as motivações de estudantes brasileiros e colombianos. Magis Revista Internacional de Investigación en Educación, v.8, n.16, p.109-132, 2015. DOI: http://dx.doi.org/10.11144/Javeriana.m8-16.mamsCRUZ, V. X. A. PROGRAMA CIÊNCIA SEM FRONTEIRAS: Uma avaliação da política pública de internacionalização do ensino superior sob a perspectiva do Paradigma Multidimensional. Dissertação (Mestrado em Administração Pública). 2016. 209f. Universidade Federal de Goiás, Faculdade de Ciências e Tecnologia – FCT, Goiânia, GO, 2016.CUTTI, L. et al. Programa Ciência sem Fronteiras: relato de experiências. Revista Eletrônica de Educação, v.11, n.3, p.1020-1033, set./dez., 2017. DOI: http://dx.doi.org/10.14244/198271991897 DALMOLIN, I. S. et al. Intercâmbio acadêmico cultural internacional: uma experiência de crescimento pessoal e científico. Rev Bras Enferm, Brasília, v. 66, n.33. p. 442-447, 2013.FERREIRA, I.G.; CARREIRA, L. B.; BOTELHO, N. M. Mobilidade internacional na graduação em medicina: relato de experiência. ABCS Health Sci., v. 42, n.2, p.115-119, 2017. DOI: http://dx.doi.org/10.7322/abcshs.v42i2.1013INSTITUTE FOR INTERNATIONAL EDUCATION – IIE. Open Doors Report 2015: Fast Facts New York, 2015. Disponível em: https://www.iie.org/Research-and-Insights/Open-Doors/Fact-Sheets-and-Infographics/Fast-Facts. Acesso em: 15 nov. de 2017.INSTITUTE OF INTERNATIONAL EDUCATION – IIE. International student totals by place of origin, 2012/13 – 2015/16. Open Doors Report on International Educational Exchange, 2016. Disponível em: https://www.iie.org/Research-and-Insights/Open-Doors/Data/International-Students/Places-of-Origin. Acesso em: 15 nov. de 2017.INSTITUTE OF INTERNATIONAL EDUCATION – IIE. Open Doors Report 2017: Fast Facts Disponível em: https://www.iie.org/Research-and-Insights/Open-Doors/Fact-Sheets-and-Infographics/Fast-Facts. Acesso em: 01 ago. 2018.INTERNATIONAL TRADE ADMINISTRATION – ITA. 2016 Top Markets Report Education: Brazil Country Case Study. Disponível em: https://www.trade.gov/topmarkets/pdf/Education_Brazil.pdf. Acesso em: 15 nov. de 2017.KNIGHT, J. Internationalization remodeled: definition, approaches, and rationales. Journal of Studies in International Education, v. 1, p. 5-31, 2004.LIMA, M. C.; RIEGEL, V. A influência da mobilidade acadêmica sobre a formação dos jovens. UniRitter, Negócios e Talentos, v.2 , n.11, 2013.MAJID, S. et al. Motivations for studying abroad and adjustment challenges faced by international students in Singapore. Acad. J. Educ. Res., v.5, n.8, p. 223-235, 2017. DOI: http://dx.doi.org/10.15413/ajer.2017.0712MANÇOS, G. R.; COELHO, F. S. Internacionalização da Ciência Brasileira: subsídios para avaliação do programa Ciência sem Fronteiras. Revista Brasileira de Políticas Públicas e Internacionais, p.73, 2017.MARANHÃO, C. M. S.; DUTRA, C. I.; MARANHÃO, R. K. Internacionalização do ensino superior: um estudo sobre barreiras e possibilidades. Administração: Ensino e Pesquisa, Rio de Janeiro, v. 18, n. 1, p. 09–38, jan-abr 2017. DOI: http://dx.doi.org/10.13058/raep.2017.v18n1.458MARQUES, F. Experiência encerrada. Revista Pesquisa Fapesp, ed. 256, 27-29, jun. 2017. Disponível em http://revistapesquisa.fapesp.br/2017/06/19/experiencia-encerrada . Acesso em: 21 nov. 2017.MARTINS, V.; MONTAGUE, A.; SILVA, P. B. Cooperação internacional para mobilidade estudantil: o caso da Umesp e da Zuyd. Revista de Educação do Cogeime, ano 26, n. 50, jan/jun 2017.MOROSINI, M. C.; AMARAL, G. M. Avaliação da mobilidade acadêmica universitária: A perspectiva dos alunos intercambistas. In: SIMPÓSIO AVALIAÇÃO DA EDUCAÇÃO SUPERIOR, 2015, Porto Alegre. Anais... Porto Alegre, 17 e 18 set. 2015. OLIVEIRA, A. L.; FREITAS, M. E. Motivações para mobilidade acadêmica internacional: a visão de alunos e professores universitários. Educação em Revista, Belo Horizonte, v.32, n.03, p. 217-246, jul/set 2016. DOI: http://dx.doi.org/10.1590/0102-4698148237PEREIRA, V. Relatos de uma viagem: uma análise feita pelos bolsistas sobre o programa Ciência Sem Fronteiras. Revista Perspectivas do Desenvolvimento: um enfoque multidimensional, v. 03, no 4, jul. 2015.PROLO, I.; VIEIRA, R. C. O programa Ciência sem Fronteiras e as Universidades Brasileiras: Uma política pública a celebrar? In: Seminários em Administração (SEMEAD), XX, 2017, LOCAL. Anais..., nov. 2017. ISSN 2177-3866.SÁ, C. M. The Rise and Fall of Brazil’s Science Without Borders. International Higher Education, n.85, p.17-18, 2016. STALLIVIERI, L. As dinâmicas de uma nova linguagem intercultural na mobilidade acadêmica internacional. 2009. 235f. Tese (Doutorado em Línguas Modernas). Universidade Del Salvador, Buenos Aires, Argentina, 2009.SANTOS, S. R. et al. Turismo e intercâmbio: contribuições para a formação discente nos cursos de graduação das instituições de ensino superior de São Luís, Maranhão. Cultur, ano 08, n. 2, jul. 2014.SEHNEM, P. R.; LUNA, J. M. F. Os egressos do Programa Ciência sem Fronteiras pela percepção dos seus professores. Revista Eletrônica de Educação, v. 12, n. 1, p. 104-119, jan./abr., 2018. DOI: http://dx.doi.org/10.14244/198271991919UNITED NATIONS ORGANIZATION FOR EDUCATION, SCIENCE AND CULTURE (UNESCO). Recueil des donneés mondiales sur l'éducation: statistiques comparées sur l'éducation dans le monde. Montreal: Unesco, 2009. Dispo­nível em: http://www.uis.unesco.org/Library/Documents/ged09-fr.pdf Acesso em: 01 abri 2019.e3633105

Background: The World Health Organization (WHO) has approved the use of two new drugs, namely Bedaquiline (Bdq) and Delamanid (Dlm), for treatment of Drug Resistant Tuberculosis (DR-TB). One of the concerns raised with the use of these drugs was QT-interval prolongation. This condition could be serious and life threatening. Hence, knowing the magnitude and its management is very important. This case series identifies the incidence and discusses the management of clinically significant QT-interval prolongation amongst a cohort of patients who have been on these medicines. Materials and Methods: Patients with reports of high grade QT-Interval prolongation (i.e. Grade-3 and Grade-4) were identified from the cohort of 265 patients enrolled on bedaquiline and/or delamanid and discussion is made on the pattern, severity and management of each cases identified. Results: Only 4 (1.5%) out of all 265 patients enrolled on Bedaquiline and/or Delamanid have developed high grade QT-Interval prolongation. And all are managed without permanent discontinuation of both drugs. Conclusion: The Incidence of clinically significant QTcF-interval prolongation among DR-TB patients taking bedaquiline and /or delamanid in Lesotho is low. And almost all cases can be managed with more frequent Electrocardiogram (ECG) monitoring and management of other possible causes of QT-interval prolongation without the need to stop one or both drugs permanently.

Les relations entre la France et la Yougoslavie pendant la p?riode o? cette derni?re ?tait dirig?e par Tito, ?taient marqu?es d?abord par l?aide yougoslave aux in?surg?s alg?riens, et ensuite par le refus de g?n?rale De Gaule de rencontrer le pr?sident Yougoslave. L?aide aux FLN alg?rien s?inscrivait dans la politique de non-alignement de Tito dont un aspect important ?tait la coop?ration avec les pays musulmans dans le Tiers Mondes, facilit? en partie par les liens mis en place entre les pays musulmans et les Musulmans Yougoslaves. G?n?ral De Gaule, consid?rait le sort que Tito avait r?serv? ? g?n?ral Mihailovic comme inacceptable, et estimait en plus que la f?d?ra?tion yougoslave en tant que telle est une structure ?tatique plus que fragile.

Rhamnus alaternus L. (evergreen buckthorn), family Rhamnaceae, is a small, hardy shrub from Mediterranean regions grown for its ornamental persistent green or variegated foliage. Chlorotic oak leaf or ringspot symptoms on R. alaternus leaves have been observed in southern France (Bellegarde, Gard department in 1998; Fanjaux, Aude department in 2000; and Saint-Jean-Cap-Ferrat, Alpes-Maritimes department in 2002). Samples from these three localities revealed the presence of Alfalfa mosaic virus (AMV) due to (i) the symptoms observed in an inoculated diagnostic host range previously described (1), (ii) observation of typical bullet-shaped virion particles of different sizes with transmission electron microscopy, (iii) nonpersistent transmission to Nicotiana tabacum cv. Xanthi-nc by Myzus persicae, and (iv) positive reaction in double-antibody sandwich-enzyme-linked immunosorbent assays (DAS-ELISA) to antibodies raised against AMV (gift of G. Marchoux). In addition, in Fanjaux, Viburnum tinus L. plants located close to the infected R. alaternus plants were also infected by AMV and exhibited typical intense calico mosaics (3). The close species, R. frangula L., was previously identified as a natural host for AMV in Italy (2). Following isolation from local lesions on Vigna unguiculata, the Fanjaux isolate was grown in cv. Xanthi-nc plants, where it induced a severe mosaic and stunting of the plants, and inoculated to 2-year-old virus-free R. alaternus plants either mechanically or with M. persicae (10 plants each). Plants were subsequently kept in an insect-proof greenhouse. At 8 and 12 months postinoculation, only one aphid-inoculated plant showed symptoms on young leaves and was AMV-positive in DAS-ELISA, while no mechanically infected plants were infected. This low infection level together with the rare observation of symptoms in natural conditions suggest that R. alaternus is not frequently infected by AMV. References: (1) L. Cardin and B. Moury. Plant Dis. 84:594, 2000. (2) F. Marani and L. Giunchedi. Acta Hortic. 59:97, 1976. (3) N. Plese and D. Milicic. Phytopathol. Z. 72:219, 1971.

Dothistroma needle blight (DNB), also known as red band needle blight, is an important fungal disease of Pinus spp. that occurs worldwide. On the basis of molecular and morphological studies of the anamorphic stage, Barnes et al. (1) showed that two closely related species were involved in DNB: Dothistroma septosporum (Dorog.) Morelet and D. pini Hulbary. D. septosporum (teleomorph: Mycosphaerella pini Rostr.) has a worldwide distribution and is reported as the species that caused past epidemics of DNB. This species is reported on more than 80 different pine species, and Pinus radiata D. Don (Monterey pine) is classified as a highly or moderately susceptible species, depending on the published sources (4). D. pini (telemorph: unknown) was initially found on needles of P. nigra J. F. Arnold collected from 1964 to 2001 in the north central United States (Minnesota, Nebraska, and Michigan). It was subsequently found in Ukraine and southwestern Russia, where it has been associated with the emergence of DNB on P. nigra subsp. pallasiana (Lamb.) Holmboe, in Hungary on P. nigra, and in Russia on P. mugo Turra (1). In France, D. pini was reported for the first time on P. nigra, and was sometimes found in association with D. septosporum on the same needles (3). Later on, a more intensive survey of DNB was launched in France and 216 stands of Pinus sp. were studied. D. septosporum and D. pini were detected in 133 and 123 stands, respectively. Both species co-occurred in 40 stands but D. pini was only found on P. nigra (subsp. laricio and austriaca) (2). Up to now, D. pini was therefore only reported on European pine species, mainly on the different allopatric subspecies belonging to the black pine complex and on one occasion on P. mugo, which belongs to the same section and subsection as P. nigra. In March 2011, typical symptoms of DNB (needles with orangey-red brown distal ends, dark red bands, and green bases; small and black fruit bodies within the bands) were observed in a 50- to 60-year old P. radiata stand of ~3 ha located in Pyrénées Atlantiques close to the Spanish border (1°36′08″ W, 43°19′51″ N). The density of pine was relatively low and patches of natural regeneration were present. Although nearly all of the trees showed DNB symptoms, less than 50% of their needles were affected by the disease. In this stand, needles showing typical DNB symptoms were randomly taken from four pines and mixed together to form a single sample for analysis. Total DNA was extracted from symptomatic needle pieces. The presence of D. pini was confirmed by a specific multiplex real-time PCR analysis using the D. pini-specific primers/probe combination DPtef-F1-/R1/-P1 (3), and by sequencing a D. pini-specific amplicon generated by another conventional PCR (3) using DPtef-F/DPtef-R primers (GenBank Accession KC853059) (3). D. septosporum was not detected in the sample. To our knowledge, this is the first report worldwide of D. pini on P. radiata, a pine species largely planted in Spain and in the Southern Hemisphere. This is also the first report of this pathogen on a non-European pine species. The original native range and the host range of D. pini remain unknown and there is currently no data about host preferences or aggressiveness on different pine species. References: (1) I. Barnes et al. For. Pathol. 41:361, 2011. (2) B. Fabre et al. Phytopathology 102:47, 2012. (3) R. Ioos et al. Phytopathology 100:105, 2010. (4) M. Watt et al. For. Ecol. Manage. 257:1505, 2009.

Pelargonium zonate spot virus (PZSV) was first isolated from tomato in southern Italy in 1982 (1) and later was also reported from Spain (3) and France (2). Infected tomato plants showed stunting, malformation, yellow rings and line patterns on the leaves, and concentric chlorotic ringspots on the stems. In June of 2006, more than 100 tomato (Lycopersicon esculentum Mill.) plants exhibiting symptoms similar to PZSV were observed in seven acres of tomato fields in Yolo County, California. The causal agent was mechanically transmitted to several indicator species. Symptoms on infected plants included local lesions on Beta macrocarpa, Chenopodium amaranticolor, C. capitatum, C. quinoa, Cucumis melo, Cucurbita pepo, and Tetragonia expansa, and systemic infection on Capsicum annuum, Chenopodium murale, L. esculentum, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum, Physalis floridana, and P. wrightii. Two field-infected tomato plants and one each of the mechanically inoculated host plant were positive with double-antibody sandwich (DAS)-ELISA using a commercial PZSV IdentiKit (Neogen Europe Ltd., Ayr, Scotland, UK). Partially purified virions stained with 2% uranyl acetate contained spherical to ovate particles. The particle diameters ranged between 25 and 35 nm. Published sequences of PZSV (GenBank Accession Nos. NC_003649 for RNA1, NC_003650 for RNA2, and NC_003651 for RNA3) were used to design three sets of primer pairs specific for PZSV RNA1 (R1-F: 5′ TGGCTGGCTTTTTCCGAACG 3′ and R1-R: 5′ CCTAATCTGTTGGTCCGAACTGTC 3′), RNA2 (R2-F: 5′ GCGTGCGTATCATCAGAAATGG 3′ and R2-R: 5′ ATCGGGAGCAG AGAAACACCTTCC 3′), and RNA3 (R3-F: 5′ CTCACCAACTGAAT GCTCTGGAC 3′ and R3-R: 5′ TGGATGCGTCTTTCCGAACC 3′) for reverse transcription (RT)-PCR tests. Total nucleic acids were extracted from field-infected tomato plants and partially purified virions for RT-PCR. RT-PCR gave DNA amplicons of the expected sizes. The DNA amplicons were gel purified and sequenced. The sequenced amplicons had 92, 94, and 96% nt sequence identity to PZSV RNA1, RNA2, and RNA3, respectively. The symptomatology, serology, particle morphology, and nucleotide sequences confirm the presence of PZSV in a tomato field in California. To our knowledge, this is the first report of the occurrence of PZSV in the United States. References: (1) D. Gallitelli. Ann. Appl. Biol. 100:457, 1982. (2) K. Gebre-Selassie et al. Plant Dis. 86:1052, 2002. (3) M. Luis-Arteaga et al. Plant Dis. 84:807, 2000.

BackgroundGliomas represent the most common brain tumors within the central nervous system, with glioblastoma being the most aggressive type.1 Conventional treatment combines several approaches including surgery, chemotherapy, and radiation.2 However, the prognosis for glioblastoma remains unfavorable, with only 5% of patients surviving more than 5 years post-diagnosis.3 Thus, new treatment approaches are urgently needed. Natural killer (NK) cells directly lyse malignantly transformed or virally infected cells and secrete inflammatory cytokines that polarize cytotoxic immunity. Allogeneic NK cell adoptive transfer has shown clinical benefit in patients with advanced cancer.4–7 However, limitations of this approach include relatively low numbers of donor NK cells that can be isolated during an apheresis and variability in the quality of NK cells between donors. To overcome these limitations, we have developed a GMP manufacturing strategy to mass produce NK cells from induced pluripotent stem cells (iPSCs) as an approach to off-the-shelf cancer immunotherapy. We refer to these cells as ‘iNK’ (iPSC-derived NK) cells. Here, we provide preclinical data demonstrating the efficacy of iNK cells for immunotherapy against glioblastoma.Abstract 155 Figure 1Engineered iNK cells exhibit highly effective antitumor function in a xenogeneic model of glioblastoma. (A) Schematic of the experimental design to test iNK cell function against glioblastoma in vivo. (B) Kaplan Meier plots showing survival for groups of mice that received either vehicle alone or iNK cells after tumor engraftment (n=5 mice/group)MethodsWe generated iNK cells using previously published methods.8–10 iNK cells were used as effectors against an array of patient-derived glioblastoma lines in 2-dimensional live imaging IncuCyte assays where iNK cell-mediated killing was observed over the course of 48 hours. To investigate iNK cell infiltration and cytotoxicity in a more physiological context that accounts for the 3-dimensional architecture of the tumor, we also performed live imaging IncuCyte assays using iNK cells as effectors against glioblastoma spheroids. To test the anti-tumor function of iNK cells in vivo, we implanted patient-derived glioblastoma cells into mice via intracranial injection. Seven days later, 5 mice received intratumoral injections of iNK cells, and 5 mice received vehicle alone (as a control; figure 1A). All mice were monitored for weight and survival over 100 days.Results iNK cells exhibited strong and sustained cytotoxicity against 6 primary patient-derived mesenchymal glioblastoma lines in 2-dimensional IncuCyte assays and complete infiltration and destruction of glioblastoma spheroids in 3-dimensional IncuCyte assays. In xenogeneic adoptive transfer experiments, all mice receiving intratumoral injections of iNK cells survived out to day 100, while all mice in the vehicle group became moribund and had to be sacrificed by day 60 (figure 1B).ConclusionsiNK cells are highly cytotoxic against glioblastoma cells, and our preclinical in vivo data provides proof-of-concept for future clinical trials.Ethics ApprovalThis project has been approved by the University of Minnesota IACUC. Approval ID: 1812-36595AReferencesLouis D N, Perry A, Reifenberger G, von Deimling A, Figarella-Branger D, Cavenee W K, Ohgaki H, Wiestler O D, Kleihues P, Ellison D W. The 2016 world health organization classification of tumors of the central nervous system: a summary. Acta Neuropathol 2016;131:803–820.Stupp R, Mason W P, van den Bent M J, Weller M, Fisher B, Taphoorn M J B, Belanger K, Brandes A A, Marosi C, Bogdahn U, Curschmann J, Janzer R C, Ludwin S K, Gorlia T, Allgeier A, Lacombe D, Cairncross J G, Eisenhauer E, Mirimanoff R O, European Organization for Research and Treatment of Cancer Brain Tumor and Radiotherapy Groups; National Cancer Institute of Canada Clinical Trials Group. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 2005;352:987–996.Thakkar JP, Dolecek TA, Horbinski C, Ostrom QT, Lightner DD, Barnholz-Sloan JS, Villano JL. Epidemiologic and molecular prognostic review of glioblastoma. Cancer Epidemiol Biomarkers Prev 2017;23:1985–1996.Miller J S, Soignier Y, Panoskaltsis-Mortari A, McNearney S A, Yun G H, Fautsch S K, McKenna D, Le C, Defor T E, Burns L J, Orchard P J, Blazar B R, Wagner J E, Slungaard A, Weisdorf D J, Okazaki J, McGlave P B. Successful adoptive transfer and in vivo expansion of human haploidentical NK cells in patients with cancer. Blood 2005;105:3051–3057.Bachanova V, Cooley S, Defor T E, Verneris M R, Zhang B, McKenna D H, Curtsinger J, Panoskaltsis-Mortari A, Lewis D, Hippen K, McGlave P, Weisdorf D J, Blazar B R, Miller J S. Clearance of acute myeloid leukemia by haploidentical natural killer cells is improved using IL-2 diphtheria toxin fusion protein. Blood 2014;123:3855.Ciurea S O, Schafer J R, Bassett R, Denman C J, Cao K, Willis D, Rondon G, Chen J, Soebbing D, Kaur I, Gulbis A, Ahmed S, Rezvani K, Scpall E J, Lee D A, Champlin R E. Phase 1 clinical trial using mbIL21 ex vivo-expanded donor-derived NK cells after haploidentical transplant. Blood 2017;130:1857–1868.Romee R, Rosario M, Berrien-Elliott M M, Wagner J A, Jewell B A, Schappe T, Leong J W, Abdel-Latif S, Schneider S E, Willey S, Neal C C, Yu L, Oh T, Lee S, Mulder A, Cooper M A, Fehniger T A. Cytokine-induced memory-like natural killer cells exhibit enhanced responses against myeloid leukiemia. Sci Transl Med 2016:8;375ra123.Valamehr B, Abujarour R, Robinson M, Le T, Robbins D, Shoemaker D, Flynn P. A novel platform to enable the high-throughput derivation and characterization of feeder-free human iPSCs. Sci Rep 2012:2;213.Valamehr B, Robinson M, Abujarour R, Rezner B, Vranceanu F, Le T, Medcalf A, Lee T T, Fitch M, Robbins D, Flynn P. Platform for induction and maintenance of transgene-free hiPSCs resembling ground state pluripotent stem cells. Stem Cell Reports 2014;2:366–381.Zhu H, Blum R H, Bjordahl R, Gaidarova S, Rogers P, Lee T T, Abujarour R, Bonello G B, Wu J, Tsai P-F, Miller J S, Walcheck B, Valamehr B, Kaufman D S. Pluripotent stem cell-derived NK cells with high-affinity noncleavable CD16a mediate improved antitumor immunity. Blood 2020;135:399–410.

O estudo teve objetivo analisar a BNCC para o Ensino Fundamental, em seus aspectos pedagógicos e curriculares, com foco na Educação Física e na concepção e classificação do esporte. Tratou-se de um estudo bibliográfico e documental fundamentado em uma perspectiva histórica- crítica. No documento, a Educação Física é um componente curricular que permite a aprendizagem de práticas corporais: brincadeiras e jogos, ginásticas, dança, lutas, práticas corporais de aventura e esportes. Essa concepção fundamenta-se na Praxiologia Motriz, que estuda a lógica interna e externa dos jogos e esportes, a partir da cooperação, interação com o adversário, desempenho motor e objetivos táticos da ação, na tentativa de romper com a perspectiva positivista, busca-se na linguagem e no significado da ação motriz uma vertente social do esporte. Essa concepção pelo viés da motricidade, continua se perpetuando na Educação Física, repercutindo na BNCC e contrariando as críticas histórias.REFERÊNCIASARAÚJO P. A., RIBAS, J. F. M. Contribuições da praxiologia motriz para a abordagem crítico-superadora. Disponível em: https://repositorio.ufsm.br/bitstream/handle/1/881/Araujo_Pablo_Aires.pdf?sequence=3. Acesso em: 20/03/2017.BETTI, Mauro. Por uma Teoria da Prática. Motus Corporis. Rio de Janeiro, v. 3, n. 2, p. 73-127, dez. 1996.BITTENCOURT, J. A base nacional comum curricular: uma análise a partir do ciclo de políticas. In: XIII Congresso Nacional de Educação. Anais do EDUCERE. Paraná, 2017. BRASIL. Base Nacional Comun Currícular. Ministerio da Educação. Brasília, DF, 2018. Disponivel em: http://basenacionalcomum.mec.gov.br/wp-content/uploads/2018/02/bncc-20dez-site.pdf. Acesso em: 07/08/2018.KUNZ, E. Transformação didático-pedagógica do esporte. Ijuí: Editora Unijuí, 1994.MARTINELI, T. A. P.; MAGALHÃES, C. H.; MILESKI, K. G.; ALMEIDA, E. M.. A Educação Física na BNCC: concepções e fundamentos políticos e pedagógicos. Motrivivência. Santa Catarina, v. 28, n. 48, p. 76-95, setembro/2016. Disponível em: https://periodicos.ufsc.br/index.php/motrivivencia/article/view/2175-8042.2016v28n48p76/32564 Acesso em: 09/08/2018.MELLO, R. A. A necessidade da Educação Física na escola. São Paulo: Instituto Lukács, 2014.MOREIRA, L. R.et al. Apreciação da Base Nacional Comum Curricular e a Educação Física em foco. Motrivivência, v. 28, n. 48, p. 61-75, setembro/2016.NEIRA, M. G.; JUNIOR, M. S. A Educação Física na BNCC: procedimentos, concepções e efeitos. Motrivivência. Santa Catarina, v. 28, n. 48, p. 188-206, setembro/2016. Disponível em: https://periodicos.ufsc.br/index.php/motrivivencia/article/view/45356 Acesso em: 09/08/2018.NORA, D. D.; WALTER, J; BUFFON, E.; RIBAS, J. F. M. Praxiologia motriz, trabalho pedagógico e didática na educação física. Movimento, Porto Alegre, v. 22, n. 4, 1365-1378, out./dez. de 2016. Disponível em: http://seer.ufrgs.br/index.php/Movimento/article/view/65268. Acesso em: 21/03/2018.OLIVEIRA, G. T; RIBAS, J. F. M. Articulações da praxiologia motriz coma Concepção Crítico-Emancipatória. Movimento, Porto Alegre, v. 16, n. 01, p. 131-148, jan./mar. 2010. Disponível em: http://www.seer.ufrgs.br/Movimento/article/viewFile/9680/7521. Acesso em: 03/05/2018.OLIVEIRA, A. A. B; PERIM, G. L. Fundamentos Pedagógicos do Programa Segundo Tempo. Maringá: EDUEM, 2009.PARLEBAS, P. Eléments de sociologie du sport. Revue française de sociologie. França, n. 3, v. 28, p. 547-550, 1987.PAULO-NETTO, J. Introdução ao estudo do método de Marx. São Paulo: Editora Expressão Popular, 2011.PIAGET, J. A Epistemologia genética; Sabedoria e ilusões da filosofia. São Paulo: Abril Cultural, 1983.PIMENTEL, A. O método da análise documental: seu uso numa pesquisa historiográfica. Cadernos de Pesquisa, n. 114, p. 179-195, novembro/ 2001. Disponível em: http://www.scielo.br/pdf/cp/n114/a08n114.pdf .Acesso em: 03/08/2018.RENE, B. X. L’education physique Au XX e Siecleen France. Paris: Nouvelle, 1994.RIBAS, J. F. M. Praxiologia Motriz: construção de um novo olhar dos jogos e esportes na escola. Motriz, Rio Claro, v.11 n.2 p.113-120, mai./ago. 2005. Disponível em: http://www.rc.unesp.br/ib/efisica/motriz/11n2/10MRJ.pdf . Acesso em: 20/03/2017.RIBAS, J. F. M. O voleibol e os novos olhares dos jogos esportivos coletivos. In: RIBAS, J. F. M (Org.). Praxiologia motriz e voleibol: elementos para o trabalho pedagógico. Ijuí: Editora Unijuí, p. 21-56, 2014.RODRIGUES, A. T. Base Nacional Comum Curricular para a área de linguagens e o componente curricular Educação Física. Motrivivência, v. 28, n. 48, p. 32-41, setembro/2016.RUFINO, L. G. B; NETO, S. de S. Saberes docentes e formação de professores de Educação Física: análise da Base Nacional Comum Curricular (BNCC) na perspectiva da Profissionalização do Ensino. Motrivivência, v. 28, n. 48, p. 42-60, setembro/2016.SARAVÍ, J. R. A praxiologia motriz: presente, passado e futuro. Entrevista com Pierre Parlebas. Movimento, Porto Alegre, v. 18, n. 01, p. 11-35, jan/mar de 2012. Disponível em: http://seer.ufrgs.br/Movimento/article/view/27065 . Acesso em: Acesso em: 21/03/2018.SILVA, M. R; PIRES, G. L.; PEREIRA, R. S. A Base Nacional Comum Curricular da Educação Básica em tempos de neoconservadorismo e de “neoliberalismo que saiu do armário”; mas também de tempos de resistência: Fora Temer!!!. Motrivivência. Santa Cataria, v. 28, n. 48, 2016. Disponível em: https://periodicos.ufsc.br/index.php/motrivivencia/article/view/2175-8042.2016v28n48p7/32530 Acesso em: 09/08/2018. SHIROMA, E.O.; CAMPO, R. F.; GARCIA, R. M. C. Decifrar textos para compreender a política: subsídios teórico-metodológicos para análise de documentos. Perspectiva. Florianópolis, v. 23, n. 02, p. 427-446, jul./dez. 2005.TABORDA, D. S. Aproximações teóricas entre a praxiologia motriz e a proposta transformação didático-pedagógica do esporte: por um diálogo da possibilidade. Dissertação (Mestrado). UFSM. Programa de Pós-Graduação em Educação Física. RS, 2014. Disponível em: http://repositorio.ufsm.br/bitstream/handle/1/6744/TABORDA%2c%20DOUGLAS%20DOS%20SANTOS.pdf?sequence=1isAllowed=y . Acesso em: 20/03/2017.Recebido em 15-05-2018 e aceito em 14-08-2018.

Twenty Peas (Pisum sativum L.) varieties/ lines were evaluated against Fusarium wilt caused by Fusarium oxysporum .Sp.pici by sowing them in sick plot during the year of 2016-17 at the Plant Pathology Research Institute, Faisalabad. Each cultivar/line was planted in a single row of three meter length, with plant to plant and row to row distances of 15cm and 30 cm respectively and replicated thrice by following Randomized Complete Block Design (RCBD). Out of these twenty varieties/ lines 13 including check variety Olympia were found highly susceptible ranging from 53.2 to 83.5% plant mortality. Six varieties/lines were susceptible ranging from 30.3 to 44.1 % plant mortality. Only a single variety Garrow performed as moderately resistant by showing 21% plant mortality in the field. Efficacy of five fungicides against Fusarium oxysporum .Sp.pici, at various concentrations was evaluated in-vitro and significant variations among treatments was observed. In general there was a significant decrease in mycelial growth of the fungus with an increase in concentration of fungicides. Tilt (Propiconazol),( Daconil (Chlorothalonil) and Crest (Carbendazim) were the most effective fungicides in inhibiting the growth of the fungus in descending order. The Tilt almost 90% inhibited the growth @ 50µg/ml concentration, Daconil and Crest exhibited intermediate effectiveness. Topsin-M (Thiophanate-methyl) and Score (Difenoconazole) were the least effective fungicides.Ahmad, M. A., S. M. Iqbal, N. Ayub, Y. Ahmad and A. Akram. 2010. Identification of resistant sources in chickpea against Fusarium wilt. Pak. J. Bot, 42: 417-426.Borum, D. E. and J. Sinclair. 1968. Evidence for systemic protection against Rhizoctonia solani with vitavax in cotton seedlings. Phytopathology, 58: 976-&.Davies, D., G. Berry, M. Heath and T. Dawkins. 1985. Pea (Pisum sativum L.). Grain Legume Crops. Collins, London, UK: 147-198.Food and Agriculture Organization of the United Nations. 2011Hagedorn, D. 1984. Compendium of pea diseases. 57 p. Am. Phytopathol. Soc., St. Paul, Minnesota, USA.Hannan, A., S. T. Sahi, I. Ahmed and A. A. Choudhry. 2014. Differential impact of Fusarium oxysporum f. sp. pisi on resistance source of pea genotypes and its chemical management. Pakistan Journal of Phytopathology, 26: 91-96.Haware, M. P. 1978. Eradication of Fusarium oxysporum f. sp. ciceri Transmitted in Chickpea Seed. Phytopathology, 68: 1364.Haware, M.P. and Nene, Y.L., 1982. Races of Fusarium oxysporum f.sp. ciceri. Plant disease, 66 (9), pp.809-810.Hulse, J. H. 1994. Nature, composition, and utilization of food legumes. Expanding the Production and Use of Cool Season Food Legumes. Springer Netherlands, pp. 77-97.Ilyas, M., M. Iqbal and K. Iftikhar. 1992. Evaluation of some fungicides against Fusarium oxysporum f. sp. ciceris and chickpea wilt. Pakistan Journal of Phaytopahtology, 4: 5-8.Iqbal, S. M. 2005. Screening of chickpea genotypes for resistance against Fusarium wilt. Mycopath (Pakistan).Javaid, I. A., A. Ghafoorm and R. Anwar. 2002. Evaluation of local and exotic pea Pisum sativum germplasm for vegetable and dry grain straits. Pak. J. Bot, 34: 419-427.Khan, I., S. Alam and A. Jabbar. 2002. Selection for resistance to Fusarium wilt and its relationship with phenols in chickpea.Khan, S. A., A. Awais, N. Javed, K. Javaid, A. Moosa, I. U. Haq, N. A. Khan, M. U. Chattha and A. Safdar. 2016. Screening of pea germplasm against Fusarium oxysporum f. sp. pisi and invitro management through chemicals. Pakistan Journal of Phytopathology, 28: 127-131.Khokhar, M. 2014. Production status of major vegetables in Pakistan, their problems and suggestions. Agric. Corner, 9.Kraft, J. M. 1994. Fusarium wilt of peas (a review). Agronomie, 14: 561-567.Maitlo, S., R. Syed, M. Rustamani, R. Khuhro and A. Lodhi. 2014. Comparative efficacy of different fungicides against fusarium wilt of chickpea (Cicer arietinum L.). Pakistan Journal of Botany, 46: 2305-2312.McPhee, K. 2003. Dry pea production and breeding. Food, Agri Environ, 1: 64-69.Nawab, N. N., G. M. Subhani, K. Mahmood, Q. Shakil and A. Saeed. 2008. Genetic variability, correlation and path analysis studies in garden pea (Pisum sativum L.). J. Agric. Res, 46: 333-340.Nene, Y., M. Haware and M. Reddy. 1981. Chickpea diseases: resistance-screening techniques.Pande, S., J. N. Rao and M. Sharma. 2007. Establishment of the Chickpea Wilt Pathogen Fusarium oxysporum f. sp. ciceris in the Soil through Seed Transmission. The Plant Pathology Journal, 23: 3-6.Persson, L., L. Bødker and M. Larsson-Wikström. 1997. Prevalence and pathogenicity of foot and root rot pathogens of pea in Southern Scandinavia. Plant Disease, 81: 171-174.Steel, R. G. D. and J. H. Torrie. 1980. Principles and procedures of statistics, a biometrical approach. McGraw-Hill Kogakusha, Ltd.Sundar, A. R., N. Das and D. Krishnaveni. 1995. In-vitro antagonism of Trichoderma spp. against two fungal pathogens of Castor. Indian Journal of Plant Protection, 23: 152-155.Vyas, S. C. 1984. Systemic fungicides. Systemic fungicides.

The organization of the rod photoreceptor cytoskeleton suggests that microtubules (MTs) and F actin are important in outer segment (OS) membrane renewal. We studied the role of the cytoskeleton in this process by first quantifying OS membrane assembly in rods from explanted Xenopus eyecups with a video assay for disc morphogenesis and then determining if the rate of assembly was reduced after drug disassembly of either MTs or F actin. Membrane assembly was quantified by continuously labeling newly forming rod OS membranes with Lucifer Yellow VS (LY) and following the tagged membranes' distal displacement along the OS. LY band displacement displayed a linear increase over 16 h in culture. These cells possessed a longitudinally oriented network of ellipsoid MTs between the sites of OS protein synthesis and OS membrane assembly. Incubation of eyecups in nocodazole, colchicine, vinblastine, or podophyllotoxin disassembled the ellipsoid MTs. Despite their absence, photoreceptors maintained a normal rate of OS assembly. In contrast, photoreceptors displayed a reduced distal displacement of LY-labeled membranes in eyecups treated with cytochalasin D, showing that our technique can detect drug-induced changes in basal rod outer segment assembly. The reduction noted in the cytochalasin-treated cells was due to the abnormal lateral displacement of newly added OS disc membranes that occurs with this drug (Williams, D. S., K. A. Linberg, D. K. Vaughan, R. N. Fariss, and S. K. Fisher. 1988. J. Comp. Neurol. 272:161-176). Together, our results indicate that the vectorial transport of OS membrane constituents through the ellipsoid and their assembly into OS disc membranes are not dependent on elliposid MT integrity.

Esteve A., C.R. Schwartz, J. van Bavel, I. Permanyer, M. Klesment, J. García-Román. The end of hypergamy: global trends and implications Clark G. Microbes and markets: was the Black Death an economic revolution? Van Mol C. Do employers value international study and internships? A comparative analysis of 31 countries Niedomysl T., U. Ernstson, U. Fransson. The accuracy of migration distance measures Graham C., J.R. Pozuelo. Happiness, stress, and age: how the U curve varies across people and places Lennartz C., R. Arundel, R. Ronald. Younger adults and homeownership in Europe through the global financial crisis Demintseva E., D. Kashnitsky. Contextualizing migrants' strategies of seeking medical care in Russia Kashnitsky I., M. Gunko. Spatial variation of in-migration to Moscow: testing the effect of housing market Oparin D.A. Migration and contemporary Muslim space in Moscow. Contextualizing north caucasian loud dhikr and the religious practices of Central Asian folk mullas Demintseva E. Labour migrants in post-Soviet Moscow: patterns of settlement Schöley J., F. Willekens. Visualizing compositional data on the Lexis surface Migheli M. Size of town, level of education and life satisfaction in Western Europe Shi Y., J.J. Kennedy. delayed registration and identifying the "missing girls" in China Peri-Rotem N. Religion and fertility in Western Europe: trends across cohorts in Britain, France and the Netherlands

Se estudió el impacto psicológico frene al COVID – 19 en los internos de enfermería de prácticas pre – profesionales en relación a las variables sociodemográficas y los niveles de ansiedad, depresión y miedo. Para el análisis se consideró a 150 internos prácticos de la carrera de enfermería, para la evaluación de este estudio se utilizaron las escalas de STAI, IDER, FCV19S y K10. Los resultados exponen que existe mayor nivel de ansiedad en los internos que declararon no tener equipos de bioseguridad necesarios. Los internos que rotan en el área hospitalaria presentan mayores niveles de ansiedad, miedo y malestar psicológico compara con los internos del área comunitaria. Sin embargo, los niveles de depresión fueron ligeramente mayores en los internos de área comunitaria. No hubo diferencia significativa de los estados emocionales entre mujeres y varones. Palabras Clave: Ansiedad, depresión, miedo al COVID-19, impacto psicológico. Referencias [1]M. Del Campo, «Covid-19 y su impacto en la salud y el trabajo,» Revista de la Asociación Española de Especialistas en Medicina del Trabajo, vol. 29, nº 3, p. 183, 2020. [2]H. Scholten, VE. Quezada-Scholz, G.Salas, NA. Barria Aseenio, R. Molina, JE. García, M. Juliá, A. Marinero, A. Zambrano, E. Gómez, A. Cheroni, T. Caycho-Rodriguez, T. Reyes, N. Pinochet, P. Binde, J. Uribe, C. Rojas, J. Bernal, F. Somarriva, “Abordaje psicológico del COVID-19: Una revisión narrativa de la experiencia latinoamericana,” Rev Interam Psicol J Psychol, vol. 54, pp.287, May. 2020. [3]A. Tusev, L. Tonon, y M. Capella, “Efectos Iniciales en la Salud Mental por la Pandemia de Covid-19 en algunas Provincias de Ecuador”, IRR, vol. 15, pp. 11-24, oct. 2020. [4]Ministerio de Salud Pública (2020, marzo 13) Informe de situación N° 001.[En línea]. Disponible en: https://www.gestionderiesgos.gob.ec/wp-content/uploads/2020/03/Informe-de-Situaci%C3%B3n-No001-Casos-Coronavirus-Ecuador-12032020.pdf [5]F. De Caneva, M. García-Gómez, E Baur, “Salud emocional del personal sanitario del Área de Urgencias durante la pandemia COVID-19”, Rev. Med Clin. Vol. 155, no. 8, pp. 365, junio 2020. [6]S Dubey, P. Biswas, R. Ghosh, S. Chatterjee, MJ. Dubey, S. Chatterjee, D. Lahiri, CJ. Lavie, “Psychosocial impact of COVID-19”, Rev Diabetes Metab Syndr. Vol.14, no. 5, pp. 779-788, septiembre-octubre. 2020. [7]G. Arias, F. Navarrete, M. Flor, “Factores asociados al bienestar psicológico de los estudiantes de la escuela académico-profesional de odontología de la Universidad nacional Jorge Basadre Grohmann”, Revista médica Basadrina. Vol. 7, no. 2, pp. 28-30, septiembre. 2013. [8]S. Sandoval, A. Dorner, A. Véliz, “Bienestar psicológico en estudiantes de carreras de la salud,” Rev Investigación en Educación Médica, Vol. 6, no. 24, pp.260-266, diciembre 2017. [9]C. Mitchell, OPS/OMS | La OMS (2020, octubre 23) caracteriza a COVID-19 como una pandemia. Pan American Health Organization / World Health Organization [En línea] Disponible en: https://www.paho.org/hq/index.php?option=-com_content&view=article&id=15756:who-characterizes-covid-19-as-a-pandemic&Itemid=1926&lang=es [10]MC. Johnson, L. Saletti-Cuesta, N. Tumas, “Emociones, preocupaciones y reflexiones frente a la pandemia del COVID-19 en Argentina,” Rev Ciênc Saúde Coletiva, vol 25(suppl 1), pp. 2447-56, junio. 2020. [11]L. Hernani, A. Aquino, E. Araujo, “Relación entre el bienestar auto percibido, autoestima, inteligencia emocional, personalidad y razonamiento, abstracto en un grupo de estudiantes universitarios,” Revista peruana de Psicología y trabajo social, vol. 2, no. 1, pp. 49-62, mayo. 2013. [12]N. Ozamiz-Etxebarria, M. Dosil-Santamaria, M. Picaza-Gorrochategui, N. Idoiaga-Mondragon, “Niveles de estrés, ansiedad y depresión en la primera fase del brote del COVID-19 en una muestra recogida en el norte de España,” Cad Saúde Pública, vol. 36, no. 4, abril. 2020. [13]H. Blake, F. Bermingham, G. Johnson, and A. Tabner, “Mitigating the Psychological Impact of COVID-19 on Healthcare Workers: A Digital Learning Package,” International Journal of Environmental Research and Public Health, vol. 17, no. 9, pp. 2997, abril 2020. [14]M. Walton, E. Murray, MD. Christian, “Mental health care for medical staff and affiliated healthcare workers during the COVID-19 pandemic,” Rev. Eur Heart J Acute Cardiovasc Care, vol. 9, no. 3, pp. 241-247, Abril. 2020. [15]J. Shijo, P. Gunaseelan, S. Bhandari, S. Dutta, “How the novel coronavirus (COVID-19) could have a quivering impact on mental health?,” Rev. Open J Psychiatry Allied Sci, vol.11, no. 2, pp.135-136, julio-diciembre. 2020. [16]W. El-Hage, C. Hingray, C. Lemogne, A. Yrondi, P. Brunault, T. Bienvenu, B. Etain, C. Paquet, B. Gohier, D Bennabi, P. Birmes, A. Sauvaget, E. Fakra, N. Prieto, S. Bulteau, P. Vidailhet, V. Camus, M. Levoyer, M. Krebs, B. Aouizerate, “Les professionnels de santé face à la pandémie de la maladie à coronavirus (COVID-19): quels risques pour leur santé mentale ?,” Rev. L’Encephale, vol. 46, no. 3, pp.73-80, octubre, 2020. [17]Sociedad Española de psiquiatría. “Cuidado de la salud mental del personal sanitario”. 2020 [En línea] Disponible en: http://www.sepsiq.org/file/InformacionSM/SEP%20COVID19-Salud%20Mental%20personal%20sanitario.pdf [18]A. Lozano-Vargas, “Impacto de la epidemia del Coronavirus (COVID-19) en la salud mental del personal de salud y en la población general de China,” Rev Neuropsiquiatr, vol. 83, pp. 51-6, enero, 2020. [19]D. Talevi, V. Socci, M. Carai, G. Carnaghi, S. Faleri, E.Trebbi, A. Di Bernardo, F. Capelli, F. Pacitti, “Mental health outcomes of the CoViD-19 pandemic,” Riv Psichiatr, vol. 55, no. 3, pp. 137-144, mayo-junio, 2020. [20]A. Urzúa, P. Vera-Villarroel, A. Caqueo-Urízar, R. Polanco-Carrasco, “La Psicología en la prevención y manejo del COVID-19. Aportes desde la evidencia inicial,” Rev. Ter Psicológica, vol. 38, pp. 103-18, abril, 2020. [21]R. Sierra. Técnicas de investigación social. 9na Edición. Madrid. Ed.Paraninfo S.A. 1988. [22]C. Spielberger, R. Gorsuch, R. Lushene. “Cuestionario de Ansiedad Estado-Rasgo”. TEA: Ediciones, 2015. [En línea] Disponible en: http://www.web.teaediciones.com/Ejemplos/STAI-Manual-Extracto.pdf [23]D. Gudelo, Y. Gómez, P. López, “Propiedades Psicométricas del Inventario de Depresión Estado Rasgo (IDER) con una muestra de población general colombiana,” Rev. Av En Psicol Latinoam, vol. 32, no 1, pp. 71-84, 2014. [24]D. Tzur, A. Grossman-Giron, Y. Bloch, Y. Mayer, N. Shiffman, S. Mendlovic, “Fear of COVID-19 scale: Psychometric characteristics, reliability and validity in the Israeli population,”Rev.Psychiatry, vol. 289, pp. 113100, julio, 2020. [25]B. Vargas, V. Villamil, C. Rodríguez, J. Pérez, S. Cortés, “Validación de la escala Kessler 10 (K-10) en la detección de depresión y ansiedad en el primer nivel de atención. Propiedades psicométricas,” Rev. Salud Ment, vol. 34, pp. 323-331, julio-agosto 2011.

In April 2005, a rust fungus on Pennsylvania blackberry, Rubus pensilvanicus Poiret (= R. abactus Bailey), was collected in Humboldt County, CA. Although native to eastern North America, this host is an escaped cultivar that occurs in disturbed areas throughout California. Morphological and molecular data suggest that this rust is Phragmidium violaceum (Schultz) G. Winter. To confirm the identification of the specimen from California, an ~1,000-bp section of ribosomal DNA from the 28S large subunit was amplified and sequenced with rust-specific primers (M. C. Aime, unpublished data) (Genbank Accession No. EF672358). This sequence was 100% homologous to sequences of this rust species from Oregon and France. Widespread in Europe and introduced into Australasia as a biological control agent, P. violaceum has recently been reported from Oregon on Himalayan and evergreen blackberries, R. armeniacus Focke and R. laciniatus Willd. (2). Finding this rust in California about the same time as in Oregon suggests that its distribution may be widespread, possibly existing in the United States for some time. To our knowledge, this the first report from California and of the rust species on this plant host (1). The specimen from California is infected with urediniospores but lacks teliospores; it has been deposited at the U.S. National Fungus Collections as BPI 877816. References: (1) D. F. Farr et al. Fungal Databases. Systematic Botany and Mycology Laboratory. Online publication. USDA, ARS, 2007. (2) N. Osterbauer et al. Online publication. doi:10.1094/PHP-2005-0923-01-BR. Plant Health Progress, 2005.

The life of people with disabilities are marked by adverse situations, like architectural barriers, communication barriers and attitudinal barriers, This group also suffers from violent situations in their daily lifes, such as physical and verbal aggression. In the current scientific production, there is few researches that investigates the discourse of the person victim of violence, a fact that, on one hand, may characterize some ignorance of the situations experienced by these people, and, on the other hand, may result in discredit of the discourse of people with disabilities. The objective of this research was to investigate the violence experienced by people with disabilities through a case study of a young person with physical disability. The research was descriptive and had a qualitative nature, using the theoretical framework of the Sociology of disability, Violence and Stigma. Semi-structured interview was conducted, using Comprehensive Sociology as a data analysis tool. The results showed that insults and exclusions are a part of the daily life of the young, actions that can be classified as bullying. The young experience several conflicts in the school environment, having some of these conflicts resolved through the mediation of professionals. Violence against people with disabilities is a dynamic and recurring phenomenon, requiring prevention and intervention programs in the school and other researches on the theme that focuses on the victim point of view.ResumoA vida das pessoas com deficiência é marcada por situações adversas, como barreiras físicas, comunicacionais e atitudinais. Esse grupo também sofre de situações violentas em seu cotidiano, como agressões físicas e verbais. Na produção científica atual se notam poucas pesquisas que investigam o discurso da própria pessoa vítima de violência, fato esse que, de um lado, pode caracterizar desconhecimento das situações vividas por essas pessoas e, por outro, pode resultar em um descrédito em relação ao discurso das pessoas com deficiência. Nesse sentido, o objetivo desta pesquisa foi investigar as violências vividas por pessoas com deficiência por meio de um estudo de caso de um jovem com deficiência física. A pesquisa realizada foi descritiva e de natureza qualitativa, utilizando-se do referencial teórico da Sociologia da Deficiência, da Violência e do Estigma. Foi realizada entrevista a partir de um roteiro semiestruturado de questões, sendo utilizada a Sociologia Compreensiva como ferramenta de análise dos dados. Os resultados mostraram que xingamentos e exclusões fazem parte do cotidiano do jovem com deficiência, ações tais que podem, legalmente, ser tidas como bullying. O jovem vive diversos conflitos no ambiente escolar, tendo alguns desses conflitos resolvidos a partir da mediação de profissionais. A violência contra as pessoas com deficiência é um fenômeno dinâmico e recorrente, são necessários programas de prevenção e de intervenção no ambiente escolar, além de outras pesquisas sobre a temática que focalizem a perspectiva da vítima.Palavras-chave: Violência, Pessoas com deficiência, Estigma, Bullying.Keywords: Violence, Disabled Persons, Stigma, Bullying.ReferencesABRAMOVAY, M. Cotidiano das escolas: entre violências. Brasília, DF: Unesco, Observatório de Violência, Ministério da Educação 2006.AMARAL, L. A. Sobre crocodilos e avestruzes: falando de diferenças físicas, preconceitos e sua superação. In: Diferenças e preconceito na escola: alternativas teóricas e práticas. Volume 5. São Paulo: Summus, 1998. p. 11-30.ARANHA, M. S. F. Paradigmas da relação da sociedade com as pessoas com deficiência. Revista do Ministério Público do Trabalho, v. 11, n. 21, p. 160-173, 2001.BARROS, A. C. M. W.; DESLANDES, S. F.; BASTOS, O. M. A violência familiar e a criança e o adolescente com deficiências. Cadernos de Saúde Pública, v. 32, 2016.BENETTI, D. S. Efeitos de um treino de habilidades para a vida junto a adolescentes com deficiência intelectual e em situação de acolhimento. 2015. Tese (Doutorado em Educação e Ciências Humanas). Programa de Pós-Graduação em Educação Especial. Universidade Federal de São Carlos, 2015.BIANCHETTI, L. Os trabalhos e os dias dos deuses e dos homens: a mitologia como fonte para refletir sobre normalidade e deficiência. Revista Brasileira de Educação Especial, v. 7, n. 1, p. 61-75, 2001.BONI, V.; QUARESMA, S. J. Aprendendo a entrevistar: como fazer entrevistas em Ciências Sociais. Em Tese, v. 2, n. 1, p. 68-80, 2005.BORGES, L.; CAMPOS, J. A. P. P. Fatores determinantes ao ingresso de alunos com deficiência no ensino médio. Psicologia Educacional, São Paulo, n. 44, p. 79-91, jun. 2017.BOTELHO, R. G.; SOUZA, J. M. C. Bullying e educação física na escola: características, casos, conseqüências e estratégias de intervenção. Revista de Educação Física/Journal of Physical Education, v. 76, n. 139, 2007.BRANDÃO, E. C.; MATIAZI, L. D. Bullying: Violência socioeducacional – desafio permanente. Pedagogia em Ação, v. 9, n. 1, p. 17-33, 2017.BRASIL. Estatuto da Pessoa com Deficiência. Lei Brasileira de Inclusão. Lei nº 13.146, de 6 de julho de 2015. Presidência da República, Brasília/DF; 2015.CHARLOT, B. A violência na escola: como os sociólogos franceses abordam essa questão. Sociologias, Porto Alegre, n. 8, p. 432-443, 2002.CUNHA, M, J.; PINTO, P. C. Representaciones mediáticas de la deficiencia: un estudio longitudinal en la prensa. Sociologia, Problemas e Práticas, Lisboa, n. 85, p. 131-147, set. 2017.EMERICH, D. R.; ALCKMIN-CARVALHO, F.; SILVA, M. H. M. Rejeição e vitimização por pares em crianças com deficiência intelectual e transtorno do espectro autista. Revista Educação Especial, v. 30, n. 58, 2017.FERNANDES, A. P. C. S.; DENARI, F. E. Pessoa com deficiência: estigma e identidade. Revista da FAEEBA Educação e Contemporaneidade, v. 26, n. 50, p. 77-89, 2017.FOUCAULT, M. Vigiar e punir: o nascimento da prisão. Tradução R. Ramalhete. 21. ed. Petrópolis, RJ: Vozes; 1999.FRASER, M. T. D.; GONDIM, S. M. G. Da fala do outro ao texto negociado: discussões sobre a entrevista na pesquisa qualitativa. Paidéia, v. 14, n. 28, p. 139-152, 2004.GOFFMAN, E. Estigma: notas sobre a manipulação da identidade deteriorada. Rio de Janeiro: Coletivo Sabotagem, 1988.GOMES, A. E. G.; REZENDE, L. K. Reflexões sobre bullying na realidade brasileira utilizando a técnica de análise de conteúdo: revisão bibliográfica. Cadernos de Pós-Graduação em Distúrbios do Desenvolvimento, v. 11, n. 1, 2018.GUIMARÃES, A. M. A dinâmica da violência escolar: conflito e ambiguidade. Campinas, SP: Editora Autores Associados, 1996.HARLOS, F. E. Sociologia da deficiência: vozes por significados e práticas (mais) inclusivas. 2012. 201 f. Dissertação (Mestrado em Educação Especial ? Educação do Indivíduo Especial) ? Universidade Federal de São Carlos, São Carlos, 2012.MAFFESOLI, M. Dinâmica da violência. São Paulo: Editora Revista dos Tribunais, 1987.MAFFESOLI, M. Elogio da razão sensível. Petrópolis, RJ: Vozes, 1998.MAFFESOLI, M. Entre o bem e o mal. Compêndio de subversão pós-moderna. Lisboa: Instituto Piaget, 2002.MAFFESOLI, M. O conhecimento comum: introdução à sociologia compreensiva. Porto Alegre: Sulina, 2007.MAGNABOSCO, M. B.; SOUZA, L. L. Educação inclusiva e as representações dos estudantes sobre seus pares com deficiência. Psicologia Escolar e Educacional, v. 22, n. 1, p. 115-122, 2018.MAZZOTTA, M. J. S.; D'ANTINO, M. E. F. Inclusão social de pessoas com deficiências e necessidades especiais: cultura, educação e lazer. Saúde e Sociedade, v. 20, p. 377-389, 2011.MENDES, C. S. Prevenção da violência escolar: avaliação de um programa de intervenção. Revista da Escola de Enfermagem da USP, v. 45, n. 3, p. 581-588, 2011.MENDES, E. G. Breve histórico da educação especial no Brasil. Revista Educación y Pedagogía, v. 22, n. 57, maio/ago. 2010.MOREIRA, M. C. N.; BASTOS, O. M.; BASTOS, L. C.; SOARES, A. H. R.; SOUZA, W. D. S.; SANCHEZ, R. N. Violência contra crianças e adolescentes com deficiência: narrativas com conselheiros tutelares. Ciência e Saúde Coletiva, v. 19, p. 3869-3878, 2014.ORGANIZAÇÃO MUNDIAL DA SAÚDE (OMS). CIF: Classificação Internacional de Funcionalidade, Incapacidade e Saúde. Organização Mundial da Saúde. Lisboa; 2004.ORGANIZAÇÃO MUNDIAL DA SAÚDE (OMS). World report on violence and health. World Health Organization. Geneva; 2002.PAULINO, V. C.; CAIADO, K. R. M. A construção do conceito de deficiência por estudantes sem deficiência, a partir de suas histórias de vida. Educação em Foco, v. 20, n. 32, p. 35-59, 2017.SÃO PAULO. Serviço de Acolhimento Institucional para Crianças e Adolescentes. Prefeitura Municipal de São Paulo. 2017. Disponível em: <https://www.prefeitura.sp.gov.br/cidade/secretarias/assistencia_social/protecao_social_especial/index.php?p=28980>. Acesso em: 6 set. 2019.SILVA, F. R.; ASSIS, S. G. Prevenção da violência escolar: uma revisão da literatura. Educação e Pesquisa, São Paulo, v. 44. 2018.SILVA, J. L. D.; OLIVEIRA, W. A. D.; SILVA, M. A. I. D.; PEREIRA, B. O.; CECILIO, S. Estudo exploratório sobre as concepções e estratégias de intervenção de professores em face do bullying escolar. Psicologia, Sa?o Paulo, Brasil, v. 17, n. 3, p. 189-199, 2015.SIMMEL, G. A natureza sociológica do conflito. In: MORAES FILHO, E. (Org.). Simmel. São Paulo: Ática, 1983. p. 122-134.STELKO-PEREIRA, A. C.; WILLIAMS, L. C. A. Reflexões sobre o conceito de violência escolar e a busca por uma definição abrangente. Temas Psicológicos, Ribeirão Preto/SP, v. 18, n. 1, p. 45-55, 2010.STELKO-PEREIRA, A. C. Avaliação de um programa preventivo de violência escolar: planejamento, implantação e eficácia. 2012. 193 f. Tese (Doutorado em Psicologia), Universidade Federal de São Carlos, São Carlos. 2012.VIEIRA, C. M.; DENARI, F. E. Programa informativo sobre deficiência mental e inclusão: mudanças nas atitudes sociais de crianças sem deficiência. Revista Brasileira de Educação Especial, Marília/SP, v. 18, n. 2, p. 265-282, 2012.WILLIAMS, L. C. A. Sobre deficiência e violência: reflexões para uma análise de revisão de área. Revista Brasileira de Educação Especial, v. 9, n. 2, p. 141-154, 2003.YIN, R. K. Estudo de caso: planejamento e método. Porto Alegre, RS: Bookman, 2001.e3308080

В стандартных условиях проведен модельный эксперимент по влиянию сил обеднения на процесс высыхания капли взвесей невзаимодействующих частиц аэросил – полистирольный латекс. Впервые обнаружен быстропротекающий процесс фазового превращения аэросила в кристаллический SiO2 в течение десятков секунд, сопровождающийся резким изменением цвета раствора от светло-голубого до синего. Обнаружена дифракционная картина, свидетельствующая о нанокристаллической природе зародышеобразования новой фазы. Фазообразование интерпретировано как результат действия неравновесной силы обеднения в условиях гидродинамической неустойчивости высыхающей капли. REFERENCES Tret’yakov Yu. D. Self-organisation processes in the chemistry of materials. Uspekhi khimii [Russian Chemical Reviews], 2003, v. 72(8), pp. 651–679. https://doi.org/10.1070/RC2003v072n08ABEH000836 Kushnir S. E., Kazin P. E., Trusov L. A., Tret’yakov Yu. D. Self-organization of micro- and nanoparticles in ferrofl uids. Uspekhi khimii [Russian Chemical Reviews], 2012, v. 81(6), pр. 560–570. https://doi.org/10.1070/RC2012v081n06ABEH004250 Lebedev-Stepanov P. V., Kadushnikov R. M., Molchanov S. P., Ivanov A. A., Mitrokhin V. P., Vlasov K. O., Rubin N. I., Yurasik G. A., Nazarov V. G., Alfi mov M. V. Self-assembly of nanoparticles in the microvolume of colloidal solution: Physics, modeling, and experiment. Rossiiskie nanotekhnologii [Nanotechnologies in Russia], 2013, v. 8(3-4), pр. 137–162. https://doi.org/10.1134/S1995078013020110 Walker D. A., Kowalczyk B., Cruz M. O., Grzybowski B. A. Electrostatics at the nanoscale. Nanoscale, 2011, v. 3(4), pp. 1316–1344. https://doi.org/10.1039/C0NR00698J Ouyang Q., Castets V., Boissonade J., et al. Sustained patterns in chlorite–iodide reactions in a onedimensional reactor. J. Chem. Phys., 1991, v. 95(1), pp. 351–360. https://doi.org/10.1063/1.461490 Tarasevich Yu. Yu., Pravoslavnova D. M. Kachestvennyy analiz zakonomernostey vysykhaniya kapli mnogokomponentnogo rastvora na tverdoy podlozhke [Qualitative analysis of patterns of drying of a drop of a multicomponent solution on a solid substrate], Zhurnal tekhnicheskoi fi ziki [Technical Physics], 2007, vol. 77, no. 2. pp. 17–21. URL: http://journals.ioffe. ru/articles/viewPDF/9047 (in Russ.) Faigl’ F., Anger V. Kapel’nyi analiz neorganicheskikh veshchestv [Drip Analysis of Inorganic Substances]. Moscow, Mir Publ., 1976, v. 1, 390 p., v. 2, 320 p. (in Russ.) Yakhno T. A., Kazakov V. V., Sanina O. A., Sanin A. G., Yakhno V. G. Kapli biologicheskikh zhidkostey, vysykhayushchie na tverdoy podlozhke: dinamika morfologii, massy, temperatury i mekhanicheskikh svoystv [Drops of biological fluids drying on a solid substrate: dynamics of morphology, mass, temperature, and mechanical properties]. Zhurnal tekhnicheskoi fi ziki [Technical Physics], 2010, v. 80(7), pp. 17–23. URL: http://journals.ioffe.ru/articles/viewPDF/10043 (in Russ.) Alfi mov M. V., Kadushnikov R. M., Shturkin N. A., Alievskii V. M., Lebedev-Stepanov P. V. Immitatsionnoe modelirovanie protsessov samoorganizatsii nanochastits [Simulation modeling of self-organization processes of nanoparticles], Rossiiskie nanotekhnologii [Nanotechnologies in Russia], 2006, v. 1(1–2), pp. 127–133. (in Russ.) Lebedev-Stepanov P. V., Gromov S. P., Molchanov S. P., Chernyshov N. A., Batalov I. S., Sazonov S. K., Lobova N. A., Shevchenko N. N., Men’shikova A. Yu., Alfimov M. V. Controlling the self-assemblage of modifi ed colloid particle ensembles in solution microdropletsRossiiskie nanotekhnologii [Nanotechnologies in Russia], 2011, v. 6(9–10), 569–578, pp. 72–78. https://doi.org/10.1134/S1995078011050119 Andreeva L. V., Novoselova A. S., Lebedev-Stepanov P. V., Ivanov D. A., Koshkin A. V., Petrov A. N., Alfi mov M. V. Zakonomernosti kristallizatsii rastvorennykh veshchestv iz mikrokapli [Patterns of crystallization of dissolved substances from microdrops]. Zhurnal tekhnicheskoi fi ziki [Technical Physics], 2007, v. 77(2), pp. 22–30. URL: http://journals.ioffe.ru/articles/view-PDF/9048 (in Russ.) Barash L. Yu. Marangoni convection in an evaporating droplet: Analytical and numerical descriptions. International Journal of Heat and Mass Transfer, 2016, v. 102, pp. 445–454. https://doi.org/10.1016/j.ijh eatmasstransfer.2016.06.042 al Bityutskaya L. A., Zhukalin D. A., Tuchin A. V., Frolov A. A., Buslov V. A. Thermal dissipative structures in the case of carbon nanotubes aggregation in drying drops. Kondensirovannye sredy i mezhfaznye granitsy [Condensed Matter and Interphase], 2014, v. 16(4), pp. 425–430. URL: https://journals.vsu.ru/kcmf/ article/view/856/937 (in Russ.) Asakura S., Oosawa F. Interaction between particles suspended in solutions of macromolecules. Polymer Science Part A: General Papers, 1958, v. 33(126), pp. 183–192. https://doi.org/10.1002/pol.1958.1203312618 Minton A. P. How can biochemical reactions within cells differ from those in test tubes? Journal of Cell Science, 2015, v. 119(14), pp. 2863–2869. https://doi.org/10.1242/jcs.03063 Chebotareva N. A., Kurganov B. I., Livanova N. B. Biochemical effects of molecular crowding. Biohimija [Biochemistry], 2004, v. 69(11), pp. 1239–1251. https://doi.org/10.1007/s10541-005-0070-y Bishop K. J., Wilmer C. E., Soh S., Grzybowski B. A. Nanoscale forces and their uses in self-assembly. Small, 2009, v. 5(14), p. 1600–1630. https://doi.org/10.1002/smll.200900358 Minton A. P. The infl uence of macromolecular crowding and macromolecular confi nement on biochemical reactions in physiological media. Journal of Biological Chemistry, v. 276(14), pp. 10577–10580. https://doi.org/10.1074/jbc.r100005200 Huber F., Strehle D., Schnauss J., Kas J. Formation of regularly spaced networks as a general feature of actin bundle condensation by entropic forces. New J. Physics, 2015, v. 17(4), p. 043029. https://doi.org/10.1088/1367-2630/17/4/043029 Jiang H., Wada H., Yoshinaga N., Sano M. Manipulation of colloids by a nonequilibrium depletion force in a temperature gradient. Physical Review Letters, 2009, v. 102(20), p. 208301. https://doi.org/10.1103/physrevlett.102.208301 Deng H., Li G., Liu H. Assembling of three-dimensional crystals by optical depletion force induced by a single focused laser beam. Optics Express, 2012, v. 20(9), p. 9616. https://doi.org/10.1364/oe.20.009616 Wulfert R., Seiferta U., Speck T. Nonequilibrium depletion interactions in active microrheology. Soft Matter, 2017, v. 13(48), p. 9093–9102. https://doi.org/10.1039/c7sm01737e Dolgih I. I., Bitutskaya L. A. Entropy driven aggregation of CNT in a drying drop on hydrophilic and hydrophobic substrate. Kondensirovannye sredy i mezhfaznye granitsy [Condensed Matter and Interphase], 2018, v. 20(4), p. 664–668. https://doi.org/10.17308/kcmf.2018.20/635

We present the application of a generic, semi-empirical first-order radiative transfer modelling approach for the retrieval of soil- and vegetation related parameters from coarse-resolution space-borne scatterometer measurements ( σ 0 ). It is shown that both angular- and temporal variabilities of ASCAT σ 0 measurements can be sufficiently represented by modelling the scattering characteristics of the soil-surface and the covering vegetation-layer via linear combinations of idealized distribution-functions. The temporal variations are modelled using only two dynamic variables, the vegetation optical depth ( τ ) and the nadir hemispherical reflectance (N) of the chosen soil-bidirectional reflectance distribution function ( B R D F ). The remaining spatial variabilities of the soil- and vegetation composition are accounted for via temporally constant parameters. The model was applied to series of 158 selected test-sites within France. Parameter estimates are obtained by using ASCAT σ 0 measurements together with auxiliary Leaf Area Index ( L A I ) and soil-moisture ( S M ) datasets provided by the Interactions between Soil, Biosphere, and Atmosphere (ISBA) land-surface model within the SURFEX modelling platform for a time-period from 2007–2009. The resulting parametrization was then used used to perform S M and τ retrievals both with and without the incorporation of auxiliary L A I and S M datasets for a subsequent time-period from 2010 to 2012.

[1] Hawkey CR, Yap T, Pereira J, Moore DA, Davidson RN, Pasvol G, et al. Characterization and management of paradoxical upgrading reactions in HIV-uninfected patients with lymph node tuberculosis. Clinical infectious diseases. 2005;40(9):1368-71. [2] Breton G. Syndrome inflammatoire de reconstitution immune (IRIS) associé à la tuberculose. Journal des Anti-infectieux. 2012;14(4):180-5. [3] Cheng V, Ho P, Lee R, Chan K, Woo P, Lau S, et al. Clinical spectrum of paradoxical deterioration during antituberculosis therapy in non-HIV-infected patients. European Journal of Clinical Microbiology and Infectious Diseases. 2002;21(11):803-9. [4] Al-Majed S. Study of paradoxical response to chemotherapy in tuberculous pleural effusion. Respiratory medicine. 1996;90(4):211-4. [5] Campbell I, Dyson A. Lymph node tuberculosis: a comparison of various methods of treatment. Tubercle. 1977;58(4):171-9. [6] Memish Z, Mah M, Mahmood SA, Bannatyne R, Khan M. Clinico‐diagnostic experience with tuberculous lymphadenitis in Saudi Arabia. Clinical microbiology and infection. 2000;6(3):137-41. [7] Choremis C, Padiatellis C, ZOU MLD, Yannakos D. Transitory exacerbation of fever and roentgenographic findings during treatment of tuberculosis in children. American review of tuberculosis. 1955;72(4):527. [8] Orlovic D, Smego J. Paradoxical tuberculous reactions in HIV-infected patients. The International Journal of Tuberculosis and Lung Disease. 2001;5(4):370-5. [9] Park I-S, Son D, Lee C, Park JE, Lee J-S, Cheong M-H, et al. Severe paradoxical reaction requiring tracheostomy in a human immunodeficiency virus (HIV)-negative patient with cervical lymph node tuberculosis. Yonsei medical journal. 2008;49(5):853-6. [10] Martinez V, Bricaire F. Réactions paradoxales. La Presse Médicale. 2006;35(1):1753-6. [11] Narita M, Ashkin D, Hollender ES, Pitchenik AE. Paradoxical worsening of tuberculosis following antiretroviral therapy in patients with AIDS. American journal of respiratory and critical care medicine. 1998;158(1):157-61. [12] Vidal CG, Garau J. Systemic steroid treatment of paradoxical upgrading reaction in patients with lymph node tuberculosis. Clinical infectious diseases. 2005;41(6):915-6. [13] Rakotoarivelo R, Vandenhende M-A, Michaux C, Morlat P, Bonnet F. Réactions paradoxales sous traitement antituberculeux chez des personnes non infectées par le VIH: quatre nouvelles observations et revue de la littérature. La Revue de médecine interne. 2013;34(4):202-8. [14] Cheng V, Yam W, Woo P, Lau S, Hung I, Wong S, et al. Risk factors for development of paradoxical response during antituberculosis therapy in HIV-negative patients. European Journal of Clinical Microbiology and Infectious Diseases. 2003;22(10):597-602. [15] Rao GP, Nadh BR, Hemaratnan A, Srinivas T, Reddy PK. Paradoxical progression of tuberculous lesions during chemotherapy of central nervous system tuberculosis: report of four cases. Journal of neurosurgery. 1995;83(2):359-62. [16] Fontanilla J-M, Barnes A, Von Reyn CF. Current diagnosis and management of peripheral tuberculous lymphadenitis. Clinical Infectious Diseases. 2011;53(6):555-62. [17] Guinchard A-C, Pasche P. Lymphadénite tuberculeuse cervicale et réaction paradoxale: diagnostic et traitement. ORL. 2012;356(34):1860-5. [18] Colebunders R, John L, Huyst V, Kambugu A, Scano F, Lynen L. Syndrome inflammatoire de reconstitution immunitaire de la tuberculose dans les pays à ressources limitées. Int J Tuberc Lung Dis. 2006;10(9):946-53. [19] Malone J, Paparello S, Rickman L, Wagner K, Monahan B, Oldfield E. Intracranial tuberculoma developing during therapy for tuberculous meningitis. Western Journal of Medicine. 1990;152(2):188. [20] Valdez LM, Schwab P, Okhuysen PC, Rakita RM. Paradoxical subcutaneous tuberculous abscess. Clinical infectious diseases. 1997;24(4):734-. [21] Bouchez B, Arnott G, Colover J. Paradoxical expansion of intracranial tuberculomas during chemotherapy. The Lancet. 1984;324(8400):470-1. [22] [Recommendations of the French Language Pneumology Society for tuberculosis management in France: consensus conference. Nice, France, 23 January 2004]. Revue des maladies respiratoires. 2004;21(3 Pt 2):S3-104. [23] Rabar D, Issartel B, Petiot P, Boibieux A, Chidiac C, Peyramond D. Tuberculomes et méningoradiculite tuberculeuse d’évolution paradoxale sous traitement. La Presse Médicale. 2005;34(1):32-4. [24] Chambers S, Record C, Hendrickse W, Rudge P, Smith H. Paradoxical expansion of intracranial tuberculomas during chemotherapy. The Lancet. 1984;324(8396):181-4. [25] Safdar A, Brown AE, Kraus DH, Malkin M. Paradoxical reaction syndrome complicating aural infection due to Mycobacterium tuberculosis during therapy. Clinical infectious diseases. 2000;30(3):625-7. [26] Hejazi N, Hassler W. Multiple intracranial tuberculomas with atypical response to tuberculostatic chemotherapy: literature review and a case report. Infection. 1997;25(4):233-9.

Objetivo: verificar o comportamento da incidência da tuberculose na população privada de liberdade e estimando sua tendência. Materiais e métodos: Trata-se de um estudo ecológico de série temporal com análise de tendência da incidência da tuberculose na população privada de liberdade. Utilizou-se de dados secundários provenientes do Sistema de Informações e Agravos de Notificação. A população foi composta por todas as notificações de Tuberculose da população privada de liberdade de unidades masculinas e femininas no período de 2007 a 2016. Na análise de tendência temporal foi realizada através da criação de modelos de regressão polinomial e testados os modelos linear; quadrático; exponencial. Resultados: A tendência da incidência na população privada de liberdade geral e no sexo masculino foi considerada estável, ambas com (p=0,180), e no sexo feminino decrescente (p= 0,040). Conclusão: É necessário avanços na condução do controle da tuberculose nas unidades prisionais. Descritores: Tuberculose; Epidemiologia; Prisioneiros; Incidência; Saúde Pública. Referências Ministério da Saúde. Secretaria de Vigilância em Saúde. Departamento de Vigilância Epidemiológica. Manual de recomendação para o controle da tuberculose no Brasil. Brasília: Ministério da Saúde. 2018. World Heatlh Organization. 2017 Fer.Disponívelem: http://www.who.int/tb/areas-of-work/population-groups/prisons-facts/en/. Acesso em : 20 Jan. 2017. Kayomo MK, Hasker E, Aloni M, Nkuku L, Kazadi M, Kabengele T, et al. Outbreak of Tuberculosis and Multidrug-Resistant Tuberculosis, Mbuji-Mayi Central Prison, Democratic Republic of the Congo. Emerg Infect Dis. 2018;24(11):2029-35. Schwitters A, Kaggwa M, Omiel P, Nagadya G, Kisa N, Dalal S. Tuberculosis incidence and treatment completion among Ugandan prison Int J Tuberc Lung Dis. 2014;18(7):781-86. Ministério da Saúde. Secretaria de Vigilância em Saúde. Boletim epidemiológico. Brasília: Ministério da Saúde, 2018;49(8). Alinaghi SAS, Farhoudi B, Najafi Z, Jafari S. Comparing Tuberculosis incidence in a prison with the society, Tehran, Iran. Arch Clin Infect Dis. 2018;E60247:1-3. Sacramento DS, Gonçalves MJF. Situação da tuberculose em pessoas privadas de liberdade no período de 2007 a 2012 . J Nurs UFPE on line. 2017;11(1):140-51. Valença MS, Possuelo LG, Cezar-Vaz MR, Silva PE. Tuberculose em presídios brasileiros: uma revisão integrativa da literatura. Cien Saude Colet. 2016;21(7):2147-60. Sánchez A, Larouzé B. Tuberculosis control in prisons, from research to action: the Rio de Janeiro, Brazil, experience. Cien Saude Colet. 2016;21(7):2071-80. Martins ELC, Martins LG, Silveira AM, Melo EM. The contradictory right to health of people deprived of liberty: the case of a prison in Minas Gerais , Brazil. Saúde soc. 2014;23(4):1222-34. Ministério da Saúde (BR). Secretaria de Vigilância em Saúde. Departamento de Vigilância das Doenças Transmissíveis. Brasil livre da tuberculose. Plano nacional pelo fim da tuberculose como problema de saúde pública [Internet]. Brasília: Ministério da Saúde; 2017 [citado 2018 mar 8]. 52 p. Disponível em: https://drive.google.com/file/d/0B0CE2wqdEaR-eVc5V3cyMVFPcTA/view. Macedo LR, Maciel ELN, Struchiner CJ. Tuberculose na população privada de liberdade do Brasil, 2007-2013*. Epidemiol Serv Saúde. 2017;26(4):783-94. Silva PF, Moura GS, Caldas AJM. Fatores associados ao abandono do tratamento da tuberculose pulmonar no Maranhão, Brasil, no período de 2001 a 2010. Cad Saúde Pública. 2014;30(8):1745-54. Montgomery DC, Jennings CL, Kulahci M. Introductionto Time Series Analysis and Forecasting. 2th ed. Hoken, NJ: John Wiley&Sons; 2015. Cavalcante GMS, de Macedo Bernardino Í, da Nóbrega LM, Ferreira RC, Ferreira E Ferreira E, d'Avila S. Temporal trends in physical violence, gender differences and spatial vulnerability of the location of victim's residences. Spat Spatiotemporal Epidemiol. 2018;25:49-56. Alves JP, Brazil JM, Nery AA, Vilela ABA, Filho IEM. Perfil Epidemiológico de pessoas privadas de liberdade. Rev enferm UFPE on line. 2017;11(supl.10):4036-44. Lambert LA, Armstrong LR, Lobato MN, Ho C, France AM, Haddad MB. Tuberculosis in Jails and Prisons: United States. AJPH Res. 2016;106(12):2231-37. Orlando S, Triulzi I, Ciccacci F, Palla I, Palombi L, Marazzi MC et al. Delayed diagnosis and treatment of tuberculosis in HIV+ patients in Mozambique: A cost-effectiveness analysis of screening protocols based on four symptom screening, smear microscopy, urine LAM test and Xpert MTB/RIF. PLoS One. 2018;13(7):1-16. World HeatlhOrganization.The end TB strategy [Internet]. Geneva: World HeatlhOrganization; 2015. 20 p. Available in: http://www.who.int/tb/End_TB_brochure.pdf Belo MTCT, Luiz RR, Hanson SL, Teixeira EG, Chalfoun T, Trajman A. Tuberculose e gênero em um município prioritário no estado do Rio de Janeiro. J Bras Pneumol. 2010;36(5):621-25. Sá LD, Santos ARBN, Oliveira AAV, Nogueira JA, Tavares LM, Villa TCS. O cuidado á saúde da mulher com tuberculose na perspectiva do enfoque familiar. Texto contexto - enferm. 2012;21(2):409-17. Minayo MCS, Ribeiro AP. Condições de saúde dos presos do estado do Rio de Janeiro, Brasil Health conditions of prisoners in the state of Rio de Janeiro , Brazil. Ciênc saúde coletiva. 2016;21(7):2031-40. Ministério da Justiça e Segurança Pública. Departamento Penitenciário Nacional. Levantamento Nacional de Informações Penitenciárias: INFOPEN atualização junho de 2016. Org. Tandhara Santos; Colaboração. Marlene Inês da Rosa, et al. Brasília – DF, 2017, p. 65 Winter BCA, Grazinoli Garrido R. A tuberculose no cárcere: um retrato das mazelas do sistema prisional brasileiro. Med leg Costa Rica. 2017;34(2):20-31. Soares Filho MM, Bueno PMMG. Demography, vulnerabilities and right to health to Brazilian prison population. Cien Saude Colet. 2016;21(7):1999-2010. Santos MNA, Sá AMM. Viver com tuberculose em prisões: O desafio de curar-se. Texto contexto - enferm. 2014;23(4):854-61. Ilievska-Poposka B, Zakoska M, Pilovska-Spasovska K, Simonovska L, Mitreski V. Tuberculosis in the Prisons in the Republic of Macedonia, 2008-2017. Maced J Med Sci. 2018;6(7):1300-4. Oliveira LGD, Natal S, Camacho LAB. Contextos de implantação do Programa de Controle da Tuberculose nas prisões brasileiras. Rev Saúde Pública. 2015;49:66. da Silva RD, de Luna FDT, de Araújo AJ, Camêlo ELS, Bertolozzi MR, Hino P, Lacerda SNB, Fook SML, de Figueiredo TMRM. Patients' perception regarding the influence of individual and social vulnerabilities on the adherence to tuberculosis treatment: a qualitative study. BMC Public Health. 2017;17(1):725.

Ralph Lee Woodward, Jr., Central America: A Nation Divided. New York: Oxford University Press, 1985. Pp. 390. Cloth, $22.50; Paper $8.95. Second Edition. Review by Donald J. Mabry of Mississippi State University. Edward M. Anson. A Civilization Primer. San Diego: Harcourt Brace Jovanovich, 1985. Pp. 121. Spiral bound, $5.95. Review by Gordon R. Mork of Purdue University. Stephen J. Lee. Aspects of European History, 1494-1789. Second edition. London & New York: Methuen, 1984. Pp. viii, 312. Paper, $11.95. Review by Michael W. Howell of The School of the Ozarks. Roland N. Stromberg. European Intellectual History Since 1789. Englewood Cliffs, NJ: Prentice-Hall, Inc., 1986. Fourth edition. Pp. x, 340. Paper, $18.95. Review by Irby C. Nichols, Jr. of North Texas State University. R. W. Southern. Medieval Humanism and Other Studies. New York: Basil Blackwell, 1985. Pp. 261. Cloth, $24.95; Paper, $10.95. Review by Benjamin F. Taggie of Central Michigan University. H. T. Dickinson. British Radicalism and the French Revolution, 1789-1815. New York: Basil Blackwell, 1985. Pp. 88. Paper, $6.95; F. D. Dow. Radicalism in the English Revolution, 1640-1660. New York: Basil Blackwell, 1985. Pp. 90. Paper, $6.95. Review by Harry E. Wade of East Texas State University. H. R. Kedward. Occupied France: Collaboration and Resistance 1940-1944. New York: Basil Blackwell, 1985. Pp. 88. $6.95; M. E. Chamberlain. Decolonization: The Fall of the European Empire. New York: Basil Blackwell, 1985. Pp. 86. $6.95. Review by Steven Philip Kramer of the University of New Mexico. Harriet Ward. World Powers in the Twentieth Century. London: British Broadcasting Corporation and the Heinemann Educational Books, 1985. Second edition. Pp. xvii, 333. Paper, $12.00. Review by Gerald H. Davis of Georgia State University. Paul Preston, ed. Revolution and War in Spain, 1931-1939. London and New York: Methuen, 1984. Pp. xi, 299. Cloth, $29.95: Paper, $12.95. Review by Robert Kern of the University of New Mexico. Glenn Blackburn. The West and the World Since 1945. New York: St. Martin's Press, 1985. Pp. vi, 152. Paper, $9.95. Review by Victoria L. Enders of Northern Arizona University. M. K. Dziewanowski. A History of Soviet Russia. Englewood Cliffs, NJ: Prentice-Hall, Inc., 1985. Second edition. Pp. x, 406. Paper, $22.95. Review by Elizabeth J. Wilcoxson of Northern Essex Community College. Peter L. Steinberg. The Great "Red Menace": United States Prosecution of American Communists, 1947-1952. Westport, CT: Greenwood Press, 1984. Pp. xiv, 311. Cloth, $35.00. Review by Kenneth G. Alfers of Mountain View College. Winthrop D. Jordan, Leon F. Litwack, Richard Hoftstadter, William Miller, Daniel Aaron. The United States: Brief Edition. Englewood Cliffs, NJ: Prentice-Hall, Inc., 1985. Second Edition. Pp. xiv, 513. Paper, $19.95. Review by Richard A. Diem of The University of Texas at San Antonio. Edwin J. Perkins and Gary M. Walton. A Prosperous People: The Growth of the American Economy. Englewood Cliffs, NJ: Prentice-Hall, Inc., 1985. Pp. xiii, 240. Paper, $14.95. Review by Larry Madaras of Howard Community College.

Интерес к изучению систем, содержащих сульфиды формулой АIВIIIСVI2, обусловлен, прежде всего, открывающимися возможностями их практического использования в изготовлении нелинейных оптических приборов, детекторов, солнечных батарей, фотодиодов, люминофоров и др. Поэтому в связи с поиском новых перспективных материаловна основе тиогаллата серебра и железа целью этой работы является исследование квазибинарного разреза FeGa2S4–AgGaS2 четырехкомпонентной системы Fe–Ag–Ga–S.Синтез сплавов системы AgGaS2–FeGa2S4 проводили из лигатур с использованием высокой чистоты: железа – 99.995 %, галлия – 99.999 %, серебра – 99.99 % и серы – 99.99 %. Исследование сплавов проводили методами дифференциально-термического, рентгенофазового, микроструктурного анализов, а также измерением микротвердости и определениемплотности.Методами физико-химического анализа впервые изучена и построена Т-x фазовая диаграмма разреза AgGaS2–FeGa2S4, который является внутренним сечением квазитройной системы FeS–Ga2S3–Ag2S. Установлено, что система относится к простому эвтектическому типу. Состав эвтектической точки: 56 мол. % FeGa2S4 и Т = 1100 К. На основе исходных компонентов были определены области твердых растворов. Растворимость на основе FeGa2S4 и AgGaS2 при эвтектической температуре достигает до 10 и 16 мол. % соответственно. С уменьшением температуры твердые растворы сужаются и при комнатной температуре составляют на основе тиогаллата железа (FeGa2S4) 4 мол. % AgGaS2,а на основе тиогаллата серебра (AgGaS2) 11 мол. % FeGa2S4. ЛИТЕРАТУРА 1. Zhаo B., Zhu S., Li Z., Yu F., Zhu X., Gao D. Growth of AgGaS2 single crystal by descending cruciblewith rotation method and observation of properties. Chinese Sci. Bull. 2001; 46(23): 2009–2013. DOI:https://doi.org/10.1007/BF029019182. Горюнова Н. А. Сложные алмазоподобные полупроводники. М.: Сов. радио; 1968. 215 с.3. Абрикосов Н. Х., Шелимова Л. Е. Полупроводниковые материалы на основе соединений АIVBVI..М.:Наука; 1975. 195 с.4. Kushwaha A. K., Khenata R., Bouhemadou A., Bin-Omran S., Haddadi K. Lattice dynamical propertiesand elastic constants of the ternary chalcopyrite compounds CuAlS2, CuGaS2, CuInS2, and AgGaS2. Journalof Electronic Materials. 2017;46(7): 4109–4118. DOI: https://doi.org/10.1007/s11664-017-5290-65. Uematsu T., Doi T., Torimoto T., Kuwabata S. Preparation of luminescent AgInS2-AgGaS2 solid solutionnanoparticles and their optical properties. The Journal of Physical Chemistry Letters. 2010;1(22):3283–3287. DOI: https://doi.org/10.1021/jz101295w6. Karaagac H., Parlak M. The investigation of structural, electrical, and optical properties of thermalevaporated AgGaS2 thin films. J. Thin Solid Films. 2011;519(7): 2055–2061. DOI: https://doi.org/10.1016/j.tsf.2010.10.0277. Karunagaran N., Ramasamy P. Synthesis, growth and physical properties of silver gallium sulfi de singlecrystals. Materials Science in Semiconductor Processing. 2016;41: 54–58. DOI: https://doi.org/10.1016/j.mssp.2015.08.0128. Zhou H., Xiong L., Chen L., Wu L. Dislocations that decrease size mismatch within the lattice leadingto ultrawide band gap, large second-order susceptibility, and high nonlinear optical performance of AgGaS2.Angewandte Chemie International Edition. 2019;58(29): 9979–9983. DOI: https://doi.org/10.1002/anie.2019039769. Li G., Chu Y., Zhou Z. From AgGaS2 to Li2ZnSiS4: Realizing impressive high laser damage thresholdtogether with large second-harmonic generation response. Journal Chemistry of Materials. 2018;30(3):602–606. DOI: https://doi.org/10.1021/acs.chemmater.7b0535010. Yang J., Fan Q., Yu Y., Zhang W. Pressure effect of the vibrational and thermodynamic properties ofchalcopyrite-type compound AgGaS2: A fi rst-principles investigation. Journal Materials. 2018;11(12): 2370.DOI: https://doi.org/10.3390/ma1112237011. Paderick S., Kessler M., Hurlburt T. J., Hughes S. M. Synthesis and characterization of AgGaS2nanoparticles: a study of growth and fl uorescence. Journal Chemical Communications. 2018;54(1): 62–65.DOI: https://doi.org/10.1039/C7CC08070K12. Kato K., Okamoto T., Grechin S., Umemura N. New sellmeier and thermo-optic dispersion formulasfor AgGaS2. Journal Crystals. 2019;9(3): 129–135. DOI: https://doi.org/10.3390/cryst903012913. Li W., Li Y., Xu Y., Lu J., Wang P., Du J., Leng Y. Measurements of nonlinear refraction in the mid-infraredmaterials ZnGeP2 and AgGaS2. Journal Applied Physics B. 2017;123(3). DOI: https://doi.org/10.1007/s00340-017-6643-914. Jahangirova S. K., Mammadov Sh. H., Ajdarova D. S., Aliyev O. M., Gurbanov G. R. Investigation ofthe AgGaS2–PbS and some properties of phases of variable composition. Russian Journal of InorganicChemistry. 2019;64(9): 1169–1171. DOI: https://doi.org/10.1134/S003602361909009215. Asadov S. M., Mustafaeva S. N., Guseinov D. T. X-ray dosimetric characteristics of AgGaS2 singlecrystals grown by chemical vapor transport. Inorganic Materials. 2017;53(5): 457–461. DOI: https://doi.org/10.1134/S002016851705002816. Mys O., Adamenko D., Skab I., Vlokh R. Anisotropy of acousto-optic fi gure of merit for the collineardiffraction of circularly polarized optical waves at the wavelength of isotropic point in AgGaS2 crystals.Ukrainian Journal of Physical Optics. 2019;20(2): 73–80.DOI: https://doi.org/10.3116/16091833/20/2/73/20117. Karunagaran N., Ramasamy P. Investigation on synthesis, growth, structure and physical propertiesof AgGa0.5In0.5S2 single crystals for Mid-IR application. Journal of Crystal Growth. 2018;483: 169–174.DOI: https://doi.org/10.1016/j.jcrysgro.2017.11.03018. Ranmohotti K. G. S., Djieutedjeu H., Lopez J., Page A., Haldolaarachchige N., Chi H., Sahoo P., Uher C.,Young D., Poudeu P. F. P. Coexistence of high-Tc ferromagnetism and n-type electrical conductivity inFeBi2Se4. J. of the American Chemical Society. 2015;137(2): 691–698. DOI: https://doi.org/10.1021/ja508425519. Karthikeyan N., Aravindsamy G., Balamurugan P., Sivakumar K. Thermoelectric properties of layeredtype FeIn2Se4 chalcogenide compound. Materials Research Innovations. 2018;22(5): 278–281. DOI:https://doi.org/10.1080/14328917.2017.131488220. Nakafsuji S., Tonomura H., Onuma K., Nambu Y., Sakai O., Maeno Y., Macaluso R. T., Chan J. Y.Spin disorder and order in quasi-2D triangular Heisenberg antiferromagnets: comparative study ofFeGa2S4, Fe2Ga2S5 and NiGa2S4. Phys. Rev. Letters. 2007;99(1–4): 157–203. DOI: https://doi.org/10.1103/PhysRevLett.99.15720321. Rushchanskii K. Z., Haeuseler H., Bercha D. M. Band structure calculations on the layered compoundsFeGa2S4 and NiGa2S4. J. Phys. Chem. Solids. 2002;63(11): 2019–2028. DOI: https://doi.org/10.1016/S0022-3697(02)00188-922. Dalmas de Reotier P., Yaouanc A., MacLaughlin D. E., Songrui Zhao. Evidence for an exotic magnetictransition in the triangular spin system FeGa2S4. J. Phys. Rev. B. 2012;85(14): 140407.1–140407.5. DOI: https://doi.org/10.1103/physrevb.85.14040723. Myoung B. R., Lim J. T., Kim C. S. Investigation of magnetic properties on spin-ordering effects ofFeGa2S4 and FeIn2S4. Journal of Magnetism and Magnetic Materials. 2017;438: 121–125. DOI: https://doi.org/10.1016/j.jmmm.2017.04.05624. Asadov M. M., Mustafaeva S. N., Hasanova U. A., Mamedov F. M., Aliev O. M., Yanushkevich K. I., NikitovS. A., Kuli-Zade E. S. Thermodynamics of FeS–PbS–In2S3 and properties of intermediate phases. JournalDefect and Diffusion Forum.2018;385: 175–181. DOI: https://doi.org/10.4028/www.scientific.net/DDF.385.17525. Li K., Yuan D., Shen S., Guo J. Crystal structures and property characterization of two magneticfrustration compounds. Journal Powder Diffraction. 2018;33(3): 190–194. DOI: https://doi.org/10.1017/S088571561800050726. Chen B., Zhu S., Zhao B., Lei Y., Wu X., Yuan Z., He Z. Differential thermal analysis and crystal growthof AgGaS2. Journal of Crystal Growth. 2008;310(3): 635–638. DOI: https://doi.org/10.1016/j.jcrysgro.2007.10.06727. Sinyakova E. F., Kosyakov V. I., Kokh K. A. Oriented crystallization of AgGaS2 from the melt systemAg–Ga–S. J. Inorganic Materials. 2009;45(11): 1217–1221. DOI: https://doi.org/10.1134/S002016850911004128. Chykhrij S. I., Parasyuk O. V., Halka V. O. Crystal structure of the new quaternary phase AgCd2GaS4and phase diagram of the quasibinary system AgGaS2–CdS. Journal of Alloys and Compounds.2000;312(1–2):189–195. DOI: https://doi.org/10.1016/S0925-8388(00)01145-229. Olekseyuk I. D., Parasyuk O. V., Halka V. O., Piskach L. V. F., Pankevych V. Z. Romanyuk Ya. E. Phaseequilibria in the quasi-ternary system Ag2S–CdS–Ga2S3. J. Alloys and compounds. 2001;325(10): 167–179. DOI:https://doi.org/10.1016/S0925-8388(01)01361-530. Brand G., Kramer V. Phase equilibrium in the quasi-binary system Ag2S–Ga2S3. Mater. Res. Bull.1976;11(11): 1381–1388. DOI: https://doi.org/10.1016/0025-5408(76)90049-031. Лазарев В. Б., Киш З. З., Переш Е. Ю., Семрад Е. Е. Сложные халькогениды в системе Аэ–Вэээ–СVI. М.: Металлургия; 1993. 229 с.32. Угай Я. А. Введение в химию полупроводников.М.: Высшая школа; 1975. 302 с.33. Pardo M. E, Dogguy-Smiri L., Flahaut J., Nguyen H. D. System Ga2S3–FeS Diagramme dephase — etude cristallographique. Mater. Res. Bull. 1981;16(11): 1375–1384. DOI: https://doi.org/10.1016/0025-5408(81)90056-834. Wintenberger M. About the unit cells and crystal structures of ~MGa2X4 (M = Mn, Fe, Co; X = S,Se) and ZnAI2S4 Type. In: Proc. VII Int. Conf. on Solid Compounds of Transition Elements, CNRS. Grenoble,France: IA 14/1-3, 1983.35. Rustamov P. G., Babaeva P. K., Azhdarova D. S., Askerova N. A., Ailazov M. R. Nature of interaction inMn(Fe,Co,Ni)–Ga(In)–S(Se) ternary systems. Azerb. Khim. Zh. 1984;15: 101–103.36. Raghavan V. Fe-Ga-S (Iron-Gallium-Sulfur). J. Phase Equil. 1998;19: 267–268. DOI: https://doi.org/10.1361/10549719877034231937. Ueno T., Scott S. D. Phase relations in the Ga-Fe-S system at 900 and 800 C. The Canadian Mineralogist.2002;40(2): 568–570. DOI: https://doi.org/10.2113/gscanmin.40.2.56338. Allazov M. R. The system of FeS–GaS–S. Bulletin of Baku State University. 2009;(2): 42-47. Режимдоступа: http://static.bsu.az/w8/Xeberler%20Jurnali/Tebiet%202009%203/42-47.pdf39. Dogguy-Smiri L., Dung Nguyen Huy, Pardo M. P. Structure crystalline du polytype FeGa2S4 a 1T. Mater.Res. Bull. 1980;15(7): 861–866. DOI: https://doi.org/10.1016/0025-5408(80)90208-140. Hahn H., Klingler W. Unter such ungen uber ternare chalkogenide. I. Uber die, kristall structureiniger ternaerer sulfi de, die sichvom In2S3 ableiten. Zeitschrift fur Anorganische und Allgemeine Chemie.1950; 263(4): 177–190. DOI: https://doi.org/10.1002/zaac.1950263040641. Dogguy-Smiri L., Pardo M. P. Etude cristallographique du systeme FeS–Ga2S3. Compt. Rend. Acad.Sci. 1978;287: 415–418.42. Аллазов М. Р., Мусаева С. С., Аббасова Р. Ф., Гусейнова А. Г. Области кристаллизации фаз поизотермическим сечениям систем Fe-Ga-S. Известия Бакинского государственного университета.2013;(3): 11–14. Режим доступа: http://static.bsu.az/w8/Xeberler%20Jurnali/Tebiet%20%202013%20%203/11-15.pdf43. Рзагулуев В. А., Керимли О. Ш., Аждарова Д. С., Мамедов Ш. Г., Алиев О. М. Фазовые рав-новесия в системах Ag8SnS6–Cu2SnS3 и Ag2SnS3–Cu2Sn4S9. Конденсированные среды и межфазныеграницы. 2019;21(4): 544–551. DOI: https://doi.org/10.17308/kcmf.2019.21/2365

La pandemia por COVID-19 ha desatado importantes situaciones en el mundo, entre las que se destacan los problemas económicos, problemas en el sector educativo y problemas en la comunidad médica, además de muchos otros. La responsabilidad de los especialistas de salud ante el COVID-19 ha implicadoque afronten situaciones de gran presión en el colectivo. Atender a pacientes infectados de COVID-19 implica riesgos significativos para el personal, tanto por la posibilidad latente de contagio como por el impacto emocional y en la salud mental de atender gran cantidad de enfermos y el manejo de un elevado número de fallecidos, lo que puede afectar considerablemente el estado físico, mental y emocional del especialista médico. Partiendo de estas premisas, se presenta en este trabajo un análisis de las emociones, valores y fortalezas morales del personal de salud, especialmente las enfermeras, en los centros de salud del Ecuador. Se pudo observar que las emociones negativas coexisten con importantes valores morales y fortalezas, que pueden ser condicionantes para el tratamiento médico y la atención a los enfermos. Palabras Clave: personal de salud, COVID-19, estrés laboral. Referencias [1]OMS, «Brote de enfermedad por coronavirus 2019,» Sitio web Mundial, 2019. [2]BONALIP, «Origen de la COVID,» 2020. [En línea]. Disponible: https://bolavip.com/otros/Animal-o-quimi-co-El-origen-del-Covid-19-20200406-0102.html. [Último acceso: 10 de Agosto 2020]. [3]A. Lozano, «Impacto de la epidemia del Coronavirus (COVID-19) en la salud mental del personal de salud y en la población general de China,» Revista de Neuro-Psiquiatría, vol. 83, nº 1, pp. 51-56, 2020. [4]SNGRE, «SITUACIÓN NACIONAL POR COVID-19(CORONAVIRUS),» Ecuador, 2020. [5]W. H. Organization, «sector salud - consejo,» World Health Organization , 2020. [6]N. Loncharich, «El cuidado enfermero,» Rev enferm Herediana., vol. 1, nº 1, p. 3, 2010. [7]O. M. d. l. Salud, «Directrices para ayudar a los países a mantener los servicios sanitarios esenciales durante la pandemia de COVID-19),» 2020. [8]J. De La Cruz, «Protegiendo al personal de la salud en la pandemia Covid-19,» Revista de la Facultad de Medicina Humana, vol. 20, nº 2, pp. 173-174, 2020. [9]F. Suarez y L. Rosales, «Algoritmos para la detección de estados emocionales,» UNEXPO Puerto Ordaz, Puerto Ordaz, 2020. [10]«Sentimiento,» Significados. com, 10 12 2019. [En línea]. Disponible: https://www.significados.com/sentimiento/. [Último acceso: 10 de Agosto 2020]. [11]M. Thomen Bastardas, «Psicología-Online,» Psicología-Online, 28 05 2019. [En línea]. Disponible: https://www.psicologia-online.com/que-son-los-sentimientoslista-tipos-y-ejemplos-4606.html. [Último acceso: 10 08 2020]. [12]N. Benito, M. Campos, S. Plaza, A. Sánchez y M. Carrasco, «El cuidado de las emociones en enfermería,» Revista de participación, investigación y documentación, p. Buenas prácticas, 2017. [13]A. Alvarado, «La ética del cuidado,» Aquichan, vol. 4, nº 1, pp. 30-39, 2004. [14]B. Hernández, F. Javier, V. Nava, L. Ramos y O. Medina, «¨El significado de cuidado en la práctica profesional de enfermería¨,» Aquichan, vol. 9, nº 2, pp.127-134, 2009. [15]Y. Naranjo Hernández, J. A. Concepción Pacheco y M. Rodríguez Larreynaga, «¨La teoría Déficit de autocuidado: Dorothea Elizabeth Orem.¨,» Gaceta MédicaEspirituana, vol. 19, nº 3, pp. 89-100, 2017. [16]Y. Naranjo, J. Concepción y M. Rodríguez, «La teoría Déficit de autocuidado: Dorothea Elizabeth Orem,» Gaceta Médica Espirituana, vol. 19, nº 3, 2017. [17]L. A. Prado Solar, M. González Reguera, N. Paz Gómez y K. Romero Borges, «La teoría Déficit de autocuidado: Dorothea Orem punto de partida para calidaden la atención,» Revista Médica Electrónica, vol. 36, nº6, pp. 835-845, 2014. [18]R. Paul, El conflicto de las interpretaciones, 2010 ed., F. d. C. Económica, Ed., México: Fondo de Cultura Económica, 2010. [19]I. d. P. y. S. M. M. (Madrid), «Cuidando la salud mental del personal sanitario,» Instituto de Psiquiatría y Salud Mental Marañón, Madrid, 2020. [20]S. E. d. Psiquiatría, «Cuidando la Salud Mental del Personal Sanitario,» Madrid, 2020.

Este artigo trata de jornalismo e despolitização da política, considerando a literatura nacional e internacional. Ele tem como referência as críticas a um modelo normativo típico que descreve/prescreve a relação da organização e da atividade econômica da imprensa com a política e a democracia, a partir de uma analogia com a concepção liberal da economia e da política: as pressões de mercado não levam à diversidade de conteúdos e à politização, ao contrário, elas tendem a reforçar a despolitização da política. A literatura sobre mídia e política no Brasil é analítica, qualificada e volumosa, mas não trata das relações entre os processos de midiatização e de despolitização da política. Já a literatura internacional dispõe textos que revelam várias práticas e processos do espaço do jornalismo que caracterizam a despolitização da política.PALAVRAS-CHAVES: Midiatização. Despolitização. Jornalismo. ABSTRACTThis article treats of journalism and depoliticization of the politics, considering the national and international literature. He has as reference the critics to a typical normative model which presents the relation of the organization and the economic activity of the press with politics and democracy through an analogy to the liberal conception of economy and politics: the market pressures do not lead to the diversity of contents and to politicization. On the contrary, they tend to reinforce the content homogenization and the depoliticization of politics. The literature on media and politics in Brazil is analytical, qualified and bulky, but it doesn't treat of the relationships among the mediatization processes and of depoliticization of politics. Already the international literature disposes texts that reveal several practices and processes of the space of the journalism that characterize the depoliticization of the politics.KEYWORDS: Mediatization. Depoliticization. Journalism. RESUMENEste articulo trata de periodismo y despolitización de la política, considerando la literatura nacional e internacional. El tiene como referencia las críticas a un modelo normativo típico que presenta la relación de la organización y de la actividad económica de la prensa con la política y la democracia, a partir de una analogía con la concepción liberal de la economía y de la política: las presiones del mercado no llevan a la diversidad de contenidos y a la politización, al contrario, tienden a reforzar la homogeneización de contenido y la despolitización de la política. La literatura sobre los medios de comunicación y política en Brasil es analítica, cualificada y abundante pero no aborda las relaciones entre los procesos de mediatización y de despolitización de la política. Ya la literatura internacional dispone textos que revelan varias prácticas y procesos del espacio periodístico que caracterizan la despolitización de la política.PALABRAS CLAVE: Mediatización. Despolitización. Periodismo. ReferênciasARAUJO, V. T. Enquadramentos do governo Dilma na mídia impressa brasileira. Dissertação de Mestrado. Programa de Pós-Graduação em Desenvolvimento Regional, UFT, 2014.AZEVEDO, F. A. CHAIA, V. L. M. O Senado nos editoriais dos jornais paulistas (2003 - 2004). Opinião Pública, v. 14, n. 1, 2008.AZEVEDO, F. A. Mídia e democracia no Brasil: relações entre o sistema de mídia e o sistema político. Opinião Pública, v. 12, n. 1, 2006.BENSON, R. La logique du profit dans lesv medias americains. Actes de la Recherche en Sciences Sociales. v. 131-132, 2000.BIROLI, F. Gênero e política no noticiário das revistas semanais brasileiras: ausências e estereótipos. Cadernos Pagu, n. 34, 2010.BIROLI, F. MANTOVANI, D. Disputas, ajustes e acomodações na produção da agenda eleitoral: a cobertura jornalística ao Programa Bolsa Família e as eleições de 2006. Opinião Pública, v.16, n.1, 2010.BOURDIEU, P. A distinção: critica social do julgamento. São Paulo/Porto Alegre: Edusp/Zouk, 2006.BOURDIEU, P. O campo econômico. Política & Sociedade, n. 6, 2005.BOURDIEU, P. O mercado dos bens simbólicos. In: BOURDIEU, P. A economia das trocas simbólicas. São Paulo: Perspectiva, 1974.BOURDIEU, P. Sobre a televisão. Rio de Janeiro: Zahar, 1997.CALDAS, S. Jornalismo Econômico. São Paulo, Editora Contexto, 2003.CHAIA, V. TEIXEIRA, M. A. Democracia e escândalos políticos. São Paulo em Perspectiva, v. 15, n. 4, 2001.CHAMPAGNE, P. A visão midiática. In: BOURDIEU, P. A miséria do mundo. Petrópolis: Vozes, 1998.CHAMPAGNE, P. Faire l`opinion. Le neuveau jeu politique. Paris: Minuit, 2015.CHAMPAGNE, P. La double dependance. Quelques remarques sur les rapports entre les champs politique, économique et journalistique, Hermes, 17-18, 1995.COMBY, J. B. L'individualisation des problèmes collectifs: une dépolitisation politiquement située. Savoir/Aagir, Paris, n. 28, 2014.FINAMORE, C. M. CARVALHO, J. E. C. HOFF, J. Mulheres candidatas: relações entre gênero, mídia e discurso. Rev. Estud. Fem, v. 14, n. 2, 2006.GRÜN, R. Escândalos, marolas e finanças: para uma sociologia da transformação do ambiente econômico. Dados, vol. 51, n. 2, 2008a.GRÜN, R. Guerra cultural e transformações sociais: as eleições presidenciais de 2006 e a "blogosfera". Sociedade e Estado, v. 23, n. 3, 2008b.HORKHEIMER, M. ADORNO, T. A indústria cultural: o iluminismo como mistificação de massas. In: LIMA, L. C. Teoria da cultura de massa. São Paulo: Paz e Terra, 2002.KACIAF, N. Communication politique et distanciation journalistique. Les transformations contemporaines des pages Politique de la presse écrite française. Savoir/Aagir, Paris, n. 28, 2014.KACIAF, N. Les Pages "politique". Histoire du journalisme politique dans la presse écrite française (1945- 2006). Rennes: PUR, 2003.KUSCHNIR, K. Antropologia da política. Rio de Janeiro: Zahar, 2007.LAZEVEDO, F. A. Imprensa, cobertura eleitoral e objetividade: a eleição de 2000 na capital paulista. Opinião Pública, v. 7, n. 2, 2001.LEROUX, P. RIUTORT, P. Politiser en distrayant ? L'improbable pari du divertissement. Savoir/Aagir, Paris, n. 28, 2014.LOURENÇO, L. C. Propaganda negativa: ataque versus votos nas eleições presidenciais de 2002. Opinião Pública, v. 15, n. 1, 2009.MIGUEL, L. F. A eleição visível: a Rede Globo descobre a política em 2002. Dados, v. 46, n. 2, 2003.MIGUEL, L. F. Mídia e eleições: a campanha de 1998 na Rede Globo. Dados, v. 42, n. 2, 1999.NEVEU, E. De quelques effets des processos de mediatisation sur la democraties contemporaines. Réseaux, v. 18 n. 100, 2000.NEVEU, E. Sociologia do jornalismo. São Paulo: Loyola, 2006.PEDROSO NETO, A. J. O espaço dos jornalistas da economia brasileiros: gerações, origem social e dinâmica profissional. Repocs, v. 12, n. 23, 2015.RUBIM, A. A. C. AZEVEDO, F. A. Mídia e política no Brasil. Lua Nova, n. 43, 1998.SAÏTTA, E. Les transformations du rapport à la politique des journalistes français et italiens. Savoir/Aagir, Paris, n. 28, 2014.SCHUDSON, M. Discovering the news. A social history of american newspapers. New York: Basic Books, 1981.SCHUDSON, M. The power of news. Cambridge: Harvard University Press, 2000.SCHUDSON, M. The sociology of news production. Media Culture Society, n. 11, 1989.SEDEL, J. Les médias et la banlieue. Paris: Le Bord de Le Eau, 2013.THOMPSON, J. B. Ideología y cultura moderna. Teoría crítica en la era de la comunicación de masas. Ciudad de México: Universidad Autónoma Metropolitana, 1998a.THOMPSON, J. B. Los media y la modernidad. Una teoría de los medios de comunicación. Barcelona: Paidós, 1998b. Disponível em:Url: http://opendepot.org/2685/ Abrir em (para melhor visualização em dispositivos móveis - Formato Flipbooks):Issuu / Calameo

Objetivo: Esse estudo objetivou investigar percepções de estudantes de Odontologia quanto ao medo e à ansiedade em relação ao manejo de pacientes e ao risco de infecção por COVID-19. Materiais e métodos: Esse estudo transversal envolveu todos os alunos regularmente matriculados em Odontologia, no primeiro semestre de 2020, da Universidade Federal de Pelotas. Um questionário foi aplicado, coletando dados demográficos, nível de formação e perguntas relacionadas ao medo e ansiedade frente à pandemia de COVID-19. Quatro comparações de acordo com a fase da graduação (fase pré-clínica ou clínica), nível de graduação e pós-graduação e de acordo com os sexos foram feitas. Análises independentes para as comparações entre os sexos foram realizadas para os alunos de graduação e de pós-graduação (α<5%). Resultados: Foram incluídos 408 estudantes. Na graduação, mulheres relataram sentirem-se mais ansiosas ao realizar tratamento em pacientes com suspeita de COVID-19 (54%) e sentem mais medo ao ouvir que a infecção tem causado mortes (92,4%), na pós-graduação, responderam ser mais nervosas para conversar com pacientes em ambientes fechados em comparações com homens (P<0,05). Alunos em fase pré-clínica possuem significativamente menor receio (65,5%), ansiedade (32,3%) e nervosismo (28,3%) do contágio do COVID-19 quando comparados com aqueles na fase clínica. Conclusões: Mulheres e alunos na fase clínica apresentam maior ansiedade e nervosismo. Descritores: Ansiedade; Estudantes de Odontologia; Medo; Infecções por Coronavírus. Referências Chang J, Yuan Y, Wang D. [Mental health status and its influencing factors among college students during the epidemic of COVID-19]. Nan Fang Yi Ke Da Xue Xue Bao. 2020;40(2):171-176. World Health Organization. WHO Director-General’s opening remarks at the media briefing on COVID-19- 11 March 2020. 2020. Disponível em: https://www.who.int/dg/speeches/detail/who-director-general-s-opening-remarks-at-the-media-briefing-on-covid-19---11-march-2020. Acesso em: 8 de novembro de 2020. Pascarella G, Strumia A, Piliego C, Bruno F, Del Buono R, Costa F, Scarlata S, Agrò FE. COVID-19 diagnosis and management: a comprehensive review. J Intern Med. 2020;288(2):192-206. Chen E, Lerman K, Ferrara E. Tracking Social Media Discourse About the COVID-19 Pandemic: Development of a Public Coronavirus Twitter Data Set. JMIR Public Health Surveill. 2020;6(2):e19273. Iyer P, Aziz K, Ojcius DM. Impact of COVID-19 on dental education in the United States. J Dent Educ. 2020;84(6):718-722. Meng L, Hua F, Bian Z. Coronavirus Disease 2019 (COVID-19): Emerging and Future Challenges for Dental and Oral Medicine. J Dent Res. 2020;99(5):481-487. Peng X, Xu X, Li Y, Cheng L, Zhou X, Ren B. Transmission routes of 2019-nCoV and controls in dental practice. Int J Oral Sci. 2020;12(1):9. Machado RA, Bonan PRF, Perez DEDC, Martelli Júnior H. COVID-19 pandemic and the impact on dental education: discussing current and future perspectives. Braz Oral Res. 2020;34:e083. Ataş O, Talo Yildirim T. Evaluation of knowledge, attitudes, and clinical education of dental students about COVID-19 pandemic. PeerJ. 2020;8:e9575. Deery C. The COVID-19 pandemic: implications for dental education. Evid Based Dent. 2020;21(2):46-47. Basudan S, Binanzan N, Alhassan A. Depression, anxiety and stress in dental students. Int J Med Educ. 2017;8:179-186. Elani HW, Allison PJ, Kumar RA, Mancini L, Lambrou A, Bedos C. A systematic review of stress in dental students. J Dent Educ. 2014; 78(2):226-42. Sahu P. Closure of Universities Due to Coronavirus Disease 2019 (COVID-19): Impact on Education and Mental Health of Students and Academic Staff. Cureus. 2020;12(4):e7541. Ahmed MA, Jouhar R, Ahmed N, Adnan S, Aftab M, Zafar MS, Khurshid Z. Fear and Practice Modifications among Dentists to Combat Novel Coronavirus Disease (COVID-19) Outbreak. Int J Environ Res Public Health. 2020;17(8):2821. Talevi D, Socci V, Carai M, Carnaghi G, Faleri S, Trebbi E, di Bernardo A, Capelli F, Pacitti F. Mental health outcomes of the CoViD-19 pandemic. Riv Psichiatr. 2020;55(3):137-44. Mijiritsky E, Hamama-Raz Y, Liu F, Datarkar AN, Mangani L, Caplan J, Shacham A, Kolerman R, Mijiritsky O, Ben-Ezra M, Shacham M. Subjective Overload and Psychological Distress among Dentists during COVID-19. Int J Environ Res Public Health. 2020;17:5074. Rymarowicz J, Stefura T, Major P, Szeliga J, Wallner G, Nowakowski M, Pędziwiatr M. General surgeons' attitudes towards COVID-19: A national survey during the SARS-CoV-2 virus outbreak. Eur Surg. 2020;1-6. Adams JG, Walls RM. Supporting the Health Care Workforce During the COVID-19 Global Epidemic. JAMA. 2020;323(15):1439-40. Naz N, Iqbal S, Mahmood A. Stress, anxiety and depression among the dental students of university college of medicine and dentistry Lahore; Pakistan. Pak J Med Health Sci. 2017;11(4):1277-81. Waqas A, Iftikhar A, Malik Z, Aedma KK, Meraj H, Naveed S. Association of severity of depressive symptoms with sleep quality, social support and stress among Pakistani medical and dental students: A cross-sectional study. Global Psychiatry. 2019;2(2):211-20. Wang Y, Di Y, Ye J, Wei W. Study on the public psychological states and its related factors during the outbreak of coronavirus disease 2019 (COVID-19) in some regions of China. Psychol Health Med. 2020;1-10. Xiong J, Lipsitz O, Nasri F, Lui LMW, Gill H, Phan L, Chen-Li D, Iacobucci M, Ho R, Majeed A, McIntyre RS. Impact of COVID-19 pandemic on mental health in the general population: A systematic review. J Affect Disord. 2020;277:55-64. Liu N, Zhang F, Wei C, Jia Y, Shang Z, Sun L, Wu L, Sun Z, Zhou Y, Wang Y, Liu W. Prevalence and predictors of PTSS during COVID-19 outbreak in China hardest-hit areas: Gender differences matter. Psychiatry Res. 2020;287;112921. Terán E, Mayta-Tovalino F. Risk Factors, Self-perceived Stress, and Clinical Training among Dentistry Students in Peru: A Cross-sectional Study. J Contemp Dent Pract. 2019;20(5):561-5. Uraz A, Tocak YS, Yozgatligil C, Cetiner S, Bal B. Psychological well-being, health, and stress sources in Turkish dental students. J Dent Educ. 2013:77(10):1345-55. Agius AM, Gatt G, Vento Zahra E, Busuttil A, Gainza-Cirauqui ML, Cortes ARG et al. Self-reported dental student stressors and experiences during the COVID-19 pandemic. J Dent Educ. 2020. doi: 10.1002/jdd.12409. Hu J, Zou H, Dai Y, Feng Z. How to keep students engaged in oral health education during the COVID-19 pandemic. J Dent Educ. 2020. doi: 10.1002/jdd.12420. Liu S, Yang L, Zhang C, Xiang YT, Liu Z, Hu S, Zhang B. Online mental health services in China during the COVID-19 outbreak. Lancet Psychiatry. 2020;7(4):e17-8. Maia BR, Dias PC. Anxiety, depression and stress in university students: the impact of COVID-19. Estudos de Psicologia (Campinas). 2020;37:e200067.

Con el propósito de estudiar la organización de datos e identificar la diversidad de representaciones construidas en situación de exploración de datos auténticos, en un grupo de 56 estudiantes chilenos de tercer grado de primaria, se diseñó e implementó un plan de clases de estadística, en el que se solicitó a los estudiantes ordenar y organizar los datos para responder a un problema. Este artículo se centra en el estudio cualitativo de las representaciones de datos producidas por los estudiantes durante la implementación del plan de clases. La exploración de los datos realizada por los estudiantes sobre los alimentos que consumían en la escuela (“colaciones”), los llevó a elaborar representaciones de datos (listas, estado intermedio de esquema tabular y tabla de frecuencias). Se concluye que el contexto auténtico y la construcción de representaciones propias promovieron que los estudiantes construyeran preponderantemente listas (77%), aplicando con sentido la partición, la clase y el cardinal. Se sugiere incorporar explícitamente en la enseñanza el formato lista, como herramienta representacional y unidad básica de la tabla. Referencias Brizuela, B., y Alvarado, M. (2010). First graders' work on additive problems with the use of different notational tools. Revista IRICE, 21, 37-43. Recuperado a partir desde https://ojs.rosario-conicet.gov.ar/index.php/revistairice/article/view/v21n21a04 Brizuela, B., y Lara-Roth, S. (2002). Additive relations and function tables. Journal of Mathematical Behavior, 20(3), 309-319. https://doi.org/10.1016/S0732-3123(02)00076-7 Coutanson, B. (2010). La question de l’éducation statistique et de la formation de l’esprit statistique à l’école primaire en France. Étude exploratoire de quelques caractéristiques de situations inductrices d’un enseignement de la statistique au cycle III (Tesis doctoral). Université de Lyon, Francia. Recuperado desde https://tel.archives-ouvertes.fr/tel-00494338/ Dibble, E. (1997). The Interpretation of Tables and Graphs. Seattle, WA: University of Washington. Duval, R. (2003). Comment Analyser le Fonctionnement Representationnel des Tableaux et leur Diversite? Spirale -Revue de Recherches en Éducation-, 32, 7-31. Recuperado desde http://spirale-edu-revue.fr/IMG/pdf/1_Duval_Spi32F.pdf Estrella, S. (2014). El formato tabular: una revisión de literatura. Revista Actualidades Investigativas en Educación, 14(2), 1-23. Estrella, S., e Isoda, M. (2020). Suma Primero: manual del docente, 1° básico. Valparaíso: Ediciones Universitarias de Valparaíso. Estrella, S., Mena-Lorca, A., y Olfos, R. (2017). Naturaleza del objeto matemático “Tabla”. Magis: Revista Internacional de Investigación en Educación, 10(20), 105-122. https://doi.org/10.15517/aie.v14i2.14817 Estrella, S., Olfos, R., Morales, S., y Vidal-Szabó, P. (2017). Argumentaciones de estudiantes de primaria sobre representaciones externas de datos: componentes lógicas, numéricas y geométricas. Revista Latinoamericana de Investigación en Matemática Educativa, 20(3), 345-370. https://doi.org/10.12802/relime.17.2034 Estrella, S., Olfos, R., Vidal-Szabó, P., Morales, S., y Estrella, P. (2018). Competencia meta-representacional en los primeros grados: representaciones externas de datos y sus componentes. Revista Enseñanza de las Ciencias, 36(2), 143-163. https://doi.org/10.5565/rev/ensciencias.2143 Estrella, S., Zakaryan, D., Olfos, R., y Espinoza, G. (2020). How teachers learn to maintain the cognitive demand of tasks through Lesson Study. Journal of Mathematics Teacher Education, https://doi.org/10.1007/s10857-018-09423-y Friel, S. N., Curcio, F. R., y Bright, G. W. (2001). Making sense of graphs: Critical factors influencing comprehension and instructional implications. Journal for Research in Mathematics Education, 124-158. https://psycnet.apa.org/doi/10.2307/749671 Gabucio, F., Martí, E., Enfedaque, J., Gilabert, S., y Konstantinidou, A. (2010). Niveles de comprensión de las tablas en estudiantes de primaria y secundaria. Cultura y Educación, 22(2), 183-197. https://doi.org/10.1174/113564010791304528 Kaufman, E. L., Lord, M. W., Reese, T. W., y Volkmann, J. (1949). The discrimination of visual number. The American journal of psychology, 62(4), 498-525. Lehrer, R., y Schauble, L. (2000). Inventing data structures for representational purposes: Elementary grade students' classification models. Mathematical Thinking and Learning, 2(1-2), 51-74. https://psycnet.apa.org/doi/10.1207/S15327833MTL0202_3 Martí, E. (2009). Tables as cognitive tools in primary education. En C. Andersen, N. Scheuer, M. Pérez Echeverría, y E.V. Teubal (Coord.), Representational systems and practices as learning tools (pp. 133-148). Rotterdam: Sense Publishers. Martí, E., García-Mila, M., Gabucio, F., y Konstantinidou, K. (2010). The construction of a double-entry table: a study of primary and secondary school students’ difficulties. European Journal of Psychology of Education, 26(2), 215-234. www.jstor.org/stable/23883606 Martí, E., Pérez, E., y De la Cerda, C. (2010). Alfabetización gráfica. La apropiación de las tablas como instrumentos cognitivos. Contextos, 10, 65-78. Martínez, M., y Brizuela, B. (2006). A third grader’s way of thinking about linear function tables. Journal of Mathematical Behavior, 25, 285-298. https://doi.org/10.1016/j.jmathb.2006.11.003 Ministerio de Educación de Chile. (2018). Bases Curriculares Primero a Sexto Básico. Santiago de Chile: Unidad de Currículum y Evaluación, Ministerio de Educación de Chile. Recuperado desde https://www.curriculumnacional.cl/614/articles-22394_bases.pdf Moore, D. S., y Cobb, G. W. (2000). Statistics and mathematics: Tension and cooperation. The American Mathematical Monthly, 107(7), 615-630. Nisbet, S., Jones, G., Thornton, C., Langrall, C., y Mooney, E. (2003). Children’s Representation and Organisation of Data. Mathematics Education Research Journal, 15(1), 42-58. https://doi.org/10.1007/BF03217368 Pérez-Echeverría, M., y Scheuer, N. (2009). External Representations as Learning Tools: An Introduction. En C. Andersen, N. Scheuer, M. Pérez-Echeverría, y E. Teubal (Eds.), Representational systems and practices as learning tools (pp. 1-17). Rotterdam: Sense Publishers. Pfannkuch, M., y Rubick, A. (2002). An exploration of students’ statistical thinking with given data. Statistics Education Research Journal, 1(2), 4-21. https://iase-web.org/documents/SERJ/SERJ1(2).pdf Sepúlveda, A., Díaz-Levicoy, D., y Jara, D. (2018). Evaluación de la comprensión sobre Tablas Estadísticas en estudiantes de Educación Primaria. Bolema: Boletim de Educação Matemática, 32(62), 869-886. http://dx.doi.org/10.1590/1980-4415v32n62a06 Tukey, J. (1977). Exploratory data analysis. Reading, MA: Addison-Wesley. Wu, H., y Krajcik, J. (2006). Inscriptional Practices in Two Inquiry-Based Classrooms: A Case Study of Seventh Graders’ Use of Data Tables and Graphs. Journal of Research in Science Teaching, 43(1), 63-95. https://doi.org/10.1002/tea.20092 Financiamiento: Esta investigación se ha realizado dentro del proyecto subvencionado por Agencia Nacional de Investigación y Desarrollo (ANID) / FONDECYT 1200346 y Proyecto VRIE-PUCV 039.439/2020

Facilitating the uptake of established methodologies for risk-based decision-making in product conformity assessment taking into account measurement uncertainty by providing dedicated software is the aim of the European project EMPIR CASoft(2018–2020), involving the National Measurement Institutes from France, Sweden and the UK, and industrial partner Trescal (FR) as primary supporter. The freely available software helps end-users perform the required risk calculations in accordance with current practice and regulations and extends that current practice to include bivariate cases. The software is also aimed at supporting testing and calibration laboratories in the application of the latest version of the ISO/IEC 17025:2017 standard, which requires that“…the laboratory shall document the decision rule employed, taking into account the level of risk […] associated with the decision rule and apply the decision rule.” Initial experiences following launch of the new software in Spring 2020 are reported.

In this article, reflectivity is considered as an individual general ability to develop different attitudes to life events in order to reduce an external and internal uncertainty in situations. The objective of the research is to examine the self-assessment criteria for reflectivity with psychosemantic procedure. The author designs a modified version of the Ch. Osgood’s (1957) Semantic Differential (SD) for examining the content and formal features of the self-assessment criteria of reflectivity. This study suggests two main processes of self-assessment of reflectivity, notably differentiation and integration. The results of factor analysis indicate that individuals with high reflectivity level are aligned with low differentiation of the semantic space and monolithic nature of self-assessment criteria. The coherence and consistency of self-assessment criteria reduce the individuals’ level of inner uncertainty, transform external problems to familiar tasks and increase an efficient decision-making. A high level of differentiation is related to individual readiness to make a correct decision in the situation of multiple choice. High differentiation increases the individual adjustment and prevents from poor effects of high reflectivity. Consequently, a high level of reflectivity is associated with a low level of differentiation of self-assessment criteria. References Грановская Р.М. Психология веры. Санкт-Петербург: Питер, 2010. Карпов А.В. Психология рефлексивных механизмов деятельности. Москва: Изд-во «Институт психологии РАН», 2004. Карпов А.В., Пономарева В.В. Психология рефлексивных механизмов управ­ления. М.: Изд­во ИП РАН, 2000. Лактионов А.Н. Координаты индивидуального опыта. Харьков: Харьк. нац. ун-т им. В. Каразина, 2010. Леонтьев Д.А. Психологические ресурсы преодоления стрессовых ситуаций: к уточнению базовых конструктов. Психология стресса и совладающего поведения в современном российском обществе: Материалы II Междун. научно-практич. конференции. Кострома: КГУ им. Н.А. Некрасова, 2010, 2, 40–42. Леонтьев Д.А., Аверина А.Ж. Феномен рефлексии в контексте проблемы саморегуляции. Психологические исследования. 2011. №2(16). Режим доступа: http://psystudy.ru/index.php/num/2011n2-16/463-leontiev-averina16.html. Петренко В.Ф. Основы психосемантики. Москва: Эксмо, 2010. Похилько В. И., Федотова Е.О. Техника репертуарных решеток в экспериментальной психологии личности. Вопросы психологии, 1984. № 3, 151–157. Проблемы психологической герменевтики / Под ред. Н.В. Чепелевой. Киев : Изд-во Национального педагогического университета им. Н. П. Драгоманова, 2009. Савченко О.В. Рефлексивна компетентність особистості. Херсон : ПП Вишемирський В. С., 2016 Савченко О. Структура семантичного простору, що відображає уявлення суб’єкта про власну рефлексивну активність // East European Journal of Psycholinguistics. 2015. Т. 2 (1), 114–123. Чуприкова Н.И. Психология умственного развития: Принцип дифференциации. Москва : АО «Столетие», 1997. Gawronski, B. & Bodenhausen, G. (2006). Associative and propositional processes in evaluation: An integrative review of implicit and explicit attitude change. Psychological Bulletin, 132(5), 692-731. Halpern, D. F. (2001). Assessing the Effectiveness of Critical Thinking Instruction. The Journal of General Education, 50(4), 270–286. Harvey, O.J., Hunt, D. E., & Schroder, H. M. (1961). Conceptual System and Personality Organization. New York: Wiley & Sons. Janzen, G. (2006). The Representational Theory of Phenomenal Character: A Phenomenological Critique. Phenomenology and the Cognitive Sciences, 5, 321–339 [in English]. Kriegel, U. (2003). Consciousness as Intransitive Self-Consciousness: Two views. Canadian Journal of Philosophy, 33, 103-132. Lieberman, M. D., Gaunt, R., Gilbert, D. T., & Trope, Y. (2002). Reflexion and reflection: A social cognitive neuroscience approach to attributional inference. In Advances in experimental social psychology (Vol. 34, pp. 199-249). Academic Press. Nolen-Hoeksema, S., Wisco, B. E., & Lyubomirsky, S. (2008). Rethinking rumination. Perspectives on Psychological Science, 3(5), 400–424. Peters, F. (2013). Theories of consciousness as reflexivity. The Philosophical Forum, 44, 341-372. Savchenko O. (2016b) The formation level of the components of the reflective experience as a factor of the students` educational success. Psychological Prospects, 28, 269-282. References (translated and transliterated) Granovskaya, R. M. (2010). Psihologiya Very [Psychology of Faith]. S.-Petersburg: Piter. Karpov, A. V. (2004). Psihologiya Refleksivnyh Mehanizmov Deyatelnosti [Psychology of Reflective Activity Mechanisms]. Moscow: Institute of Psychology of the Russian Academy of Sciences. Karpov, A. V., Ponomareva, V. V. (2000). Psihologiya Refleksivnyh Mehanizmov Upravleniya [Psychology of Reflective Management Mechanisms]. Moscow: Institute of Psychology of the Russian Academy of Sciences. Laktionov, A.N. (2010). Koordinaty Individualnogo Opyta [Coordinates of Individual Experience]. Kharkiv: Karazin National University of Kharkiv. Leontyev, D. A. (2010). Psihologicheskie resursyi preodoleniya stressovyih situatsiy: k utochneniyu bazovyih konstruktov [Psychological resources of stressful situations overcoming: to clarify the basic constructs]. Psychology of Stress and Coping Behavior in Modern Russian Society. Book of Abstracts of the 2nd International Scientific and Applied Conference, 2. Kostroma: Nekrasov Kostroma State University. (40-42). Leontyev, D.A., Averina, A. Zh. (2011). Fenomen refleksii v kontekste problemyi samoregulyatsii [The phenomenon of reflection in the context of the problem of self-regulation]. Psihologicheskie Issledovaniya, 2(16). Retrieved from http://psystudy.ru/index.php/num/2011n2-16/463-leontiev-averina16.html. Petrenko, V.F. (2010). Osnovyi Psihosemantiki [Fundamentals of Psychosemantics]. Moscow: Eksmo. Pohilko, V. I., Fedotova, E. O. (1984). Tehnika repertuarnyih reshetok v eksperimentalnoy psihologii lichnosti [Repertory grid technique in experimental psychology of personality.]. Voprosy Psihologii, 3, 151–157. Chepeleva, N. V. (Ed.). (2009). Problemy Psihologicheskoy Germenevtiki [Issues of Psychological Hermeneutics]. Kyiv: Drahomanov National Pedagogical University. Savchenko, O.V. (2016a). Refleksyvna Kompetentnist Osobystosti [Personality`s Reflective Competence]. Kherson: Vyshemyrskyi. Savchenko, O. (2015). Struktura semantychnoho prostoru, shcho vidobrazhaie uiavlennia subyekta pro vlasnu refleksyvnu aktyvnist [The Semantic space structure of the subject’s sonception of his own mental activity]. East European Journal of Psycholinguistics, 2(1), 114–123. Chuprikova, N. I. (1997). Psihologiya Umstvennogo Razvitiya: Printsip Differentsiatsii [Psychology of Mental Development: The Principle of Differentiation.]. Moscow: Stoletiye. Gawronski, B. & Bodenhausen, G.V. (2006). Associative and propositional processes in evaluation: An integrative review of implicit and explicit attitude change. Psychological Bulletin, 132(5), 692-731. Halpern, D. F. (2001). Assessing the effectiveness of critical thinking instruction. The Journal of General Education, 50(4), 270–286. Harvey, O.J., Hunt, D. E., & Schroder, H. M. (1961). Conceptual System and Personality Organization. New York: Wiley & Sons. Janzen, G. (2006). The Representational Theory of Phenomenal Character: A Phenomenological Critique. Phenomenology and the Cognitive Sciences, 5, 321–339. Kriegel, U. (2003). Consciousness as Intransitive Self-Consciousness: Two views. Canadian Journal of Philosophy, 33, 103-132. Lieberman, M. D., Gaunt, R., Gilbert, D. T., & Trope, Y. (2002). Reflexion and reflection: A social cognitive neuroscience approach to attributional inference. In M. P. Zanna (Ed.), Advances in experimental social psychology, 34 (pp. 199–249). Academic Press. Nolen-Hoeksema, S., Wisco, B. E., & Lyubomirsky, S. (2008). Rethinking rumination. Perspectives on Psychological Science, 3(5), 400–424. Peters, F. (2013). Theories of consciousness as reflexivity. The Philosophical Forum, 44, 341-372. Savchenko O. (2016b) The formation level of the components of the reflective experience as a factor of the students` educational success. Psychological Prospects, 28, 269-282.

Abstract Introduction. Investigators from Johns Hopkins University pioneered the use of post-transplantation cyclophosphamide (PT-Cy) after T cell-replete haploidentical bone marrow (BM) infusion. A significant component of this scheme is tacrolimus (FK), associated to mycophenolate mofetil (MMF), to prevent immunological complications. FK is a calcineurin inhibitor, almost 100-fold more potent than cyclosporine A (CyA) in its inhibitory activity. In this retrospective study, we analyzed 100 patients grafted with Haplo-SCT with PT-Cy, and receiving FK or CyA. Patients and Methods. From April 2009 until April 2013, we analyzed 100 consecutive patients at two institutions (Institut Paoli Calmettes Marseille, France and Humanitas Cancer Center, Rozzano, Italy). Conditioning regimen was identical consisting of Fludarabine, Cyclophosphamide, and low dose TBI. GVHD prophylaxis consisted of Cy 50 mg/kg on days +3 and +4, FK or CyA and MMF. FK (at a total dose of 1 mg) was administered as a continuous infusion and then converted to oral formulation. CyA was dosed at 3 mg/kg as a continuous infusion and was then converted to oral formulation. MMF was administered at 45 mg/kg/day until day +35. FK, CyA and MMF were started on day +5. FK and CyA were tapered by day +100-180. Stem cell source was BM or peripheral blood stem cells (PBSC). Results. Patient and transplant characteristics are shown in Table 1. The cumulative incidence of engraftment was similar between FK and CyA groups: 30-days absolute neutrophil count > 500 was 79% vs 91% (p 0.3), and unsupported platelet count more than 20 000 at 60 days was 77% vs 84% (p 0.7), respectively. The incidence of grade 2-4 acute GVHD was 26% vs 30% (p 0.5) and the incidence of chronic GVHD was 13% vs 8% (p 0.9), respectively. The 2-year progression free survival (PFS) and overall survival (OS) were 53% vs 64% (p 0.2) and 65% vs 65%, respectively (p 0.7). The 2-year relapse incidence (RI) was 28% vs 12% (p 0.08) and the 2-year non relapse mortality was 16% vs 14% (p 0.7), respectively. In univariate analysis, only disease status (CR vs not CR) impacted the PFS, OS, and RI. Patients were regrouped in 3 cohorts (1 patient excluded because received FK + PBSC): FK + BM (n 42), CyA + BM (n 14), and CyA + PBSC (n 43). 1-year NRM was not different (17% vs 14% vs 15%, p 0.8). Compared to FK +BM and CyA + PBSC, a trend in favor of CyA + BM was observed in terms of aGVHD (7% vs 24% vs 38%, p 0.05) and cGVHD (0 vs 13% vs 10%, p 0.9). Conclusions. Although this is a retrospective study with potential selection bias, using CyA instead of standard FK did not seem to affect any major clinical outcome, with special interest for aGVHD and cGVHD. The NRM is acceptable in line with that published. GVHD incidence was lower in the group CyA + BM compared to other 2 groups. Disease status before haplo SCT was the only prognostic factor for survival and relapse. Table 1. Patient and transplant characteristics. All pts FK CSA p N % N % 100 43 57 Male Female 58/42 22/21 51/49 36/21 63/37 0.229 Age (mean) 46 44 48 0.135 Disease status at haplo 0.466 CR 56 23 53 33 58 PR 29 14 33 15 26 SD 6 1 2 5 9 PD 9 5 12 4 7 Armand Risk 0.646 Low 9 3 7 6 11 Int 72 33 77 39 68 High/Very high 19 7 16 12 21 Previous transplant <0.001 Relapse after ALLO 8 0 0 8 14 Relapse after HDC 40 21 49 19 33 Sex D/R 0.533 F/F 16 9 21 7 12 F/M 21 8 19 13 23 M/M 38 14 33 24 42 M/F 25 12 28 13 23 CMV D/R 0.009 POS/POS 70 35 81 35 61 NEG/NEG 18 2 5 16 28 POS/NEG 11 6 14 5 9 Donor 0.578 children 26 12 28 14 25 Mother 15 7 16 8 14 Father 11 6 14 5 9 Sibling 47 17 40 30 53 Cousin 1 Stem cell source <0.001 BM 56 42 98 14 25 PBSC 44 1 2 43 75 HCT-CI 0.007 0 31 18 42 13 23 1-2 23 13 30 10 18 >3 46 12 28 34 60 CD34 (mean) 4,4 3,5 5,2 <0.001 Disclosures No relevant conflicts of interest to declare.

This research aimed to evaluated and assessed the effect of the molasses level on organoleptic quality of multinutrient block (MnB). The materials used were corn forage, bentonite, urea, salt, molasses, water, blood clamshell and egg shells. The experimental designed used was a Completely Randomized Design with 4 treatments (T0 = MnB Formulation T0 + 0% of molasses, T1 = MnB Formulation T1 + 20% of molasses, T2 = MnB Formulation T2 + 35% of molases, and T3 = MnB Formulation T3 + 50% of molasses) and 4 replications. The variables observed were moisture content, texture, colored and aroma of MnB. The results showed that the addition of molasses had significantly (P <0.05) improved of MnB organoleptic quality. The conclusion for the study, that the multinutrient block formulation with 50% molasses resulted the best organoleptic quality. Key words: molasses, multinutrient block, organoleptic quality DAFTAR PUSTAKA Devendra C & Burns M. 1994. Produksi Kambing di Daerah Tropis. Bogor (ID) : Institut Pertanian Bogor Press Fathia N. 2006. Uji sifat fisik dan mekanik pakan ikan buatan dengan binder tepung tapioka. [skripsi]. Bandar Lampung (ID): Fakultas Pertanian Universitas Lampung. Garcia LO & Restrepo JIR. 1995. Multinutrient Block Handbook (FAO Better Farming Series no. 45). Rome (IT): Food and Agriculture Organization of United Nation. Hermawan, R Sutrisna & Muhtarudin. 2015. Kualitas fisik, kadar air, dan sebaran jamur pada wafer limbah pertanian dengan lama simpan berbeda. Jurnal Ilmu Peternakan Terpadu. 3 (2): 55 – 60 Ismi RS, Pujaningsih RI & Sumarsih S. 2017. Pengaruh penambahan level molases terhadap kualitas fisik dan organoleptik pakan kambing periode penggemukan. Jurnal Ilmu Petenakan. 5 (1): 58-63 Krisnan R & Ginting SP. 2009. Penggunaan Solid Ex-Decanter sebagai binder pembuatan pakan komplit berbentuk pellet: Evaluasi fisik pakan komplit berbentuk pellet. Bogor (ID): Seminar Nasional Teknologi Peternakan dan Veteriner. Bogor Litbang Pertanian Kurnia F, Suhardiman M, Stephani L & Purwadaria T. 2012. Peranan nano-mineral sebagai bahan imbuhan pakan untuk meningkatkan produktivitas dan kualitas produksi ternak. Wartazoa. 22 (4): 187 – 194 Pratama N, Djamas D & Darvina Y. 2016. Pengaruh variasi ukuran partikel terhadap nilai konduktivitas termal papan partikel tongkol jagung. Jurnal Pillar of Physics. 7 (1): 25 – 32 Santi RK, Fatmasari D, Widyawati SD & Suprayogi PS. 2012. Kualitas dan nilai kecernaan in vitro silase batang pisang (Musa paradisiaca) dengan penambahan beberapa akselerator. Jurnal Tropical Animal Husbandry. 1 (1): 15 – 23 Simanihuruk K & Sirait, J. 2010. Silase kulit buah kopi sebagai pakan dasar pada kambing boerka sedang tumbuh. Bogor (ID): Seminar Nasional Teknologi Peternakan dan Veteriner. Litbang Pertanian Syahri M, Retnani Y & Khotijah L. 2018. Evaluasi penambahan binder berbeda terhadap kualitas fisik mineral wafer. Bulletin Makanan Ternak. 16 (1): 24-35 Syukur A & Suharno B. 2014. Bisnis Pembibitan Kambing. Yogyakarta (ID): Penebar Swadaya, Toharmat T, Nurasih E, Nazilah R, Hotimah N, Noerzihad TQ, Sigit NA & Retnani Y. 2005. Sifat fisik pakan kaya serat dan pengaruhnya terhadap konsumsi dan kecernaan nutrien ransum pada kambing. Media Peternakan. 29 (3): 146 – 154 Triyanto E, Prasetiyono BWHE & Mukodiningsih S. 2013. Pengaruh bahan pengemas dan lama simpan terhadap kualitas fisik dan kimia wafer pakan komplit berbasis limbah agroindustri. Jurnal Animal Agriculture. 2 (1): 400 – 409. Warsy, Chadijah S & Rustiah W. 2016. Optimalisasi kalsium karbonat dari cangkang telur untuk produksi pasta komposit. Al-Kimia. 4 (2): 86 - 97 Widiastuti R. 2013. Kualitas pellet berbasis sisa pangan foodcourt dan limbah sayuran fermentasi sebagai bahan pakan fungsional ayam broiler. [tesis] Semarang (ID): Fakultas Peternakan dan Pertanian Universitas Diponegoro Yusmadi, Nahrowi & Ridla M. 2008. Kajian mutu dan palatabilitas silase dan hay ransum komplit berbasis sampah organik primer pada kambing Peranakan Etawah. Agripet. 8 (1): 31 – 38. Zakaria ZA B, Zakaria N & Kasim Z. 2014. Mineral composition of the cockle (Anadara granosa) shells, hard clamp (Meretrix meretrix) shells and corais (Porites spp.): a comparative study. Journal Animal Veterinary Advances. 3 (7): 445 – 447

Abstrak: Penelitian ini bertujuan untuk mendeskripsikan pengelolaan kantin sehat di SDN 6 Bukit Tunggal Palangka Raya. Penelitian ini menggunakan pendekatan kualitatif dengan rancangan studi kasus. Sumber data penelitian terdiri dari kepala sekolah, guru dan para pedagang kantin sekolah. Pengumpulan data dilakukan dengan teknik observasi, wawancara, dan studi dokumentasi. Teknik analisis data dilakukan dengan tahapan: reduksi data, penyajian data dan verifikasi atau penarikan kesimpulan. Hasil penelitian menunjukkan bahwa: (1) proses perencanaan kantin sehat dilakukan dengan tahapan mulai dari identifikasi kebutuhan layanan kantin sehat hingga penetapan jadwal kegiatan kantin sehat; (2) pengorganisasian kantin sehat dilakukan dengan menetapkan struktur organisasi kantin beserta tugas serta tanggungjawab pengelola kantin; (3) pelaksanaan kantin sehat dikelola sekolah bersama penjaga kantin; dan (4) pengawasan kantin sehat dilakukan secara internal oleh pihak sekolah dan eksternal dengan melibatkan stakeholders seperti: Badan POM, Puskesmas Kayon, dan Dinas Lingkungan Hidup. Abstract: This study aims to describe the management of a healthy canteen at SDN 6 Bukit Tunggal Palangka Raya. This study used a qualitative approach with case study design. Sources of research data consisted of school principals, teachers and school canteen traders. The data was collected by means of observation, interview and documentation study. The data analysis technique was carried out in stages: data reduction, data presentation and verification or drawing conclusions. The results showed that: (1) the planning process for a healthy canteen was carried out with stages starting from identifying the need for healthy canteen services to establishing a schedule for healthy canteen activities; (2) the organization of a healthy canteen is carried out by determining the organizational structure of the canteen and the duties and responsibilities of the canteen manager; (3) implementation of a healthy canteen managed by the school together with the canteen guard; and (4) supervision of the healthy canteen is carried out internally by the school and externally by involving stakeholders such as: the POM, Kayon Puskesmas, and the Environmental Agency. References: Adriani, M., & Wirjatmadi, B. (2013). Pengantar Gizi Masyarakat. Jakarta: Kencana Prenada Media Group. Daryanto., & Farid, M. (2013). Konsep Dasar Manajemen Pendidikan di Sekolah. Yogyakarta: Gava Media Februhartanty, J., Iswarawanti, D. N., Ermayani, E., Meiyetriani, E., Laras, I. P., & Astuti, R. D. (2018). Pengembangan Kantin Sehat Sekolah. Jakarta: Southeast Asian Ministers of Education Organization Regional Centre for Food and Nutrition SEAMEO RECFON. Hanum, S. M. F., & Latifah, F. N. (2019). PKM Kantin Sehat SMP di Kecamatan Porong Kabupaten Sidoarjo Jawa Timur. Jurnal ABDINUS: Jurnal Pengabdian Nusantara, 2(2), 159-168. doi: https://doi.org/10.29407/ja.v2i2.12407. Mavidayanti, H., & Mardiana. (2016). Kebijakan Sekolah dalam Pemilihan Makanan Jajanan pada Anak Sekolah Dasar. Unnes Journal of Health Education, 1(1), 71-77. Miles, M. B., & Huberman, A. M. (1994). Analisis Data Kualitatif Buku Sumber tentang Metode-Metode Baru. Jakarta: UI Press. Novariska, T. (2004). Prinsip Dasar Ilmu Gizi. Jakarta: PT Gramedia Pustaka Umum. Sagala, S. (2012). Administrasi Pendidikan Kontemporer. Bandung: Alfabeta. Soemanto, W. (1990). Psikologi Pendidikan Landasan Kerja Pemimpin Pendidikan. Jakarta: PT Rineka Cipta. Yusuf, L., Yulastri, A., Kasmita., & Faridah, A. (2008). Teknik Perencanaan Gizi Makanan: untuk Sekolah Menengah Kejuruan. Jakarta: Direktorat Pembinaan Sekolah Menengah Kejuruan, Direktorat Jenderal Pendidikan Dasar dan Menengah.

AGYEMAN, J. et al. Trends and Directions in Environmental Justice: From Inequity to Everyday Life, Community, and Just Sustainabilities. Annual Review of Environmental Resources, v. 41, p. 6.1-6.20, 2016.BOYLE, A. Human rights and the environment: where next? The European Journal of International Law, v. 23, n. 3, p. 613-642, 2012.CRUTZEN, P. J.; STOERMER, E. F. The ‘Anthropocene’. Global Change Newsletter, v. 41, p. 17-18, 2000.DRYZEK, J. S.; NORGAARD, R. B.; SCHLOSBERG, D. Climate-Challenged Society. Oxford: Oxford University Press, 2013.GONÇALVES, A.; GUERRA, J. Experimentar ciência e cidadania: o caso EuroLifeNet. Atas do VI Congresso Português de Sociologia: Mundos Sociais: Saberes e Práticas. Lisboa: Associação Portuguesa de Sociologia, 2008.GUERRA, J.; LOURENÇO, L. C. The 2030 Agenda: trends of transition toward sustainability. In: DELICADO, A.; DOMINGOS, N.; SOUSA, L. (org.). The Diverse Worlds of Sustainability. Lisboa: Imprensa de Ciências Sociais, 2018. p. 53-85.GUDOWSKYA, N.; ROSA, A. Bridging epistemologies – Identifying uniqueness of lay and expert knowledge for agenda setting. Futures, v. 109, p. 24-38, 2019.GUIVANT, J. S. O Legado de Ulrich Beck. Ambiente & Sociedade, v. 19, n. 1, p. 229-240, 2016.HOLANDA, S. B. Raízes do Brasil. São Paulo: Cia. das Letras, 2006.IPCC. Climate Change 2014: Synthesis Report. Contribution of Working Groups I, II and III to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change. Genebra: IPCC, 2014.IPCC. Global warming of 1.5°C. An IPCC Special Report on the impacts of global warming of 1.5°C above pre-industrial levels and related global greenhouse gas emission pathways, in the context of strengthening the global response to the threat of climate change, sustainable development, and efforts to eradicate poverty. Genebra: World Meteorological Organization, 2018.KAISER J. Ecologists on a mission to save the world. Science, v. 287, p. 1188-1192, 2000.LIKENS, G. E. The role of science in decision making: does evidence-based science drive environmental policy? Frontiers in Ecology and the Environment, v. 8, n. 6, p. e1-e9, 2010.LIMA, S. et al. Produção e consumo de produtos orgânicos no mundo e no Brasil. Rio de Janeiro: Instituto de Pesquisa Econômica Aplicada, 2020.PIKETTY, T.; SAEZ, E. Inequality in the long run. Science, v. 344, n. 6186, p. 838-843, 2014.PNUD. Relatório de Desenvolvimento Humano 2011 – Sustentabilidade e Equidade: um Futuro Melhor para Todos. Lisboa: IPAD/PNUD, 2011.REGANOLD, J.; WACHTER, J. Organic agriculture in the twenty-first century. Nature Plants, v. 2, Article 15221, 2016. DOI: 10.1038/NPLANTS.2015.221.TAYLOR, D. Is Environmental Health a Basic Human Right? Environmental Health Perspectives, v. 112, n. 17, p. A1006-A1009, 2004.UN GENERAL ASSEMBLY. Transforming our World: the 2030 Agenda for Sustainable Development - Resolution adopted by the General Assembly on 25 September 2015. Genebra: ONU, 2015.UNCHE. Report of the United Nations Conference of the Human Environment. Stockholm: United Nations Publication, 5-16 June 1972.

Background. Novel targeted therapies have demonstrated high efficacy in relapse and/or refractory (R/R) MCL. Ibrutinib, a first in class BTK inhibitor, is approved for R/R MCL. Venetoclax, a first in class bcl-2 inhibitor, is currently under investigation in prospective trials in R/R MCL. Obinutuzumab is a type II glycol-engineered, humanized anti-CD20 antibody approved in frontline and R/R follicular lymphoma which has shown efficacy in MCL (Chiron Blood 2016, Le Gouill ICML/EHA 2019). Pre-clinical investigations have demonstrated the utility of combining these three molecules in MCL (Chiron et al, Blood 2016) The OAsIs trial (NCT02558816) is a multicenter, non-randomised, phase I study that was designed to assess the safety, tolerability and efficacy of Ibrutinib/ Venetoclax/Obinutuzumab in both R/R MCL and in newly diagnosed MCL. The study is divided into three steps (A, B,C, respectively) : step A enrolled nine R/R MCL who were treated with Ibrutinib plus Obinutuzumab and step B enrolled 24 R/R MCL patients who were treated with Ibrutinib/Venetoclax/Obinutuzumab (Venetoclax dose from 200 to 800mg ). The Ibrutinib/Venetoclax/Obinutuzumab combination demonstrated a good safety profile and high response rates in R/R MCL (step B). No DLT was reported in either step (Le Gouill et al, ASH 2018). Herein, we present the safety (primary objective), clinical and MRD results for Oasis step C where Ibrutinib/Venetoclax/Obinutuzumab was given to newly-diagnosed, untreated MCL patients. Methods: Obinutuzumab was given at 1000mg IV C1D1, 8, 15, C2-6 D1 and every 2 months until C23. Ibrutinib was given as a standard dose (560mg/d) from C1D2 and until progression. The dose of Venetoclax was 400mg (according to step B analysis and DSMC recommendations) and administered from C1-bis (to prevent TLS: C1-bis W1-20mg, C1-bis W2-50, C1-bis W3-100, C1-bis W4-200) and at 400mg from C2 to C23. Response was assessed by cheson 99 criteria at C2, C4 and C6 and by Lugano criteria at Cycle 6. MRD by ASO-qPCR (assay sensitivity 10-5) was measured at the end of C3 and 6 in blood and / or bone marrow. DLTs were assessed during the first 3 months (C1, C1-bis and C2) of treatment. Results. Fifteen untreated MCL patients were enrolled from August 2018 to April 2019, in 6 participating centers (France and UK). Median age at inclusion was 65y (range 51-77). All patients presented with stage III/IV disease and nodal disease (four patients had tumor mass &gt;5cm). The MIPI score was high in 9 cases, intermediate in 5 and low in one case. One patient presented with pleomorphic variant. TP53 status at diagnosis was assessed in 13 patients (one was not informative and two are ongoing) of these one presented TP53 mutation. IGHV status (assessed in 13 patients, ongoing in 2) was mutated in two cases including the p53mutcase and not mutated in 8 (not informative in 3 cases). During the first three months of treatment (C1, C1-bis and C2), the relative dose intensity (ratio of delivered to the planned dose intensity) was 87% for Ibrutinib, 93% for Obinutuzumab and 100% for Venetoclax. During this period, non-hematological grade 3-4 AEs were hepatobiliary disorders (n=4; 3 patients with raised GGT-grade 3-, alanine -grade 3- and aspartate -grade 4- aminotransferase and one with biological cytolysis - grade 4) and rash (n=1; grade 3). Hematological grade 3-4 AEs were lymphocytosis (n=1; grade 3) and neutropenia (n=1; grade 4). All (n=15) patients are in response (including CR/uCR in 7 cases) at end of cycle 2 according to Cheson 99 criteria. In terms of MRD status, 8 patients (others are ongoing) were assessed at end of cycle 3 and all were MRD negative in BM (n=6) and/or in blood (n=8), including the p53mutpatient. Seven patients completed 6 cycles, all reached CR according to Lugano criteria (6 in CR/Cru according to Cheson criteria) and were MRD neg (in blood in all cases and in BM in 6 cases -one not done), including the P53mut patient. At date of last monitoring (Jul 2019), no disease progression is reported and all patients remain under the planned treatment. Conclusion. Ibrutinib/Venetoclax/Obinutuzumab combination therapy has a very good safety profile and shows high efficacity rates at the molecular level in untreated patients. Oasis step C is the first trial that report the use of Ibrutinib/Venetoclax/Obinutuzumab as frontline therapy in MCL. Disclosures Le Gouill: Janssen-cilag: Consultancy, Honoraria; Novartis: Consultancy; Abbvie: Consultancy, Honoraria; Roche Genentech: Consultancy, Honoraria; Gilead-Kite: Consultancy, Honoraria; Servier: Consultancy; loxo: Consultancy, Honoraria; Takeda: Consultancy. Morschhauser:Bayer: Membership on an entity's Board of Directors or advisory committees; Epizyme: Membership on an entity's Board of Directors or advisory committees; F. Hoffmann-La Roche Ltd: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees; Celgene: Honoraria, Membership on an entity's Board of Directors or advisory committees; Janssen: Honoraria; BMS: Membership on an entity's Board of Directors or advisory committees; Gilead: Membership on an entity's Board of Directors or advisory committees. Bouabdallah:Takeda: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Roche: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees. Cartron:Roche, Celgene: Consultancy; Sanofi, Gilead, Janssen, Roche, Celgene: Honoraria. Chevallier:Jazz Pharmaceuticals: Honoraria; Daiichi Sankyo: Honoraria; Incyte: Consultancy, Honoraria. Rule:Janssen: Consultancy, Honoraria, Research Funding; Roche: Consultancy, Honoraria, Research Funding; Astra-Zeneca: Consultancy, Honoraria; Napp: Consultancy; TG Therapeutics: Consultancy, Honoraria; Sunesis: Consultancy, Honoraria; Gilead: Consultancy, Honoraria; Pharmacyclics: Consultancy, Honoraria; Celgene: Consultancy, Honoraria; Kite: Consultancy. OffLabel Disclosure: Venetoclax, obinutuzumab in mantle cell lymphoma

Trace elements investigated by electron microprobe analysis (EMPA) have been combined with oxygen isotopic composition of pink, red and other colored spinels (blue, purple, brown, orange, lavender) hosted by marbles and found in placers from Luc Yen and An Phu deposits, Yen Bai province, North Vietnam. The deposits are those from Nuoc Ngap, Cong Troi, Bai Son and different placers from the An Phu area. Trace elements such as Fe-Zn-Cr-V in red and pink gem spinels permit to separate those from Cong Troi and those from the others deposits of the An Phu area. Spinels from Cong Troi have low to extremely low Zn (< 500 ppm) and high Fe contents (3,000 to 16,000 ppm) while those from An Phu area are Zn-rich (up to 11,000 ppm). Iron is the dominant element for the other colored spinels whereas Zn, Cr and V contents are extremely variable. The Bai Son blue spinel is Fe-rich (5,000 to 7,200 ppm) with some V (950 to 1,830 ppm), Cr (270 to 480 ppm), Co (240 to 400 ppm) and Ni (550 to 950 ppm). The O-isotope composition of the whole spinels ranges between 12.1 and 24.2‰ (n = 25). Within each deposit, the range of δ18O values for red, pink and colored spinels is usually similar. However, the red and pink spinels from An Phu present two distinct sets of δ18O values, respectively between 13.2 to 17.0‰ (n = 7) and 22.5< δ18O < 24.2 (n = 5). Those from Cong Troi are from 14.8 to 17.7‰ (n = 3) and their range overlaps that of An Phu. The use of O-isotopes is not useful for distinguishing between the deposits, but the low to extremely low Zn content of the Cong Trois spinels is a discriminant. The variation of δ18O values (12.1 <δ18O < 24.2‰) of the whole spinels indicates that the oxygen isotopic compositions of the metamorphic fluids were probably buffered by the local δ18O values of the impure host marbles.ReferencesChauviré B., Rondeau B., Fritsch E., Ressigeac Ph., Devidal J.-L., 2015. Blue spinel from the Luc Yen district of Vietnam. Gems & Gemology, 51, 2-17.D'Ippolito V., Andreozzi G.B., Hålenius H., Skogby H., Hametner K., Günther D., 2015. Colour mechanisms in spinel: cobalt and iron interplay for the blue colour. Physics and Chemistry of Minerals, 42, 431-439.Garnier V., 2003. Les gisements de rubis associés aux marbres de l’Asie Centrale et du Sud-est: genèse et caractérisation isotopique. PhD thesis INPL, Nancy, France, 373p.Garnier, V., Ohnenstetter, D., Giuliani, G., Maluski, H., Deloule, E., Phan Trong Trinh, Pham Van Long, Hoang Quang Vinh, 2005. Age and significance of ruby-bearing marbles from the Red River shear zone, northern Vietnam. The Canadian Mineralogist, 43, 1315-1329.Garnier V., Giuliani G., Ohnenstetter D., Fallick A.E., Dubessy J., Banks D., Hoang Quang Vinh, Lhomme Th., Maluski H., Pêcher A., Bakhsh K.A., Pham Van Long, Phan Trong Trinh, Schwarz D., 2008. Marble-hosted ruby deposits from central and Southeast Asia: towards a new genetic model. Ore Geology Reviews, 34, 169-191.Giuliani G., Fallick A.E., Garnier V., France-Lanord Ch., Ohnenstetter D., Schwarz D., 2005. Oxygen isotope composition as a tracer for the origins of rubies and sapphires. Geology, 33(4), 249-252.Giuliani G., Fallick A.E., Boyce A.J., Pardieu V., Pham Van Long, 2017. Pink and red spinels in marble: trace elements, oxygen isotopes, and sources. The Canadian Mineralogist, 55, 743-761.Hauzenberger C.A., Häeger T., Baumgartner L.P., Hofmeister W., 2001. High-grade metamorphism and stable isotope geochemistry of N-Vietnamese gem-bearing rocks. In: Proceedings of the Workshop on gems and minerals of Vietnam, Hanoi, 124-138.Hauzenberger C.A., Bagola C., Häeger T., Muellen C., Nguyen Ngoc Khoi, Le Thi Thu Huong, 2014. Mineralogy and petrology of the An Phu marble hosted spinel and corundum deposit, Luc Yen, N-Vietnam. In Proceedings of the 4th International Gem and Jewelry Conference, Chiang Mai, Thailand, 76-78.Kleišmantas A., Daukšyte A., 2016. The influence of Vietnam and Sri Lanka spinel mineral chemical elements on colour. Chemija, 27, 45-51.Kretz R., 1983. Symbols for rock-forming minerals. American Mineralogist, 68, 277-279.Le Thi Thu Huong, Häeger T., Hofmeister W., Hauzenberger C., Schwarz D., Pham Van Long, Wehmeister U., Nguyen Ngoc Khoi, Nguy Tuyet Nhung, 2012. Gemstones from Vietnam: An update. Gems & Gemology, 48, 158-176.Malsy A., Klemm L., 2010. Distinction of gem spinels from the Himalayan mountain belt. Chimia, 64(10), 741-746.Malsy A., Karampelas S., Schwarz D., Klemm L., Armbruster T., Tuan Do Anh, 2012. Orangey-red to orangey-pink gem spinels from a new deposit at Lang Chap (Tan Huong - Truc Lau), Vietnam. The Journal of Gemmology, 33, 19-27.Pham Van Long, Hoang Quang Vinh, Garnier V., Giuliani G., Ohnenstetter D., Lhomme,T., Schwarz D., Fallick A.E., Dubessy J., Phan Trong Trinh, 2004. Gem corundum deposits in Vietnam. Journal of Gemmology, 29, 129-147.Pham Van Long, Pardieu V., Giuliani G., Nguy Tuyet Nhung, Pham Thi Thanh Hien, Pham Duc Anh, Nguyen Ngoc Khoi, Hoang Quang Vinh, 2014. Gemmological characteristics of spinel from Luc Yen, Yen Bai. Journal of Geology, 340, 29-36.Pham Van Long, Pardieu V., Giuliani G., 2014. Update on gemstone mining in Luc Yen, Vietnam. Gems & Gemology, 49, 233-245.Pouchou J.L., Pichoir F., 1991. Quantitative analysis of homogeneous or stratified microvolumes applying "PAP" In Electron Probe Quantification (K.F.J. Heinrich & D.E. Newbury eds.). Plenum Press, New York, USA, 31-75.Valley J.W., 1986. Stable isotope geochemistry of metamorphic rocks. Reviews in Mineralogy, 16, 445-481.Yui T.F., Khin Zaw, Wu C.-M., 2008. A preliminary stable isotope study on Mogok ruby, Myanmar. Ore Geology Reviews, 34, 182-199.

Curriculum material is generally considered the subject matter of information, talents, dispositions, understandings, and principles that make up research programs in the field. At a more complex level, the curricula need to contain historical and socio-political strengths, traditions, cultural views, and goals with wide differences in sovereignty, adaptation, and local understanding that encompass a diversity of cultures, laws, metaphysics, and political discourse This study aims to develop a curriculum with local content as a new approach in early childhood science learning. The Local Content Curriculum (LCC) is compiled and developed to preserve the uniqueness of local culture, natural environment, and community crafts for early childhood teachers so that they can introduce local content to early childhood. Research and model development combines the design of the Dick-Carey and Dabbagh models with qualitative and quantitative descriptive analysis. The results showed that local content curriculum products can be supplemented into early childhood curricula in institutions according to local conditions. Curricula with local content can be used as a reinforcement for the introduction of science in early childhood. The research implication demands the concern of all stakeholders to see that the introduction of local content is very important to be given from an early age, so that children know, get used to, like, maintain, and love local wealth from an early age. Keywords: Early Childhood, Scientific Learning, Local Content Curriculum Model References: Agustin, R. S., & Puro, S. (2015). Strategy Of Curriculum Development Based On Project Based Learning (Case Study: SMAN 1 Tanta Tanjung Tabalong South Of Kalimantan ) Halaman : Prosiding Ictte Fkip Uns, 1, 202–206. Agustina, N. Q., & Mukhtaruddin, F. (2019). The Cipp Model-Based Evaluation on Integrated English Learning (IEL) Program at Language Center. English Language Teaching Educational Journal, 2(1), 22. https://doi.org/10.12928/eltej.v2i1.1043 Altinyelken, H.K. (2015). Evolution of Curriculum Systems to Improve Learning Outcomes and Reduce Disparities in School Achievement, in Background paper prepared for the Education for All Global Monitoring Report 2015. Andrian, D. (2018). International Journal of Instruction. 11(4), 921–934. Andrian, D., Kartowagiran, B., & Hadi, S. (2018). The instrument development to evaluate local curriculum in Indonesia. International Journal of Instruction, 11(4), 921–934. https://doi.org/10.12973/iji.2018.11458a Aslan, Ö. M. (2018). From an Academician’ s Preschool Diary: Emergent Curriculum and Its Practices in a Qualified Example of Laboratory Preschool. 7(1), 97–110. https://doi.org/10.5430/jct.v7n1p97 Bakhtiar, A. M., & Nugroho, A. S. (2016). Curriculum Development of Environmental Education Based on Local Wisdom at Elementary School. International Journal of Learning, Teaching and Educational Research, 3(3), 20–28. Barbarin, O. A., & Wasik, B. H. (2009). Handbook of child development and early education. Guilford Press. Baron-gutty, A. (2018). Provision in Thai basic education”. March. Bodrova, E. (2008). Make-believe play versus academic skills: A Vygotskian approach to today’s dilemma of early childhood education. European Early Childhood Education Research Journal, 16(3), 357–369. https://doi.org/10.1080/13502930802291777 Bohling-philippi, V., Crim, C., Cutter-mackenzie, A., Edwards, C., Desjean-perrotta, B., Finch, K., Brien, L. O., & Wilson, R. (2015). International Journal of Early Childhood. 3(1), 1–103. Brooker, L., Blaise, M., & Edwards, s. (2014). The SAGE handbook of play and learning in early childhood. Sage. Broström, S. (2015). Science in Early Childhood Education. Journal of Education and Human Development, 4(2(1)). https://doi.org/10.15640/jehd.v4n2_1a12 Childhood, E., Needs, T., & Han, H. S. (2017). Implementing Multicultural Education for Young Children in South Korea: Implementing Multicultural Education for Young Children in South Korea: Early Childhood Teachers’ Needs 1 ). March. Dabbagh, N & Bannan-Ritland, B. (2005). Online Learning: Concepts, Strategies, and Application. Pearson Education, Inc. Dahlberg, G., Moss, P., & Pence, A. (2013). Beyond quality in early childhood education and care: Languages of evaluation. Routledge. Dahlberg, G., Moss, P., & Pence, A. (2013). Beyond quality in early childhood education and care: Languages of evaluation. Routledge. Daryanto. (2014). Pendekatan Pembelajaran Saintifik. Gava Media. Dick, C. & C. (2009). The Sistematic Design of Instruction. Upper Saddle River. Elde Mølstad, C., & Karseth, B. (2016). National curricula in Norway and Finland: The role of learning outcomes. European Educational Research Journal, 15(3), 329–344. https://doi.org/10.1177/1474904116639311 Eurydice. (2018). Steering Documents and Types of Activities. Farid, MN. (2012). Peranan Muatan Lokal Materi Batik Tulis Lasem Sebagai Bentuk Pelestarian Budaya Lokal. Jurnal Komunitas, 4(1), 90–121. Fisnani, Y., Utanto, Y., Ahmadi, F., Tengah, J., Technology, E., Semarang, U. N., Education, P. T., Semarang, U. N., & Info, A. (2020). The Development of E-Module for Batik Local Content in Pekalongan Elementary. 9(23), 40–47. Fitriani, R. (2018). The Effect of Scientific Approach Applied on Scientific Literacy to Student Competency at Class VIII Junior High School 12 Padang. International Journal of Progressive Sciences and Technologies (IJPSAT), 7(1), 97–105. Fleer, M. (2015). Pedagogical positioning in play-teachers being inside and outside of children’s imaginary play. Early Child Development and Care, 185(11–12), 1801–1814. https://doi.org/10.1080/ 03004430.2015.1028393 Hakk, İ. (2011). Curriculum Reform and Teacher Autonomy in Turkey: The Case of the HistoryTeachi̇ng. International Journal of Instruction, 4(2), 113–128. Haridza, R., & Irving, K. E. (2017). The Evolution of Indonesian and American Science Education Curriculum: A Comparison Study. 9(February), 95–110. Hatch, J. A. (2012). From theory to curriculum: Developmental theory and its relationship to curriculum and instruction in early childhood education. In & D. W. N. File, J. Mueller (Ed.), Curriculum in early childhood education: Re-examined, rediscovered, renewed (pp. 42–53). Hos, R., & Kaplan-wolff, B. (2020). On and Off Script: A Teacher’ s Adaptati on of Mandated Curriculum for Refugee Newcomers in an Era of Standardization On and Off Script: A Teacher’ s Adaptati on of Mandated Curriculum for Refugee Newcomers in an Era of Standardization. Journal of Curriculum and Teaching, 9(1), 40–54. https://doi.org/10.5430/jct.v9n1p40 Hosnan, M. (2014). Pendekatan saintifk dan kontekstual dalam pembelajaran abad 21. Ghalia Indonesia. Hussain, A., Dogar, A. H., Azeem, M., & Shakoor, A. (2011). Evaluation of Curriculum Development Process. International Journal of Humanities and Social Science, 1(14), 263–271. Maryono. (2016). The implementation of schools’ policy in the development of the local content curriculum in primary schools in Pacitan , Indonesia. Education Research and Reviews, 11(8), 891–906. https://doi.org/10.5897/ERR2016.2660 Masithoh, D. (2018). Teachers’ Scientific Approach Implementation in Inculcating the Students ’ Scientific Attitudes. 6(1), 32–43. Mayfield, B. J. (1995). Educational curriculum. Journal of Nutrition Education, 27(4), 214. https://doi.org/10.1016/s0022-3182(12)80438-9 Muharom Albantani, A., & Madkur, A. (2018). Think Globally, Act Locally: The Strategy of Incorporating Local Wisdom in Foreign Language Teaching in Indonesia. International Journal of Applied Linguistics and English Literature, 7(2), 1. https://doi.org/10.7575/aiac.ijalel.v.7n.2p.1 Nasir, M. (2013). Pengembangan Kurikulum Muatan Lokal dalam Konteks Pendidikan Islam di Madrasah. Hunafa: Jurnal Studia Islamika, 10(1), 1–18. Nevenglosky, E. A., Cale, C., & Aguilar, S. P. (2019). Barriers to effective curriculum implementation. Research in Higher Education Journal, 36, 31. Nuttal, J. (2013). Weaving Te Whariki: Aotearoa New Zealand’s early childhood curriculum framework in theory and practice (2nd ed.) (2nd ed.). NZCER Press. Oates, T. (2010). Could do better: Using international comparisons to refine the National Curriculum in England. O’Gorman, L., & Ailwood, J. (2012). ‘They get fed up with playing’: Parents’ views on play-based learning in the preparatory year. Contemporary Issues in Early Childhood, 13(4), 266–275. https://doi.org/10.2304/ ciec.2012.13.4.266 Orakci, S., Durnali, M., & Özkan, O. (2018). Curriculum reforms in Turkey. In Economic and Geopolitical Perspectives of the Commonwealth of Independent States and Eurasia (Issue July 2019, pp. 225–251). https://doi.org/10.4018/978-1-5225-3264-4.ch010 Organization for Economic and Co-Operation and Development. (2019). Change Management: Facilitating and Hindering Factors of Curriculum Implementation. 8th Informal Working Group (IWG) Meeting, 1–25. Poedjiastutie, D., Akhyar, F., Hidayati, D., & Nurul Gasmi, F. (2018). Does Curriculum Help Students to Develop Their English Competence? A Case in Indonesia. Arab World English Journal, 9(2), 175–185. https://doi.org/10.24093/awej/vol9no2.12 Prasetyo, A. (2015). Curriculum Development of Early Childhood Education through Society Empowerment as Potential Transformation of Local Wisdom in Learning. Indonesian Journal of Early Childhood Education Studies, 4(1), 30–34. https://doi.org/10.15294/ijeces.v4i1.9450 Ramdhani, S. (2019). Integrative Thematic Learning Model Based on Local Wisdom For Early Childhood Character. Indonesian Journal of Early Childhood Education Studies, 8(1), 38–45. Reifel, S. (2014). Developmental play in the classroom. In & S. E. L. Brooker, M. Blaise (Ed.), The SAGE handbook of play and learning in early childhood (pp. 157–168). Sage. Reunamo, J., & Suomela, L. (2013). Education for sustainable development in early childhood education in finland. Journal of Teacher Education for Sustainability, 15(2), 91–102. https://doi.org/10.2478/jtes-2013-0014 Saefuddin, A., & Berdiati, I. (2014). Pembelajaran efektif. Remaja Rosda Karya. Sagita, N. I., Deliarnoor, N. A., & Afifah, D. (2019). Local content curriculum implementation in the framework of nationalism and national security. Central European Journal of International and Security Studies, 13(4), 91–103. Saracho, O. (2012). An integrated play-based curriculum for young children. Routledge. Schumacher, D. H. (1995). Five Levels of Curriculum Integration Defined, Refined , and Described. Research in Middle Level Education. https://doi.org/10.1080/10825541.1995.11670055 Scott, D. (2014). Knowledge and the curriculum. The Curriculum Journal, 25(1), 14–28. https://doi.org/10.1080/09585176.2013.876367 Setiawan, A., Handojo, A., & Hadi, R. (2017). Indonesian Culture Learning Application based on Android. 7(1), 526–535. https://doi.org/10.11591/ijece.v7i1.pp526-535 Syarifuddin, S. (2018). The effect of using the scientific approach through concept understanding and critical thinking in science. Jurnal Prima Edukasia, 6(1), 21–31. https://doi.org/10.21831/jpe.v6i1.15312 Ulla, M. B., & Winitkun, D. (2017). Thai learners’ linguistic needs and language skills: Implications for curriculum development. International Journal of Instruction, 10(4), 203–220. https://doi.org/10.12973/iji.2017.10412a van Oers, B. (2012). Developmental education: Foundations of a play-based curriculum. In B. van Oers (Ed.), Developmental education for young children: Concept, practice, and implementation (pp. 13–26). Springer. Wahyono, Abdulhak, I., & Rusman. (2017). Implementation of scientific approach-based learning. International Journal of Education Research, 5(8), 221–230. Wahyudin, D., & Suwirta, A. (2017). The Curriculum Implementation for Cross-Cultural and Global Citizenship Education in Indonesia Schools. EDUCARE: International Journal for Educational Studies, 10(1), 11–22. Westbrook, J., Brown, R., Pryor, J., & Salvi, F. (2013). Pedagogy, Curriculum , Teaching Practices and Teacher Education in Developing Countries. December. Wood, E., & Hedges, H. (2016). Curriculum in early childhood education: Critical questions about content, coherence, and control. The Curriculum Journal. https://doi.org/10.1080/09585176.2015.1129981

The article is devoted to one of the most interesting topics: the ideological heritage of constructivism and evaluation of its value. The no­velty of the research is determined by the choice of its subject: unrealized projects of Soviet architects of the 1920s (I.I. Leonidov, K.S. Melnikov, V.A. Vesnin, A.A. Vesnin, L.A. Vesnin and N.A. Ladovsky) as a source of promising ideas for the architecture and design of the late 20th—early 21st century. The paper aims to assess the creative and artistic value of the unrealized projects of Soviet constructivists for the modern architectural design. The main result is the attempt to present a historical and conceptual overview of the origin and features of constructivism and rationalism as trends in urban planning. The 1920s, when the principles and trends in constructivist architecture were formed, became the time of development of a new production and architectural model. The combination of rationalist approach with utopian functionality of most of these projects was the reason for rejection of a truly constructivist trend in Soviet architecture in favor of the “Stalin Empire Style”, and later — deconstructivism. The problematics of constructivist solutions of the 1920s in the field of urban planning and environmental management largely determined the methodology of architectural space organization of the USSR cities in the 1930s, when the stan­dard of “industry oriented” socialist society became a priority. The author considers theoretical studies and scientific publications about the works of Soviet constructivist architects, gives examples of explicit translation of the principles of constructivism in the 21st century architecture, and makes an assumption about the relationship between the ideolo­gical heritage of Soviet constructivists and the artistic and creative process of modern architects and desig­ners (founders of high-tech style R. Piano, N. Foster; deconstructivists F. Gehry, Z. Hadid, D. Libeskind).The article concludes that the constructivist ima­ges and stylistics of the analyzed period, though not translated by modern designers and architects “directly”, become the basis for implementation of new conceptual solutions.

Michael B. Katz. Reconstructing American Education. Cambridge and London: Harvard University Press, 1987. Pp. viii, 212. Cloth, $22.50; E. D. Hirsch, Jr. Cultural Literacy: What Every American Needs to Know. Boston: Houghton Mifflin Co., 1987. Pp. xvii, 251. Cloth, $16.45; Diana Ravitch and Chester E. Finn, Jr. What Do Our 17-Year-Olds Know? A Report on the First National Assessment of History and Literature. New York: Harper & Row, 1987. Pp. ix, 293. Cloth, $15.95. Review by Richard A. Diem of The University of Texas at San Antonio. Henry J. Steffens and Mary Jane Dickerson. Writer's Guide: History. Lexington, Massachusetts, and Toronto: D. C. Heath and Company, 1987. Pp. x, 211. Paper, $6.95. Review by William G. Wraga of Bernards Township Public Schools, Basking Ridge, New Jersey. J. Kelley Sowards, ed. Makers of the Western Tradition: Portraits from History. New York: St. Martin's Press, 1987. Fourth edition. Vol: 1: Pp. ix, 306. Paper, $12.70. Vol. 2: Pp. ix, 325. Paper, $12.70. Review by Robert B. Luehrs of Fort Hays State University. John L. Beatty and Oliver A. Johnson, eds. Heritage of Western Civilization. Englewood Cliffs, New Jersey: Prentice-Hall, Inc., 1987. Sixth Edition. Volume I: Pp. xi, 465. Paper, $16.00; Volume II: pp. xi, 404. Paper, $16.00. Review by Dav Levinson of Thayer Academy, Braintree, Massachusetts. Lynn H. Nelson, ed. The Human Perspective: Readings in World Civilization. New York: Harcourt Brace Jovanovich, 1987. Vol. I: The Ancient World to the Early Modern Era. Pp. viii, 328. Paper, $10.50. Vol. II: The Modern World Through the Twentieth Century. Pp, x, 386. Paper, 10.50. Review by Gerald H. Davis of Georgia State University. Gerald N. Grob and George Attan Billias, eds. Interpretations of American History: Patterns and Perspectives. New York: The Free Press, 1987. Fifth Edition. Volume I: Pp. xi, 499. Paper, $20.00: Volume II: Pp. ix, 502. Paper, $20.00. Review by Larry Madaras of Howard Community College. Eugene Kuzirian and Larry Madaras, eds. Taking Sides: Clashing Views on Controversial Issues in American History. -- Volume II: Reconstruction to the Present. Guilford, Connecticut: The Dushkin Publishing Groups, Inc., 1987. Pp. xii, 384. Paper, $9.50. Review by James F. Adomanis of Anne Arundel County Public Schools, Annapolis, Maryland. Joann P. Krieg, ed. To Know the Place: Teaching Local History. Hempstead, New York: Hofstra University Long Island Studies Institute, 1986. Pp. 30. Paper, $4.95. Review by Marilyn E. Weigold of Pace University. Roger Lane. Roots of Violence in Black Philadelphia, 1860-1900. Cambridge, Massachusetts, and London: Harvard University Press, 1986. Pp. 213. Cloth, $25.00. Review by Ronald E. Butchart of SUNY College at Cortland. Pete Daniel. Breaking the Land: The Transformation of Cotton, Tobacco, and Rice Cultures since 1880. Urbana and Chicago: University of Illinois Press, 1985. Pp. xvi, 352. Paper, $22.50. Review by Thomas S. Isern of Emporia State University. Norman L. Rosenberg and Emily S. Rosenberg. In Our Times: America Since World War II. Englewood Cliffs, New Jersey: Prentice-Hall, 1987. Third edition. Pp. xi, 316. Paper, $20.00; William H. Chafe and Harvard Sitkoff, eds. A History of Our Time: Readings on Postwar America. New York: Oxford University Press, 1987. Second edition. Pp. xiii, 453. Paper, $12.95. Review by Monroe Billington of New Mexico State University. Frank W. Porter III, ed. Strategies for Survival: American Indians in the Eastern United States. New York, Westport, Connecticut, and London: Greenwood Press, 1986. Pp. xvi, 232. Cloth, $35.00. Review by Richard Robertson of St. Charles County Community College. Kevin Sharpe, ed. Faction & Parliament: Essays on Early Stuart History. London and New York: Methuen, 1985. Pp. xvii, 292. Paper, $13.95; Derek Hirst. Authority and Conflict: England, 1603-1658. Cambridge: Harvard University Press, 1986. Pp. viii, 390. Cloth, $35.00. Review by K. Gird Romer of Kennesaw College. N. F. R. Crafts. British Economic Growth During the Industrial Revolution. New York: Oxford University Press, 1985. Pp. 193. Paper, $11.95; Maxine Berg. The Age of Manufactures, 1700-1820. New York: Oxford University Press, 1985. Pp. 378. Paper, $10.95. Review by C. Ashley Ellefson of SUNY College at Cortland. J. M. Thompson. The French Revolution. New York: Basil Blackwell, 1985 reissue. Pp. xvi, 544. Cloth, $45.00; Paper, $12.95. Review by W. Benjamin Kennedy of West Georgia College. J. P. T. Bury. France, 1814-1940. London and New York: Methuen, 1985. Fifth edition. Pp. viii, 288. Paper, $13.95; Roger Magraw. France, 1815-1914: The Bourgeois Century. New York and Oxford: Oxford University Press, 1985. Pp. 375. Cloth, $24.95; Paper, $9.95; D. M.G. Sutherland. France, 1789-1815: Revolution and Counterrevolution. New York and Oxford: Oxford University Press, 1986. Pp. 242. Cloth, $32.50; Paper, $12.95. Review by Fred R. van Hartesveldt of Fort Valley State College. Woodford McClellan. Russia: A History of the Soviet Period. Englewood Cliffs, New Jersey: Prentice-Hall, 1986. Pp. xi, 387. Paper, $23.95. Review by Pasquale E. Micciche of Fitchburg State College. Ranbir Vohra. China's Path to Modernization: A Historical Review from 1800 to the Present. Englewood Cliffs, New Jersey: Prentice-Hall, 1987. Pp. xiii, 302. Paper, $22.95. Reivew by Steven A. Leibo of Russell Sage College. John King Fairbank. China Watch. Cambridge and London: Harvard University Press, 1987. Pp. viii, Cloth, $20.00. Review by Darlene E. Fisher of New Trier Township High School, Winnetka, Illinois. Ronald Takaki, ed. From Different Shores: Perspectives on Race and Ethnicity in America. New York and Oxford: Oxford University Press, 1987. Pp. 253. Paper, $13.95. Review by Robert C. Sims of Boise State University.

Problem setting. The current state of the world economy is characterized by large-scale transformations, which are manifested in the development of key technologies of Industry 4.0, smart specialization, increasing international competition, accelerating all processes that become global and more open. For developing countries, including Ukraine, innovation is particularly important as it underpins industrialization, which plays a key role in diversifying the economy and overcoming its structural weakness. Industry is the engine of innovation, productivity growth and exports. Аnalysis of recent researches and publications. Numerous works by well-known foreign economists have devoted to the issues of innovative development of economic systems, research of innovations as a factor of sustainable growth and increase of competitiveness of the country in the conditions of globalization, digital transformation of economy: P. Drucker, M. Castells, F. Nixon, P. Fischer, J. Schumpeter, K. Schwab, L. Abalkin, A. Aganbegyan, A. Warsaw, L. Gokhberg, R. Greenberg, M. Delyagin, V. Inozemtsev, N. Ivanova, B. Kuzyk, D. Lviv. Also these issues were researched by Ukrainian specialists: G. Androschuk, L. Antonyuk, Y. Atamanova, Y. Bazhal, V. Bazylevych, O. Butnik - Siversky, V. Geets, V. Gusev, O. Zhilinska, I. Egorov, O. Kuzmin, L. Ligonenko B Malitsky, I. Makarenko, V. Muntiyan, V. Parkhomenko, S. Prilipko, V. Solovyov, V. Sidenko, O. Simson, N. Chukhrai, L. Fedulova, A. Yakovlev and others. At the same time, the multifaceted and complex nature of this issue, the dynamics of change in the world, especially during the pandemic COVID-19, require further research. The purpose of this research is to research the dynamics of innovation activity on an international scale based on the consolidated indicators of the Global Innovation Index for 2020, to determine the place of Ukraine in it. Article’s main body. Based on the consolidated indicators of the Global Innovation Index for 2020, the dynamics of innovation activity on an international scale is considered, a comparative analysis is conducted, the relative advantages and weaknesses of national innovation systems are identified, and Ukraine’s place is determined. In GII, Ukraine ranks 45th out of 131 countries, showing an overall increase in the ranking of the innovation index and in the sub-indices: + 20 positions in education and +10 in R&D. Ukraine also retained 2nd place among countries with below-average income. It is noted that the coronavirus pandemic has had a negative impact on innovation and caused a significant decline in national and global economies. At the same time, by affecting some industries, COVID-19 stimulates the development and funding of innovation in others, especially in the areas of computer technology, digitalization, and healthcare. The study confirmed the stability of innovative development of countries that have traditionally been leaders in this index in previous years. The crisis caused by COVID-19 can be a catalyst for innovation in many traditional industries, such as tourism, education and retail. It can also stimulate innovation in the organization of work processes at the level of enterprises and individual employees, as well as in the (re) organization of production locally and globally. Today, it is extremely important to unleash this potential, which requires government support, as well as models of interaction and further private sector investment in innovation. Conclusions and prospects for the development. In conclusion, it should be noted that GII continues to support and stimulate innovation in an era of change. The purpose of the next 13th analytical report is to provide meaningful data on innovations and thus help the representatives of policy-making bodies in assessing the effectiveness of innovation activities of their countries, making informed decisions on further state innovation policy. At this stage, with increasing one-sidedness and nationalism, it is important to remember that most countries that have improved their positions in GII over time have benefited significantly from integration into global value chains and innovation networks. China, Vietnam, India and the Philippines are good examples.

У статті обґрунтовано актуальність вивчення чинників акультурації та мовної адаптації у контексті дослідження специфіки прояву прокрастинації іноземними студентами. Висвітлено особливості операціоналізації вказаних понять у сучасній науковій літературі. Вибірку дослідження склали іноземні студенти (n=41), які навчаються за освітнім рівнем «бакалавр» у двох вищих навчальних закладах України. Результати кореляційного аналізу свідчать про позитивний взаємозв’язок прокрастинації із загальним рівнем прояву стресу акультурації (r = 0.43, p<0,01), а також такими його аспектами як акультураційний страх (r = 0.46, p<0,01), сприйнята дискримінація (r = 0.37, p<0,05), почуття провини (r = 0.31, p<0,05). Вагоме значення аспектів мовної інтеграції у контексті вивчення тематики прокрастинації підтверджено зафіксованими прямими значущими кореляційними зв’язками із загальною шкалою мовної тривожності (r = 0.59, p<0,001), страхом негативної оцінки (r = 0.62, p<0,001), страхом спілкування (r = 0.62, p<0,001) та складання іспитів (r = 0.47, p<0,01). Література References Грабчак О. Особливості академічної прокрастинації студентів-першокурсників// Педагогіка і психологія професійної освіти. 2016. № 4. С. 210-218 Колтунович Т.А., Поліщук О. М. Прокрастинація – конфлікт між «важливим» і «приємним»// Young Scientist. 2017. Вип. 5, № 45. С. 211-218. Ряднова В. В., Безега Н. М., Безкоровайна І. М., Воскресенська Л. К., Пера-Васильченко А. В. Психологічні особливості процесу адаптації й організації навчання студентів-іноземців// Актуальні питання медичної (фармацевтичної) освіти іноземних громадян: проблеми та перспективи. Збірник наукових статей. 2018. С. 74-76. Balkis, M., Duru, E. (2019). Procrastination and Rational/Irrational Beliefs: A Moderated Mediation Model. Journal of Rational-Emotive & Cognitive-Behavior Therapy. doi:10.1007/s10942-019-00314-6 Berry, J. W. (2005). Acculturation: Living successfully in two cultures. International Journal of Intercultural Relations, 29(6), 697-712. http://dx.doi.org/10.1016/j.ijintrel.2005.07.013 Chowdhury, S.F., Pychyl, T.A. (2018). A critique of the construct validity of active procrastination. Personality and Individual Differences, 120, 7-12. DOI: https://doi.org/ 10.1016/j.paid.2017.08.016. DuBow, F. McCabe, E., Kaplan, G. (1979). Reactions to Crime: A Critical Review of the Literature, Unpublished report. Center for Urban Affairs, Northwestern University, Evanston, IL. Ferrari J.R., Crum K.P., Pardo M.A. (2018), Decisional procrastination: Assessing characte­rological and contextual variables around indecision. Current Psychology, 37(2), doi: 10.1007/s12144-017-9681-x. Ferrari, J. R., Johnson, J. L., McCown, W. G. (1995). The Plenum series in social/clinical psychology. Procrastination and task avoidance: Theory, research, and treatment. N.Y.: Plenum Press. doi: 10.1007/978-1-4899-0227-6 Ferrari, J. R., O'Callaghan, J., Newbegin, I. (2005). Prevalence of Procrastination in the United States, United Kingdom, and Australia: arousal and avoidance delays among adults. North American Journal of Psychology, 7(1), 1-6. Gamst-Klaussen, T., Steel, P., Svartdal, F. (2019). Procrastination and personal finances: Exploring the roles of planning and financial self-efficacy. Frontiers in Psychology, 10, 1-10. https://doi.org/10.3389/fpsyg.2019.00775 Goldin, C., Katz, L. F., Kuziemko, I. (2006), The homecoming of American college women: The reversal of the college gender gap. The Journal of Economic Perspectives, 20(4), 133-157. Haghbin, M. (2015). Conceptualization and operationalization of delay: Development and validation of the multifaceted measure of academic procrastination and the delay questionnaire. (Unpublished Ph.D. thesis). Carleton University, Ottowa, Canada. Hashemi, M., Abbasi, M. (2013). The role of the teacher in alleviating anxiety in language classes. International Journal of Applied and Basic Sciences, 4(3), 640-646. Horwitz, E. K., Horwitz, M.B., Cope, J. (1986). Foreign language classroom anxiety. The Modern Language Journal, 70(2), 125-132. Klingsieck, K. B. (2013). Procrastination: When good things don’t come to those who wait. European Psychologist, 18(1), 24-34. doi: 10.1027/1016-9040/a000138 Kornienko, A. A., Shamrova, D. P., Kvesko, S. B., Kornienko, A. A., Nikitina, Y. A., Chaplinskaya, Y. I. (2016). Adaptation Problems Experienced by International Students in Aspect of Quality Management. The European Proceedings of Social & Behavioral Sciences, 48, 358-361 doi: 10.15405/epsbs.2017.01.48 Kráľová, Z., Sorádová D. (2015). Foreign Language Learning Anxiety. In: Teaching Foreign Languages in Inclusive Education: (A teacher-trainee´s handbook), Nitra: Constantine the Philosopher University. doi: 10.17846/SEN.2015.91-100 Lee, S. (2008). Relationship between selected predictors and adjustment/acculturation stress among East Asian international students. (Doctoral dissertation). University of Kentucky, Lexington. Lindblom-Ylänne, S., Saariaho, E., Inkinen, M., Haarala-Muhonen. A., Hailikari., T (2015). Academic procrastinators, strategic delayers and something betwixt and between: An interview study. Frontline Learning Research, 3(2), 47-62. Markiewicz, K. (2018). Prokrastynacja i prokrastynatorzy. Definicja, etiologia, epidemiologia i terapia. Annales Universitatis Mariae Curie-Skłodowska, 31(3), 195-213. Markiewicz, K., Dziewulska, P. (2018). Procrastination Predictors and moderating effect of personality traits. Polskie Forum Psychologiczne, 23(3), 593-609 doi: 10.14656/ PFP20180308 Pychyl, T.A., Sirois, F. M. (2016). Procrastination, emotion regulation, and well-being. In: Procrastination, Health, and Well-Being, (pp. 163-188). Academic Press, Rorer, L. G. (1983). “Deep” RET: A reformulation of some psychodynamic explanations of procrastination. Cognitive Therapy and Research, 7, l-10. Russell, J., Rosenthal, D., Thomson, G. (2010). The international student experience: Three styles of adaptation. Higher Education, 60, 235-249 Sandhu, D. S., Asrabadi, B. R. (1994). Development of an acculturative stress scale for international students: Preliminary findings. Psychological Reports, 75(1,2), 435-448. doi: 10.2466/pr0.1994.75.1.435 Schouwenburg, H. C., Lay, C. H., Pychyl, T. A., Ferrari, J. R. (Eds.). (2004). Counseling the Procrastinator in Academic Settings. Washington, DC: American Psychological Association. doi: 10.1037/10808-000 Sirois, F.M., Pychyl, T.A. (2013). Procrastination and the Priority of Short-Term Mood Regulation: Consequences for Future Self. Social and Personality Psychology Compass, 7(2), 115-127. Steel, P. (2007). The nature of procrastination: a meta-analytic and theoretical review of quintessential selfregulatory failure. Psychological Bulletin, 133, 65–94. doi: 10.1037/0033-2909.133.1.65 Steel, P., Ferrari, J. (2013). Sex, education and procrastination: An epidemiological study of procrastinators’ characteristics from a global sample. European Journal of Personality, 27(1), 51-58. doi: 10.1002/per.1851. Tibbett, T. P., Ferrari, J. R. (2015). The portrait of the procrastinator: Risk factors and results of an indecisive personality. Personality and Individual Differences, 82, 175–184 Van Eerde, W., Klingsieck, K. B. (2018). Overcoming procrastination? A meta-analysis of intervention studies. Educational Research Review, 25, 73-85. Zhanibek, A. (2001). The relationship between language anxiety and students’ participation in foreign language classes. (Master thesis). Bilkent University, Ankara. References (translated and transliterated) Hrabchak, O. (2016). Osoblyvosti akademichnoji prokrastynaciji studentiv-pershokursnykiv [Academic procrastination features in first-year students]. Pedaghohika i Psykholohiya Profesiynoyi Osvity, 4, 210-218 Koltunovych, T.A., Polishhuk, O.M (2017). Prokrastynacija – konflikt mizh “vazhlyvym” i “pryjemnym” [Procrustination - the conflict between “important” and “pleasant”]. Young Scientist, 5 (45), 211-218. Riadnova, V.V., Bezeha, N.M., Bezkorovaina, I.M., Voskresens’ka, L.K., Pera-Vasylchenko, A.V. (2018). Psykhologhichni osoblyvosti procesu adaptaciyi i orghanizaciyi navchannia studentiv-inozemtsiv [Psychological features of the process of adaptation and organization of international students’ training]. Issues of Medical (Pharmaceutical) Education of International Citizens: Problems and Prospects. Book of abstracts (74-76). Poltava, Ukraine. Balkis, M., Duru, E. (2019). Procrastination and Rational/Irrational Beliefs: A Moderated Mediation Model. Journal of Rational-Emotive & Cognitive-Behavior Therapy. doi:10.1007/s10942-019-00314-6 Berry, J. W. (2005). Acculturation: Living successfully in two cultures. International Journal of Intercultural Relations, 29(6), 697-712. http://dx.doi.org/10.1016/j.ijintrel.2005.07.013 Chowdhury, S.F., Pychyl, T.A. (2018). A critique of the construct validity of active procrastination. Personality and Individual Differences, 120, 7-12. DOI: https://doi.org/ 10.1016/j.paid.2017.08.016. DuBow, F. McCabe, E., Kaplan, G. (1979). Reactions to Crime: A Critical Review of the Literature, Unpublished report. Center for Urban Affairs, Northwestern University, Evanston, IL. Ferrari J.R., Crum K.P., Pardo M.A. (2018), Decisional procrastination: Assessing characte­rological and contextual variables around indecision. Current Psychology, 37(2), doi: 10.1007/s12144-017-9681-x. Ferrari, J. R., Johnson, J. L., McCown, W. G. (1995). The Plenum series in social/clinical psychology. Procrastination and task avoidance: Theory, research, and treatment. N.Y.: Plenum Press. doi: 10.1007/978-1-4899-0227-6 Ferrari, J. R., O'Callaghan, J., Newbegin, I. (2005). Prevalence of Procrastination in the United States, United Kingdom, and Australia: arousal and avoidance delays among adults. North American Journal of Psychology, 7(1), 1-6. Gamst-Klaussen, T., Steel, P., Svartdal, F. (2019). Procrastination and personal finances: Exploring the roles of planning and financial self-efficacy. Frontiers in Psychology, 10, 1-10. https://doi.org/10.3389/fpsyg.2019.00775 Goldin, C., Katz, L. F., Kuziemko, I. (2006), The homecoming of American college women: The reversal of the college gender gap. The Journal of Economic Perspectives, 20(4), 133-157. Haghbin, M. (2015). Conceptualization and operationalization of delay: Development and validation of the multifaceted measure of academic procrastination and the delay questionnaire. (Unpublished Ph.D. thesis). Carleton University, Ottowa, Canada. Hashemi, M., Abbasi, M. (2013). The role of the teacher in alleviating anxiety in language classes. International Journal of Applied and Basic Sciences, 4(3), 640-646. Horwitz, E. K., Horwitz, M.B., Cope, J. (1986). Foreign language classroom anxiety. The Modern Language Journal, 70(2), 125-132. Klingsieck, K. B. (2013). Procrastination: When good things don’t come to those who wait. European Psychologist, 18(1), 24-34. doi: 10.1027/1016-9040/a000138 Kornienko, A. A., Shamrova, D. P., Kvesko, S. B., Kornienko, A. A., Nikitina, Y. A., Chaplinskaya, Y. I. (2016). Adaptation Problems Experienced by International Students in Aspect of Quality Management. The European Proceedings of Social & Behavioral Sciences, 48, 358-361 doi: 10.15405/epsbs.2017.01.48 Kráľová, Z., Sorádová D. (2015). Foreign Language Learning Anxiety. In: Teaching Foreign Languages in Inclusive Education: (A teacher-trainee´s handbook), Nitra: Constantine the Philosopher University. doi: 10.17846/SEN.2015.91-100 Lee, S. (2008). Relationship between selected predictors and adjustment/acculturation stress among East Asian international students. (Doctoral dissertation). University of Kentucky, Lexington. Lindblom-Ylänne, S., Saariaho, E., Inkinen, M., Haarala-Muhonen. A., Hailikari., T (2015). Academic procrastinators, strategic delayers and something betwixt and between: An interview study. Frontline Learning Research, 3(2), 47-62. Markiewicz, K. (2018). Prokrastynacja i prokrastynatorzy. Definicja, etiologia, epidemiologia i terapia. Annales Universitatis Mariae Curie-Skłodowska, 31(3), 195-213. Markiewicz, K., Dziewulska, P. (2018). Procrastination Predictors and moderating effect of personality traits. Polskie Forum Psychologiczne, 23(3), 593-609 doi: 10.14656/ PFP20180308 Pychyl, T.A., Sirois, F. M. (2016). Procrastination, emotion regulation, and well-being. In: Procrastination, Health, and Well-Being, (pp. 163-188). Academic Press, Rorer, L. G. (1983). “Deep” RET: A reformulation of some psychodynamic explanations of procrastination. Cognitive Therapy and Research, 7, l-10. Russell, J., Rosenthal, D., Thomson, G. (2010). The international student experience: Three styles of adaptation. Higher Education, 60, 235-249 Sandhu, D. S., Asrabadi, B. R. (1994). Development of an acculturative stress scale for international students: Preliminary findings. Psychological Reports, 75(1,2), 435-448. doi: 10.2466/pr0.1994.75.1.435 Schouwenburg, H. C., Lay, C. H., Pychyl, T. A., Ferrari, J. R. (Eds.). (2004). Counseling the Procrastinator in Academic Settings. Washington, DC: American Psychological Association. doi: 10.1037/10808-000 Sirois, F.M., Pychyl, T.A. (2013). Procrastination and the Priority of Short-Term Mood Regulation: Consequences for Future Self. Social and Personality Psychology Compass, 7(2), 115-127. Steel, P. (2007). The nature of procrastination: a meta-analytic and theoretical review of quintessential selfregulatory failure. Psychological Bulletin, 133, 65–94. doi: 10.1037/0033-2909.133.1.65 Steel, P., Ferrari, J. (2013). Sex, education and procrastination: An epidemiological study of procrastinators’ characteristics from a global sample. European Journal of Personality, 27(1), 51-58. doi: 10.1002/per.1851. Tibbett, T. P., Ferrari, J. R. (2015). The portrait of the procrastinator: Risk factors and results of an indecisive personality. Personality and Individual Differences, 82, 175–184 Van Eerde, W., Klingsieck, K. B. (2018). Overcoming procrastination? A meta-analysis of intervention studies. Educational Research Review, 25, 73-85. Zhanibek, A. (2001). The relationship between language anxiety and students’ participation in foreign language classes. (Master thesis). Bilkent University, Ankara.

Abstract Abstract 2911 Background: AZA gives 50–60% responses and improves OS in higher-risk MDS but its role in t MDS/AML, characterized by a high frequency of unfavorable karyotypes and poor response to available treatments, remains unknown. Methods: An AZA compassionate program (ATU) was opened in France between Dec 2004 and Jan 2009 for higher risk MDS, and for AML not candidates to or refractory to intensive chemotherapy (IC). We analyzed t MDS/AML included in this program and having received at least 1 cycle of AZA, excluding patients (pts) previously treated with chemotherapy (CT) for their tMDS/AML. Results: 60 tMDS/AML were included: M/F:24/36, median age 69 (range 20–87). Primary disease was Breast Carcinoma (n=17), CLL (n=6), Hodgkin's disease (n=4), NHL (n=7), ALL (n=2), ovarian (n=2), liver(n=2), prostate carcinoma (n=2), other cancers (n=16), immunosuppressive therapy for lupus or Lung transplant in the last 2 pts. Treatment of primary neoplasm consisted in C×T in 86% and R×T in 61%. Diagnosis (WHO) was RCMD+/− RS in 4 pts, RAEB-1 in 10 pts, RAEB-2 in 28 pts MDS with myelofibrosis in 1 pt, and AML in 17 pts (including 12 FAB RAEBt). IPSS cytogenetics were fav in 4 (6.7%), int in 11 (18.3%), and unfav in 45 (75%, including 71% Complex karyotypes). Patients received a median of 4 cycles (range 1–24) of AZA, at FDA/EMEA-approved schedule (75 mg/m2/d ×7d/4 week) in 73% patients and a less intensive schedule (5d/4w, or <75mg/m2/d) in 27% patients. 25 (41.6%) pts received < 4 cycles, mainly due to early death (32%), failure (28%) or hematological toxicity (16%). Best response according to IWG 2006 criteria was CR in 9 pts (15%), marrow CR (mCR) in 8 (13%), PR in 1, stable disease (SD) with HI in 5 (8%) ie an overall response rate (ORR) of 38%. In pts who received >4 cycles, ORR was 21/35 (60%). Age, WBC count, baseline platelet count, % marrow blasts, karyotype (whatever the categorization) and ECOG status had no impact on ORR. 1, 2 and 3 year survival was 35%, 15% and 7%. Female gender (p=0.02), achievement of response (p=0.003) and ECOG status (0-1 vs 2–4) (p=0.04) had significant impact on OS while karyotype and % marrow blasts had no impact. However, there was a trend for lower OS in patients with chrom 5 abn (2y 0S 7.7% vs 23 %, p=0.08). 9 (15%) patients, all females, median age 55 (range 35–66) were allografted after a median number of 6 AZA cycles (range 2–17), including 3 pts, 4 pts and 2 pts who had achieved CR, mCR and no response to AZA, respectively. 4 (44%) of them were alive after 5+,17+,32+ and 42+ months. By comparison to the 232 pts with de novo MDS/AML included in the same program, tMDS/AML had a higher frequency of complex karyotype (71 vs 29.5, p<0.01), received fewer cycles of AZA (4 vs 6, p=0.0014) due to more frequent discontinuation of AZA before 4 cycles (41.6% vs 25%, p=0.025) mainly related to a higher incidence of early deaths. tMDS/AML had a similar response rate (38% vs 45% in de novo MDS/AML, p=0.67), but significantly shorter OS (2yOS 15% vs 33.3, p=0.003, figure 1). Conclusion: In this cohort of tMDS/AML, survival with AZA was shorter than in de novo MDS/AML, probably largely due to their more severe baseline characteristics. Only 15% of tMDS/AML could be allografted, half of them with so far a favorable outcome. Disclosures: Fenaux: CELGENE, JANSSEN CILAG, AMGEN, ROCHE, GSK, NOVARTIS, MERCK, CEPHALON: Honoraria, Research Funding.

<p>A central theme in the reindeer husbandry is the conflicts between this and other economic interests as tourism, community development etc. in connection with the utilization of common territory. A retrospective glance will show that this is an old problem and not a new phenomenon. The Nordic Sami Institute has carried out a research project with the following objectives: 1.to give an account of the terms of planning for the reindeer husbandry, 2.to find out how the S&aring;mi (Lapp) community's and so the reindeer husbandry's interests are taken into account in local planning. 3.find ways for how the reindeer husbandry's use of land can be described. 4.give suggestions as to how the interests of the Sami community can better be taken into account or how it can increase its influence in relation to planning. The suggestions based upon the results from the research project are: &mdash;that the Sami community aquire competence by preparing itself for the changes in its environment. &mdash;that it builds up its own organization. &mdash;that it aquires a more noticeable influence in community planning and decision making. This project and earlier experiencies have shown that the way of influencing e.g. by land-use-planning is weak and unreliable today.</p><p>Rensk&ouml;tsel och kommunal planering.</p><p>Abstract in Swedish / Sammandrag: Ett centralt tema i renskotselsammanhang ar konflikterna mellan renskotsel och andra ekonomiska intressen som turism, samh&aring;llsutbyggnad etc. vid utnyttjande av gemensamma arealer. En historisk tillbakablick visar att denna problematik inte p&aring; n&aring;got s&aring;tt &aring;r n&aring;gon ny foreteelse utan ett gammalt tema med variationer i tid och rum. I ett forskningsprojekt vid Sami Instituhtta har en studie genomforts med syftet att: 1.soka beskriva planeringsforuts&aring;ttningarna for renskotseln. 2. soka forklara hur renskotselns intressen tas tillvara i den kommunala fysiska planeringen. 3. finna former for hur renskotselns markanv&aring;ndning kan beskrivas. 4. att l&aring;mna forslag p&aring; hur samebyns interessen kan b&aring;tre tillvaratas och hur den kan oka sitt inflytande i planeringssammanhang. P&aring; grundval av framkomna resultat foresl&aring;s: &mdash;att samebyn skapar egen kompetens. Det &aring;r fr&aring;ga om att forbereda sig infor forandringar i omgivningen exvis i form av markanv&aring;ndnings- och utvecklingsplanering. &mdash;att samebyn bygger upp den egna organisationen. &mdash;att samebyn f&aring;r ett mera breddat och fordjupat inflytande i det kommunala planerings- och beslutssystemet. Detta projekt och tidigare erfarenheter visar p&aring; att samr&aring;d som form for inflytande &aring;r svag och os&aring;ker.</p><p>Poronhoito ja kunnallinen suunnittelu.</p><p>Abstract in Finnish / Yhteenveto: Keskeinen teema poronhoidon yhteydess&aring; on selkkaukset poronhoidon ja muiden taloudellisten hyotyjen v&aring;lill&aring; kuten turismin, yhteiskunnan laajennuksen j.n.e. yhteisten pinta-alojen hyv&aring;ksik&aring;ytoss&aring;. Historiallinen, taannehtiva katsaus osoittaa, ettei t&aring;rna ongclma ole mill&aring;&aring;n tavalla joku uusi ilmio, vaan vanha teema vaihdellen ajassa ja alueilla. Sami Instituhttan er&aring;&aring;ss&aring; tutkimusprojektissa on suoritettu tutkielma pit&aring;en p&aring;&aring;m&aring;&aring;r&aring;n&aring;: 1. koettaa kuvailla poronhoidon suunnitteluedellytykset, 2. koettaa selvitt&aring;&aring;, miten poronhoidon edut otetaan talteen kunnallisessa, fyysilliscssa suunnittelussa, 3. loyt&aring;&aring; ilmaisumuotoja siit&aring;, miten poronhoidon maa-alueen k&aring;ytto voidaan kuvailla, 4. j&aring;tt&aring;&aring; ehdotuksia siit&aring;, miten paliskunnan etuja voidaan paremmin ottaa talteen sck&aring; miten se voi lis&aring;t&aring; vaikutusvaltaansa suunnittelun yhteydess&aring;. Esilletulleiden tulosten perusteella ehdotetaan:&mdash; ett&aring; paliskunta muodostaa oman toimivallan. On kysymys valmistautua ymp&aring;riston muutoksiin esimerkiksi maa-alueen k&aring;yton- ja kehityssuunnittelussa, &mdash; ett&aring; paliskunta perustaa oman j&aring;rjeston, &mdash; ett&aring; paliskunta saa leve&aring;mm&aring;n ja syvemm&aring;n vaikutusvallan kunnallisessa suunnittelu- ja p&aring;&aring;toselimess&aring;. Tamd projekti ja aikaisempi kokemus osoittaa, ett&aring; neuvottelu vaikutusvaltaisena on hcikkoa ja ep&aring;varmaa.</p>

Electroclinical, MRI, and Neuropathological Study of 10 Patients with Nodular Heterotopia, with Surgical Outcomes Tassi L, Colombo N, Cossu M, Mai R, Francione S, Lo Russo G, Galli C, Bramerio M, Battaglia G, Garbelli R, Meroni A, Spreafico R Brain 2005;128:321–337 We present the results of a retrospective study on 10 patients operated on for intractable epilepsy associated with nodular heterotopia, as identified by high-resolution MRI. Seven patients had unilateral heterotopia, one patient had symmetrical bilateral heterotopia, and two patients had asymmetrical bilateral heterotopia. By stereoelectroencephalogram (SEEG; nine patients), interictal activity within nodules was similar in all cases, and ictal activity never started from nodules alone but from the overlying cortex or simultaneously in nodules and cortex. Excellent outcomes (Engel class Ia, 1987) were achieved in the seven patients with unilateral heterotopia, showing that surgery can be highly beneficial in such cases when the epileptogenic zone is carefully located before surgery by MRI and particularly SEEG. For the bilateral cases, surgical outcomes were Engel IIa (one patient) or Engel IIIa (two patients). Histologic/immunohistochemical studies of resected specimens showed that all nodules had similar microscopic organization, even though their extent and location varied markedly. The overlying cortex was dysplastic in nine patients, but of normal thickness. We suggest that nodule formation may be the result of a dual mechanism: ( 1 ) failure of a stop signal in the germinal periventricular region leading to cell overproduction; and ( 2 ) early transformation of radial glial cells into astrocytes, resulting in defective neuronal migration. The intrinsic interictal epileptiform activity of nodules may be due to an impaired intranodular GABAergic system. The Role of Periventricular Nodular Heterotopia in Epileptogenesis Aghakhani Y, Kinay D, Gotman J, Soualmi L, Andermann F, Olivier A, Dubeau F Brain 2005;128:641–651 A temporal resection in patients with periventricular nodular heterotopia (PNH) and intractable focal seizures yields poor results. To define the role of heterotopic grey matter tissue in epileptogenesis and to improve outcome, we performed stereoencephalography (SEEG) recordings in eight patients with uni- or bilateral PNH and intractable focal epilepsy. The SEEG studies aimed to evaluate the most epileptogenic areas and included the allo- and neocortex and at least one nodule of grey matter. Interictal spiking activity was found in ectopic grey matter in three patients, in the cortex overlying the nodules in five, and in the mesial temporal structures in all. At least one heterotopion was involved at seizure onset in six patients, synchronous with the overlying neocortex or ipsilateral hippocampus. Two patients had their seizures originating in the mesial temporal structures only. Six patients had surgery, and the resected areas included the seizure onset, with follow-up from 1 to 8 years. An amygdalohippocampectomy was performed in two (Engel classes Id and III), an amygdalohippocampectomy plus removal of an adjacent heterotopion in two (class Ia), and a resection of two contiguous nodules plus a small rim of overlying occipital cortex in one patient (class Id). One patient with bilateral PNH had three adjacent nodules resected and an ipsilateral amygdalohippocampectomy, resulting in a reduction of the number of seizures by 25 to 50%. The best predictor of surgical outcome is the presence of a focal epileptic generator; this generator may or may not include the PNH. Invasive recording is required in patients with PNH; it improves localization and is the key to better outcome.

RESUMENDe entre todos los objetos, tiempos, espacios, palabras y seres que componen el mundo físico, algunos están investidos de un valor especial por cuanto se les atribuye la virtud de visibilizar las instancias invisibles de las que dependemos los mortales. Es lo sagrado. A lo sagrado se le depara un trato singular hecho de respeto, veneración o miedo, pero en ocasiones también de rencor y de odio por lo que encarna o representa. Es adorado, pero también, y acaso por las mismas razones, puede ser insultado, destruido, objeto de burla y, si tiene forma humana, martirizado o asesinado. La violencia contra lo sagrado puede caber en sistemas religiosos que le otorgan a la agresión un papel central en su universo mítico o ritual. También se ofende u agrede lo santo para grupos o pueblos a someter, puesto que en ello está resumido su orden del mundo. Desde esta perspectiva, el agravio, la irreverencia y el daño pasan a reclamar un lugar protagonista en los estudios sobre la institución religiosa de la cultura bajo las figuras del sacrilegio y la profanación.PALABRAS CLAVE: sagrado, profanación, sacrilegio, violencia religiosa, iconoclastia.ABSTRACTOf all the objects, times, spaces, words and beings that make up the physical world, some are invested with a special value because they are attributed the virtue of making visible the invisible instances on which we mortals depend. This is the sacred. The sacred is given a singular treatment combining respect, veneration or fear, but sometimes also resentment and hatred of what it embodies or represents. It is adored, but also, and perhaps for the same reasons, it can be insulted,destroyed, mocked and, if it has a human form, martyred or killed. Violence against the sacred can fit into religious systems that give aggression a central role in their mythical or ritual universe. Also offended or attacked is what is sacred for groups or peoples to be subdued, since in it an embodiment of their world order. From this perspective, aggravation, irreverence and damage occupy a central place in the studies on the religious institution of culture under the figures of sacrilege and profanation.KEY WORDS: sacred, profanation, sacrilege, religious violence, iconoclasm. BIBLIOGRAFÍAAgamben, G. (2005), Profanaciones, Barcelona, Anagrama.Arbeola, V. M. (1973), Socialismo y anticlericalismo, Madrid, Taurus.Arce Fustero, G. (2018), De espaldas a Cristo. Una historia del anticlericalisme en Colombia, 1849-1948, Medellín, Editorial Universidad de Medellín.Aston, M. (1988), England’s Iconoclasts, Oxford, Oxford University Press.Auzépy, M. F. (1987), “L’iconodulie: Défense de l’image ou de la devotion de l’image”, en Boesfplug, F. y Lossy, N. (comp.), Nicée II, 787-19 87. Douze siecles d’imagerie religieuse, París, Cerf, 157-164.Bataille, G. (2007 [1957]), El erotismo, Barcelona, Tusquets.Bateson, G. y Bateson, M. C. (1989), El temor de los ángeles. Epistemología de lo sagrado, Barcelona, Gedisa, 29-64.Bajtin, M. (1988 [1965]), La cultura popular en la Edad Media y el Renacimiento. El contexto de François Rabelais, Madrid, Alianza.Beçanson, A. (2003), La imagen prohibida: Una historia intelectual de la iconoclastia, Madrid, Siruela.Benjamin, W. (2014 [1921]), El capitalismo como religión, Madrid, La Llama.Benedict, R. (1938), “Religion”, en Boas, F. (ed.), General Anthropology, Nueva York, Columbia University Press, 627-655.Beránek, O. y Ťupek, P. (2018), The Temptation of Graves in Salafi Islam. Iconoclasm, Destruction and Idolatry, Edimburgo, Edinburgh University Press.Bernard, C. y Gruzinski, S. (1993), De la idolatría. Hacia una arqueología de las ciencias de la religión, México DF, FCE.Blom, P. (2007), Encyclopédie. El triunfo de la razón en tiempos irracionales, Barcelona, Anagrama.Caillois, R. (2014 [1939]), El hombre y lo sagrado, México DF, FCE.Crew, Ph. M. (1978), Calvinist Preaching and lconoclasm in the Neederlanden, 1544-1566, Cambridge, Cambridge University Press.Cottret, B. (1984), “Pour une sémiotique de la Réforme: Le Consensus Tigurinus (1549) et la Brève résolution... (1555) de Calvin”, Annales ESC, 40 (2), 265-285.Crouzet, D. (1990), Les Guerriers de Dieu. La violence au temps des troubles de religion, París, Champ Vallon, 2 vols.Cueva, J. de la, (1998): “El anticlericalismo en la Segunda República y la Guerra Civil”, en La Parra López, E. y Suárez Cortina, M. (eds.), El anticlericalismo español contemporáneo, Madrid, Biblioteca Nueva, 211-230.–(2000), “’Si los curas y frailes supieran…’ La violencia anticlerical”, en Juliá, S. (dir.), Violencia política en la España del siglo XX, Madrid, Taurus, 191-233.Cueva Merino, J. de la, y Montero García, F. (eds.) (2007), La secularización conflictiva. España (1898-1931), Madrid, Biblioteca Nueva.–(2009), Laicismo y catolicismo. El conflicto político-religioso en la segunda república, Alcalá de Henares, Universidad de Alcalá.De Baets, A. (2014), “The Year Zero: Iconoclastic breaks with the past”, Annales Universitatis Paedagogicae Cracoviensis Studia Politologica, 13, 3-18.Delgado, M. (2012), La ira sagrada. Anticlericalismo, iconoclastia y antirritualismo en la España contemporánea, Barcelona, RBA.Di Stefano, R. (2010), Ovejas negras. Historia de los anticlericales argentinos, Buenos Aires, Sudamericana.Durkheim, É. (2006 [1906]), “Determinación del hecho social”, en Sociología y filosofía, Buenos Aires, Schapire, 35-65.– (2008 [1912]), Las formas elementales de la vida religiosa, Alianza, Madrid.Davis, N. Z. (1993), “Los ritos de la violencia”, en Sociedad y cultura en la Francia moderna, Barcelona, Crítica, 149-185.Eliade, M. (1981 [1957]), Lo sagrado y lo profano, Madrid, Guadarrama.Freedberg, D. (2017), Iconoclasia. Historia y psicología de la violencia contra las imágenes, Vitoria-Buenos Aires, Sans Soleil Ediciones.Hubert, H, y Mauss, M. (2010 [1899]), “Ensayo sobre el sacrificio”, en Mauss, M., El sacrificio. Magia, mito y razón, Buenos Aires, Las Cuarenta.Gamboni, D. (2014), La destrucción del arte: iconoclasia y vandalismo desde la Revolución Francesa, Madrid, Cátedra.Garrisson Estebe, J. (1975), “The rites of violence: Religious riot in Sixteenth Century France”, Past & Present, 66, 127-150.Giobellina, F. (2014), El lado oscuro. La polaridad sagrado/profano en Durkheim y sus avatares, Buenos Aires, Katz.Girard, R. (1983), La violencia y lo sagrado. Anagrama, Barcelona.Gofmann, E. (2009 [1959]), La presentación de la persona en la vida cotidiana, Buenos Aires, Amorrortu.Goody, J. (1999), “¿Iconos e iconoclastia en África? Ausencia y ambivalencia”, en Representaciones y contradicciones, Barcelona, Paidós, 51-90.Grabar, A. (1998), La Iconoclastia bizantina, Madrid, Akal.Gruzinski, S. (2014), La Colonización de lo imaginario, México DF, FCE.Gumbrecht, H. U. (2005), Producción de presencia. Lo que el significado no puede transmitir, México DF, Universidad Iberoaméricana.Habermas, J. (2011), El poder de la religión en la esfera pública, Madrid, Trotta.Hermant, D. (1978), “Destructions et vandalisme pendant la Révolution française”, Annales ESC, 33 (4), 703-719.Hill, Ch. (2015), El mundo trastornado. El ideario popular extremista en la Revolución inglesa del siglo XVII, Madrid, Siglo XXI.La Parra López, E. y Suárez Cortina, M. (eds.) (1998), El anticlericalismo español contemporáneo, Madrid, Biblioteca Nueva.Lalouette, J. (1997), “El anticlericalismo en Francia, 1877-1914”, en Cruz, R. (ed.), El anticlericalismo, Madrid, Marcial Pons, (27), 15-38.Lannon, F. (1990), Privilegio, persecución y profecía. La iglesia católica en España, 1875-1975, Madrid, Alianza.Latour, B. (2002), “What is Iconoclash? or Is there a world beyond the image wars?”, en Weibel, P. y Latour, B., Iconoclash, Beyond the Image-Wars in Science, Religion and Art, Cambridge, ZKM and MIT Press, 14-37.Ledesma, J. L. (2005), “La ‘santa ira popular’ del 36: la violencia en guerra civil y revolución, entre cultura y política”, en Muñoz, J., Ledesma, J. L. y Rodrigo, J. (coords.), Madrid, Sierte Mares, 147-192.Leiris, M. (2007 [1931]), El África fantasmal. De Dakar a Yibuti, 1931-1933, Valencia, Pre-textos.Llobera, J. (1996), El dios de la modernidad. El desarrollo del nacionalismo en Europa occidental, Barcelona, Anagrama.Luther, M. (2012 [1529]), Grand Catéchisme, Florencia, Nabu Press.Mannelli, S. (2002), Anticlericalismo e democrazia: Storia del Partito radicale in Italia e a Roma, 1901–1914, Soveria Marelli, Rubbettimo.Martínez Assad, C. (1991), El laboratorio de la revolución. El Tabasco garridista, México DF, Siglo XXI.Mellor, A. (1967), Historia del anticlericalismo francés, Bilbao, Mensajero.Milhazes, J. (2012), “Comunismo como fase suprema do anticlericalismo”, Cultura, Espaço & Memória, 3, 63-78.Mitchell, T. J. (1988), Violence and Piety in Spanish Folklore, Minesotta, University of Pennsylvania Press.Mochizuki, M. M. (2006), The Netherlandish Image after Iconoclasm, 1566–1672. Material Religion in the Dutch Golden Age, Londres, Routledge.Otaola, J. (1999), Laicidad. Una estrategia para la libertad, Barcelona, Bellaterra.Otto, R. (1980 [1917]), Lo santo. Lo racional y lo irracional en la idea de Dios, Madrid, Alianza.Philipps, J. (1973), The Reformation of lmages: Destruction of Art in England, 1535-1600, Berkeley, University of Berkeley Press.Prades, J. A. (1998) Lo sagrado. Del mundo arcaico a la actualidad, Barcelona, Península.Radcliffe-Brown, A. R. (1996 [1939]), “Tabú”, en Estructura y función en la sociedad primitiva, Barcelona, Península, 153-173.Rambelli, F. y Reinders, E. (2012), Buddhism and Iconoclasm in East Asia: A History, Londres/Nueva York, Blombsbury.Ranzato, G. (1997), “Dies irae. La persecuzione religiosa nella zona republicana durante la guerra civile spagnola (1936-1939)”, en La difficile modernità e altri saggi sulla storia della Spagna contemporanea, Turín, Edizioni dell’Orso, 195-220.Reinders, E. (2004), “Monkey kings make havoc: iconoclasm and murder in the Chinese cultural revolution”, Religion, 34, 191-209.Ríos Figueroa, J. (2002), Siglo XX. Muerte y resurrección de la Iglesia Católica en Chiapas, San Cristóbal de las Casas, UNAM.Romero, P. G. (2002), El ojo de la batalla. Estudios sobre iconoclastia e iconodulia, historia del arte y vanguardia moderna, Valencia, Col·legi Major Rector Peset.Sansi, R. (2009), « Intenció i atzar en la historia del fetitxe », Quaderns de l’Institut Català d’Antropologia, 23 (8), 139-158.Sarró, R. (2009), The Politics of religious change on the Upper Guinea Coast: Iconoclasm done and undone, Edimburgo, Edinburgh University Press.Simmel, G. (1986 [1908]), “El secreto y la sociedad secreta”, en Sociología, Madrid, Alianza, vol. I, 357-424.Thomas, M. (2014), La Fe y la furia: violencia anticlerical popular e iconoclasta en España, 1931-1936, Granada, Comares.Tylor, R. P. (1985), The Death and the Resurrection Show. From Shamanism to Superstars, Londres, Blond.Ullman, J. C. (2009 [1968]), La Semana Trágica, Barcelona, Ediciones B.

El objetivo fue diseñar propuestas de mejora para un servicio de mantenimiento y reparación de vehículos que posee la concesión de una marca internacional de automóviles. La metodología consideró principalmente los aportes del modelo chileno de gestión de excelencia, una norma para el tratamiento de los reclamos, una metodología de diagnóstico de gestión, las dimensiones del modelo Servperf y la técnica de análisis de factores. Los principales resultados permitieron conocer el nivel de calidad del servicio, identificación de una dimensión de calidad subyacente, catorce prácticas de gestión y el diseño de un mecanismo de control y seguimiento fundamentado en la teoría del cuadro de mando integral. Las principales conclusiones indican que integrando los aportes de la literatura de gestión de calidad se pueden diseñar propuestas de mejora en los ámbitos estratégico, personal, análisis de datos, métodos y tecnología. Palabras Clave: Calidad de servicio, enfoques de calidad, propuestas de mejora, servicio técnico automotriz. Referencias [1]H. Arellano, «La calidad en el servicio como ventaja competitiva,» Dom. Cien, vol. 3, nº mon, pp. 72-83, 2017. [2]C. Gómez, «Estructura de las exportaciones y competitividad: El caso de los países de la Asociación de Naciones del Sudeste Asiático,» Análisis Económico, vol. 81, 2017. [3]C. Camisón, S. Cruz y T. González, Gestión de la Calidad - Conceptos, enfoques, modelos y sistemas, España: Prentice Hall., 2006. [4]A. Mora y G. Hernández, «Estrategias de mercadeo implementadas por las empresas de servicios de la Gran Área Metropolitana en Costa Rica,» Revista Nacional de Administración, vol. 10, nº 2, pp. 93-102, 2019. [5]A. Ruiz, J. Ayala, N. Alomoto y J. Acero, «Revisión de la literatura sobre gestión de la calidad: caso de las revistas publicadas en Hispanoamérica y España,» 2015. [En línea]. Available: https://doi.org/10.1016/j.estger.2015.01.004. [6]J. Alarcón, Carrillo, W. Saltos y S. Arguello, «Modelo de mejora basado en procesos, orientado a empresas de servicios automotrices del Ecuador. Caso de estudio,» 2020. [En línea]. Disponible en: https://www.revistaespacios.com/a20v41n31/a20v41n31p01.pdf. [7]F. Arrollo, C. Buenaño y C. Armas, «Calidad en el Servicio: Oportunidad para el Sector Automotor en el Ecuador,» 2017. [En línea]. Disponible en: https://dialnet.unirioja.es/servlet/articulo?codigo=6128451. [8]G. Tobar y A. Valle, «El marketing relacional y la rentabilidad en los servicios prestados por tres concesionarios automotrices en la provincia de Tungurahuadel Ecuador,» 2017. [En línea]. Disponible en: https://dialnet.unirioja.es/servlet/articulo?codigo=6756364. [9]CNPC, Modelo de gestión de excelencia. Premio Nacional a la calidad y gestión de excelencia., C. N. d. P. y. Calidad, Ed., Santiago, 2013. [10]A. De Santa María, R. Espinoza, M. Solano y E. Alf, «Modelos y premios de excelencia en la gestión: una revisión de literatura,» 2019. [En línea].Disponible en: DOI: http://dx.doi.org/10.6036/MN9086. [11]P. Resende y A. Nascimento, «Incursión De La Gestión Del Conocimiento En La Gestión Excelencia Premios: Un Análisis En El Contexto Latinoamericano,» 2016. [En línea]. Disponible en: DOI: https://doi.org/10.14488/BJOPM.2016.v13.n2.a2. [12]H. Hernández, I. Barrios y D. Martínez, «Gestión de la calidad: elemento clave para el desarrollo de las organizaciones,» 2018. [En línea]. Disponible en: https://dialnet.unirioja.es/servlet/articulo?codigo=6676025. [13]F. Lasrado, «Las organizaciones logran la excelencia mediante premios a la calidad. En: Lograr la excelencia organizacional,» 2018. [En línea]. Disponible en: https://doi.org/10.1007/978-3-319-70075-5_2. [14]N. Melão , S. Guia y M. Amorin, «Quality Management and Excellence in the third sector: examining European Quality in Social Services (EQUASS) innon-profit social services”,» 2017. [En línea]. Disponible en: https://doi.org/10.1080/14783363.2015.1132160. [15]H. Safariet, H. Razghandi, M. Reza, V. Cruz y R. Cabrita, «The effectiveness of quality awards on the company's performance – The case of Iran's nationalquality awards,» 2020. [En línea]. Disponible en: https://doi.org/10.1108/BIJ-12-2018-0409. [16]I. Herrera, E. Borja y M. D’Armas, «Evaluación de la calidad de los servicios,» 2019. [En línea].Disponible en: https://www.uctunexpo.autanabooks.com/index.php/uct/article/view/97. [17]C. Torres, «DIagnóstico SIGA 2012,» Working paper, pp. 1-8, 2017. [18]International Organization for Standardizaion, Quality Management — Customer Satisfaction — Guidelines for Complaints Handling in Organizations. International Organization for Standardization. ISO 10002, Geneva, 2018, p. 34. [19]M. Nasir y M. Adil, «Exploring the applicability of Servperf model in Indian two-wheeler industry: a CFA approach,» International Journal of Productivity andQuality Management, vol. 29, nº 3, 2020. [20]L. Carneiro y A. Rachid, «Production management and employees – a survey of auto parts companies,» Rev. Adm. Mackenzie, vol. 17, nº 2, pp. 211-244, 2016. [21]H. Dinçer, S. Yüksel y L. Martínez, «Analysis of balanced scorecard-based servqual criteria based on hesitant decision-making approaches,» Computers & Industrial Engineering, vol. 131, pp. 1-12, 2019. [22] Z. Shi y S. Huifang, «Una revisión sobre la calidad del servicio y el modelo Servqual,» Lecture Notes in Computer Science, vol. 12204, 2020. [23]M. Díaz, A. León, A. Henao y M. Díaz, Introducción al análisis estadístico multivariado aplicado: Experiencia y casos en el Caribe colombiano, Chile: Ed. Universidad del Norte, 2018. [24]P. Vergara y P. Vera, Análisis multivariado para toma de decisiones, Santiago: Ediciones Universidad Tecnológica Metropolitana. [25] A. Melo, P. Tiusi, M. Rocha, A. Silveira y A. Ayaviri, «XXXVII Encontro Nacional de Engenharia de Joinville,» de Factores determinantes para a satisfação doconsumidor on-line: Uma pesquisa descritiva por meio das equações estruturais, Joinville. Brasil, 2017. [26]M. Torres y C. Vásquez, «Contribución de la información en la calidad de los servicios,» Enl@ce Revista Venezolana de Información, Tecnología y Conocimiento, vol. 8, nº 1, pp. 55-70, 2011. [27]H. Gutiérrez y R. De La Vara, Control estadístico de la calidad y seis sigma, México: McGraw-Hill, 2013. [28]Y. Galip y U. Akkucuk, «Measuring quality in automobile aftersales: auto servqual scale,» Amfiteatru Economic Journal, vol. 44, pp. 110-123, 2017. [29]J. Amat, «Del dominio del control financiero a una perspectiva cualitativa del control de gestión,» Revista Facultad de Ciencias Económicas: Investigación y Reflexión., vol. 24, nº 1, pp. 5-11, 2016. [30]F. Ganga, L. Ramos, A. Leal y K. Pérez, «Administración estratégica: Aplicación del cuadro de mando integral (CMI) a una organización no gubernamental,»2015. [En línea]. Disponible en: http://www.redalyc.org/articulo.oa?id=28037734012. [31]P. Niven, Balanced Scorecard Evolution: A Dynamic Approach to Strategy Execution, USA: Wiley, 2014. [32]F. Doguett, Calidad y Satisfacción en el Servicio a Clientes de la Industria Automotriz: Análisis de Principales Factores que Afectan la Evaluación de los Clientes, Chile: Tesis de Grado, 2012. [33]F. Vázquez, E. Harzheim, S. Terrasa y S. Berra, «Validación psicométrica en español de la versión corta brasileña del cuestionario Primary Care AssessmentTools: usuarios para la evaluación de la orientación de los sistemas de salud hacia la atención primaria,» 2017. [En línea]. Disponible en: https://doi.org/10.1016/j.aprim.2016.04.007. [34]R. Román, S. Domínguez, M. Saucedo y J. Tánori, «Validación de un instrumento sobre cultura de género en instituciones de educación, salud e investigación en el Noroeste de México,» 2016. [En línea]. Disponible en: http://www.scielo.org.mx/scielo.php?script=sci_arttext&pid=S1405-94362016000200083&lng=es&tlng=es.

RESUMENEl objetivo de este artículo es reflexionar sobre los mecanismos de financiación y de control de las instituciones religiosas por los laicos en las primeras décadas de la conquista y colonización de Hispanoamérica. Investigar sobre la inversión laica en lo sagrado supone en un primer lugar aclarar la historiografía sobre laicos, religión y dinero en las sociedades de Antiguo Régimen y su trasposición en América, planteando una mirada desde el punto de vista de las motivaciones múltiples de los actores seglares. A través del ejemplo de restituciones, donaciones y legados en losAndes, se explora el papel de los laicos españoles, y también de las poblaciones indígenas, en el establecimiento de la densa red de instituciones católicas que se construye entonces. La propuesta postula el protagonismo de actores laicos en la construcción de un espacio cristiano en los Andes peruanos en el siglo XVI y principios del XVII, donde la inversión económica permite contribuir a la transición de una sociedad de guerra y conquista a una sociedad corporativa pacificada.PALABRAS CLAVE: Hispanoamérica-Andes, religión, economía, encomienda, siglos XVI y XVII.ABSTRACTThis article aims to reflect on the mechanisms of financing and control of religious institutions by the laity in the first decades of the conquest and colonization of Spanish America. Investigating lay investment in the sacred sphere means first of all to clarifying historiography on laity, religion and money within Ancien Régime societies and their transposition to America, taking into account the multiple motivations of secular actors. The example of restitutions, donations and legacies inthe Andes enables us to explore the role of the Spanish laity and indigenous populations in the establishment of the dense network of Catholic institutions that was established during this period. The proposal postulates the role of lay actors in the construction of a Christian space in the Peruvian Andes in the sixteenth and early seventeenth centuries, when economic investment contributed to the transition from a society of war and conquest to a pacified, corporate society.KEY WORDS: Hispanic America-Andes, religion, economics, encomienda, 16th and 17th centuries. BIBLIOGRAFIAAbercrombie, T., “Tributes to Bad Conscience: Charity, Restitution, and Inheritance in Cacique and Encomendero Testaments of 16th-Century Charcas”, en Kellogg, S. y Restall, M. (eds.), Dead Giveaways, Indigenous Testaments of Colonial Mesoamerica end the Andes, Salt Lake city, University of Utah Press, 1998, pp. 249-289.Aladjidi, P., Le roi, père des pauvres: France XIIIe-XVe siècle, Rennes, Presses universitaires de Rennes, 2008.Alberro, S., Les Espagnols dans le Mexique colonial: histoire d’une acculturation, Paris, A. Colin, 1992.Alden, D., The making of an enterprise: the Society of Jesus in Portugal, its empire, and beyond 1540-1750, Stanford California, Stanford University Press, 1996.Angulo, D., “El capitán Gómez de León, vecino fundador de la ciudad de Arequipa. Probança e información de los servicios que hizo a S. M. en estos Reynos del Piru el Cap. Gomez de León, vecino que fue de cibdad de Ariquipa, fecha el año MCXXXI a pedimento de sus hijos y herederos”, Revista del archivo nacional del Perú, Tomo VI, entrega II, Julio-diciembre 1928, pp. 95-148.Atienza López, Á., Tiempos de conventos: una historia social de las fundaciones en la España moderna, Madrid, Marcial Pons Historia, 2008.Azpilcueta Navarro, M. de, Manual de penitentes, Estella, Adrián de Anvers, 1566.Baschet, J., “Un Moyen Âge mondialisé? Remarques sur les ressorts précoces de la dynamique occidentale”, en Renaud, O., Schaub, J.-F., Thireau, I. (eds.), Faire des sciences sociales, comparer, Paris, éditions de l’EHESS, 2012, pp. 23-59.Boltanski, A. y Maldavsky, A., “Laity and Procurement of Funds», en Fabre, P.-A., Rurale, F. (eds.), Claudio Acquaviva SJ (1581-1615). A Jesuit Generalship at the time of the invention of the modern Catholicism, Leyden, Brill, 2017, pp. 191-216.Borges Morán, P., El envío de misioneros a América durante la época española, Salamanca, Universidad Pontifícia, 1977.Bourdieu, P., “L’économie des biens symboliques», Raisons pratiques: sur la théorie de l’action, Paris, Seuil, [1994] 1996, pp. 177-213.Brizuela Molina, S., “¿Cómo se funda un convento? Algunas consideraciones en torno al surgimiento de la vida monástica femenina en Santa Fe de Bogotá (1578-1645)”, Anuario de historia regional y de las Fronteras, vol. 22, n. 2, 2017, pp. 165-192.Brown, P., Le prix du salut. Les chrétiens, l’argent et l’au-delà en Occident (IIIe-VIIIe siècle), Paris, Belin, 2016.Burke, P., La Renaissance européenne, Paris, Seuil, 2000.Burns, K., Hábitos coloniales: los conventos y la economía espiritual del Cuzco, Lima, Quellca, IFEA, 2008.Cabanes, B y Piketty, G., “Sortir de la guerre: jalons pour une histoire en chantier”, Histoire@Politique. Politique, culture, société, n. 3, nov.-dic. 2007.Cantú, F., “Evoluzione et significato della dottrina della restituzione in Bartolomé de Las Casas. Con il contributo di un documento inedito”, Critica Storica XII-Nuova serie, n. 2-3-4, 1975, pp. 231-319.Castelnau-L’Estoile, C. de, “Les fils soumis de la Très sainte Église, esclavages et stratégies matrimoniales à Rio de Janeiro au début du XVIIIe siècle», en Cottias, M., Mattos, H. (eds.), Esclavage et Subjectivités dans l’Atlantique luso-brésilien et français (XVIIe-XXe), [OpenEdition Press, avril 2016. Internet : <http://books.openedition.org/ http://books.openedition.org/oep/1501>. ISBN : 9782821855861]Celestino, O. y Meyers, A., Las cofradías en el Perú, Francfort, Iberoamericana, 1981.Celestino, O., “Confréries religieuses, noblesse indienne et économie agraire”, L’Homme, 1992, vol. 32, n. 122-124, pp. 99-113.Châtellier Louis, L’Europe des dévots, Paris, Flammarion, 1987.Christian, W., Religiosidad local en la España de Felipe II, Madrid, Nerea, 1991.Christin, O., Confesser sa foi. Conflits confessionnels et identités religieuses dans l’Europe moderne (XVIe-XVIIe siècles), Seyssel, Champ Vallon, 2009.Christin, O., La paix de religion: l’autonomisation de la raison politique au XVIe siècle, Paris, Seuil, 1997.Clavero, B., Antidora: Antropología católica de la economía moderna, Milan, Giuffrè, 1991.Cobo Betancourt, “Los caciques muiscas y el patrocinio de lo sagrado en el Nuevo Reino de Granada”, en A. Maldavsky y R. Di Stefano (eds.), Invertir en lo sagrado: salvación y dominación territorial en América y Europa (siglos XVI-XX), Santa Rosa, EdUNLPam, 2018, cap. 1, mobi.Colmenares, G., Haciendas de los jesuitas en el Nuevo Reino de Granada, siglo XVIII, Bogotá, Universidad Nacional de Colombia, 1969.Comaroff, J. y Comaroff, J., Of Revelation and Revolution. Vol. 1, Christianity, Colonialism, and Consciousness in South Africa, Chicago, University of Chicago Press, 1991.Costeloe, M. P., Church wealth in Mexico: a study of the “Juzgado de Capellanias” in the archbishopric of Mexico 1800-1856, London, Cambridge University Press, 1967.Croq, L. y Garrioch, D., La religion vécue. Les laïcs dans l’Europe moderne, Rennes, PUR, 2013.Cushner, N. P., Farm and Factory: The Jesuits and the development of Agrarian Capitalism in Colonial Quito, 1600-1767, Albany, State University of New York Press, 1982.Cushner, N. P., Jesuit Ranches and the Agrarian Development of Colonial Argentina, 1650-1767, Albany, State University of New York Press, 1983.Cushner, N. P., Why have we come here? The Jesuits and the First Evangelization of Native America, Oxford, Oxford University Press, 2006.De Boer, W., La conquista dell’anima, Turin, Einaudi, 2004.De Certeau M., “La beauté du mort : le concept de ‘culture populaire’», Politique aujourd’hui, décembre 1970, pp. 3-23.De Certeau, M., L’invention du quotidien. T. 1. Arts de Faire, Paris, Gallimard, 1990.De la Puente Brunke, J., Encomienda y encomenderos en el Perú. Estudio social y político de una institución, Sevilla, Diputación provincial de Sevilla, 1992.Del Río M., “Riquezas y poder: las restituciones a los indios del repartimiento de Paria”, en T. Bouysse-Cassagne (ed.), Saberes y Memorias en los Andes. In memoriam Thierry Saignes, Paris, IHEAL-IFEA, 1997, pp. 261-278.Van Deusen, N. E., Between the sacred and the worldly: the institutional and cultural practice of recogimiento in Colonial Lima, Stanford, Stanford University Press, 2001.Dictionnaire de théologie catholique, 1937, s.v. “Restitution”.Durkheim, É., Les formes élémentaires de la vie religieuse, Paris, Presses universitaires de France, 1960 [1912].Duviols, P. La lutte contre les religions autochtones dans le Pérou colonial: l’extirpation de l’idolâtrie entre 1532 et 1660, Lima, IFEA, 1971.Espinoza, Augusto, “De Guerras y de Dagas: crédito y parentesco en una familia limeña del siglo XVII”, Histórica, XXXVII.1 (2013), pp. 7-56.Estenssoro Fuchs, J.-C., Del paganismo a la santidad: la incorporación de los Indios del Perú al catolicismo, 1532-1750, Lima, IFEA, 2003.Fontaine, L., L’économie morale: pauvreté, crédit et confiance dans l’Europe préindustrielle, Paris, Gallimard, 2008.Froeschlé-Chopard, M.-H., La Religion populaire en Provence orientale au XVIIIe siècle, Paris, Beauchesne, 1980.Glave, L. M., De rosa y espinas: economía, sociedad y mentalidades andinas, siglo XVII. Lima, IEP, BCRP, 1998.Godelier, M., L’énigme du don, Paris, Fayard, 1997.Goffman, E., Encounters: two studies in the sociology of interaction, MansfieldCentre, Martino publishing, 2013.Grosse, C., “La ‘religion populaire’. L’invention d’un nouvel horizon de l’altérité religieuse à l’époque moderne», en Prescendi, F. y Volokhine, Y (eds.), Dans le laboratoire de l’historien des religions. Mélanges offerts à Philippe Borgeaud, Genève, Labor et fides, 2011, pp. 104-122.Grosse, C., “Le ‘tournant culturel’ de l’histoire ‘religieuse’ et ‘ecclésiastique’», Histoire, monde et cultures religieuses, 26 (2013), pp. 75-94.Hall, S., “Cultural studies and its Theoretical Legacy”, en Grossberg, L., Nelson, C. y Treichler, P. (eds.), Cultural Studies, New York, Routledge, 1986, pp. 277-294.Horne, J., “Démobilisations culturelles après la Grande Guerre”, 14-18, Aujourd’hui, Today, Heute, Paris, Éditions Noésis, mai 2002, pp. 45-5.Iogna-Prat, D., “Sacré’ sacré ou l’histoire d’un substantif qui a d’abord été un qualificatif”, en Souza, M. de, Peters-Custot, A. y Romanacce, F.-X., Le sacré dans tous ses états: catégories du vocabulaire religieux et sociétés, de l’Antiquité à nos jours, Saint-Étienne, Publications de l’Université de Saint-Étienne, 2012, pp. 359-367.Iogna-Prat, D., Cité de Dieu. Cité des hommes. L’Église et l’architecture de la société, Paris, Presses universitaires de France, 2016.Kalifa, D., “Les historiens français et ‘le populaire’», Hermès, 42, 2005, pp. 54-59.Knowlton, R. J., “Chaplaincies and the Mexican Reform”, The Hispanic American Historical Review, 48.3 (1968), pp. 421-443.Lamana, G., Domination without Dominance: Inca-Spanish Encounters in Early Colonial Peru, Durham, Duke University Press, 2008.Las Casas B. de, Aqui se contienen unos avisos y reglas para los que oyeren confessiones de los Españoles que son o han sido en cargo a los indios de las Indias del mas Océano (Sevilla : Sebastián Trujillo, 1552). Edición moderna en Las Casas B. de, Obras escogidas, t. V, Opusculos, cartas y memoriales, Madrid, Biblioteca de Autores Españoles, 1958, pp. 235-249.Lavenia, V., L’infamia e il perdono: tributi, pene e confessione nella teologia morale della prima età moderna, Bologne, Il Mulino, 2004.Lempérière, A., Entre Dieu et le Roi, la République: Mexico, XVIe-XIXe siècle, Paris, les Belles Lettres, 2004.Lenoble, C., L’exercice de la pauvreté: économie et religion chez les franciscains d’Avignon (XIIIe-XVe siècle), Rennes, Presses universitaires de Rennes, 2013.León Portilla, M., Visión de los vencidos: relaciones indígenas de la conquista, México, Universidad nacional autónoma, 1959.Levaggi, A., Las capellanías en la argentina: estudio histórico-jurídico, Buenos Aires, Facultad de derecho y ciencias sociales U. B. A., Instituto de investigaciones Jurídicas y sociales Ambrosio L. Gioja, 1992.Lohmann Villena, G., “La restitución por conquistadores y encomenderos: un aspecto de la incidencia lascasiana en el Perú”, Anuario de Estudios americanos 23 (1966) 21-89.Luna, P., El tránsito de la Buenamuerte por Lima. Auge y declive de una orden religiosa azucarera, siglos XVIII y XIX, Francfort, Universidad de navarra-Iberoamericana-Vervuert, 2017.Macera, P., Instrucciones para el manejo de las haciendas jesuitas del Perú (ss. XVII-XVIII), Lima, Universidad Nacional Mayor de San Marcos, 1966.Málaga Medina, A., “Los corregimientos de Arequipa. Siglo XVI”, Histórica, n. 1, 1975, pp. 47-85.Maldavsky, A., “Encomenderos, indios y religiosos en la región de Arequipa (siglo XVI): restitución y formación de un territorio cristiano y señoril”, en A. Maldavsky yR. Di Stefano (eds.), Invertir en lo sagrado: salvación y dominación territorial en América y Europa (siglos XVI-XX), Santa Rosa, EdUNLPam, 2018, cap. 3, mobi.Maldavsky, A., “Finances missionnaires et salut des laïcs. La donation de Juan Clemente de Fuentes, marchand des Andes, à la Compagnie de Jésus au milieu du XVIIe siècle”, ASSR, publicación prevista en 2020.Maldavsky, A., “Giving for the Mission: The Encomenderos and Christian Space in the Andes of the Late Sixteenth Century”, en Boer W., Maldavsky A., Marcocci G. y Pavan I. (eds.), Space and Conversion in Global Perspective, Leiden-Boston, Brill, 2014, pp. 260-284.Maldavsky, A., “Teología moral, restitución y sociedad colonial en los Andes en el siglo XVI”, Revista portuguesa de teología, en prensa, 2019.Margairaz, D., Minard, P., “Le marché dans son histoire”, Revue de synthèse, 2006/2, pp. 241-252.Martínez López-Cano, M. del P., Speckman Guerra, E., Wobeser, G. von (eds.) La Iglesia y sus bienes: de la amortización a la nacionalización, México, Universidad Nacional Autónoma de México, Instituto de Investigaciones Históricas, 2004.Mauss, M., “Essai sur le don. Forme et raison de l’échange dans les sociétés archaïques (1923-1924)”, en Mauss, M., Sociologie et anthropologie, Paris, Presses universitaire de France, 1950, pp. 145-279.Mendoza, D. de, Chronica de la Provincia de San Antonio de los Charcas, Madrid, s.-e., 1665.Mills K., Idolatry and its Enemies. Colonial andean religion and extirpation, 1640-1750, Princeton, New Jersey, Princeton University Press, 1997.Mörner, M., The Political and Economic Activities of the Jesuits in the La Plata Region: The Hapsburg Era, Stockholm, Library and Institute of Ibero-American Studies, 1953.Morales Padrón, F., Teoría y leyes de la conquista, Madrid, Ediciones Cultura Hispánica del Centro Iberoamericano de Cooperación, 1979.“Nuevos avances en el estudio de las reducciones toledanas”, Bulletin of the National Museum of Ethnology, 39(1), 2014, pp. 123-167.O’Gorman, E., Destierro de sombras: luz en el origen de la imagen y culto de Nuestra Señora de Guadalupe del Tepeyac, México, Universidad nacional autónoma de México, Instituto de Investigaciones Históricas, 1986.Pompa, C., Religião como tradução: Missionários, Tupi e Tapuia no Brasil colonial, São Paulo, ANPOCS, 2003.Prodi, P. Una historia de la justicia. De la pluralidad de fueros al dualismo moderno entre conciencia y derecho, Buenos Aires-Madrid, Katz, 2008.Ragon, P., “Entre religion métisse et christianisme baroque : les catholicités mexicaines, XVIe-XVIIIe siècles», Histoire, monde et cultures religieuses, 2008/1, n°5, pp. 15-36.Ragon, P., “Histoire et christianisation en Amérique espagnole», en Kouamé, Nathalie (éd.), Historiographies d’ailleurs: comment écrit-on l’histoire en dehors du monde occidental ?, Paris, Karthala, 2014, pp. 239-248.Ramos G., Muerte y conversión en los Andes, Lima, IFEA, IEP, 2010.Rodríguez, D., Por un lugar en el cielo. Juan Martínez Rengifo y su legado a los jesuitas, 1560-1592, Lima, Universidad Nacional Mayor de San Marcos, 2005.Romano, R., Les mécanismes de la conquête coloniale: les conquistadores, Paris, Flammarion, 1972.Saignes, T., “The Colonial Condition in the Quechua-Aymara Heartland (1570–1780)”, en Salomon, F. y Schwartz, S.(eds.), The Cambridge History of theNative Peoples of the Americas. Vol. 3, South America, Cambridge, Cambridge University Press, 1999, pp. 58–137.Saignes, T., Caciques, tribute and migration in the Southern Andes: Indian society and the 17th century colonial order (Audiencia de Charcas), Londres, Inst. of Latin American Studies, 1985.Schmitt, J.-C., “‘Religion populaire’ et culture folklorique (note critique) [A propos de Etienne Delaruelle, La piété populaire au Moyen Age, avant- propos de Ph. Wolff, introduction par R. Manselli et André Vauchez] «, Annales. Économies, Sociétés, Civilisations, 31/5, 1976, pp. 941953.Schwaller, J. F., Origins of Church Wealth in Mexico. Ecclesiastical Revenues and Church Finances, 1523-1600, Albuquerque, University of New Mexico press, 1985.Spalding, K., Huarochirí, an Andean society under Inca and Spanish rule, Stanford, Stanford University Press, 1984.Stern, S. J., Los pueblos indígenas del Perú y el desafío de la conquista española: Huamanga hasta 1640, Madrid, Alianza, 1986.Taylor, W. B., Magistrates of the Sacred: Priests and Parishioners in Eighteenth-Century Mexico. Stanford University Press, 1996.Thomas, Y., “La valeur des choses. Le droit romain hors la religion”, Annales, Histoire, Sciences Sociales, 2002/T, 57 année, pp. 1431-1462.Thornton, J. K., Africa and Africans in the Formation of the Atlantic World, 1400–1680), New York, Cambridge University Press, 1998.Tibesar, A., Franciscan beginnings in colonial Peru, Washington, Academy of American Franciscan History, 1953.Tibesar A., “Instructions for the Confessors of Conquistadores Issued by the Archbishop of Lima in 1560”, The Americas 3, n. 4 (Apr. 1947), pp. 514-534.Todeschini, G., Richesse franciscaine: de la pauvreté volontaire à la société de marché, Lagrasse, Verdier, 2008.Toneatto, V., “La richesse des Franciscains. Autour du débat sur les rapports entre économie et religion au Moyen Âge”, Médiévales. Langues, Textes, Histoire 60, n. 60 (30 juin 2011), pp. 187202.Toneatto, V., Les banquiers du Seigneur: évêques et moines face à la richesse, IVe-début IXe siècle, Rennes, Presses universitaires de Rennes, 2012.Toquica Clavijo, M. C., A falta de oro: linaje, crédito y salvación, Bogotá, Universidad Nacional de Colombia, Ministero de Cultura, Instituto Colombiano de Antropología e Historia, 2008.Torre, A., “‘Faire communauté’. Confréries et localité dans une vallée du Piémont (XVIIe -XVIIIe siècle)”, Annales. Histoire, Sciences Sociales 2007/1 (año 62), pp. 101-135.Torre, A., “Politics Cloaked in Worship: State, Church and Local Power in Piedmont 1570-1770”, Past and Present, 134, 1992, pp. 42-92.Vargas Ugarte, R., “Archivo de la beneficencia del Cuzco”, Revista del Archivo Histórico del Cuzco, no. 4 (1953), pp. 105-106.Vauchez A., Les laïcs au Moyen Age. Pratiques et expériences religieuses, Paris, Cerf, 1987.Vincent, C., “Laïcs (Moyen Âge)”, en Levillain, P. (ed.), Dictionnaire historique de la papauté, Paris, Fayard, 2003, pp. 993-995.Vincent, C., Les confréries médiévales dans le royaume de France: XIIIe-XVe siècle, Paris, A. Michel, 1994.Valle Pavón, G. del, Finanzas piadosas y redes de negocios. Los mercaderes de la ciudad de México ante la crisis de Nueva España, 1804-1808, México, Instituto Mora, Historia económica, 2012.Vovelle, M., Piété baroque et déchristianisation en Provence au XVIIIe siècle, Paris, Plon, 1972.Wachtel, N., La Vision des vaincus: les Indiens du Pérou devant la Conquête espagnole, Paris, Gallimard, 1971.Wilde, G., Religión y poder en las misiones de guaraníes, Buenos Aires, Ed. Sb, 2009.Wobeser, G. von, El crédito eclesiástico en la Nueva España, siglo XVIII, México, Universidad Nacional Autónoma de México, Instituto de Investigaciones Históricas, 1994.Wobeser, G. von, Vida eterna y preocupaciones terrenales. Las capellanías de misas en la Nueva España, 1600-1821, Mexico, Universidad Nacional Autónoma de México, 2005.Zavala, S., La encomienda indiana, Madrid, Junta para ampliación de estudios e investigaciones científicas-Centro de estudios históricos, 1935.Zemon Davis, N., Essai sur le don dans la France du XVIe siècle, Paris, Seuil, 2003.

В статье кратко изложены основные результаты и перспективные направления изучения ботайской культуры коллективом Международной комплексной казахстанско-британской археологической экспедиции. Особое внимание в статье уделено освещению большой работы, проведенной западными учеными под руководством Алана Оутрама на поселении Ботай по анализу археозоологических, химико-физических и биологических источников из культурного слоя памятника. Библиографические ссылки 1. Зайберт В.Ф. Ботайская культура. Алматы: «КазАкпарат», 2009. 576 с. 2. Захарук Ю.Н. Историзм: проблемы археологии и этнографии // Историзм археологии: методические проблемы: тез. докл. конф. М., 1976. С. 6-10. 3. Левин М. Истоки конного хозяйства на евразийской степи // Поздняя доисторическая эксплуатация евразийской степи. Левин М., Рассамакин Ю., Кисленко А., Татаринцева Н. (ред.). Кембридж: Институт Макдональда, 1999. С. 5-58. 4. Левин М. Изучение критериев раннего приручения лошадей // Следы предков: исследования в честь Колина Ренфрю. Джонс М. (изд.). Кембридж: Институт Макдональда, 2004. С. 115-26. 5. Массон В.М. Основные направления культурно-исторического процесса // Становление производства в эпоху энеолита и бронзы: по материалам Южного Туркменистана. М.: «Наука», 1981. С. 35-48. 6. Токарев С.А. Проблемы типов этнических общностей (к методологическим проблемам этнографии) // Вопросы философии. 1964. № 11. С. 48-59. 7. Хотинский Н.А. Голоцен Северной Евразии: опыт трансконтинентальной корреляции этапов развития растительности и климата (К X Конгрессу YNAUA (Великобритания, 1977); 8). М.: «Наука», 1977. С. 13-16. 8. Чубарьян А.О. Опыт мировой истории и идеологии обновления // Всеобщая история: дискуссии, новые подходы. М., 1989. Вып. 1. С. 7-17. 9. Arnaud F., Poulenard J., Giguet-Covex C., Wilhelm B., Révillon S., Jenny J.P., Revel M., Enters D., Bajard M., Fouinat L., Doyen E. Erosion under climate and human pressures: An alpine lake sediment perspective // Quaternary Science Reviews. 2016. 152. P. 1-18. 10. Bendrey R. New methods for the identification of evidence for bitting on horse remains from archaeological sites // JAS. 2007. 34 (7). P. 1036-1050. 11. French C., Kousoulakou M. Geomorphological and micromorphological investigations of palaeosols, valley sediments and a sunken floored dwelling at Botai, Kazakhstan // Levine M.A., Renfrew C., Boyle K.V. (eds). Prehistoric Steppe Adaptation and the Horse. Cambridge: McDonald Institute, 2003. P. 105-114. 12. Jones M.A., Hunt H.A., Kneale C.A., Lightfoot E.M., Lister D.I., Liu X.I., Motuzaite-Matuzeviciute G.I. Food globalisation in prehistory: The agrarian foundations of an interconnected continent // Journal of the British Academy. 2016. 4. P. 73-87. 13. O’Connell T., Levine M., Hedges R. The importance of fish in the diet of Central Eurasian peoples from the Mesolithic to the Early Iron Age // Levine M., Renfrew C., Boyle K. (eds) Prehistoric Steppe Adaptation and the Horse. Cambridge: McDonald Institute for Archaeological Research, 2003. P. 253-268. 14. Olsen S.A., Bradley B., Maki D., Outram A. Community organization among Copper Age sedentary horse pastoralists of Kazakhstan // Peterson D.L., Popova L.M., Smith A.T. (eds) Beyond the steppe and the sown: Proceedings of the 2002 University ofChicago Conference on Eurasian Archaeology. Leiden: Brill, 2006. P. 89-111. 15. Outram A.K., Stear N. A., Bendrey R., Olsen S., Kasparov A., Zaibert V., Thorpe N., Evershed R.P. The earliest horse harnessing and milking // Science. 2009. 323 (5919). P. 1332-1335. 16. Outram A.K. Animal Domestications // Oxford Handbook of the Archaeology and Anthropology of Hunter-Gatherers. Cumming V., Jordan P., Zvelebil M. (eds). Oxford: Oxford University Press, 2014. P. 749-763. 17. Outram A.K. Pastoralism // The Cambridge World History, Vol. II: A World with Agriculture, 12,000 BCE – 500 CE. Barker G., Goucher C. (eds). Cambridge: Cambridge University Press, 2015. P. 161-185. 18. Seetah K., Cucchi T., Dobney K., Barker G. A geometric morphometric re-evaluation of the use of dental form to explore population differences in horses (Equus caballus) and its potential zooarchaeological application // JAS. 2014. 41. P. 904-910. 19. Stear N.A. Changing patterns of animal exploitation in the prehistoric Eurasian steppe: an integrated molecular, stable isotope and archaeological approach. Unpublished PhD Thesis. University of Bristol, 2008.

The paper presents the issue of language use and identity among Muslim Roma youth from Bulgaria, living in Berlin, Germany. Interviews with a structured questionnaire on language use and identity was conducted with Bulgarian Muslim Roma living in Berlin, Germany. The results showed that, in order to be accepted by the German Turks, Bulgarian Muslim Roma youth change their language use and identity from Muslim Roma to a new identity - Bulgarian “Osmanli” Turks. The findings showed that the change of language and identity among young Roma in this study served as strategies for integration and acceptance in the German society. References Bailey, B. (2001). The language of multiple identities among Dominican Americans. Journal of Linguistic Anthropology, 10(2), 190-223. Berry, J. (1997). Immigration, acculturation and adaptation. Applied Psychology: An International Review, 46, 5-36. Bleich, E. (2009). Where do Muslims Stand on Ethno-Racial Hierarchies in Britain and France? Evidence from Public Opinion Surveys, 1998-2008; 43, 379-400. Brizic, K. (2006). The secret life of a languages. Origin-specific differences in L1/L2 acquisition by immigrant children. International Journal of Applied Linguistics, 16(3), 339-362. Broeder, P. & Extra, G. (1995). Ethnic identity and community languages in the Netherlands In: Sociolinguistica – International Yearbook of European Sociolinguistics/ Internationales Jahrbuch für europäische Soziolinguistik, 9, 96-112. Dimitrova, R., Ferrer-Wreder, L. (2017). Positive Youth Development of Roma Ethnic minority Across Europe. In: Handbook on positive development of minority children and youth (pp. 307-320). N. Cabrera & B. Leyendeker, (Eds.). New York: Springer Erikson, E. (1964). Childhood and Society. New York: W. W. Norton & Company. Fishman, J. (1998). Language and ethnicity: The view from within. In: The Handbook of Sociolinguistics. (pp. 327-343). F. Coulmas (Ed.). Oxford: Blackwell. Fought, C. (2006). Language and ethnicity. Cambridge: Cambridge University Press. Giles, H. (ed.) (1984). The Dynamics of speech accommodation. International Journal of Socio­logy of Language, 46, 1-155 Giray, B. (2015). Code-switching among Bulgarian Muslim Roma in Berlin. In: Ankara Papers in Turkish and Turkic Linguistics. (pp. 420-430). D. Zeyrek, C.S. Șimșek, U. Ataș and J. Rehbein (Eds.). Wiessbaden: Harrassowitz Verlag. Kivisto, P. (2013). (Mis)Reading Muslims and multiculturalism. Social Inclusion, 1, 126-135. Kyuchukov, H. (2016). The Turkish in Berlin spoken by Bulgarian Muslim Roma. Ural-Altaic Studies, 22, 7-12. Kyuchukov, H. (2007). Turkish and Roma children learning Bulgarian. Veliko Tarnovo: Faber. Larson, R. W. (2000). Toward a psychology of positive youth development. American Psycho­logist, 55, 170-183. Lerner, R. Et al. (2005) Positive youth development. A view of the issues. Journal of Early Adolescence, 25(1), 10-16. Lerner, R., Dowling, E., Anderson, P. (2003) Positive youth development: Thriving as the basis of personhood and civil society. Applied Developmental Science, 7(3), 172-180. Marushiakova, E. & Popov, V. (2004). Muslim Minorities in Bulgaria. In: Migration and Political Intervention: Diasporas in Transition Countries. (pp. 18-32). Blaschke, J. (Ed.). Berlin: Parabolis. Merton, R. (1968). The Matthew effect in Science. Science, 159(3810), 56-63. Ochs, E. (1993). Constructing social identity: a language socialization perspective. Research on Language and Social Interaction, 26, 287-306. Organista, P. B, Marin, G., Chun, K. M. (2010). The psychology of ethnic groups in United States. London: SAGE Publication. Padilla, A., Perez, W. (2003). Acculturation, social identity and social cognition: A new Per­spective. Hispanic Journal of Behavioral Sciences, 25, 35-55. Peoples, J., Bailey, G. (2010). Humanity: An Introduction to Cultural Anthropology (9th ed.). Belmont, CA: Wadsworth Cengage learning. Rovira, L. (2008). The relationship between language and identity. The use of the home language as a human right of the immigrant. Revista Interdisciplinar da Mobilidade Humana, XVI (31), 63-81. Tajfel, H. Turner, J.C. (1986). The social identity theory of intergroup behavior. In: Psychology of Intergroup Relations (pp. 7-24). Worchel, S. & Austin, W. G. (Eds.). Chicago: Nelson-Hall. Tabouret-Keller, A. (1998). Language and identity. In: The Handbook of Sociolinguistics. (pp. 315-326). F. Coulmas (Ed.). Oxford: Blackwell. Trudgill, P. (1992). Ausbau sociolinguistics and the perception of language status in contemporary Europe. International Journal of Applied Linguistics, 2, 167-178.

In November 2012, unusual symptoms were observed in plants of sweet pepper (Capsicum annuum L.) grown in commercial greenhouses of Almería Province, southeastern Spain. Symptoms included interveinal yellowing, upward leaf curling, and internode shortening, and were more evident in the upper part of the plant. Abnormal ripening of fruits was observed in symptomatic plants, with fruits remaining orange in the red varieties and yellow in the orange varieties, thus reducing their marketability. During December 2012 and January 2013, severe outbreaks of this disease syndrome occurred, with many greenhouses exhibiting almost 100% incidence. The symptoms observed were similar to those reported for isolates of Pepper vein yellows virus (PeVYV, genus Polerovirus, family Luteoviridae) (previously also named Pepper yellow leaf curl virus [PYLCV] and Pepper yellows virus [PYV]) (2,4). Twenty five symptomatic leaf and/or fruit samples (some of them supplied by Zeraim Ibérica, S.A.), each from a different greenhouse, were analyzed and all reacted positively in double-antibody sandwich-ELISA with an antiserum against the polerovirus Cucurbit aphid-borne yellows virus (CABYV) (Sediag, Longvic, France), known to cross-react with PeVYV (2). Total RNA was extracted by TRIsure reagent (Bioline, London, United Kingdom) from symptomatic leaves and analyzed by reverse transcription (RT)-PCR with primers Pol-G-F (5′-GAYTGCTCYGGYTTYGACTGGAG-3′) and Pol-G-R (5′-GATYTTATAYTCATGGTAGGCCTTGAG-3′) designed for universal detection of poleroviruses by amplifying the RNA-dependent RNA polymerase (RdRp) and coat protein (CP) partial genes (3). DNA fragments of the expected size (1.1 kbp) were amplified supporting a polerovirus infection in all the analyzed samples. The PCR product obtained from one sample (Almería-1) was extracted from agarose gel with a QIAquick gel extraction kit (Qiagen, Hilden, Germany), cloned in pGEM-T Easy vector (Promega, Madison, WI), and one clone was sequenced (Macrogen Inc., Seoul, South Korea). The PCR products amplified from three other samples (2-13, 7-13, and 8-13) were directly sequenced. The nucleotide identity between the amplified fragments (GenBank Accession Nos. KC769487, KC839992 to 94), calculated after alignment with ClustalW, was 99.7 to 100%. The highest nucleotide identity of the Spanish sequences was with a PeVYV isolate from Turkey (FN600344, named as PYV) (98.5 to 98.7%). The spread of PeVYV in Spain is additional evidence of the emergence of this virus as a global threat for pepper crops after its first detection in Japan in 1995 and recent reports from the Mediterranean Basin (1,2). References: (1) N. Buzkan et al. Arch. Virol. 158:881, 2013. (2) A. Dombrovsky et al. Phytoparasitica 38:477, 2010. (3) D. Knierim et al. Plant Pathol. 59:991, 2010. (4) R. Murakami et al. Arch. Virol. 156:921, 2011.