To see the other types of publications on this topic, follow the link: Family vineyards.
Journal articles on the topic 'Family vineyards'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Family vineyards.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Cieniewicz, Elizabeth, Madison Flasco, Melina Brunelli, Anuli Onwumelu, Alice Wise, and Marc F. Fuchs. "Differential Spread of Grapevine Red Blotch Virus in California and New York Vineyards." Phytobiomes Journal 3, no. 3 (January 2019): 203–11. http://dx.doi.org/10.1094/pbiomes-04-19-0020-r.
Full textAbstract:
Limited information is available on the spread dynamics of grapevine red blotch virus (GRBV, genus Grablovirus, family Geminiviridae) in vineyards. In this study, we investigated red blotch disease progress in three vineyards with a disparate initial inoculum prevalence. Secondary spread was documented in Cabernet Sauvignon and Cabernet franc vineyards in California, but not in a Merlot vineyard in New York. Increase in annual disease incidence (4.8, 0.13, and 0%) was unrelated to the estimated initial source of inoculum at planting (1, 40, and 40%) in the Cabernet franc, Cabernet Sauvignon, and Merlot vineyards, respectively. Limited genetic diversity of GRBV populations in newly infected vines supported localized spread in California vineyards, and suggested the planting material as the primary source of inoculum. Among the community of hemipteran insects visiting two of the three study vineyards, populations of Spissistilus festinus, the vector of GRBV, were absent in the Merlot vineyard and low in the Cabernet Sauvignon vineyard. Furthermore, all cover crop samples collected from GRBV-infected California vineyards each spring of 2016 to 2018, particularly legume species which are preferred hosts of S. festinus, tested negative for GRBV, suggesting a minimal role, if any, in GRBV spread as inoculum reservoirs. Together our findings illustrate differential disease progress in distinct vineyard ecosystems, and support the elimination of virus inoculum sources as an actionable disease management strategy across vineyards.
2
Pfingstmann, Alexandra, Daniel Paredes, Jacob Buchholz, Pascal Querner, Thomas Bauer, Peter Strauss, Sophie Kratschmer, Silvia Winter, and Johann Zaller. "Contrasting Effects of Tillage and Landscape Structure on Spiders and Springtails in Vineyards." Sustainability 11, no. 7 (April 8, 2019): 2095. http://dx.doi.org/10.3390/su11072095.
Full textAbstract:
Interactions between predatory species and their potential prey are little studied in vineyards, especially considering the surrounding landscape structure. We examined the effects of soil tillage intensities in vineyard inter-rows on the activity density and diversity of spiders (Araneae) and springtails (Collembola), their potential preys, and assessed whether these effects are altered by non-crop elements in the surrounding landscape. We collected data in 16 vineyards in Austria; eight were periodically mechanically disturbed (PMD), eight had permanent green cover (PGC). The study vineyards were embedded in landscapes ranging from structurally simple to complex. Both, spiders and springtails were collected with pitfall traps. Data analyses using generalized linear mixed models (GLMM) showed different effects of soil tillage intensities on spiders and springtails and an interaction with semi-natural elements (SNEs) in the surrounding landscape. Activities of springtails were higher under PMD than under PGC while spider activity density remained unaffected. Spider family Shannon diversity was lower under PMD than under PGC, while springtail species Shannon diversity was unaffected by tillage. Under PMD, spider activity and family diversity decreased with increasing SNEs in the surroundings indicating spider emigration away from vineyards. Under PGC, spider activity density increased with increasing SNE proportions in the surroundings when springtail activity density was high. Our findings suggest that recommendations on sustainable vineyard management should include both site and landscape factors.
3
Bick, Emily N., Cindy R. Kron, and Frank G. Zalom. "Timing the Implementation of Cultural Practices for Spissistilus festinus (Hemiptera: Membracidae) in California Vineyards Using a Stage-Structured Degree-Day Model." Journal of Economic Entomology 113, no. 5 (August 17, 2020): 2558–62. http://dx.doi.org/10.1093/jee/toaa165.
Full textAbstract:
Abstract The three-cornered alfalfa hopper, Spissistilus festinus (Say), was shown to transmit Grapevine red blotch virus (GRBV), the causative agent for Grapevine red blotch disease, in a greenhouse study on grapes. GRBV is a major concern of wine grape growers due to its economic impact on wine quality. Plants in the family Fabaceae are preferred hosts of S. festinus and are commonly planted as cover crops or present in a vineyard’s native vegetation. In late winter, during grapevine dormancy, S. festinus migrate into vineyards to feed and reproduce on these cover crop and weed hosts. Tilling vineyard floor vegetation provides growers an opportunity to disrupt the life cycle of early instars that are relatively immobile, reducing the S. festinus first-generation population. Nymphal presence is difficult to detect. First through third instars were not detected in sweep net samples in a 2-yr weekly sampling study, whereas fourth and fifth instars were first found on the same sample date as emerging adults. A degree-day model was developed and successfully predicted when early S. festinus instars are present in the vineyard to aid in exploiting the time period when S. festinus is most susceptible to cultural control measures.
4
Brignardello, María. "Changes and continuities in agricultural work: the case of small and medium-sized vineyards in Mendoza, Argentina." Cahiers Agricultures 27, no. 3 (May 2018): 35007. http://dx.doi.org/10.1051/cagri/2018025.
Full textAbstract:
To examine today’s agricultural production processes requires redefining work and the social agents involved in it. As such, this article belongs to the scholarly literature that seeks to understand how the emphasis on quality in the agricultural industry reshapes agricultural work at the local level. In particular, it aims to explore the implications of these structural changes for small and medium-sized vineyards. Since the late 1980s, the wine grape industry in the Argentine province of Mendoza has experienced structural changes. This process has been referred to as a “quality turn”. As a result, small and medium-sized vineyards must alter their practices. In this context, our questions include the following: what does this mean for labor in these vineyards? Who performs the newly required tasks, as well as the traditional ones? We address these questions through a qualitative analysis of interviews with the winegrape growers of small and medium-sized vineyards located in the High Mendoza River Area (Argentina). Using this methodology, we strive to understand the current forms of labor organization in an agricultural sector influenced by both global changes and local history. In conclusion, we argue that the labor practices and power structure between the winegrape grower, his family, and non-family workers are not uniform across all vineyards. Instead, we find great diversity in the organization and operation of small and medium-sized vineyards.
5
Poojari, S., J. Boulé, N. DeLury, D. T. Lowery, M. Rott, A. M. Schmidt, and J. R. Úrbez-Torres. "Epidemiology and Genetic Diversity of Grapevine Leafroll-Associated Viruses in British Columbia." Plant Disease 101, no. 12 (December 2017): 2088–97. http://dx.doi.org/10.1094/pdis-04-17-0497-re.
Full textAbstract:
Grapevine leafroll disease (GLD) is a complex associated with one or more virus species belonging to the family Closteroviridae. The majority of viruses in this complex are vectored by one or more species of mealybugs (Pseudococcidae) and/or scale insects (Coccidae). Grape-growing regions of British Columbia (BC), including Okanagan, Similkameen, and Fraser valleys and Kamloops (BC central interior), Vancouver, and Gulf islands, were surveyed during the 2014 and 2015 growing seasons for the presence of four major grapevine leafroll-associated viruses, including Grapevine leafroll-associated virus 1 (GLRaV-1), GLRaV-2, GLRaV-3, and GLRaV-4. In total, 3,056 composite five-vine samples were collected from 153 Vitis vinifera and three interspecific hybrid vineyard blocks. The results showed GLRaV-3 to be the most widespread, occurring in 16.7% of the composite samples, followed by GLRaV-4 (3.9%), GLRaV-1 (3.8%), and GLRaV-2 (3.0%). Mixed infections of two or more GLRaVs were found in 4.1% of the total samples. The relative incidence of GLRaVs differed among regions and vineyard blocks of a different age. Characterization of partial CO1 region from a total of 241 insect specimens revealed the presence of Pseudococcus maritimus, Parthenolecanium corni, and other Pulvinaria sp. in BC vineyards. Spatial patterns of GLRaV-3 infected grapevines in three vineyard blocks from three different regions in the Okanagan Valley showed variable degrees of increase in disease spread ranging from 0 to 19.4% over three growing seasons. Regional differences in the relative incidence and spread of GLD underline the need for region-based management programs for BC vineyards.
6
Cieniewicz, Elizabeth, Jeremy R. Thompson, Heather McLane, Keith L. Perry, Gerald S. Dangl, Quinlan Corbett, Timothy Martinson, et al. "Prevalence and Genetic Diversity of Grabloviruses in Free-Living Vitis spp." Plant Disease 102, no. 11 (November 2018): 2308–16. http://dx.doi.org/10.1094/pdis-03-18-0496-re.
Full textAbstract:
The distribution and diversity of grapevine red blotch virus (GRBV) and wild Vitis virus 1 (WVV1) (genus Grablovirus; family Geminiviridae) were determined in free-living Vitis spp. in northern California and New York from 2013 to 2017. Grabloviruses were detected by polymerase chain reaction in 28% (57 of 203) of samples from California but in none of the 163 samples from New York. The incidence of GRBV in free-living vines was significantly higher in samples from California counties with high compared with low grape production (χ2 = 83.09; P < 0.001), and in samples near (<5 km) to compared with far (>5 km) from vineyards (χ2 = 57.58; P < 0.001). These results suggested a directional spread of GRBV inoculum predominantly from vineyards to free-living Vitis spp. WVV1 incidence was also significantly higher in areas with higher grape production acreage (χ2 = 16.02; P < 0.001). However, in contrast to GRBV, no differential distribution of WVV1 incidence was observed with regard to distance from vineyards (χ2 = 0.88; P = 0.3513). Two distinct phylogenetic clades were identified for both GRBV and WVV1 isolates from free-living Vitis spp., although the nucleotide sequence variability of the genomic diversity fragment was higher for WWV1 (94.3 to 99.8% sequence identity within clade 1 isolates and 90.1 to 100% within clade 2 isolates) than GRBV (98.3% between clade 1 isolates and 96.9 to 100% within clade 2 isolates). Additionally, evidence for intraspecific recombination events was found in WVV1 isolates and confirmed in GRBV isolates. The prevalence of grabloviruses in California free-living vines highlights the need for vigilance regarding potential grablovirus inoculum sources in order to protect new vineyard plantings and foundation stock vineyards in California.
7
Roviello, Valentina, Ugo Caruso, Giovanni Dal Poggetto, and Daniele Naviglio. "Assessment of Copper and Heavy Metals in Family-Run Vineyard Soils and Wines of Campania Region, South Italy." International Journal of Environmental Research and Public Health 18, no. 16 (August 11, 2021): 8465. http://dx.doi.org/10.3390/ijerph18168465.
Full textAbstract:
Copper-based phytosanitary treatments are widely employed in viticulture for combating the fungal diseases of European grape (Vitis vinifera L.). Herein we evaluated copper accumulation in the soil of a 50-year-old still productive vineyard in South Italy in comparison with samples taken from a ‘control’ area in which grapevines had never been cultivated, as well from an abandoned vineyard, now planted with cereals and forage crops, both close to the main area under investigation. Even though the heavy metal contents detected were not of concern for soils nor for wine, Cu accumulates in the soil in amounts significantly higher than the (grapevine free) control and remains at detectable concentrations also in abandoned vineyards where spraying activities had ceased about 20 years before this study. Despite the long Cu residence times in soil, the wine produced with grapes of the same vineyard showed Cu levels low enough to be safely used for human consumption, probably due to mechanisms of metal precipitation occurring during wine maturation, which are typically accompanied by sedimentation processes in artisanal production. However, this should not diminish the urgency of decreasing the copper usage as antifungal remedy in viticulture to prevent copper contamination of the agricultural soils.
8
Pijet-Migoń, Edyta, and Karolina Królikowska. "Rebirth of viticulture and associated changes in the rural areas of Lower Silesia, SW Poland." Geographia Polonica 93, no. 3 (2020): 321–40. http://dx.doi.org/10.7163/gpol.0176.
Full textAbstract:
This paper addresses the problem of how the reborn winemaking in Lower Silesia may contribute to the social, landscape and functional changes of rural areas. Newly established vineyards refer back to the local traditions of grape cultivations which vanished for the variety of reasons. Vineyards are typically small family businesses. The profiles of winemakers show that they are most often educated persons, arriving from cities, who follow their passion and consider winemaking as a supplementary source of income. They are aware of the value of local products, traditions and harmonious landscape and expose these values in both the process of winemaking itself, as well as in developing wine tourism. They support and organize new activities such as music events, recreational events, and guest presentations. Vineyards are new elements of the rural landscape, but they are historically justified and harmoniously integrated with the topography, whereas associated infrastructure usually represents good examples of revitalization of existing buildings, occasionally of architectural value. Due to the family-type business on the vineyards it is rather premature to infer their direct positive influence on local employment and incomes. Nevertheless, due to the growth of wine tourism local suppliers are expected to increasingly benefit from this development trend.
9
Bahder, Brian W., Frank G. Zalom, Maya Jayanth, and Mysore R. Sudarshana. "Phylogeny of Geminivirus Coat Protein Sequences and Digital PCR Aid in Identifying Spissistilus festinus as a Vector of Grapevine red blotch-associated virus." Phytopathology® 106, no. 10 (October 2016): 1223–30. http://dx.doi.org/10.1094/phyto-03-16-0125-fi.
Full textAbstract:
Grapevine red blotch-associated virus (GRBaV) is a single-stranded DNA virus, proposed to be a member of the family Geminiviridae, and is associated with grapevines showing red blotch symptoms in North America. The existence of the virus was reported in 2012, and subsequently detected in grapevines in major grape production regions. We investigated if a vector exists that can transmit GRBaV in vineyards. Phylogenetic analysis of the predicted amino acid sequence of coat protein (CP) of GRBaV with the CP of 23 geminiviruses representing all seven genera of the family Geminiviridae revealed that GRBaV-CP was most similar to that of Tomato pseudo-curly top virus, a geminivirus known to be transmitted by a treehopper (Membracidae), a family that is closely related to leafhoppers (Cicadellidae). To identify vectors of GRBaV, hemipteran species within and nearby wine grape vineyards where virus spread was suspected were collected and transmission assays were conducted. Among the species tested, the three-cornered alfalfa hopper Spissistilus festinus (Hemiptera: Membracidae) was able to both acquire the virus from a grapevine infected with GRBaV and transmit the virus to healthy grapevines in the laboratory. In commercial vineyards, lateral shoots of grapevines girdled due to feeding injury by the adult three-cornered alfalfa hopper also tested positive for the virus using digital PCR. These findings represent an important step in understanding the biology of GRBaV and develop management guidelines.
10
Banjanin, Tijana, Siniša Berjan, Vesna Milić, and Hamid El Bilali. "State of and Conditions for Viticulture Development in Bosnia and Herzegovina." АГРОЗНАЊЕ 17, no. 3 (February 10, 2017): 279. http://dx.doi.org/10.7251/agren1603279b.
Full textAbstract:
This paper presents the state-of-the-art of viticulture development in BiH. Research is based on the extensive literature review. A number of secondary data sources have been consulted. Viticulture in BiH is characterized by the dominance of small family owned vineyards (up to 2 ha). In older plantations there are mainly autochthonous cultivars while in new vineyards there is a modern cultivar assortment. Although BiH has a good potential and excellent conditions for viticulture, wine imports are almost five times higher than exports. Therefore, there is a need for better cooperation of professional, scientific and government institutions with grapevine growers and wineries in order to modernize production process. This cooperation is essential especially in organizing the production of virus-free propagation material, during the introduction of new cultivars and for preserving autochthonous varieties in the vineyards of BiH.
11
Mekuria, T., R. R. Martin, and R. A. Naidu. "First Report of the Occurrence of Grapevine fanleaf virus in Washington State Vineyards." Plant Disease 92, no. 8 (August 2008): 1250. http://dx.doi.org/10.1094/pdis-92-8-1250a.
Full textAbstract:
Grapevine fanleaf virus (GFLV; genus Nepovirus, family Comoviridae), responsible for fanleaf degeneration disease, is one of the most important viruses of grapevines worldwide (1). During our reconnaissance studies during 2007, dormant wood cuttings from individual grapevines of wine grape cv. Chardonnay were collected randomly from two geographically separate vineyards in eastern Washington State. Extracts made from cambial scrapings of these cuttings were tested separately for different viruses by single-tube reverse transcription (RT)-PCR using virus-specific primers. Two of the thirty-one grapevines in one vineyard tested positive for GLFV as mixed infection with Grapevine leafroll-associated virus (GLRaV)-3. In another vineyard, six of the twenty-six grapevines tested positive for GFLV as mixed infection with GLRaV-1, GLRaV-3, and Grapevine virus A (GVA) A forward primer (5′-ACCGGATTGACGTGGGTGAT, corresponding to nucleotides [nt] 2231–2250) and reverse primer (5′-CCAAAGTTGGTTTCCCAAGA, complementary to nt 2533–2552) specific to RNA-2 of GFLV-F13 isolate (GenBank Accession No. X16907) were used in RT-PCR assays for the detection of GFLV (4). Primers used for RT-PCR detection of GLRaV-1, GLRaV-2, and GVA were described in Martin et al (2) and Minafra et al (3). The RT-PCR results indicated mixed infection of GFLV with GLRaV-1, GLRaV-3, and GVA. To confirm the presence of GFLV, the 322-bp sequence representing a portion of the coat protein encoded by RNA-2 genomic segment was cloned into pCR2.1 (Invitrogen Corp., Carlsbad, CA). Amplicons obtained from six individual grapevines in the two vineyards were used for cloning. Three independent clones per amplicon were sequenced from both orientations. Pairwise comparison of these sequences showed 99 to 100% nucleotide sequence identity among themselves, indicating that GFLV isolates from the two vineyards may be identical. A comparison of the consensus sequence (GenBank Accession No. EU573307) with corresponding sequences of other GFLVs deposited in GenBank showed 89 to 91% identity at the nucleotide level and 95 to 99% identity at the amino acid level. However, mixed infection of GFLV with different viruses in the two vineyards suggests separate introduction of the planting material. ELISA with GFLV-specific antibodies further confirmed the presence of the virus in samples that were positive in RT-PCR. To our knowledge, this is the first report of GFLV in grapevines grown in the Pacific Northwest states of the United States. Further investigations are being carried out on the distribution, symptoms, molecular variability, and nematode vector transmission of GFLV. References: (1) P. Andret-Link et al. J. Plant Pathol. 86:183, 2004. (2) R. R. Martin et al. Plant Dis. 89:763, 2005. (3) A. Minafra et al. Arch. Virol. 142:417, 1997 (4) A. Rowhani et al. Phytopathology 83:749, 1993.
12
Maciejczak, Mariusz, and Tadeusz Filipiak. "Family income from vineyards according to their economic size in selected EU countries." Journal of Central European Agriculture 21, no. 2 (2020): 452–60. http://dx.doi.org/10.5513/jcea01/21.2.2585.
Full text
13
Thomson, L. J., P. J. Neville, and A. A. Hoffmann. "Effective trapping methods for assessing invertebrates in vineyards." Australian Journal of Experimental Agriculture 44, no. 9 (2004): 947. http://dx.doi.org/10.1071/ea03219.
Full textAbstract:
There is increasing interest in developing environmental management systems to ensure that agricultural industries are sustainable; invertebrate indicators provide one potential tool for monitoring sustainable production. As a first step in developing invertebrate indicators for viticulture, we compare the efficiency of 3 common trapping methods in assessing populations of relevant orders of invertebrates. Yellow sticky traps were more effective in trapping Hymenoptera, Thysanoptera, Hemiptera, Diptera, Araneae and Coleoptera; transparent sticky traps were best for Lepidoptera and Neuroptera; and pitfall traps for Collembola and the family Formicidae. Numbers collected differed among months and December was the best month, overall, for trapping. Preliminary guidelines are developed for assessing key orders. While several methods are required for assessing invertebrate biodiversity, most orders can be sampled with a single method, particularly the yellow sticky trap. Our results indicate that changes in numbers of beneficial orders, due to changes in management practices, can be detected. Power analyses suggest a relatively small number of yellow sticky traps would be sufficient to detect changes of around 30%, or greater.
14
Cieniewicz, Elizabeth J., Sarah J. Pethybridge, Gregory Loeb, Keith Perry, and Marc Fuchs. "Insights Into the Ecology of Grapevine red blotch virus in a Diseased Vineyard." Phytopathology® 108, no. 1 (January 2018): 94–102. http://dx.doi.org/10.1094/phyto-07-17-0239-r.
Full textAbstract:
Limited information is available on the spread of Grapevine red blotch virus (GRBV, genus Grablovirus, family Geminiviridae) in vineyards. To investigate ecological aspects of red blotch disease spread, sticky cards to catch flying insects were placed in 2015 (April to November) and 2016 (March to November) in a vineyard study site in California where disease incidence increased by nearly 20% between 2014 and 2016. Subsets of insect species or taxa were removed from sticky card traps and individual specimens were tested for the presence of GRBV by multiplex polymerase chain reaction. GRBV was consistently detected in Spissistilus festinus (Membracidae), Colladonus reductus (Cicadellidae), Osbornellus borealis (Cicadellidae), and a Melanoliarus sp. (Cixiidae). Populations of these four candidate vectors peaked from June to September, with viruliferous S. festinus peaking from late June to early July in both years. An assessment of co-occurrence and covariation between the spatial distribution of GRBV-infected vines and viruliferous insects identified a significant association only with viruliferous S. festinus. These findings revealed the epidemiological relevance of S. festinus as a vector of GRBV in a vineyard ecosystem. Sequencing coat protein and replicase-associated protein gene fragments of GRBV isolates from newly infected vines and viruliferous vector candidates further suggested secondary spread primarily from local sources and occasionally from background sources.
15
cruz, paula de la. "Vendimia Celebrations." Gastronomica 12, no. 2 (2012): 83–86. http://dx.doi.org/10.1525/gfc.2012.12.2.83.
Full textAbstract:
On a crisp fall day in April 1936, Delia Larrive Escudero was picking grapes for the family's table at the small vineyard her father kept at the back of their house when she received a visit from her brother, who bore good news. Her father had given his consent—she was only sixteen-years-old—for Delia to enter the first official Queen of the Grape Harvest (reina de la vendimia) competition, in the province of Mendoza, in western Argentina. She would represent Godoy Cruz, one of Mendoza's seventeen departments, each with its own particular terrain, from the lush creeks shaded by pine forests of Tunuyan to the vast barren valleys of clay soil of Tupungato. Like many others in the province, Delia was from an immigrant family. Over hundreds of years, immigrants—principally from Italy and Spain—had transformed the desert at the feet of the Andes into vineyards that bear a bounty of fruit to this day. Mendoza has been celebrating the harvest in one way or another since Spanish colonists, and Jesuits introduced grapes to Argentina (via Chile) in the late 1500s as a source for sweet Mass wine.
16
Brundin, Ethel, and Caroline Vigren-Kristoferson. "Where the two logics of institutional theory and entrepreneurship merge: are family businesses caught in the past or stuck in the future?" South African Journal of Economic and Management Sciences 16, no. 4 (November 29, 2013): 452–67. http://dx.doi.org/10.4102/sajems.v16i4.367.
Full textAbstract:
The aim of this article is to investigate how owners of family businesses combine their traditional heritage with changes in a new competitive arena. This is done by allowing the owners and managers of six vineyards to give voice to their concerns about the past, present, and future. The findings suggest that family businesses in the South African wine industry are subject to a process of institutionalisation in which entrepreneurial activities, which are part of this process, may not be as entrepreneurial as they appear at first. It is found that the two forms of logic behind the institutionalisation of the family firm and entrepreneurial activities in the context of the post-apartheid era can be successfully merged. Theoretical and practical implications bring the article to a close.
17
Beach, Steven, Michael Kovens, LeAnn Hubbert, Shae Honesty, Qiang Guo, Daniel Pap, Ru Dai, Laszlo Kovacs, and Wenping Qiu. "Genetic and Phenotypic Characterization of Grapevine vein clearing virus from Wild Vitis rupestris." Phytopathology® 107, no. 1 (January 2017): 138–44. http://dx.doi.org/10.1094/phyto-04-16-0173-r.
Full textAbstract:
Grapevine vein clearing virus (GVCV), a new member of the genus Badnavirus in the family Caulimoviridae, is associated with a vein clearing and vine decline disease that severely affects grape production and berry quality in commercial vineyards in the Midwest region of the United States. In this paper, the genetic and phenotypic characteristics of GVCV-VRU1 and GVCV-VRU2, two isolates from wild Vitis rupestris grapevines in their native habitat, are described. The GVCV-VRU1 genome is 7,755 bp long while the GVCV-VRU2 genome consists of 7,725 bp, both of which are different from the genome of the GVCV-CHA isolate (7,753 bp), which was originally discovered in the grape cultivar ‘Chardonel’. The nucleotide sequence identity among GVCV-VRU1, GVCV-VRU2, and GVCV-CHA ranges from 91.6 to 93.4%, and open reading frame (ORF) II is the most divergent ORF with only 83.3 to 88.5% identity. Sequence analysis of the ORF II indicated that GVCV isolates genetically similar to GVCV-VRU1 and GVCV-VRU2 also are present in commercial vineyards. Symptoms of GVCV-VRU1- or GVCV-VRU2-infected wild V. rupestris grapevine appeared initially as translucent vein clearing on young leaves and progressed to vein necrosis on mature leaves. Inoculation of GVCV-VRU1 or GVCV-VRU2 by grafting onto grape cultivar Chardonel resulted in mild mottle and leaf distortion. The natural range of wild V. rupestris grapevines overlaps with commercial vineyards in the Midwestern United States. Therefore, the discovery of GVCV isolates in wild V. rupestris grapevines has important implications for epidemics and management of the GVCV-associated disease.
18
Jones, Taylor, and Mizuho Nita. "Gill's mealybug, Ferrisia gilli, can Transmit Grapevine Leafroll-associated Virus-3 after a 24-hour Acquisition Time." International Journal of Phytopathology 9, no. 2 (August 28, 2020): 139–44. http://dx.doi.org/10.33687/phytopath.009.02.3385.
Full textAbstract:
Grapevine leafroll disease (GLD) is a virus disease present in all grapevine-growing regions of the world. Mealybugs and scale insects have been reported as vectors of some grapevine leafroll-associated viruses belongs to the ampeloviruses (family Closteroviridae) in particular with grapevine leafroll-associated virus-1 (GLRaV-1) and GLRaV-3. Both grape (Pseudococcus maritimus) and Gill’s mealybugs are commonly present in Virginia vineyards, but we have limited information on acquisition and transmission of GLRaV-3 by Gill's mealybug (Ferrisia Gilli). We conducted acquisition and transmission assays in the greenhouse to examine the threshold for shorter acquisition time of GLRaV-3 with F. gilli. Approximately 67% and 58% rates of GLRaV-3 acquisition by F. gilli following 24 and 48 hours, respectively, of feeding period were documented. F. gilli first instars fed on a GLRaV-3-positive grapevine for 24 and 48 hours successfully transmitted GLRaV-3 to healthy grapevines after 24 hours of feeding/transmission time. The quick acquisition demonstrated in this study could be one of the factors that promoted the rapid expansion of GLRaV-3-infected vines in vineyards documented in previous studies.
19
Sudarshana, Mysore R., Keith L. Perry, and Marc F. Fuchs. "Grapevine Red Blotch-Associated Virus, an Emerging Threat to the Grapevine Industry." Phytopathology® 105, no. 7 (July 2015): 1026–32. http://dx.doi.org/10.1094/phyto-12-14-0369-fi.
Full textAbstract:
Grapevine red blotch-associated virus (GRBaV) is a newly identified virus of grapevines and a putative member of a new genus within the family Geminiviridae. This virus is associated with red blotch disease that was first reported in California in 2008. It affects the profitability of vineyards by substantially reducing fruit quality and ripening. In red-berried grapevine cultivars, foliar disease symptoms consist of red blotches early in the season that can expand and coalesce across most of the leaf blade later in the season. In white-berried grapevine cultivars, foliar disease symptoms are less conspicuous and generally involve irregular chlorotic areas that may become necrotic late in the season. Determining the GRBaV genome sequence yielded critical information for the design of primers for polymerase chain reaction-based diagnostics. To date, GRBaV has been reported in the major grape-growing areas in North America and two distinct phylogenetic clades have been described. Spread of GRBaV is suspected in certain vineyards but a vector of epidemiological significance has yet to be identified. Future research will need to focus on virus spread, the production of clean planting stocks, and the development of management options that are effective, economical, and environmentally friendly.
20
Petersen, Sylvia M., Cory Keith, Kaylie Austin, Susanne Howard, Li Su, and Wenping Qiu. "A Natural Reservoir and Transmission Vector of Grapevine Vein Clearing Virus." Plant Disease 103, no. 3 (March 2019): 571–77. http://dx.doi.org/10.1094/pdis-06-18-1073-re.
Full textAbstract:
Grapevine vein clearing virus (GVCV) is associated with a vein-clearing and vine-decline disease. In this study, we surveyed wild Ampelopsis cordata from the Vitaceae family and found that 31% (35 of 113) of native A. cordata plants are infected with GVCV. The full-length genome sequence of one GVCV isolate from A. cordata shared 99.8% identical nucleotides with an isolate from a nearby cultivated ‘Chardonel’ grapevine, suggesting the occurrence of an insect vector. To identify a vector, we collected Aphis illinoisensis (common name: grape aphids) from wild A. cordata plants and detected GVCV in the aphid populations. We found that A. illinoisensis is capable of transmitting GVCV from infected A. cordata to Chardonel grapevines in the greenhouse. Upon transmission, GVCV caused severe symptoms on the infected Chardonel 45 days post transmission. We conclude that wild GVCV isolates from A. cordata are capable of inducing a severe disease on cultivated grapevines once they spread from native A. cordata to vineyards via grape aphids. The discovery of a natural reservoir and an insect vector of GVCV provides timely knowledge for disease management in vineyards and critical clues on viral evolution and epidemiology.
21
Alabi, Olufemi J., Maher Al Rwahnih, Tefera A. Mekuria, and Rayapati A. Naidu. "Genetic Diversity of Grapevine virus A in Washington and California Vineyards." Phytopathology® 104, no. 5 (May 2014): 548–60. http://dx.doi.org/10.1094/phyto-06-13-0179-r.
Full textAbstract:
Grapevine virus A (GVA; genus Vitivirus, family Betaflexiviridae) has been implicated with the Kober stem grooving disorder of the rugose wood disease complex. In this study, 26 isolates of GVA recovered from wine grape (Vitis vinifera) cultivars from California and Washington were analyzed for their genetic diversity. An analysis of a portion of the RNA-dependent RNA polymerase (RdRp) and complete coat protein (CP) sequences revealed intra- and inter-isolate sequence diversity. Our results indicated that both RdRp and CP are under strong negative selection based on the normalized values for the ratio of nonsynonymous substitutions per nonsynonymous site to synonymous substitutions per synonymous site. A global phylogenetic analysis of CP sequences revealed segregation of virus isolates into four major clades with no geographic clustering. In contrast, the RdRp-based phylogenetic tree indicated segregation of GVA isolates from California and Washington into six clades, independent of geographic origin or cultivar. Phylogenetic network coupled with recombination analyses showed putative recombination events in both RdRp and CP sequence data sets, with more of these events located in the CP sequence. The preponderance of divergent variants of GVA co-replicating within individual grapevines could increase viral genotypic complexity with implications for phylogenetic analysis and evolutionary history of the virus. The knowledge of genetic diversity of GVA generated in this study will provide a foundation for elucidating the epidemiological characteristics of virus populations at different scales and implementing appropriate management strategies for minimizing the spread of genetic variants of the virus by vectors and via planting materials supplied to nurseries and grape growers.
22
Morales, R. Z., and J. Monis. "First Detection of Grapevine leafroll associated virus-7 in California Vineyards." Plant Disease 91, no. 4 (April 2007): 465. http://dx.doi.org/10.1094/pdis-91-4-0465b.
Full textAbstract:
Grapevine leafroll is one of the most important viral diseases in grapevine and occurs wherever grapevines are grown. At least nine different Grapevine leafroll associated viruses (GLRaVs) belonging to different genera within the Closteroviridae family have been reported. Typical leafroll symptoms include downward rolling and interveinal reddening or yellowing of leaves, reduced fruit size, sugar content, and yield. Our laboratory has detected the presence of GLRaV-7 in many grapevine cuttings collected in California vineyards. During the 2005-2006 fall/winter testing season, symptomatic and asymptomatic grapevine varieties collected from different vineyards in California were tested for the detection of economically important viruses and processed for reverse transcription (RT)-PCR and ELISA. The RT-PCR assays using primers specifically designed for the detection of GLRaV-7 (C. Turturo et al., 13th ICVG [Abstr.], 2000) amplified a single band of approximately 200 bp in samples from selections of Chardonnay, Merlot, Pinot Noir, and Sauvignon Blanc cultivars. The same samples showed low or no reactivity to GLRaV-7 specific antibodies (BIOREBA AG, Reinach, Switzerland). The variability of detection by ELISA can be due to the lower sensitivity of ELISA as compared with RT-PCR and the uneven distribution of GLRaVs in grapevines (1). To confirm that the amplified DNA was GLRaV-7 specific, different isolates were sequenced and compared with the nucleotide and derived amino acid sequences obtained by Turturo et al. (13th ICVG [Abstr.], 2000). The California isolates showed 81 to 98% similarity with the Italian isolates. To our knowledge, this is the first report of GLRaV-7 in California and the United States. Our initial testing data indicates that GLRaV-7 is wide spread in California vineyards. Further studies will allow us to determine the potential effect of this virus in grapevines grown in California. Reference: (1) J. Monis, and R. K. Bestwick. Am. J. Enol. Vitic. 47:199, 1996.
23
Kačániová, Miroslava, Simona Kunová, Jozef Sabo, Eva Ivanišová, Jana Žiarovská, Soňa Felšöciová, Katarína Fatrcová-Šramková, and Margarita Terentjeva. "Isolation and Identification of Lactic Acid Bacteria in Wine Production by MALDI-TOF MS Biotyper." Acta Horticulturae et Regiotecturae 23, no. 1 (May 1, 2020): 21–24. http://dx.doi.org/10.2478/ahr-2020-0006.
Full textAbstract:
AbstractThe aim of this study was to identify lactic acid bacteria (LAB) in grapes, must and wines. A total amount of 90 samples including grape (n = 30), must (no = 30) and wine (no = 30) were collected from vineyards in Slovakia. LAB were used cultured on MRS agar with subsequent confirmation with MALDI-TOF mass spectrometry (Bruker Daltonics). Altogether, 904 isolates were identified. Members of the family Lactobacillaeceae were the most abundant in grape (60%), must (46%) and wine (51%). Lactobacillus, Lactococcus, Leuconostoc, Pediococcus and Weissella genera and 27 species of LAB were isolated from the examined samples. Leuconostoc mesenteroides spp. mesenteroides was the most abundant species in grape, must and wine.
24
FARAJI, FARID, and EDWARD A. UECKERMANN. "A new species of Mediolata Canestrini from Spain (Acari: Stigmaeidae), re-description of M. chanti and a key to the known species of Mediolata." Zootaxa 1151, no. 1 (March 14, 2006): 27. http://dx.doi.org/10.11646/zootaxa.1151.1.2.
Full textAbstract:
Two plant-inhabiting species of Mediolata were collected in the Iberian Peninsula during biodiversity assessments between 2000–2002. Mediolata roigi, sp. nov. and M. chanti Gonzalez were collected in Spain and Portugal respectively. The studies were conducted in citrus orchards in Portugal and apple orchards and vineyards in Spain. Because of some incorrect data in the original description of M. chanti, it is re-described. Eupalopsis vandergeesti Gomaa & Bolland is revealed to be a junior synonym of M. chanti and Mediolata mirus Chaudhri et al. is transferred to the family Eupalopsellidae under the genus Exthothoris. A key to the known species of the genus Mediolata is provided.
25
Biasi, Rita, Roberta Farina, and Elena Brunori. "Family Farming Plays an Essential Role in Preserving Soil Functionality: A Study on Active Managed and Abandoned Traditional Tree Crop-Based Systems." Sustainability 13, no. 7 (April 2, 2021): 3967. http://dx.doi.org/10.3390/su13073967.
Full textAbstract:
In traditional agricultural areas, where traditional crops (TCs) are cultivated, small farms are still highly represented. Located prevalently in marginal and sensitive areas, agricultural areas have undergone deep transformation. Smallholders have maintained the traditional asset of cultivation (extensive and low input requirement management) only to some extent. In some cases they have adapted traditional orchards into more intensive planting systems. Frequently, they have abandoned agriculture. The land use and management influence soil functions, i.e., the capability of a specific soil to provide key functions in terrestrial ecosystems. In order to assess whether small farms are environmentally sustainable, we used a set of soil quality indicators in three traditional tree crops in the Latium region (central Italy), like hazelnut, grapevine, and Citrus. The soil parameters, chemical, biological, and biochemical, were quantified under three different management models: extensive cultivation, intensive cultivation, and abandonment. The selected set of indicators proved to be able to discriminate adequately between the management models and to be suitable for the soil health assessment. Results proved that hazelnut orchards stored more organic C, independently from farming management, while vineyard showed the lower total organic carbon (TOC). The microbial carbon vs. organic carbon ratio (Cmic-to Corg ratio) was higher for vineyards and Citrus groves, denoting a more active degradation of soil organic matter. Soil enzymes (ESs) involved in C cycle were variable along the different treatments and mainly influenced by the C inputs to soil and soil cover, whereas those involved in N, P, and S cycles were higher in abandoned and extensive TCs. Overall, extensive cultivation performed better in terms of soil quality than intensive or abandonment. This study suggests that a transition to an agriculture based on agroecological principles and toward extensification would provide significant soil-based environmental benefits in marginal sensitive areas.
26
Holmes, Douglas R., and Jean H. Quataert. "An Approach to Modern Labor: Worker Peasantries in Historic Saxony and the Friuli Region over Three Centuries." Comparative Studies in Society and History 28, no. 2 (April 1986): 191–216. http://dx.doi.org/10.1017/s0010417500013827.
Full textAbstract:
The spread of manufacture in the European countryside initiated the formation of vital and complex rural laboring groups that defy neat classification. The nature of livelihood in these rural settings furthered an integration of diverse productive involvements rather than the creation of narrow occupational niches. In the course of their labor careers, men and women moved between agrarian and industrial pursuits—weaving linen cloth, spinning silk, raising livestock, digging potatoes, tending vineyards, making bricks, mining coal, casting iron, and forging steel. In this context, livelihood was not merely an individual concern; rather, it was part of a broader household strategy, rooted in a family-based agrarian holding. The maintenance of bonds to peasant agriculture fostered familial solidarity over working-class identity. These laborers saw their destinies in the immediacy of flesh-and-blood relationships among family and kin and not in more abstract social and political identifications.
27
Mekuria, T. A., and R. A. Naidu. "First Report of Grapevine Virus Sequences Highly Similar to Grapevine Syrah virus-1 from Washington Vineyards." Plant Disease 94, no. 6 (June 2010): 787. http://dx.doi.org/10.1094/pdis-94-6-0787b.
Full textAbstract:
Grapevine Syrah virus-1 (GSyV-1), a tentative member of the genus Marafivirus in the family Tymoviridae, has recently been found in a declining Syrah grapevine in California vineyards (1). To determine if GSyV-1 is present in grapevines grown in Washington State vineyards, extracts prepared from individual grapevines of six cultivars (Merlot, Chardonnay, Pinot Noir, Lemberger, Cabernet Sauvignon, and Syrah/Shiraz) were tested by single-tube reverse transcription (RT)-PCR using the primer pair GSyV-1 Det-F (5′-CAAGCCATCCGTGCATCTGG-3′) and GSyV-1 Det-R (5′-GCCGATTTGGAACCCGATGG-3′). The primer GSyV-1 Det-F is identical to nucleotides (nt) 1125 to 1144 and GSyV-1 Det-R complementary to nt 1401 to 1420 of the GSyV-1 genome (GenBank Accession No. NC_012484) in the putative movement protein encoding gene (1). DNA fragment of approximately 296 base pairs (bp) was amplified only from 7 of 60 and 2 of 20 individual grapevines of cv. Syrah/Shiraz and Chardonnay, respectively, obtained from geographically separate vineyards. The 296-bp fragments from three Syrah/Shiraz and two Chardonnay grapevines were cloned individually into the pCR2.1 plasmid (Invitrogen Corp., Carlsbad, CA). Three independent clones derived from each DNA fragment were sequenced from both orientations and the sequences edited and assembled using ContigExpress project in the Vector NTI Advance 11 sequence analysis software packages (Invitrogen). Pairwise comparison of four of these sequences (Accession Nos. GU372349–52) showed 99 to 100% amino acid (aa) sequence identity among themselves and with corresponding sequences of GSyV-1. Because of the lack of antibodies, an additional 611-bp fragment specific to the capsid protein (CP) gene of GSyV-1 was amplified from six isolates (five from cv. Syrah/Shiraz, and one from cv. Chardonnay) (Accession Nos. GU372353–66) using primers GSyV-1-F (5′-TGTCGACGCTCCAATGTCTGA-3′) and GSyV-1-R (5′-CATTGCTGCGCTTTGGAGGCTTTA-3′). GSyV-1-F is identical to nt 5775 to 5795 and GSyV-1-R is complementary to nt 6385 to 6408 of the GSyV-1 genome. The amplicons were cloned and sequenced as described above. Comparison of these sequences among themselves and with corresponding sequences of GSyV-1 showed 96 to 99% aa sequence identity, further complementing the results obtained above. To our knowledge, this is the first report of the occurrence of viral sequences closely related to GSyV-1 in Washington vineyards. Together with other reports (1,2), this study suggests that viruses similar to GSyV-1 could be widely distributed in wine grape cultivars across grape-growing regions. References: (1) M. Rwahnih et al. Virology 387:395, 2009. (2) S. Sabanadzovic. Virology 394:1, 2009.
28
Han, J., M. A. Ellis, and F. Qu. "First Report of Grapevine leaf roll-associated virus-2 and -3 in Ohio Vineyards." Plant Disease 98, no. 2 (February 2014): 284. http://dx.doi.org/10.1094/pdis-03-13-0276-pdn.
Full textAbstract:
Grapevine leaf roll-associated viruses (GLRaVs) are a group of nine closely related viruses belonging to the Closteroviridae family that cause grapevine leaf roll disease in vineyards across the world (3). Within the continental United States, GLRaVs have been reported in the states of California, Michigan, Missouri, New York, Oregon, Washington, and Wisconsin, but not in Ohio (2,3). During 2012, grapevines with typical leaf roll symptoms were reported by owners of several Ohio vineyards. The symptoms included small, red leaves and downwardly rolled leaf margins, accompanied by tiny grape clusters with few fruits. A total of 20 symptomatic leaf samples were collected from two sites about 300 miles apart within Ohio, namely Valley Vineyards (cultivars Vidal Blanc and Fronterac) and South River Winery (cultivar Cabernet Franc). Total RNA was extracted from the samples using a previously reported procedure (1) and subjected to reverse transcription (RT)-PCR using specific primers for five known grapevine viruses including GLRaV-1 (1F: 5′-ACCTGGTTGAACGAGATCGCTT and 1R: 5′-GTAAACGGGTGTTCTTCAATTCTCT), GLRaV-2 [2F(FQ): 5′-GCTCCTAACGAGGGTATAGAAG and 2R(FQ): 5′-AGAGCGTACATACTCGCGAACAT], GLRaV-3 [3F(FQ): CAAGTGCTCTAGTTAAGGTCAG and 3R(FQ): 5′-CGGAACGTCGGTTCATTTAGA], Grapevine fan leaf virus (GFLVR1-F: 5′-TGAGATTAGTCATGGAGCAGCTT and GFLVR1-R: 5′-GGATAGACGTCTGGTTGATTTTG), and Tobacco ring spot virus (TRSVR1-1255F: 5′-GAGTGTTGTGCAATTATCT-GCATA and TRSVR1-1844R: 5′-CAAAGATGCCAAGAAAAGTTGCAAG). A 295-bp fragment of a grapevine actin cDNA (primers VvACT-F: 5′-ATCTCCATGTCAACCAAACTGAG and VvACT-R: 5′-GACAGAATGAGCAAGGAAATCAC) was used as a positive control for RT-PCR. The samples tested negative for GFLV, TRSV, or GLRaV-1 with our primer sets. However, four of the samples were positive for GLRaV-2, and 12 positive for GLRaV-3, as evidenced by the detection of PCR fragments of expected sizes (404 and 344 bp, respectively). All samples positive for GLRaV-2 were from a single field, whereas samples positive for GLRaV-3 were from both vineyards examined. The identities of GLRaV-2 and -3 were further confirmed by directly sequencing one GLRaV-2 and two GLRaV-3 (one from each location) PCR fragments from both ends. The 404 bp GLRaV-2-specific fragment shared 95 to 98% sequence identity with various GLRaV-2 isolates whose sequences were deposited at the GenBank. Similarly, the two 344-bp GLRaV-3 fragments share a 95 to 97% identity with known GLRaV-3 isolates. Notably, the sequences of the two GLRaV-3-specific fragments derived from two vineyards are not identical (97% identity), suggesting these two isolates might have different origins. As these viruses are known to be recalcitrant to mechanical transmission, we did not attempt to transmit these viruses to healthy plants. In summary, our results report for the first time the detection of GLRaV-2 and -3 in Ohio, suggesting that these two viruses are associated with the observed leaf roll symptoms, hence should be part of an effective management plan for grapevine viral diseases in the state. References: (1) C. Louime et al. Eur. J. Sci. Res. 22:232, 2008. (2) S. Lunden and W. Qiu. Plant Dis. 96:462, 2012. (3) A. M. Sharma et al. PLoS One 6:e26227, 2011.
29
Fernandes, Maria Herlândia de Araújo, José Eudes de Morais Oliveira, Valmir Antônio Costa, and Karen Oliveira de Menezes. "Coccidoxenoides perminutus parasitizing Planococcus citri on vine in Brazil." Ciência Rural 46, no. 7 (July 2016): 1130–33. http://dx.doi.org/10.1590/0103-8478cr20150357.
Full textAbstract:
ABSTRACT: From those of the mealybug family, the citrus mealybug, Planococcus citriRisso, 1813 (Hemiptera: Pseudococcidae) is frequently held responsible for various diseases occurring in vineyards. This is a first time report in Brazil, on the occurrence of a parasitoid controlling P. citri. In our search for the natural enemies of P. citri, bunches of grapes with the vine were collected every week for one month, in those regions where table grapes were produced, like Petrolina, Pernambuco, Brazil. In these samples, among the natural pest infestations Coccidoxenoides perminutusGirault, 1915 (Hymenoptera: Encyrtidae) was the only natural enemy species reported. In this research, we attempted to study the potential of parasitism as well as the strategies that this natural agent uses in pest control.
30
Vigne, Emmanuelle, Marc Bergdoll, Sébastien Guyader, and Marc Fuchs. "Population structure and genetic variability within isolates of Grapevine fanleaf virus from a naturally infected vineyard in France: evidence for mixed infection and recombination." Journal of General Virology 85, no. 8 (August 1, 2004): 2435–45. http://dx.doi.org/10.1099/vir.0.79904-0.
Full textAbstract:
The nematode-borne Grapevine fanleaf virus, from the genus Nepovirus in the family Comoviridae, causes severe degeneration of grapevines in most vineyards worldwide. We characterized 347 isolates from transgenic and conventional grapevines from two vineyard sites in the Champagne region of France for their molecular variant composition. The population structure and genetic diversity were examined in the coat protein gene by IC-RT-PCR-RFLP analysis with EcoRI and StyI, and nucleotide sequencing, respectively. RFLP data suggested that 55 % (191 of 347) of the isolates had a population structure consisting of one predominant variant. Sequencing data of 51 isolates representing the different restrictotypes confirmed the existence of mixed infection with a frequency of 33 % (17 of 51) and showed two major predominant haplotypes representing 71 % (60 of 85) of the sequence variants. Comparative nucleotide diversity among population subsets implied a lack of genetic differentiation according to host (transgenic vs conventional) or field site for most restrictotypes (17 of 18 and 13 of 18) and for haplotypes in most phylogenetic groups (seven of eight and six of eight), respectively. Interestingly, five of the 85 haplotypes sequenced had an intermediate divergence (0·036–0·066) between the lower (0·005–0·028) and upper range (0·083–0·138) of nucleotide variability, suggesting the occurrence of homologous RNA recombination. Sequence alignments clearly indicated a mosaic structure for four of these five variants, for which recombination sites were identified and parental lineages proposed. This is the first in-depth characterization of the population structure and genetic diversity in a nepovirus.
31
Ben Moussa, I. E., P. Lemoyne, C. Beaulieu, J. Kits, and M. L. Fall. "A first Canadian and three new Québec records of Cicadellidae (Hemiptera) in grapevine (Vitaceae): potentials virus vectors." Canadian Entomologist 152, no. 6 (October 13, 2020): 797–801. http://dx.doi.org/10.4039/tce.2020.53.
Full textAbstract:
AbstractA comprehensive biovigilance programme was undertaken in 2018 to monitor potential insect vectors of viruses of grapevines (Vitis vinifera; Vitaceae) in two vineyards in Québec. Two hundred seventy-four insects were collected using yellow sticky traps and sweeping nets. Collected specimens were first classified into orders, with special attention given to the Hemiptera order, which is the main group of virus vectors. Hemipteran pests were identified to species. Among these specimens, one adult of Rossmoneura tecta McAtee (Hemiptera: Cicadellidae) was identified, the first report of this species in Canada. Empoasca vincula DeLong, Erythroneura acuticephala Robinson, and Erythroneura cymbium McAtee, three other species belonging to the same family and previously reported in other Canadian provinces, were also identified for the first time in Québec. Further investigations are being undertaken to test the ability of these species to transmit grapevine viruses.
32
Jones, T. J., F. Westover, and M. Nita. "First Report of Grapevine leafroll-associated virus-2 and -3 in Texas Vineyards." Plant Disease 98, no. 11 (November 2014): 1592. http://dx.doi.org/10.1094/pdis-06-14-0619-pdn.
Full textAbstract:
Grapevine leafroll disease (GLD), caused by the grapevine leafroll-associated viruses (GLRaVs, family Closteroviridae) is an important disease in all grapevine-growing regions of the world (2). It negatively affects vine vigor, fruit yield, and grape quality (e.g., sugar accumulation) (3). Typical disease symptoms include downward rolling of grape leaves accompanied by interveinal reddening in red-fruited varieties and interveinal chlorosis in white-fruited varieties (2). The state of Texas currently has over 275 commercial vineyards and acreage under grape production is expanding. Currently, there is limited information on the presence of either GLRaV-2 (genus Closterovirus) or GLRaV-3 (genus Ampelovirus) in this state. During the 2012 season, 19 individual, symptomatic grapevines (13 cv. Lenoir and 6 cv. Blanc du Bois) were sampled (14 petioles per vine) from one vineyard site in Richards, TX. Total nucleic acid was extracted from the samples as described before (5) and tested by RT-PCR using species specific primers to amplify a 334-bp fragment of the HSP70h gene of GLRaV-2 (L2 F: 5′-ATAATTCGGCGTACATCCCCACTT-3′ and U2 R: 5′-GCCCTCCGCGCAACTAATGACAG-3′) (1) and a 541-bp fragment of the HSP70h gene of GLRaV-3 (LC1 F: 5′-CGCTAGGGCTGTGGAAGTATT-3′ and LC2 R: 5′-GTTGTCCCGGGTACCAGATAT-3′) (4). Samples were also subjected to triple (TAS) and double (DAS) antibody sandwich ELISA for GLRaV-2 and GLRaV-3 using commercially available antibody test kits (AC Diagnostics, Fayetteville, AR). Five samples tested positive for GLRaV-2 and one for GLRaV-3, all from the variety Lenoir with no incidences of mixed infection. In addition to the RT-PCR and ELISA, the presence of GLRaV-2 and GLRaV-3 was confirmed by direct sequencing of select RT-PCR products, which was purified using the QIAquick PCR Purification kit (Qiagen Inc., CA). The sequencing took place at the Virginia Bioinformatics Institute, Virginia Polytechnic Institute and State University, Blacksburg, VA. GLRaV-2 isolate TX12 (GenBank Accession No. KF417612) and GLRaV-3 isolate TX9 (KJ545571) shared 85 to 100% and 94 to 100% nucleotide identity and 74 to 100% and 82 to 100% amino acid identity, respectively, with previously reported isolates from around the world. All samples tested negative for GLRaV-1, -4, -4 strain 5, and -4 strain 9 (4), suggesting that some of the symptomatic vines may have a different disease or abiotic disorder, such as a nutrient deficiency. To our knowledge, this is the first report of GLRaV-2 and GLRaV-3 in the state of Texas. References: (1) N. Bertazzon and E. Angelini. J. Plant Pathol. 86:283, 2004. (2) M. Fuchs et al. Plant Dis. 93:395, 2009. (3) L. Kovacs et al. Am. J. Enol. Vitic. 52:254, 2001. (4) F. Osman et al. J. Virol. Methods. 141:22, 2007. (5) A. Rowhani et al. Proc. ICVG (Adelaide). 13:82, 2000.
33
raich, susan. "The Rogue Winemaker of Bully Hill." Gastronomica 10, no. 2 (2010): 71–74. http://dx.doi.org/10.1525/gfc.2010.10.2.71.
Full textAbstract:
Walter S. Taylor (1931––2001), a home-grown hero of Finger Lakes viticulture, pioneered the movement toward independent estate wine production in upstate New York. Although his family name was a prominent one in the wine industry of the 1960s, Walter's disputes with family business practices led him to set up his own winery, Bully Hill vineyards, by 1970. There, he committed himself to using hybrid-variety, locally grown grapes to produce bona fide New York State wine. His was the first independent winery to be established after Prohibition, and he advocated for legislation which allowed other farmers to bottle and sell their own vintages. Walter trumpeted an irreverent approach to the old winemaking establishment, particularly after his family's business brought legal action against him for using the Taylor name on his own bottle labels. To protest the oppression of the Taylor company corporation, Walter staged parades, promoted his own renegade image and that of Guilt Free (his pet goat), and insisted that wine must be produced with care and drunk with cheer. Walter's own artwork decorates Bully Hill bottles, and the winery shares his full-bodied spirit with thousands of visitors to this day.
34
Steenwerth, Kerri L., Ian Morelan, Ruby Stahel, Rosa Figueroa-Balderas, Dario Cantu, Jungmin Lee, Ron C. Runnebaum, and Amisha T. Poret-Peterson. "Fungal and bacterial communities of ‘Pinot noir’ must: effects of vintage, growing region, climate, and basic must chemistry." PeerJ 9 (February 4, 2021): e10836. http://dx.doi.org/10.7717/peerj.10836.
Full textAbstract:
Background The geographic and temporal distributions of bacterial and fungal populations are poorly understood within the same wine grape cultivar. In this work, we describe the microbial composition from ‘Pinot noir’ must with respect to vintage, growing region, climate, and must chemistry across the states of California and Oregon, USA. Materials and Methods We sampled ‘Pinot noir’ clone 667 clusters from 15 vineyards existing in a latitudinal gradient spanning nearly 1,200 km in California and Oregon for two vintages (2016 and 2017). Regions included five American Viticultural Areas (AVA). In order from southern California to Oregon, these AVAs were Santa Barbara, Monterey, Sonoma, Mendocino, and Willamette Valley. Uninoculated grape musts were subjected to 16S rRNA gene and ITS-1 amplicon sequencing to assess composition of microbial communities. We also measured grape maturity metrics. Finally, to describe regions by precipitation and growing degree days, we queried the Parameter-elevation Regressions on Independent Slopes Model (PRISM) spatial climate dataset. Results Most of the dominant bacterial taxa in must samples were in the family Enterobacteriaceae, notably the lactic acid bacteria or the acetic acid bacteria groups, but some, like the betaproteobacterial genus Massilia, belonged to groups not commonly found in grape musts. Fungal communities were dominated by Hanseniaspora uvarum (Saccharomycetaceae). We detected relationships between covariates (e.g., vintage, precipitation during the growing season, pH, titratable acidity, and total soluble solids) and bacterial genera Gluconobacter and Tatumella in the family Enterobacteraceae, Sphingomonas (Sphingomonodaceae), Lactobacillus (Lactobacillaceae), and Massilia (Oxalobacteraceae), as well as fungal genera in Hanseniaspora, Kazachstania, Lachancea, Torulaspora in the family Saccharomycetaceae, as well as Alternaria (Pleosporaceae), Erysiphe (Erysiphaceae), and Udeniomyces (Cystofilobasidiaceae). Fungal community distances were significantly correlated with geographic distances, but this was not observed for bacterial communities. Climate varied across regions and vintages, with growing season precipitation ranging from 11 mm to 285 mm and growing degree days ranging from 1,245 to 1,846. Discussion We determined that (1) bacterial beta diversity is structured by growing season precipitation, (2) fungal beta diversity reflects growing season precipitation and growing degree days, and (3) microbial differential abundances of specific genera vary with vintage, growing season precipitation, and fruit maturity metrics. Further, the correlation between fungal community dissimilarities and geographic distance suggests dispersal limitation and the vineyard as a source for abundant fungal taxa. Contrasting this observation, the lack of correlation between bacterial community dissimilarity and geographic distance suggests that environmental filtering is shaping these communities.
35
Abelleira, A., J. P. Mansilla, V. Padilla, I. Hita, C. Cabaleiro, E. Bertolini, A. Olmos, and F. J. Legorburu. "First Report of Arabis mosaic virus on Grapevine in Spain." Plant Disease 94, no. 5 (May 2010): 635. http://dx.doi.org/10.1094/pdis-94-5-0635a.
Full textAbstract:
Arabis mosaic virus (ArMV; genus Nepovirus, family Comoviridae) is one of several nepoviruses responsible for infectious degeneration disease of grapevines in Europe (3). The first occurrence in Spain, in the summer of 2007, was found in Val de Salnés, Rias Baixas appellation, Galice on 25-year-old vines of the Albariño variety grafted onto an unidentified rootstock and showing leaf yellowing. The second finding was in the spring of 2008 in Barriobusto, Rioja appellation, Basque Country on 30-year-old vines of Tempranillo variety grafted onto 41B rootstock. In this case, no obvious foliar symptoms were observed but fruit set was very poor. Positive ELISA results were obtained at two different laboratories using antibodies to ArMV obtained from two companies (BIOREBA, Reinach, Switzerland and Sediag, Longvic, France). At a third lab, the presence of ArMV was further confirmed by reverse transcription (RT)-nested PCR using the primers described by Bertolini et al. (1). External primers ArMV 1 and ArMV 2 amplified a fragment of 340 bp from the coat protein region of the virus and internal primers ArMV i1 and ArMV i2 amplified a fragment of 203 bp. The specificity of the amplicons was subsequently confirmed by sequencing and comparison with other ArMV isolates available in the GenBank, EMBL, and DDBJ databases. Alignment performed using Blastn showed 85% nucleotide sequence identity with ArMV isolate NW (Accession No. AY017339). ELISA revealed co-infection with GLRaV-1 in Galice, GLRaV-3 in Rioja, and GFkV at both sites; these other viruses being common in their respective appellations. ArMV could be mechanically transmitted from rooted cuttings onto Chenopodium amaranticolor with an average of a 46% success rate (1:10 tissue/buffer ratio; [2]), but the range was very wide (0 to 100%) and dependent on the individual source vine. No statistical differences were found between nicotine or phosphate buffer for extraction or when using shoot tips or root tips as a source of virus (Fisher's exact test). Infection in C. amaranticolor was symptomless, but detectable by ELISA, and systemic. The Galician grapevine was an isolated plant, replanted on the spot of a dead one. Xiphinema diversicaudatum, the nematode vector of ArMV, was found in the vineyard soil. Only two ArMV-positive vines were found among 1,993 plants analyzed in Galice from 2005 to 2007 (no field data available for the second finding). In Rioja, one positive vine was found in a random sample of 74 vines from two different vineyards. Further testing of the neighboring vines indicated that one of the adjacent plants was also infected. This minimal spread since the vineyard was planted is suggestive of a lack of vectored transmission. In Spain as a whole, the virus seems to be rare and associated with the Atlantic biogeographic region. Both vineyards were planted before certified material became widely available. Currently, statutory testing of grapevine propagation material should prevent further spread. References: (1) E. Bertolini et al. Phytopathology 93:286, 2003. (2) G. P. Martelli, ed. Graft-Transmissible Diseases of Grapevines. Handbook for Detection and Diagnosis, FAO, Rome, 1993. (3) G. P. Martelli and E. Boudon-Padieu. Directory of Infectious Diseases of Grapevines and Viruses and Virus-like Diseases of the Grapevine. Bibliographic Report 1998-2004, CIHEAM, Paris, 2006.
36
Kaliterna, Joško, Tihomir Miličević, and Bogdan Cvjetković. "Grapevine Trunk Diseases Associated with Fungi from the Diaporthaceae Family in Croatian Vineyards / Identifikacija Vrsta Roda Fusarium Izoliranih S Plodova Jabuke Nakon Skladištenja." Archives of Industrial Hygiene and Toxicology 63, no. 4 (December 1, 2012): 471–79. http://dx.doi.org/10.2478/10004-1254-63-2012-2226.
Full textAbstract:
AbstractGrapevine trunk diseases (GTD) have a variety of symptoms and causes. The latter include fungal species from the family Diaporthaceae. The aim of our study was to determine Diaporthaceae species present in the woody parts of grapevines sampled from 12 vine-growing coastal and continental areas of Croatia. The fungi were isolated from diseased wood, and cultures analysed for phenotype (morphology and pathogenicity) and DNA sequence (ITS1, 5.8S, ITS2). Most isolates were identified as Phomopsis viticola, followed by Diaporthe neotheicola and Diaporthe eres. This is the first report of Diaporthe eres as a pathogen on grapevine in the world, while for Diaporthe neotheicola this is the first report in Croatia. Pathogenicity trials confirmed Phomopsis viticola as a strong and Diaporthe neotheicola as a weak pathogen. Diaporthe eres turned out to be a moderate pathogen, which implies that the species could have a more important role in the aetiology of GTD.
37
Choueiri, Elia, Fouad Jreijiri, Paulette Chlela, Valérie Mayet, Gwénaelle Comont, Jean-Michel Liminana, Lizel Mostert, Michael Fischer, and Pascal Lecomte. "Fungal community associated with grapevine wood lesions in Lebanon." OENO One 48, no. 4 (December 31, 2014): 293. http://dx.doi.org/10.20870/oeno-one.2014.48.4.1696.
Full textAbstract:
<p style="text-align: justify;"><strong>Aims</strong>: To detect and identify the cultivable microorganisms putatively associated with esca disease in representative Lebanese vineyards.</p><p style="text-align: justify;"><strong>Methods and results</strong>: Two field surveys were conducted in Lebanon in 2005 and 2007 to study the fungal community associated with grapevine wood lesions. A total of 68 vines showing typical esca symptoms were randomly sampled in 17 vineyards and cross sections were obtained of cordons and trunks. The shape and type of inner necrosis and discoloration were examined and isolations were made from the symptomatic wood. Isolation results showed that inner necrosis and isolated fungi were similar to those previously found elsewhere, namely in Central Europe or Mediterranean countries. Additionally, three methods for numerical evaluation of micro-organisms found were compared.</p><p style="text-align: justify;"><strong>Conclusion</strong>: Most fungal pathogens generally associated with grapevine trunk diseases were detected, of which the basidiomycete <em>Fomitiporia mediterranea</em> and species of the ascomycete family <em>Botryosphaeriaceae</em> were the most frequently encountered. Additionally, a large diversity of other wood colonizing micro-organisms was detected. The putative role of some of the obtained micro-organisms in the process of wood degradation related to esca disease is discussed.</p><p style="text-align: justify;"><strong>Significance and impact of the study</strong>: This isolation study is presently the most completed that was carried out with grapevine wood samples collected in Lebanon. Besides, it is the first to provide isolation results based on a classification of inner necrosis in five categories and to compare three criteria for numerical evaluation. This study also tends to further highlight that <em>Botryosphaeriaceae</em> species are common wood inhabiting fungi that should be associated with esca.</p>
38
Oruç, Esen, Rüstem Cangi, and Aysel Ergün. "Salamuralık Yaprak Konusunda Tüketici Tercihleri: Tokat İli Örneği." Turkish Journal of Agriculture - Food Science and Technology 8, no. 3 (March 18, 2020): 668. http://dx.doi.org/10.24925/turjaf.v8i3.668-677.3172.
Full textAbstract:
Production and consumption of pickled vine leaves have been on increase in Tokat region of Turkey. A literature review yielded no study on consumption potential, consumer preferences, preferences and complaints about this product in the region. It has been considered that conclusions drawn from experience and ideas of consumers about pickled vine leaves could help the production sector during production processes. Aim of the present study was to find out consumption potential and consumer preferences for pickled vine leaves in Central, Erbaa, Niksar, Zile and Turhal Districts of Tokat Province through a questionnaire survey. Data from a face-to-face questionnaire carried out in Tokat Province constituted the main material of the study. Sample size of the research (383) were calculated using Proportional Sample Size. Data obtained were evaluated using per cent distributions and other descriptive statistics. All of women interviewed and their family members consumed pickled vine leaves. Average yearly consumption was 13.9 kg. Questionnaire data showed that most individuals obtained leaves directly from producers or they produced their pickled leaves from their own vineyards. More than half of consumers interviewed considered the price of pickled vine leaves on the market was fair.
39
Peden, Ann R. "Letters From Peplau." Journal of the American Psychiatric Nurses Association 24, no. 5 (March 13, 2018): 444–51. http://dx.doi.org/10.1177/1078390318763943.
Full textAbstract:
BACKGROUND: Dr. Hildegard Peplau, considered to be our first modern Nurse theorist and the Mother of Psychiatric Nursing, was a prolific writer, engaging in correspondence with colleagues and students who sought her professional and theoretical expertise. Through these letters, she influenced psychiatric nursing while maintaining a broad international network of professional colleagues. OBJECTIVES: An analysis of letters, written between 1990 and 1998, provides insights into Peplau’s last decade of professional life and a model of how to support the next generation of nurse scholars. DESIGN: Using content analysis, 24 letters received between 1990 and 1998 were read, reread, and coded. Recurring themes were identified. RESULTS: Three themes were identified. These include Peplau, the Person: Living a Life of Professional Balance; Lighting a Spark: Investing in the Next Generation; and Work in the Vineyards of Nursing: Maintaining a Life of Scholarship. The letters depict Peplau’s keen intellect, her wide professional network, her leisure time spent with family and friends, and her own work to assure that her theoretical legacy continued. CONCLUSIONS: Peplau’s insights continue to be relevant as psychiatric mental health nursing leaders engage in activities to support the next generation of scholars and leaders.
40
Carlucci, Antonia, Francesca Cibelli, Francesco Lops, and Maria Luisa Raimondo. "Characterization of Botryosphaeriaceae Species as Causal Agents of Trunk Diseases on Grapevines." Plant Disease 99, no. 12 (December 2015): 1678–88. http://dx.doi.org/10.1094/pdis-03-15-0286-re.
Full textAbstract:
Botryosphaeriaceae spp. have a cosmopolitan distribution and a wide range of plant hosts. Over the last 15 years, worldwide, 21 species of this family have been associated with grapevine trunk diseases that cause cankers and dieback on grapevines. Here, we surveyed vineyards of Vitis vinifera ‘Lambrusco’, ‘Sangiovese’, and ‘Montepulciano’ in three areas of the Foggia province (Cerignola, Foggia, and San Severo) in southern Italy. Wood samples from grapevines showing general decline, dieback, cankers, and wood and foliar discoloration yielded 344 fungal isolates identified as Botryosphaeriaceae spp. A phylogenetic study combining internal transcribed spacer and translation elongation factor 1-α sequences of 60 representative isolates identified nine botryosphaeriaceous species: Botryosphaeria dothidea, Diplodia corticola, D. mutila, D. seriata, Dothiorella iberica, Do. sarmentorum, Lasiodiplodia citricola, L. theobromae, and Neofusicoccum parvum. Pathogenicity tests confirmed that all nine species cause canker and dieback of grapevines. However, this is the first report of L. citricola as causal agent of wood cankers and dieback of grapevine. To date, including L. citricola, there are 25 botryosphaeriaceous species associated with V. vinifera worldwide, of which 12 have been reported for grapevines in Italy.
41
Tixier, Marie-Stéphane, Victor Dos Santos Vicente, Martial Douin, Carlo Duso, and Serge Kreiter. "Great molecular variation within the species Phytoseius finitimus (Acari: Phytoseiidae): implications for diagnosis decision within the mite family Phytoseiidae." Acarologia 57, no. 3 (May 5, 2017): 493–515. http://dx.doi.org/10.24349/acarologia/20174168.
Full textAbstract:
Molecular markers are increasingly used for species identification and new taxa description. However, rules to determine frontiers between populations and species are not clear depending on taxa considered. For mites, few studies deal with molecular diagnoses, making rules for associated decision difficult. The present study focuses on a species of the predatory mite family Phytoseiidae (Phytoseius finitimus), considered for biological control of mites and small insect pests in fruit orchards and vineyards in the Mediterranean basin. This paper aims to elucidate the causes of great molecular variations and questions the occurrence of cryptic species. Molecular (12S rRNA, CytB mtDNA, ITSS) and morphological analyses were performed on four populations collected in Corsica and Italy in crops (vine and kiwi) and in an uncultivated environment (Viburnum lantana). Different methods for identifying species have been used (tree approaches, distances and ABGD algorithms). A reference database of distances within and between Phytoseiidae species has been elaborated to inform the present question and to assist with further diagnosis within Acari. Mitochondrial DNA analyses show that specimens from V. lantana were well separated from the three other populations with high genetic distances, suggesting the existence of a cryptic species. Molecular ITSS analyses coupled with morphological features show however that the four populations seem to belong to the same species. The great mitochondrial polymorphism is discussed in regards to: (i) genetic distances reported for Phytoseiidae species and (ii) potential biological differences between populations (cultivated versus uncultivated areas). This study clearly emphasizes the necessity of integrative taxonomy approaches for diagnosis decisions. Furthermore, based on the polymorphism herein detected, maximal intraspecific distances are proposed (9, 23 and 2.8 % for 12S rRNA, CytB mtDNA and ITSS) for diagnosis decisions within Phytoseiidae. Further statistical analyses are however clearly required to determine statistical error for general and reliable decision making.
42
Rolshausen, P. E., F. Trouillas, and W. D. Gubler. "Identification of Eutypa lata by PCR-RFLP." Plant Disease 88, no. 9 (September 2004): 925–29. http://dx.doi.org/10.1094/pdis.2004.88.9.925.
Full textAbstract:
Eutypa lata is a vascular canker pathogen of woody plants commonly diagnosed by isolating the pathogen from infected tissue. Related fungi from the same family, the Diatrypaceae, also have been found in association with grapevine in Californian vineyards. An in situ polymerase chain reaction (PCR) method has been developed for detection of E. lata in infected wood tissue. However, our results indicate that this method also would amplify other Diatrypaceous fungi, which could potentially lead to an incorrect diagnosis. Therefore, we developed a PCR-restriction fragment length polymorphism (PCR-RFLP) assay. The internal transcribed spacer (ITS)1/5.8S/ITS2 ribosomal DNA region was amplified by PCR using universal primers, and RFLP patterns were determined after digestion with AluI. The restriction profiles obtained served to distinguish E. lata from wood trunk pathogens of grapevine (Phomopsis viticola, Botryodiplodia sp., Phaeoacremonium aleophilum, and Phaeomoniella chlamydospora), Diatrypaceous fungi (Diatrype sp., Diatrypella sp., Eutypella vitis, and Eutypa leptoplaca), and Cryptovalsa sp. found on dead wood of grapevine, and other Eutypa spp. (E.petrakii var. hederae, E. astroidea, E. crustata, and E. lejoplaca), with the exception of E. armeniacae, which we regard as a synonym for E. lata, and E. laevata, which has not been found on grapevine.
43
Vargas-Asencio, J., M. Al Rwahnih, A. Rowhani, F. Celebi-Toprak, J. R. Thompson, M. Fuchs, and K. L. Perry. "Limited Genetic Variability Among American Isolates of Grapevine virus E from Vitis spp." Plant Disease 100, no. 1 (January 2016): 159–63. http://dx.doi.org/10.1094/pdis-05-15-0556-re.
Full textAbstract:
A survey for the presence of Grapevine virus E (GVE, genus Vitivirus, family Betaflexiviridae) in vineyards in New York and California was conducted using macroarray hybridization or reverse-transcription polymerase chain reaction (RT-PCR) assays. In New York, GVE was detected in 10 of 46 vines of Vitis labrusca, one V. riparia, and one Vitis hybrid. All GVE-infected New York vines were coinfected with Grapevine leafroll-associated virus-3. In California, GVE was detected in 8 of 417 vines of V. vinifera. All GVE-infected California vines were also coinfected by one of the leafroll-associated viruses and other vitiviruses. In order to assess the genetic diversity among GVE isolates, a viral cDNA was amplified by RT-PCR, and a 675-nucleotide region that included the 3′ terminus of the coat protein gene, a short intergenic region, and the 5′ terminus of the putative nucleic acid binding protein gene was sequenced. All 20 GVE isolates sequenced in this study were very closely related, with >98% nucleotide identity to the SA94 isolate from South Africa. These findings confirm the presence of GVE in major grape-growing regions of the United States and indicate a very low level of genetic diversity.
44
Bressan, Alberto, Denis Clair, Olivier Sémétey, and Elisabeth Boudon-Padieu. "Insect Injection and Artificial Feeding Bioassays to Test the Vector Specificity of Flavescence Dorée Phytoplasma." Phytopathology® 96, no. 7 (July 2006): 790–96. http://dx.doi.org/10.1094/phyto-96-0790.
Full textAbstract:
The specificity of vector transmission of Flavescence dorée phytoplasma (FDP) was tested by injecting FDP, extracted from laboratory-reared infective Euscelidius variegatus, into specimens of 15 other hemipteran insect species collected in European vineyards. Concentrations of viable phytoplasma extracts and latency in vectors were monitored by injection of healthy-reared E. variegatus leafhoppers. Based on these preliminary results, insects were injected by using phytoplasma extracts that ensured the highest rate of FDP acquisition and transmission by E. variegatus. Transmission into an artificial diet through a Parafilm membrane about 3 weeks after insect injection was attempted. FDP-injected insects that belonged to 15 hemipteran species were confined in cages and fed through the membrane for a 4- to 5-day inoculation access period. FDP DNA was detected by polymerase chain reaction (PCR) in the feeding buffer fed upon by Anoplotettix fuscovenosus, Aphrodes makarovi,E. variegatus, and Euscelis incisus. PCR amplification with specific primers detected FDP DNA in injected insects of all test insect species. Band intensity was positively correlated with the transmissibility of FDP. Transmission of FDP to plants by feeding was confirmed for Anoplotettix fuscovenosus, E. variegatus, and Euscelis incisus, but not for Aphrodes makarovi. Our results suggest that vector competency of FDP is restricted to specimens belonging to the family Cicadellidae, subfamily Deltocephalinae.
45
Sawicki, Mélodie, Marine Rondeau, Barbara Courteaux, Fanja Rabenoelina, Gea Guerriero, Eric Gomès, Ludivine Soubigou-Taconnat, et al. "On a Cold Night: Transcriptomics of Grapevine Flower Unveils Signal Transduction and Impacted Metabolism." International Journal of Molecular Sciences 20, no. 5 (March 5, 2019): 1130. http://dx.doi.org/10.3390/ijms20051130.
Full textAbstract:
Low temperature is a critical environmental factor limiting plant productivity, especially in northern vineyards. To clarify the impact of this stress on grapevine flower, we used the Vitis array based on Roche-NimbleGen technology to investigate the gene expression of flowers submitted to a cold night. Our objectives were to identify modifications in the transcript levels after stress and during recovery. Consequently, our results confirmed some mechanisms known in grapes or other plants in response to cold stress, notably, (1) the pivotal role of calcium/calmodulin-mediated signaling; (2) the over-expression of sugar transporters and some genes involved in plant defense (especially in carbon metabolism), and (3) the down-regulation of genes encoding galactinol synthase (GOLS), pectate lyases, or polygalacturonases. We also identified some mechanisms not yet known to be involved in the response to cold stress, i.e., (1) the up-regulation of genes encoding G-type lectin S-receptor-like serine threonine-protein kinase, pathogen recognition receptor (PRR5), or heat-shock factors among others; (2) the down-regulation of Myeloblastosis (MYB)-related transcription factors and the Constans-like zinc finger family; and (3) the down-regulation of some genes encoding Pathogen-Related (PR)-proteins. Taken together, our results revealed interesting features and potentially valuable traits associated with stress responses in the grapevine flower. From a long-term perspective, our study provides useful starting points for future investigation.
46
Kita, Ryosuke, Sandeep Venkataram, Yiqi Zhou, and Hunter B. Fraser. "High-resolution mapping of cis-regulatory variation in budding yeast." Proceedings of the National Academy of Sciences 114, no. 50 (November 28, 2017): E10736—E10744. http://dx.doi.org/10.1073/pnas.1717421114.
Full textAbstract:
Genetic variants affecting gene-expression levels are a major source of phenotypic variation. The approximate locations of these variants can be mapped as expression quantitative trait loci (eQTLs); however, a major limitation of eQTLs is their low resolution, which precludes investigation of the causal variants and their molecular mechanisms. Here we report RNA-seq and full genome sequences for 85 diverse isolates of the yeast Saccharomyces cerevisiae—including wild, domesticated, and human clinical strains—which allowed us to perform eQTL mapping with 50-fold higher resolution than previously possible. In addition to variants in promoters, we uncovered an important role for variants in 3′UTRs, especially those affecting binding of the PUF family of RNA-binding proteins. The eQTLs are predominantly under negative selection, particularly those affecting essential genes and conserved genes. However, applying the sign test for lineage-specific selection revealed the polygenic up-regulation of dozens of biofilm suppressor genes in strains isolated from human patients, consistent with the key role of biofilms in fungal pathogenicity. In addition, a single variant in the promoter of a biofilm suppressor, NIT3, showed the strongest genome-wide association with clinical origin. Altogether, our results demonstrate the power of high-resolution eQTL mapping in understanding the molecular mechanisms of regulatory variation, as well as the natural selection acting on this variation that drives adaptation to environments, ranging from laboratories to vineyards to the human body.
47
Rwahnih, Maher Al, Ashita Dave, Michael M. Anderson, Adib Rowhani, Jerry K. Uyemoto, and Mysore R. Sudarshana. "Association of a DNA Virus with Grapevines Affected by Red Blotch Disease in California." Phytopathology® 103, no. 10 (October 2013): 1069–76. http://dx.doi.org/10.1094/phyto-10-12-0253-r.
Full textAbstract:
In the Napa Valley of California, vineyards of ‘Cabernet Franc’ (CF) clone 214, ‘Cabernet Sauvignon’ clone 337, and ‘Zinfandel’ clone 1A (Z1A) with grapevines exhibiting foliar symptoms of red blotches, marginal reddening, and red veins that were accompanied by reduced sugar accumulation in fruit at harvest were initially suspected to be infected with leafroll-associated viruses. However, reverse-transcription polymerase chain reaction (PCR) tests were negative for all known leafroll-associated viruses, with the exception of Grapevine leafroll-associated virus 2 in Z1A. Metagenomic analysis of cDNA libraries obtained from double-stranded RNA enriched nucleic acid (NA) preparations from bark scrapings of dormant canes on an Illumina platform revealed sequences having a distant relationship with members of the family Geminiviridae. Sequencing of products obtained by PCR assays using overlapping primers and rolling circle amplification (RCA) confirmed the presence of a single circular genome of 3,206 nucleotides which was nearly identical to the genome of a recently reported Grapevine cabernet franc-associated virus found in declining grapevines in New York. We propose to call this virus “Grapevine red blotch-associated virus” (GRBaV) to describe its association with grapevine red blotch disease. Primers specific to GRBaV amplified a product of expected size (557 bp) from NA preparations obtained from petioles of several diseased source vines. Chip bud inoculations successfully transmitted GRBaV to test plants of CF, as confirmed by PCR analysis. This is the first report of a DNA virus associated with red blotch disease of grapevines in California.
48
Mráv, Zsolt. "A Late Roman Luxury Villa in Nagyharsány, at the Feet of the Szársomlyó Mountain." Hungarian Archaeology 10, no. 1 (2021): 11–21. http://dx.doi.org/10.36338/ha.2021.1.2.
Full textAbstract:
Those who visit the tourist attractions of the Villány–Siklós wine route may not even suspect that a ruin of a high-status Roman villa is hiding under the picturesque landscape with vineyards at the foot of the Szársomlyó Mountain. The Mediterranean beauty and climate of this region attracted the late imperial elite of the Roman Empire, among whom an influential, senatorial family built its luxury villa here. This villa only revealed its significance and treasures slowly. After the excavation of its bathhouse, an unfortunately commissioned deep ploughing twisted large pieces of the mosaic floors out of the ground. After a long pause, the Hungarian National Museum continued the investigation of the site in 2016. The excavations brought to light the villa’s banquet hall, the floor of which was once covered with colourful mosaics representing the highest quality of Roman mosaic art. Masterpieces of Roman glass craftmanship – pieces of a wine set – were also found here. The villa of Nagyharsány plays an important role in the research of the Seuso Treasure too. The luxury reflected by the interior decoration and the artefacts of the banquet hall proved that the educated and wealthy imperial aristocracy was present in late Roman Pannonian provinces, the members of which could afford a set of silver tableware comparable to the Seuso Treasure in quality, understood the literary and visual culture based on the classical education of the elite, and spoke its sophisticated language.
49
Rouxel, Mélanie, Pere Mestre, Anton Baudoin, Odile Carisse, Laurent Delière, Michael A. Ellis, David Gadoury, et al. "Geographic Distribution of Cryptic Species of Plasmopara viticola Causing Downy Mildew on Wild and Cultivated Grape in Eastern North America." Phytopathology® 104, no. 7 (July 2014): 692–701. http://dx.doi.org/10.1094/phyto-08-13-0225-r.
Full textAbstract:
The putative center of origin of Plasmopara viticola, the causal agent of grape downy mildew, is eastern North America, where it has been described on several members of the family Vitaceae (e.g., Vitis spp., Parthenocissus spp., and Ampelopsis spp.). We have completed the first large-scale sampling of P. viticola isolates across a range of wild and cultivated host species distributed throughout the above region. Sequencing results of four partial genes indicated the presence of a new P. viticola species on Vitis vulpina in Virginia, adding to the four cryptic species of P. viticola recently recorded. The phylogenetic analysis also indicated that the P. viticola species found on Parthenocissus quinquefolia in North America is identical to Plasmopara muralis in Europe. The geographic distribution and host range of five pathogen species was determined through analysis of the internal transcribed spacer polymorphism of 896 isolates of P. viticola. Among three P. viticola species found on cultivated grape, one was restricted to Vitis interspecific hybrids within the northern part of eastern North America. A second species was recovered from V. vinifera and V. labrusca, and was distributed across most of the sampled region. A third species, although less abundant, was distributed across a larger geographical range, including the southern part of eastern North America. P. viticola clade aestivalis predominated (83% of isolates) in vineyards of the European winegrape V. vinifera within the sampled area, indicating that a single pathogen species may represent the primary threat to the European host species within eastern North America.
50
Beuve, M., T. Candresse, M. Tannières, and O. Lemaire. "First Report of Grapevine redglobe virus (GRGV) in Grapevine in France." Plant Disease 99, no. 3 (March 2015): 422. http://dx.doi.org/10.1094/pdis-10-14-1009-pdn.
Full textAbstract:
The isometric virus Grapevine redglobe virus (GRGV), was first described on grapevine cv. Red Globe in southern Italy in 2000 (3) and later in Greece and California. GRGV belongs to the genus Maculavirus in the family Tymoviridae. These viruses are thought to be disseminated through propagation and grafting, as no vectors or seed transmission are known to date. A partial sequence (2,006 nucleotides [nt]) encompassing the 3′ end of the replicase, the coat protein, and P17 genes, was obtained in 2003 (1). GRGV infections are apparently symptomless (2). In 2014, GRGV was identified by Illumina sequencing of total RNAs extracted from a Vitis vinifera cv. Cabernet franc (CF) vine grafted onto Gravesac in a vineyard of the Bordeaux region in France. This Cabernet franc plant displayed fanleaf-like degeneration symptoms associated with Tomato black ring virus (TBRV) infection. It had been collected in 2010 and maintained since in a greenhouse. The partial contigs assembled from the Illumina reads (552 and 430 nt, both in the putative replicase gene, KM491303 and KM491304) showed 85.9 and 86.3% nt identity with the partial sequence of a GRGV Italian isolate (AF521577), respectively. Total RNA extracts from leaves of 18 plants of cv. Cabernet franc from the same plot, collected in 2014, were analyzed by RT-PCR using specific primers RG-CF-F1 (5′-GAATTCGCTGTCGGCCACTC-3′) and RG-CF-R1 (5′-AGTGAGAGGAGAGATTCCATC-3′) designed on the basis of the alignment of the partial sequences of GRGV-CF and the Italian isolate (AF521577). Fifteen (83%) of the plants gave strong positive amplification for GRGV. Given the mixed viral infection status of these vines, it was not possible to associate a specific symptomatology with the presence of GRGV. Two RT-PCR amplicons were directly sequenced and showed 91.5 and 91.7% identities, respectively, with the reference GRGV-CF sequence. To our knowledge, this is the first report of GRGV in France. Further studies will be necessary to determine the prevalence of GRGV in the French vineyards and varieties, including rootstocks, and its possible threat to the grapevine industry. Studies are also needed to assess the pathogenicity of GRGV. Similarly to its close relative, Grapevine fleck virus, does it induce latent or semi-latent infections in Vitis vinifera and rootstock hybrids, influencing vigor, rooting ability, and graft compatibility? References: (1) N. Abou Ghanem-Sabanadzovic et al. Virus Genes 27:11, 2003. (2) G. P. Martelli et al. Arch. Virol. 147:1847, 2002. (3) S. Sabanadzovic et al. Arch. Virol. 145:553, 2000.