Journal articles on the topic 'Fresno County Free Library'

In spring 2016, the President’s Office at California State University-Fresno (part of the California State University system) offered grant opportunities for academic departments to create a community engagement program for students interested in supporting the Fresno community at large. Known as the Touch the Community project, the program solicited proposals that focused on a community concern and on how to address this issue. Several proposals were selected and funded ($2,000) by the President’s Office for the duration of two academic semesters. Some of these grant projects involved service-learning components: building computer labs, creating ESL programs, and engaging with K–12 students.

The original Assignment Calculator from the University of Minnesota is a free open-source tool which helps students manage time and organize the steps of a research project.1 It provides a schedule and timeline for each step, and includes tips and outside links to more information. The head of instruction and outreach services in the Henry Madden Library recognized the value of this popular tool, but felt we could expand on its potential for students and faculty here at California State University-Fresno. We accomplished this by tailoring it to our own library and campus resources, staff and services, thus making it . . .

A growing body of research points to the positive impact parents can have on their children when they read to them on a regular basis. This includes improved future academic performance as well as the promotion of important social and emotional development skills.The Salt Lake County (UT) Library wanted to better understand the impact a free book program can have on reading frequency. Staff at the county library’s Byington Reading Room put together a thirteen-question survey in both English and Spanish for parents of children receiving a free book. The survey was distributed over a four-week period in the winter of 2018, and 183 surveys were completed by parents visiting the reading room.

Abstract RTKLIB which is an open source Global Navigation Satellite Systems (GNSS) software has gained rapid acceptance among Surveying professionals thanks to recent developments in UAS (Unmanned Aerial System) technology. RTKLIB enables standard and precise point positioning (PPP) in real-time and post-processing modes to be performed. As such, UAS users utilize this software to analyze GNSS data collected by GNSS systems on UAS. By being versatile and free, RTKLIB is commonly used by many; however, it is not the only freely available GNSS software. There are also freely available online GNSS data processing software running on servers. These online GNSS data processing services provide data processing in static, kinematic and rapid static modes. Because UAS collect data in kinematic mode, in this study, kinematic data processing by aforementioned software (CSRS-PPP, GAPS and APPS) is analyzed. The results coming from these software are compared against the results produced by photogrammetric software (Agisoft Metashape and Pix4Dmapper). The aim of this practical project is to produce generalizable knowledge about the performance of these software. It is found out that RTKLIB and CSRS-PPP achieved cm-level precision. Yet, GAPS and APPS achieved dm-level precision both for horizontal and vertical coordinates. This study demonstrates the precision and accuracy expected from these software if they are used for kinematic GNSS data processing.

Background: In 2020 the Health Science Center Libraries (HSCL) at the University of Florida collaborated with the Okeechobee County Public library (OCPL) on their plan to install Little Free Libraries (LFLs) within their community. It was agreed that the HSCL would provide consumer health-related materials for the Little Free Libraries and training with the goal of improving health literacy, precision medicine, and increasing rural access to consumer health materials and services. Case Presentation: Using census data, the County Health Improvement Plan, and OCPL circulation data the team identified minority population groups, potential accessibility issues, and local consumer health information needs and barriers to select appropriate resources. Additionally, partnerships were created with the local Health Department, Parks and Recreation services, the Rotary Club, and other local organizations to make the project a success. A total of 424 books were selected for the LFLs and 40 unique online resources were selected, printed, and shipped to OCPL to be used during LFL reference sessions. Technology was purchased to assist OCPL with their planned community health reference outreach sessions. HSCL created and provided online training on facilitating consumer health outreach, conducting health information reference services, and promoting community engagement for OCPL. Discussion: LFLs have become an important resource for lower-income rural families in Okeechobee. There are 7 LFLs in Okeechobee County, with a goal of eventually establishing 15 total to provide vital health resources and books. Over 2,456 items have been circulated among the 7 LFLs since May 2020. Overall, the project has been successful with positive feedback received from the community and with OCPL planning to continue to expand the project.

Purpose The purpose of this paper is to describe how the Hudson County Community College Library hosted a Super Smash Bros. for Wii U Tournament as part of its Fall 2015 and Spring 2016 programming, and discuss what it learned from hosting the event. Design/methodology/approach This paper details how a community college library planned, hosted and learned from its experience running a Super Smash Bros. for the Wii U Tournament. It will also describe how the library continued to use this experience to plan additional video game-based programming. Findings The Super Smash Bros. for the Wii U Tournament was generally well received by student attendees. However, student feedback revealed a preference for less-competitive “friendly” events instead of tournaments. Students also requested the option of having several games available instead of one. Originality/value Thus far, there has been little research on academic or community college libraries organizing video game-based programming and activities event. There have also been few studies about whether gaming events work better in libraries as tournaments or “free play” activities.

Information centers play a very crucial role in ensuring that the community has access to the right information to suit its various information needs evidenced by several research carried out on information centers. The rolling out of Free Primary Education (FPE) in Kenya, in January 2003 led to overwhelming increase in primary school enrollment. This exerted pressure on educational facilities and created new challenges including inadequate information material for educational purposes. Community information centers whose role is to provide information services and resources to their respective communities have therefore an important role to play including provision of information services to supplement what the schools in these areas have including giving specific services and resources aimed at enhancing the performance of those pupils doing exams. Thus, this study purposed to assess provision of services and resources at Kimilili Community Library in Bungoma, Kenya for enhancing the performance of class 8 pupils. The study assessed the services and policies, available resources and the challenges encountered. The study was anchored on S. R. Ranganathan's laws of library science and Piage. Descriptive research design was used, and questionnaires and interview schedules were employed in data collection from 84 pupils, 2 librarians and 2 Ministry of Education officers. The study used statistical package for social science (SPSS), version 1.0 2023 for data analysis. The findings are presented in tables. The study established that Kimilili Community Library has various information resources including textbooks, novels, and atlases some in print and others in digital formats. If well utilized these resources would enhance the performance of class 8 pupils. The library also provides various services to pupils, including organized library visits and information literacy.

Purpose This last edition of the column begins with the disadvantages of sleeping in the library and ends with 60-year-old overdue loans, but in between are alternate ways of using different technology to access information! Design/methodology/approach Sleeping in the library is trending on the internet, not because it is a nice pastime, but because it is one of the most viral trends of the year. Findings The real advice is that falling asleep in public places such as libraries is not good. A lot of wild reactions to the picture of a girl sleeping in a university library has caused all sorts, as “photo-shoppers”have had a field day, putting the sleeper in all sorts of situations – in Drake’s “Hotline Bling” music video, dancing with Michael Jackson and more. Social implications Derrick Lewis on 26th August reported that an Orange County library had made wi-fi devices available for rural internet users. Originality/value It is helping rural families make faster connections, and it is free to try the device which can be borrowed for 3 weeks and renewed twice if no one else has booked to use it.

Two interactive pruning televideoconferences were produced, each comprised of videotaped segments and in-studio pruning demonstrations. In the first televised conference, viewers received step-by-step instructions for pruning four small and tree fruits. Twelve woody ornamentals were pruned in the second conference. The “how-to-prune” segments were performed by Extension personnel and videotaped by University Electronic and Photographic Services. Each of the 2-hour conferences was broadcast live from a classroom television studio with a total of 30 in-studio participants and 178 county extension agents, Master Gardeners, and residents at downlink sites statewide. A toll-free number was available throughout the conference to encourage two-way communication. These televideoconferences culminated in the creation of a library of “how to prune” videotapes, which are available to county agents, Master Gardeners, or residents. Also, several of these segments were aired on C.U.E. Magazine, a monthly, half-hour Extension-sponsored cable television program, and on Making It Grow!, a bimonthly, hour-long Clemson Extension program that is broadcast on SC-Educational Television.

This study purposed to use information and communication technologies for documenting indigenous farming knowledge for improved preservation, accessibility and use in Kilifi County, Kenya. The objectives that guided this study were to assess the awareness and perception of the study community regarding use of ICTs in preservation and management of indigenous farming knowledge, to explore available ICTs tools that can capture and document indigenous farming knowledge, to advance the important role a library repository could play in preservation, management, storage and dissemination of indigenous farming knowledge and to identify barriers and concerns related to IFK preservation, accessibility and use. The outcome of this research is a knowledge asset of captured indigenous farming experiences, processes, and insights to contribute to a pool of indigenous farming knowledge for learning and scaling up preservation and public utilization. This study was conducted in all the seven Sub Counties in Kilifi County namely Malindi, Magarini, Kilifi North, Kilifi South, Ganze, Kaloleni and Rabai where a sample size of ninety eight respondents that was derived using Krejcie and Morgan formula n=X2NP (1-P)/e2 (N-1) +X2P (1-P) that is used when a population is more than ten thousand (10,000) were targeted. The research instruments that were used included questionnaires, interview schedule, personal observation, storytelling and focus group discussions which were recorded using information and communication technology resources such as video recording to come up with a knowledge asset of indigenous farming knowledge experiences for uploading into the County of Kilifi Public Library repository was realized. Cronbach’s alpha was used to test the validity of the instruments. Secondary data was collected from County of Kilifi Demographic Reports, Kilifi County Development plan, County Government of Kilifi Agricultural Sector Development Programme and reputable databases. Data analysis involved the use of inferential statistics using Statistical Package for Social Science (SPSS) and tables of means and standard deviation which were used to present the data. The findings of the study are that indigenous farming knowledge is very valuable and has assisted the community in food security and needs to be passed down to the younger generation. Farmers’ awareness and perception of the role of ICT in preservation of IFK is very good and agreed that if IFK is not documented, it may disappear as they died. The farmers were aware of ICTs tools to capture, document and disseminate indigenous farming experiences for improved preservation and accessibility in Public Libraries in Kilifi County including mobile phones, radios, television, computers, internet, memory cards, social media technologies, iPads and flash discs can be used. The Sub County Agricultural Officers and Librarians have the qualification and experience required to collaborate with the Kaya Elders (Farmers) to document and preserve the IFK for posterity. The public library repository can be a knowledge asset in the preservation, management and dissemination of documented indigenous farming experiences and provide free access to indigenous knowledge information resources, providing places for access to researchers of indigenous knowledge, training users on accessing indigenous knowledge resources and allowing farmers to observe indigenous knowledge practices by offering demonstration site in the library compound. However, there were barriers and concerns including climate change, use of certified seeds instead of indigenous seeds, its accessibility, government introduction of early maturing seeds due to prolonged drought, people’s perception of it being primitive knowledge, its none documentation and inaccessibility, poor preservation, knowledge gaps left by dying indigenous knowledge owners that were noted that can be surmounted by documenting indigenous knowledge practices, creating awareness on indigenous knowledge resources, mentorship (the old passing knowledge to the young), creating platforms to allow access to indigenous knowledge as well as creating indigenous knowledge databases, mainstreaming it into our formal education, building awareness on indigenous farming knowledge, community based indigenous knowledge maintenance, creating national indigenous knowledge inventories and securing intellectual property of indigenous farming knowledge. The study recommended indigenous farming knowledge be incorporated to scientific farming knowledge by embedding it in ICTs tools such as mobile phones, and social media technologies that will enhance its accessibility and mainstreaming with scientific knowledge, educating people on value of indigenous farming knowledge by public libraries’ embracing their role of creating awareness through creation of more platforms including indigenous farming knowledge databases and revamping public libraries to become viable indigenous farming knowledge assets by empowering the public libraries in acquiring, preserving, managing and disseminating IFK in the form of books, audio visual resources, technical skills, human skills, demonstration gardens and adult education learners and double their effort in creating the necessary awareness for them to achieve their intended purpose.

The role of parents was seen as the missing link in provision of infrastructural facilities leading to achievement of desirable performance as the government fulfilled her mandate of providing free education through the Free Day Secondary Education funds. Descriptive survey design was used. The study population included 20 principals, 184 teachers, 776 parents and 776 students. The respondents who were sampled through purposive, incidental and random sampling method included principals, parents, teachers’ and form four students. The study shows there was a significant relationship between Provision of Infrastructural Facilities and students’ performance (R = .594; p < .001). The results of the regression indicated that parents’ participation in provision of Infrastructural Facilities explained 35.2% of the variance in students’ performance (R2 =.352, F (1, 239) = 130.105, p < .001). It was found that parents’ participation in provision of Infrastructural Facilities significantly predicted performance of MFIs (B = .376; p < .001). By replacing the significant coefficients into the equation connecting parents’ participation in provision of Infrastructural Facilities with students’ performance, the equation becomes Y=24,768+ 0.376X2 +:έ. Library, toilets and laboratory in day secondary schools were found to be inadequate hence affecting their performance. The study recommends that parents should be involved in infrastructure development secondary schools as this could influence academic achievement.

73 Background: Computerized provider order entry (CPOE) systems have been shown to enhance the safety and efficiency of prescribing chemotherapy over the handwritten ordering process. However, many institutions lack the financial ability, technological capability, or operational flexibility to invest in and implement such a system. In particular, Olive View-UCLA Medical Center (OVMC), a Los Angeles County safety net hospital, is among these institutions with unique restrictions that preclude the use of chemotherapy CPOE and mandate handwritten orders. Methods: In an effort to bridge the gap for safe chemotherapy prescribing, we aimed to develop and implement an effective, scalable, and sustainable chemotherapy provider order entry solution that was operationally sensitive to institutions without a chemotherapy CPOE. The solution was designed as a mobile application using Xcode, the integrative development environment of Apple Inc., with the Swift programing language. Results: On September 5th, 2018, we launched a free, chemotherapy provider order entry solution on the worldwide Apple App Store – ChemoPalRx. Using ChemoPalRx, providers can search, customize, and print common chemotherapy regimens in prescription format. Along with a reference library of over 120 order set and 450 medications, ChemoPalRx is equipped with the functions to automate dosage calculation, suggest pre-medications and safety parameters, and trigger alerts for missing prescribing information. As a quality improvement initiative, we implemented ChemoPalRx at OVMC. Implementation stages include obtaining administrative buy-in, consulting with multidisciplinary staffs, investing $100 USD for a prescription printer, and encouraging providers to download ChemoPalRx on their own mobile devices. An ongoing prospective cohort study is being conducted to determine ChemoPalRx effectiveness in reducing errors compared to handwritten orders. Conclusions: ChemoPalRx is developed to enhance the safety and efficiency of chemotherapy prescribing. Implementation of this mobile application is feasible in the safety-net hospital setting and has the potential to transform oncology practices globally.

e18071 Background: Computerized provider order entry (CPOE) systems have been shown to enhance the safety and efficiency of prescribing chemotherapy over the handwritten ordering process. However, many institutions lack the financial ability, technological capability, or operational flexibility to invest in and implement such a system. In particular, Olive View-UCLA Medical Center (OVMC), a Los Angeles County safety net hospital, is among these institutions with unique restrictions that preclude the use of chemotherapy CPOE and mandate handwritten orders. Methods: In an effort to bridge the gap for safe chemotherapy prescribing, we aimed to develop and implement an effective, scalable, and sustainable chemotherapy provider order entry solution that was operationally sensitive to institutions without a chemotherapy CPOE. The solution was designed as a mobile application using Xcode, the integrative development environment of Apple Inc., with the Swift programing language. Results: On September 5th, 2018, we launched a free, chemotherapy provider order entry solution on the worldwide Apple App Store – ChemoPalRx. Using ChemoPalRx, providers can search, customize, and print common chemotherapy regimens in prescription format. Along with a reference library of over 120 order set and 450 medications, ChemoPalRx is equipped with the functions to automate dosage calculation, suggest pre-medications and safety parameters, and trigger alerts for missing prescribing information. As a quality improvement initiative, we implemented ChemoPalRx at OVMC. Implementation stages include obtaining administrative buy-in, consulting with multidisciplinary staffs, investing $100 USD for a prescription printer, and encouraging providers to download ChemoPalRx on their own mobile devices. An ongoing prospective cohort study is being conducted to determine ChemoPalRx effectiveness in reducing errors compared to handwritten orders. Conclusions: ChemoPalRx is developed to enhance the safety and efficiency of chemotherapy prescribing. Implementation of this mobile application is feasible in the safety-net hospital setting and has the potential to transform oncology practices globally.

Abstract Background Early-stage triple-negative breast cancer (TNBC) is usually treated with neoadjuvant chemotherapy (NADC), but prognosis remains poor compared with other BC subtypes. Unfortunately, less than 30% of BC patients achieve pathological complete response (pCR) to NADC and the overall survival of TNBC when cancer spreads is estimated at 10-13 months. Complete response is associated with improved progression-free and overall survival rates, but more accurate prognostic markers are needed. In this study, we assessed the prognostic value of blood circulating metabolites by using targeted-based metabolomics. Methods Patients received standard neoadjuvant chemotherapy with epirubicin plus cyclophosphamide followed by paclitaxel. Blood samples were obtained upon completion of chemotherapy and before surgery. Pathological response to treatment was recorded according to the Miller & Payne system, and categorized as partial (MP 1, 2, & 3) or complete response (MP 4 & 5). Blood samples were collected in EDTA tubes, centrifuged and plasma was stored at -80°C. After QC standard addition and methanol extraction of proteins, four fractions of the resulting extract were analysed: two by reverse-phase/UPLC-MS/MS methods with positive ion mode electrospray ionization (ESI), one by reverse phase/UPLC-MS/MS with negative ion mode ESI, and one by hydrophilic interaction liquid chromatography/UPLC-MS/MS) by Metabolon using a Thermo Scientific Q-Exactive mass spectrometer with a heated electrospray ionization source and an Orbitrap mass analyser. Using Metabolon's hardware and software, raw data were extracted, identified, QC processed and quantified using the area under the curve (AUC). Identified compounds were compared with library entries of purified standards or recurrent unknown entities. The prognostic capacity of each metabolite was assessed using BRB ArrayTools. Selected metabolites were validated using a targeted approach using compound standards as follows. Plasma samples were re-analysed by UPLC/MS using a Vanquish LC coupled to an Orbitrap Exploris 240 MS (Thermo Fisher Scientific) with positive and negative ionization mode ESI under polarity switching. Identification of compounds were performed by comparison of retention times (against in-house authentic standards), accurate mass (with an accepted deviation of 3ppm), and MS/MS spectra. These analyses were carried out by MS-Omics (Denmark). Results Twenty patients treated in the Medical Oncology Unit of the University Hospital of Jaén were recruited. Median age was 50 (31-76). Twelve patients obtained a pathological complete response. Median follow-up after surgery was 25 months. Seven patients eventually had distant metastases (2 in the lungs, 1 in the brain, 1 in the bones and 3 multi-site). Metabolon untargeted analysis identified and quantified 985 metabolites, 789 after xenobiotics exclusion. Survival analysis identified 16 metabolites related with distant relapse (p&lt; 0.05). The ten metabolites with lower p-value were selected for targeted validation. Ms-Omics pipeline allowed absolute quantification of 5 metabolites, 3 of them showing high correlation (R &gt;0.7) between both measurements (targeted and untargeted). Validation of the prognostic value of the candidate metabolites is ongoing in a larger TNBC cohort. Conclusions Metabolomics is a useful tool for the detection of simply assessable and cost-effective prognostic biomarkers in TNBC. Easily monitoring the presence of minimal residual disease is worth to be settled up in the clinical practice for the most aggressive molecular subtype of breast cancer. In this work we have defined a set of metabolites that could predict distant relapse events in TNBC patients treated with neoadjuvant chemotherapy. Further analyses are being carried out to validate the prognostic value of the proposed candidate metabolites. Citation Format: Pedro Sánchez-Rovira, Rocio Urbano-Cubero, Angelo Gamez Pozo, Carmen González-Olmedo, Alicia Cano-Jimenez, Andrea Zapater- Moros, Leticia Díaz-Beltrán, Lucia Trilla-Fuertes, Mariana Díaz-Almirón, Enrique Espinosa, Pilar Zamora, Juan Angel Fresno Vara. Prediction of recurrence in triple negative breast cancer patients after receiving neoadjuvanttreatment using plasma metabolomics [abstract]. In: Proceedings of the 2023 San Antonio Breast Cancer Symposium; 2023 Dec 5-9; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2024;84(9 Suppl):Abstract nr PO5-13-07.

NORTHERN IRELAND FROM THE AIR. Edited by R. Common, Belfast : Queen's University Geography Department, 1964. 104 pp., 44 plates, 1 folding map. 10 × 8 ins. 25s.THE CANALS OF THE NORTH OF IRELAND, by W. A. McCutcheon. Dawlish : David and Charles, and London : Macdonald and Co., 1965. 180 pp. 8 1/2 × 5 1/4 in. 36s.ULSTER AND OTHER IRISH MAPS c.1600. Edited by G. A. Hayes‐McCoy. Dublin : Irish Manuscripts Commission, 1964. 13 × 19 in. xv + 36 pp., 23. plates. £ 6.SOILS OF COUNTY WEXFORD. Edited by P. Ryan and M. J. Gardiner. Prepared and published by An Foras Talúntais (The Agricultural Institute), Dublin 1964. 171 pp. and three fold‐in maps. 30s.THE GEOGRAPHY OF SOIL, by Brian T. Bunting. London : Hutchinson's University Library, 1965. pp. 213. 14 figs. 12 tables. 7 1/2 × 5 in. 15s.THE HISTORY OF THE STUDY OF LANDFORMS. Vol. I : GEOMORPHOLOGY BEFORE DAVIS. Richard J. Chorley, Anthony J. Dunn and Robert P. Beckinsale. London : Methuen, 1964. 678 pp. 84s.A DICTIONARY OF GEOGRAPHY, by F. J. Monkhouse. London : Edward. Arnold Ltd., 1965. 344 pp. 8 1/2 × 5 1/2 in. 35s.LA REGION DE L'OUEST, by Pierre Flatrès. Collection ‘France de Demain ‘. Paris : Presses Universitaires de France, 1964. 31s. 6d.THE BRITISH ISLES : A SYSTEMATIC GEOGRAPHY. Edited by J. Wreford Watson and J. B. Sissons. Edinburgh : Thomas Nelson, 1964. 452 pp. 45s.SCANDINAVIAN LANDS, by Roy Millward. London : Macmillan, 1964. Pp. 448. 9 × 6 in. 45s.MERSEYSIDE, by R. Kay Gresswell and R. Lawton. British Landscapes Through Maps, No. 6. The Geographical Association, Sheffield, 1964. 36 pp. + 16 plates. 7 1/2 × 9 1/2 in. 5s.WALKING IN WICKLOW, by J. B. Malone. Dublin : Helicon Ltd., 1964. 172 pp. 7 × 4 #fr1/2> in. 7s.GREYSTONES 1864–1964. A parish centenary, 1964. 23 pp. 8 #fr1/4> × 5 1/2 in. 2s. 6d. Obtainable from the A.P.C.K., 37 Dawson Street, Dublin 2.DINNSEANCHAS. Vol. I, No. I. June 1964. An Cumann Logainmneacha, Baile Atha Cliath. Pp. 24. 5s.JOURNAL OF THE ASSOCIATION OF GEOGRAPHY TEACHERS OF IRELAND. Vol. I, Dublin. 1964.MAP READING FOR THE INTERMEDIATE CERTIFICATE, by Michael J. Turner. A. Folens : Dublin. 1964. 92 pp.MAP OF CORK CITY, 1: 15,000. Dublin : Ordnance Survey Office, 1964. 32 × 24 in. On paper, flat, 4s., or folded and covered, 5s.IRELAND, by T. W. Freeman. London : Methuen & Co. Ltd. Third edition, 1965. 5 1/2 × 8 #fr1/2> in. Pp. xx + 560. 65s.THE PLANNING AND FUTURE DEVELOPMENT OF THE DUBLIN REGION. PRELIMINARY REPORT. By Myles Wright. Dublin : Stationery Office, 1965. Pp.55. 8 ins. × 11 3/4 ins. 10s 6d.LIMERICK REGIONAL PLAN. Interim Report on the Limerick—Shannon— Ennis District by Nathaniel Litchfield. The Stationery Office, Dublin 1965. 8 × 12 ins. ; Pp. 83 ; 10s. 6d.ANTRIM NEW TOWN. Outline Plan. Belfast : H. M. Stationery Office, 1965. 10 1/2 × 8 1/2 in. 15s.HEPORT OF THE DEPUTY KEEPER OF THE RECORDS 1954–1959. Belfast : Her Majesty's Stationery Office. Cmd. 490. 138 pp. 10s.ECONOMIC GEOGRAPHY, by Ronald Hope. London : George Philip and Son Ltd., 4th edition, 1965. pp. 296. 15s. 6d.CLIMATE, SOILS AND VEGETATION, by D. C. Money. London : University Tutorial Press, 1965. pp. 272. 18s.TECHNIQUES IN GEOMORPHOLOGY, by Cuchlaine A. M. King. 9 × 5 1/2 in. 342 pp. London : Edward Arnold (Publishers) Ltd., 1966. 40s.BRITISH GEOMORPHOLOGICAL RESEARCH GROUP PUBLICATIONS :— 1. RATES OF EROSION AND WEATHERING IN THE BRITISH ISLES. Occasional Publication No. 2, 1965. Pp. 46. 13 × 8 in. 7s. 6d.2. DEGLACIATION. Occasional Publication No. 3, 1966. Pp. 37. 13 × 8 in. 7s.RECHERCHES DE GÉOMORPHOLOGIE EN ÉCOSSE DU NORD‐OUEST. By A. Godard. Publication de la Faculté des Lettres de l'Université de Strasbourg, 1965. 701 pp. 482 reís.ARTHUR'S SEAT: A HISTORY OF EDINBURGH'S VOLCANO, by G. P. Black. Edinburgh & London : Oliver & Boyd, 1966. 226 pp. 7 1/2 × 5 in. 35s.OFFSHORE GEOGRAPHY OF NORTHWESTERN EUROPE. The Political and Economic Problems of Delimitation and Control, by Lewis M. Alexander. London : Murray, 1966. 35s.GEOGRAPHICAL PIVOTS OF HISTORY. An Inaugural Lecture, by W. Kirk. Leicester University Press, 1965. 6s.THE GEOGRAPHY OF FRONTIERS AND BOUNDARIES, by J. R. V. Prescott. London : Hutchinson, 1965. 15s.THE READER'S DIGEST COMPLETE ATLAS OF THE BRITISH ISLES.. London : Reader's Digest Assoc., 1965. 230 pp. 15 1/4 × 10 1/2 in. £5. 10. 0.ULSTER DIALECTS. AN INTRODUCTORY SYMPOSIUM. Edited by G. B. Adams, Belfast : Ulster Folk Museum, 1964. 201 pp. 9 1/2 × 6 1/2 in. 20s.ULSTER FOLKLIFE, Volume 11. Belfast: The Ulster Folk Museum, 1965. Pp. 139. 9 1/2 × 7 in. 15s.GEOGRAPHICAL ABSTRACTS published and edited by K. M. Clayton, F. M Yates, F. E. Hamilton and C. Board.Obtainable from Geo. Abstracts, Dept. of Geography, London School of Economics, Aldwych, London, W.C.2. Subscription rates as below.THE CLIMATE OF LONDON. T. J. Chandler. London : Hutchinson and Co., 1965. 292 pp., 86 figs., 93 tables. 70/‐.MONSOON LANDS, Part I, by R. T. Cobb and L. J. M. Coleby. London : University Tutorial Press Ltd., 1966, constituting Book Six (Part 1 ) of the Advanced Level Geography Series. 303 pp. 8 1/4 × 5 1/4 in. 20s.PREHISTORIC AND EARLY CHRISTIAN IRELAND. A GUIDE, by Estyn Evans. London : B. T. Batsford Ltd., 1966. xii + 241 pp. 45s.A REGIONAL GEOGRAPHY OF IRELAND, by G. Fahy. Dublin : Browne and Nolan Ltd. No date. 238 pp. 12s.THE CANALS OF THE SOUTH OF IRELAND, by V. T. H. and D. R. Delany. Newton Abbot : David and Charles, 1966. 260 pp. + 20 plates. 8 1/2 × 5 1/2 in. 50s.THE COURSE OF IRISH HISTORY. Edited by T. W. Moody and F. X. Martin. Cork : The Mercier Press. 1967. 404 pp. 5 3/4 × 7 3/4 ins. Paperback, 21s. Hard cover, 40s.NORTH MUNSTER STUDIES. Edited by E. Rynne. Limerick : The Thomond Archaeological Society, 1967. 535 pp. 63s.SOILS OF COUNTY LIMERICK, by T. F. Finch and Pierce Ryan. Dublin: An Foras Talúntais, 1966. 199 pp. and four fold‐in maps. 9 1/2 × 7 1/4 in. 30s.THE FORESTS OF IRELAND. Edited by H. M. Fitzpatrick. Dublin : Society of Irish Foresters. No date. 153 pp. 9 3/4 × 7 1/4 in. 30s.PLANNING FOR AMENITY AND TOURISM. Specimen Development Plan Manual 2–3, Donegal. Dublin : An Foras Forbartha (The National Institute for Physical Planning and Construction Research), 1966. 110 pp. 8 × 11 in. 12s. 6d.NEW DIMENSIONS IN REGIONAL PLANNING. A CASE STUDY OF IRELAND, by Jeremiah Newman. Dublin : An Foras Forbartha, 1967. 128 pp. 8 1/2 × 6 in. 25s.TRAFFIC PLANNING FOR SMALLER TOWNS. Dublin : An Foras Forbartha (The National Institute for Regional Planning and Construction Research), 1966. 35 pp. 8 1/4 × 10 3/4 in. No price.LATE AND POST‐GLACIAL SHORELINES AND ICE LIMITS IN ARGYLL AND NORTH‐EAST ULSTER, by F. M. Synge and N. Stephens. Institute of British Geographers Transactions No. 59, 1966, pp. 101–125.QUATERNARY CHANGES OF SEA‐LEVEL IN IRELAND, by A. R. Orme. Institute of British Geographers Transactions No. 39, 1966, pp. 127–140.LIMESTONE PAVEMENTS (with special reference to Western Ireland), by Paul W. Williams. Institute of British Geographers Transactions No. 40, 1966, pp. 155–172. 50s. for 198 pages.IRISH SPELEOLOGY. Volume I, No. 2, 1966. Pp. 18. 10 × 8 in. 5s., free to members of the Irish Speleological Association.THE GEOGRAPHER'S CRAFT, by T. W. Freeman. Manchester University Press, 1967. pp.204. 8 1/4 × 5 in. 25s.GEOGRAPHY AS HUMAN ECOLOGY. Edited by S. R. Eyre and G. R. J. Jones. London : Edward Arnold Ltd., 1966. 308 pp. 45s.LOCATIONAL ANALYSIS IN HUMAN GEOGRAPHY, by Peter Haggett. London : Edward Arnold (Publishers) Ltd., 1965. 339 pp. 9 × 5 1/2 in. 40s.AGRICULTURAL GEOGRAPHY, by Leslie Symons. London : G. Bell and Sons, Ltd., 1967. 283 pp. 8 1/2 × 5 1/2 ins. 30s.THE GEOLOGY OF SCOTLAND, edited by Gordon Y. Craig. Edinburgh and London : Oliver & Boyd, 1965. Pp. 556. 9 3/4 × 7 1/2 in. 105s.MORPHOLOGY OF THE EARTH, by Lester C. King. Edinburgh : Oliver and Boyd, 2nd ed., 1967. 726 pp. 9 1/2 × 7 in. £5. 5. 0.INTERNATIONAL YEARBOOK OF CARTOGRAPHY, V, 1965. Edited by Eduard Imhof. London : George Philip and Son Ltd., 1965. 222 pp. + 9 plates. 9 3/4 × 6 1/2 in. 47s. 6d.IRISH FOLK WAYS, by E. Estyn Evans. London : Routledge and Kegan Paul, 1967. 324 pp. 16s.A HISTORY OF MEDIEVAL IRELAND, by A.J.Otway‐Ruthven. London: Ernest Benn Limited. New York : Barnes and Noble Inc., 1968. xv + 454 pp. 70s.IRISH AGRICULTURAL PRODUCTION, ITS VOLUME AND STRUCTURE, by Raymond D. Crotty. Cork University Press, 1966. 384 pp. 42s.PLANNING IN IRELAND. Edited by F. Rogerson and P. O hUiginn. Dublin : The Irish Branch of the Town Planning Institute and An Foras Forbartha, 1907. 199 pp.THE SHELL GUIDE TO IRELAND, by Lord Killanin and Michael V. Duignan. London : Ebury Press and George Rainbird (distributed by Michael Joseph) : 2nd edition, 1967. 512 pp. 50s.THE CLIMATE OF NORTH MUNSTER, by P. K. Rohan. Dublin : Department of Transport and Power, Meteorological Service, 1968. 72 pp. 10s. 6d.SOILS OF COUNTY CARLOW, by M.J. Conry and Pierce Ryan. Dublin : An Foras Talúntais, 1967. 204 pp. and four fold‐in maps. 30s.MOURNE COUNTRY, by E. Estyn Evans. Dundalk : Dundalgan Press (W. Tempest) Ltd., 2nd ed., 1967. 244 pp. 63s.THE DUBLIN REGION. Advisory Plan and Final Report, by Myles Wright. Dublin : The Stationery Office, 1967. Part One, pp. 64. 20s. Part Two, pp. 224. 80s.BELFAST : THE ORIGIN AND GROWTH OF AN INDUSTRIAL CITY. Edited by J. C. Beckett and R. E. Glasscock. London : The British Broadcasting Corporation, 1967. 204 pp. 25s.REPORT ON SKIBBEREEN SOCIAL SURVEY, by John Jackson. Dublin : Human Sciences Committee of the Irish National Productivity Committee, 1967. 63 pp. 12s. 6d.AN OUTLINE PLAN FOR GALWAY CITY, by Breandan S. MacAodha. Dublin : Scepter Publishers Ltd., 1966. 15 pp.COASTAL PASSENGER STEAMERS AND INLAND NAVIGATIONS IN THE SOUTH OF IRELAND, by D.B. McNeill. Belfast : The Transport Museum (Transport Handbook No. 6), 1965 (issued in 1967). 44 pp. (text) + 12 pp. (plates). 3s. 6d.CANALIANA, the annual bulletin of Robertstown Muintir na Tire. Robertstown, Co. Kildare : Muintir na Tire, n.d. (issued in 1967). 60 pp. 2s. 6d.CONACRE IN IRELAND, by Breandan S. MacAodha (Social Sciences Research Centre, Galway). Dublin : Scepter Publishers Ltd., 1967, 15 pp. No price.PROCESSES OF COASTAL DEVELOPMENT, by V.P. Zenkovich, edited by J.A. Steers, translated by D.G. Fry. 738 pp. Edinburgh and London : Oliver and Boyd, 1967. £12. 12s.CONGRESS PROCEEDINGS. 20th International Geographical Congress. Edited by J. Wreford Watson. London : Nelson, 1967. 401 pp. 70s.REGIONAL GEOGRAPHY, by Roger Minshull. London : Hutchinson University Library, 1967. 168 pp. 10s. 6d.ATMOSPHERE, WEATHER AND CLIMATE, by R.G. Barry and R.J. Chorley. London : University Paperback, Methuen, 1967. 25s.THE EVOLUTION OF SCOTLAND'S SCENERY, by J.B. Sissons. Edinburgh and London : Oliver and Boyd, 1967. 259 pp. 63s.WEST WICKLOW. BACKGROUND FOR DEVELOPMENT, by F.H.A. Aalen, D.A. Gillmor and P.W. Williams. Dublin : Geography Department, Trinity College, 1966. 323 pp. Unpublished : copy available in the Society's Library.

The Fresno County Public Library in Fresno, California partnered with the Community Living Center at the VA Medical Center and the Veterans Home of California – Fresno to bring a virtual reality program to residents. The program utilized Google Expeditions to provide a fun, educational virtual reality experience for veterans. This column will discuss how the program was developed, the implementation of the program, the software and hardware used, and the outcomes.

Dr. Anthony Chow, San José State University School of Information, in collaboration with Dr. Sanda Erdelez, Simmons University School of Library and Information Science, has been awarded an IMLS one-year planning grant to design an Information Leadership (iLead) development program. As a national collaboration between LIS educators, state libraries, and national library associations, iLead will identify curricular leadership core competencies for librarians and library staff, emphasizing equity, diversity, and inclusion (EDI). Libraries and information organizations face increasing and rapidly evolving expectations for supporting EDI priorities within their communities, and recent social and health issues (CBPP, 2022) have raised glaring evidence of gaps within accessibility and inclusion. iLead will help fill these gaps by convening a diverse group of practitioners, educators, and training experts to conduct a comprehensive needs assessment and to identify core competencies, gaps in current leadership formation, and appropriate pathways for closing those gaps. We anticipate iLead will converge on at least two independent training and professional development learning opportunities – a free Massive Open Online Course (MOOC) and a graduate certificate offered through the Web-based Information Science Education (WISE) consortium – with a third option for onsite training programs also in consideration. Ultimately, these planning activities will advance the three goals of iLead: 1) Cultivate an accessible, flexible, cost-effective, and impactful library leadership program that LIS-practitioner and educator experience inform; 2) Strengthen equity, diversity, and inclusion in both the LIS workforce and within the communities that workforce supports; and 3) Establish a better-prepared internal pipeline for tomorrow’s library leaders.As the world considers a post-pandemic future, library leaders face many complex challenges involving new life patterns, work, and information access. Such evolving dynamics increasingly demand new expectations for libraries and information organizations, and staff, especially as an increased focus on equity, diversity, and inclusion (EDI) is one of the central priorities within our rebuilding society. For example, the draft 2022 ALA accreditation standards prioritize EDI to ensure its significant presence in LIS professional education. As ALA states, equity “takes difference into account to ensure a fair process and, ultimately, a fair outcome” (ALA, 2022); diversity is “...recognizing, valuing, and embracing the uniqueness of each individual” (ALA, 2022); and inclusion is creating” an environment in which all individuals are treated fairly and respectfully; are valued for their distinctive skills, experiences, and perspectives; have equal access to resources and opportunities; and can contribute fully to the organization’s success” (ALA, 2022). While it is easy to support such ideals of EDI, it is much more difficult to apply these complex constructs, especially within the different personal and work contexts coinciding with ethnic and cultural differences and worldviews.The project will be led by Co-PIs Drs. Anthony Chow and José Aguiñaga from San Jose State University’s School of Information and Dr. Sanda Erdelez and Dr. Rebecca Stallworth from Simmons University School of Library and Information Science – together will govern vision, collaboration, and deliverable objectives. To support day-to-day efforts, iLead will be managed by two co-directors, Dr. Sue Alman and Martín J Gómez, and will receive collaborative support from an operational steering committee composed of state libraries (with Nevada and Washington confirmed as of this Phase I proposal and California and Massachusetts likely to join) and national library associations – including the likely participation of the Association of LIS Educators (ALISE) Council of Deans, Directors, and Chairs (DDC) and the Association of Rural and Small Libraries (ARSL). The project will be guided by a national advisory board composed of representatives from various participating state and national library associations, including CLA, WLA, NLA, APALA, CALA, REFORMA, AILA, and BCALA. Current strategic library partners, who will assist with identifying leadership core competencies and recruitment, include the San Francisco Public Library (SFPL) in California and the King County Public Library (KCPL) in Washington. Other urban and rural library partners will also be identified in each state by the time of our Phase II proposal. The project’s planning goals are to 1) Research and identify leadership and EDI core competencies; 2) Design a curriculum outline that specifies measurable learning outcomes; 3) Design a LIS practitioner- and educator-informed accessible, flexible, cost-effective, and impactful library leadership program focused on EDI; and 4) Design iLead MOOC shell. A national coalition will identify and design the iLead leadership development program to achieve these goals. While we will allow for the efforts of the project to finalize our deliverables’ forms based on the needs assessment, we envision delivering a MOOC - a free program that removes traditional barriers such as cost, access, and convenience - a graduate post-baccalaureate certificate, which represents a more traditional and formal professional development opportunity - and, potentially, an in-person program.

Chenopodium quinoa mitovirus 1 (CqMV1), a member of Mitovirus in the family Mitoviridae, is the first identified plant mitovirus (Nerva et al., 2019), which has been reported to be capable of infecting different cultivars of Chenopodium quinoa including Cherry vanilla quinoa, GQU-7356 campesino Quinoa, and Wild (Nerva et al., 2019). Cultivation of C. quinoa has increased notably in China, with good agricultural and industrial results due to its nutritional value (Vega-Gálvez et al., 2010). In September 2019, leaf mottling and plant stunting were observed on C. quinoa (cv. Longli 1) plants (Fig. S1) in a field of about 0.9 acre in Qingyuan County, Zhejiang Province, China. About 33.3% (401/1200) of C. quinoa showed leaf mottling and plant stunting symptoms. To identify viral agents potentially associated with this disease, a sRNA library from a symptomatic leaf sample was generated and sequenced. Total RNA was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and the library was constructed using the Truseq Small RNA Library preparation kit (Illumina, CA, USA). Approximately 14 million raw reads were obtained from the Illumina MiSeq platform. The clean reads were obtained and assembled using the VirusDetect pipeline v1.6 (Zheng et al., 2017) for virus identification. A total of 22 assembled contigs, with sizes ranging from 42 to 306 nt, could be aligned to the genome of CqMV1 isolate Che1 (accession no. MF375475) with nucleotide identities of 96.3% to 99.1% and a cumulative alignment coverage of the CqMV1 genome of 84.0%. Except for CqMV1, no other viruses or viroids were found in the sample. Based on the assembled contigs and the reference CqMV1 genome, we designed two primer pairs (P1F: 5′- TCCGAATCTCATTTTCGGAGTGGGTAGA -3′ and P1R: 5′- CAGACTTTAGATCAAATGAATACACATGT -3′; P2F: 5′- TCCAGTATACCTGTGGATAGTACTTTCA -3′and P2R: 5′- CGATCTCTGCTACCAAATACTCGTGAGCC -3′) to obtain the genome sequence of CqMV1 isolate Zhejiang (CqMV1-ZJ). Total RNA from the CqMV1-infected C. quinoa plant was subject to reverse transcription (RT) using AMV reverse transcriptase (TaKaRa, Tokyo, Japan) with random primers N6 (TaKaRa, Tokyo, Japan). The cDNA was then used as the template to amplify two regions in the genome, which together covered the entire genome of CqMV1-ZJ, using high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan). The PCR products were cloned into the pLB vector (Tiangen, Beijing, China) and Sanger sequenced (YouKang Co., Ltd, China). The obtained sequences were assembled into a 2,730-nt contig, representing the complete genome of CqMV1-ZJ (GenBank accession no. MT089917). Pairwise sequence comparison using the Sequence Demarcation Tool v.1.2 (Muhire et al., 2014) revealed that CqMV1-ZJ shared a sequence identity of 96.9% with the sole CqMV1 sequence available in GenBank (MF375475), thus confirming the identity of the virus as CqMV1. Furthermore, we performed RT- PCR detection on 10 collected samples using the primer pair P1F and P1R. All seven symptomatic plants tested positive for CqMV1 infection, whereas three asymptomatic plants were CqMV1-free (Fig. S1), suggesting a possible association between the virus and the symptoms observed. However, in the study by Nerva et al, two CqMV1 infected accessions (cv. Regalona and IPSP1) were found asymptomatic (Nerva et al., 2019), we therefore speculated that the symptom caused by CqMV1 varies between different C. quinoa varieties or its growth environment. To the best of our knowledge, this is the first report of CqMV1 infecting C. quinoa in China. Its ability to be transmitted through seeds (Nerva et al., 2019) and the possible pathogenicity in C. quinoa raises a serious concern for the local C. quinoa industry. The findings reported here will assist further investigations on the epidemiology and biological characteristics of CqMV1 in Zhejiang, China.

/82/ IN The Name of God Amen I John Rastrick of Kings Lynn in the County of Norfolk Clerk being mindfull of my mortality and the uncertainty of this present Life and being Sommon'd by age and infirmities to bethink my Self of my Departure out of this world and having thro’ Gods mercy the free use of my reason and understanding Do make this my last Will and Testament, written all with my own hand in manner and form following first I Comitt my Soul into the hands of Jesus Christ my Glorified Redeemer and Intercessor and by his mediation into the hands of God my reconciled father with trust and hope of the heavenly felicity and my Body to be decently Interr'd without Unnecessary Expences at the Discretion of my Executrix in hopes of a glorious Resurrection to eternall Life thro’ the merits of Jesus Christ my Saviour and as Concerning that Earthly Estate wherewith God hath blessed me which I Shall leave behind me I dispose thereof as followeth Imprimis I doe hereby ratifye and confirm the Joynture that I have given to my dear wife Elizabeth by Indent bearing date the 29th day of May Anno Domini 1696 of my Estate in Heckington and Asgaby in the County of Lincoln willing that it goe according to the Tenor of the said Joynture and Settlement as also that Estate in Sutton St Marys and in Holland in Lincolnshire which Jane the quondam wife of James Horn Enjoyed as her Joynture by her said Husband and unto which my Son William Rastrick is heir at Law this (with the forementioned Estate at Heckington and Asgarby) I do hereby as far as I have power ratifye and confirm to the said my Son William as his Inheritance to be Enjoyed by him after the decease of his mother my present <dear> wife Elizabeth above mentioned Item I give and bequeath my now Dwelling house with the Gardens and appurtenances Situate lying and being in Spinner Lane in Kings Lynn in Norfolk aforesaid which I purchased of my good friend Mr John Williamson Deceased as also that Close or pasture conteining by Estimation four acres more or less lying in Kirkton near Boston in Lincolnshire near the gate called Forefen Stow which I bought of Gregory Mapleson late in the tenure of widow Lee of Brother Toft as also that three acres of pasture lying in Sutton St Marys in Holland in Lincolnshire aforesaid Given to my wife Elizabeth by her great uncle Mr John Horne /83/ of Lynn Regis in Norfolk aforesaid Unto my five Daughters Sarah Martha Hannah Ann and Deborah Willing and appointing that the said lands be sold and the money be Divided amongst them for their portions at the Discretion of their Mother my present dear wife Elizabeth aforesaid She having hereby bequeathed to her a power to Live in the said my mansion house in Spinner Lane in Lyn as long as She pleases and to retein or hold the other Lands in this paragraph bequeathed for her and her familys maintenance till her said Daughters Shall marry or be Some other honest way Disposed of by or with her their said Mothers liking and Consent and if any of them Dye before they be soe disposed of I will that the monys raised upon the said Lands be divided amongst the Survivors at her/their mothers Discretion Item my Will is that if my Son William Should Depart this Life having no family or heir of his own that then (after my wife Elizabeth's Decease) all my Estate and lands before mentioned or value of them when Sold (Excepting my four acres in Kirkton) shall be equally Divided amongst my Daughters aforesaid Share and Share like and if any of them die while Single her portion Shall be equally divided amongst her Surviving Sisters and my Will is that in case my Son William Should die without heir of his own Body that then the before Excepted four acres in Kirkton Shall be accounted no part of my Estate so Divided but it Shall be given and I hereby bequeath it in that case only to the Church of Kirkton in Holland aforesaid where I was Sometime Minister as an augmentation to the vicaridge there for Ever according to and by virtue of an act of parliament not Long Since made in such cases provided that is impowering and to make and so Setling such augmentactions and this Conditional provision I make partly in Consideration of a legacy once left me and given to me as minister there and partly also because my Daughters will in the said Case of their Brothers Death have Competent portions without the said pasture Item I give all my Books manuscripts mathematical Instruments Tellescopes Double Barometer and all other things whatsoever of that kind found in my study and parler adjoining Shelves Drawers Cases &c as also my picture done by Deconing To my Son William Rastrick provided and upon condition that he continue a minister and preacher of the Gospell whether in a Conforming or nonConforming Capacity But if he should not be a minister or Continue a preacher So that he shall have little occasion for them or Should depart this life in a Single State and leave no Son a Scholler to Enjoy them or capable of using them that my will is that if any pious learned Studious minister Conformist or non conformist Shall marry any of my Daughters he Shall have all my Books manuscripts &c before mentioned over and above what her portion as before provided or bequeathed Shall be But if that Should not be then my will is that yet my said Library shall not be auctioned out or Sold to any Booksellers but be disposed of to raise a publick Library for the use of the Dissenting Ministers in the City of Norwich leaving it to their liberty what (by Collection made) to give my Surviving Children for them or my Son William if he live and yet desist from preaching or the Dissenting ministers there for the time being may treat /84/ with the City and upon agreement for their own free use of it add my library to theirs selling the lesser of the Duplicates and with that mony buying Such Books as Shall yet be leanting to the whole and all to be managed at the Discretion of the said Dissenting ministers in Conjunction with an Equall number of the City Clergy whom they the Dissenting ministers shall chuse Item I give to my Son John Rastrick now or late in Carolina if he be yet living the Sum of five pounds of lawfull mony of England to be pay'd him within three months next after his return into England if he so return and also to his Children (if any such be prov'd to be) the Sum of twenty Shillings each to be paid them within the like terme after their arrival in England and if he or they Shall Settle and be diligent he in his Calling (which is that of a Stocking weaver) or they in any honest calling and Shall be of Sober life and Conversation then I hereby recommend to my Executrix to give him or them Such further Encouragement as She according to her ability and at her Discretion Shall think fitt Item I give unto my Son Samuel Rastrick at London Silk dyer the Sum of ten Shillings also to my Daughter Elizabeth the wife of Edmund Burton of Wisbich the Sum of five Shillings to be paid them within Six months after my Decease they having had their portions before Item I give to our maid Servant Susannah Hating (to be paid her within three months after my decease) the Sum of forty Shillings over and above her due wages Item all the rest of my goods and Chattles undisposed of I give and bequeath unto my said dear wife Elizabeth whom I do hereby constitute and appoint Sole Executrix of this my last Will and Testament to see my debts discharged and my legacys or childrens portions paid and my Body decently Interr'd at the least Expence posable and I do desire my good friend Mr Nathaniel Kinderley of Sechy Bridg to be Supervisor of this my last Will and Testament In witness whereof I have hereunto Set my hand and Seal the Twenty Sixth day of July in the year of our Lord one Thousand Seven Hundred twenty five John Rastrick Published and declared to be the last Will and Testament of John Rastrick the Testator and Signed and Sealed in the presence of us James Hackgill John Money Thomas Wilson

ObjectiveTo describe the impact of civil unrest on the mental health of a community in near real-time using syndromic surveillance.IntroductionAs part of a wide-spread community discussion on the presence of monuments to Confederate Civil War figures, the Charlottesville city council voted to remove a statue of General Robert E. Lee.1 Multiple rallies were then held to protest the statue’s removal. A Ku Klux Klan (KKK) rally on July 8, 2017 (MMWR Week 27) and a Unite the Right rally on August 12, 2017 (MMWR Week 32) held in Charlottesville both resulted in violence and media attention.2,3 The violence associated with the Unite the Right rally included fatalities connected to motor vehicle and helicopter crashes.Syndromic surveillance has been used to study the impact of terrorism on a community’s mental health4 while more traditional data sources have looked at the impact of racially-charged civil unrest.5 Syndromic surveillance, however, has not previously been used to document the effect of racially-charged violence on the health of a community.MethodsThe Virginia Department of Health (VDH) analyzed syndromic surveillance data from three emergency departments (EDs) in the Charlottesville area (defined to include Charlottesville city and Albemarle county), regardless of patient residence following the Unite the Right rally. Visits to these EDs between January 1 and September 2, 2017 were analyzed using the Enhanced Surveillance System for the Early Notification of Community-based Epidemics (ESSENCE) and Microsoft SQL 2012. Encounters were identified as acute anxiety-related visits based on an International Classification of Diseases, Tenth Revision (ICD-10) discharge diagnosis beginning with ’F41’. Analyses were conducted using the ESSENCE algorithm EWMA 1.2 and SAS 9.3.ResultsThe greatest number of visits with a primary diagnosis of anxiety in 2017 (N=20) was observed in MMWR week 34 (August 20-26). This represented a statistically significant increase over baseline with a p-value of 0.01.By race, a significant increase over baseline in visits with a primary diagnosis of anxiety was observed among blacks or African Americans. The largest volume of visits was observed in MMWR week 33 with a total of 8 identified visits or 1.8% of total ED visit volume. The increase in visits for anxiety observed in weeks 33-35 was 2.2 times greater among blacks or African Americans than it was among whites, p = 0.016, 95% CI [1.14, 4.16].ConclusionsPrevious work done in Virginia to identify ED visits related to anxiety included only chief complaint criteria in the syndrome definition. Due to a change in how one ED in the Charlottesville area reported data during the study period, this syndrome definition could not be applied. In order to remove any potential data artifacts, only those visits with an initial diagnosis of anxiety were included in the analysis. The resulting syndrome definition likely underestimated the occurrence of anxiety in the Charlottesville area, both because it lacked chief complaint information and because syndromic surveillance does not include data on visits to mental health providers outside of EDs. This analysis presents a trend over time rather than a true measure of the prevalence of anxiety.This analysis, while conservative in its inclusion criteria, still identified an increase in visits for anxiety, particularly among blacks or African Americans. In today’s political environment of race-related civil unrest, a way to measure the burden of mental illness occurring in the community can be invaluable for public health response. In Charlottesville, the identification of a community-wide need for mental health support prompted many local providers to offer their services to those in need pro-bono.6References1 Suarez, C. (2017, February 6). Charlottesville City Council votes to remove statue from Lee Park. The Daily Progress. Retrieved from http://bit.ly/2wYOHhv2 Spencer, H., & Stevens, M. (2017, July 8). 23 Arrested and Tear Gas Deployed After a K.K.K. Rally in Virginia. The New York Times. Retrieved from http://nyti.ms/2tCiBGU3 Hanna, J., Hartung, K., Sayers, D., & Almasy, S. (2017, August 13). Virginia governor to white nationalists: ‘Go home … shame on you’. CNN. Retrieved from http://cnn.it/2vvAGHt4 Vandentorren, S., Paty, A. C., Baffert, E., Chansard, P., Caserio-Schönemann, C. (2016, February). Syndromic surveillance during the Paris terrorist attacks. The Lancet (387(10021), 846-847. doi:10.1016/S0140-6736(16)00507-95 Yimgang, D. P., Wang, Y., Paik, G., Hager, E. R., & Black, M. M. Civil Unrest in the Context of Chronic Community Violence: Impact on Maternal Depressive Symptoms. American Journal of Public Health 107(9), 1455-1462. doi:10.2105/AJPH.2017.3038766 DeLuca, P. (2017, August 19). Downtown Charlottesville Library Offers Free Counseling. NBC29.com. Retrieved from http://bit.ly/2yIzHbl

Photo by 14825144 © Alita Xander | Dreamstime.com ABSTRACT The US government's approach to the War on Drugs has created laws to deter people from using illicit drugs through negative punishment. These laws have not controlled illicit drug use, nor has it stopped the opioid pandemic from growing. Instead, these laws have created a negative bias surrounding addiction and have negatively affected particularly vulnerable patient populations, including pregnant women with substance use disorder and newborns with neonatal abstinence syndrome. This article highlights some misconceptions and underscores the challenges they face as they navigate the justice and healthcare systems while also providing possible solutions to address their underlying addiction. INTRODUCTION Pregnant women with substance use disorder require treatment that is arguably for the benefit of both the mother and the fetus. Some suggest that addiction is a choice; therefore, those who misuse substances should not receive treatment. Proponents of this argument emphasize social and environmental factors that lead to addiction but fail to appreciate how chronic substance use alters the brain’s chemistry and changes how it responds to stress, reward, self-control, and pain. The medical community has long recognized that substance use disorder is not simply a character flaw or social deviance, but a complex condition that requires adequate medical attention. Unfortunately, the lasting consequences of the War on Drugs have created a stigma around addiction medicine, leading to significant treatment barriers. There is still a pervasive societal bias toward punitive rather than rehabilitative approaches to addiction. For example, many women with substance use disorder lose custody of their baby or face criminal penalties, including fines and jail time.[1] These punitive measures may cause patients to lose trust in their physicians, ultimately leading to high-risk pregnancies without prenatal care, untreated substance misuse, and potential lifelong disabilities for their newborns.[2] As a medical student, I have observed the importance of a rehabilitative approach to addiction medicine. Incentivizing pregnant women with substance use disorder to safely address their chronic health issues is essential for minimizing negative short-term and long-term outcomes for women and their newborns. This approach requires an open mind and supportive perspective, recognizing that substance use disorder is truly a medical condition that requires just as much attention as any other medical diagnosis.[3] BACKGROUND The War on Drugs was a government-led initiative launched in 1970 by President Richard M. Nixon with the aim of curtailing illegal drug use, distribution, and trade by imposing harsher prison sentences and punishments.[4] However, it is worth noting that one can trace the roots of this initiative back further. In 1914, Congress enacted the Harrison Narcotics Tax Act to target the recreational use of drugs such as morphine and opium.[5] Despite being in effect for over four decades, the War on Drugs failed to achieve its intended goals. In 2011, the Global Commission on Drug Policy released a report that concluded that the initiative had been futile, as “arresting and incarcerating tens of millions of these people in recent decades has filled prisons and destroyed lives and families without reducing the availability of illicit drugs or the power of criminal organizations.”[6] One study published in the International Journal of Drug Policy in the same year found that funding drug law enforcement paradoxically contributed to increasing gun violence and homicide rates.[7] The Commission recommended that drug policies focus on reducing harm caused by drug use rather than solely on reducing drug markets. Recognizing that many drug policies were of political opinion, it called for drug policies that were grounded in scientific evidence, health, security, and human rights.[8] Unfortunately, policy makers did not heed these recommendations. In 2014, Tennessee’s legislature passed a “Fetal Assault Law,” which made it possible to prosecute pregnant women for drug use during pregnancy. If found guilty, pregnant women could face up to 15 years in prison and lose custody of their child. Instead of deterring drug use, the law discouraged pregnant women with substance use disorder from seeking prenatal care. This law required medical professionals to report drug use to authorities, thereby compromising the confidentiality of the patient-physician relationship. Some avoided arrest by delivering their babies in other states or at home, while others opted for abortions or attempted to go through an unsafe withdrawal prior to receiving medical care, sacrificing the mother's and fetus's wellbeing. The law had a sunset provision and expired in 2016. During the two years this law was in effect, officials arrested 124 women.[9] The fear that this law instilled in pregnant women with substance use disorder can still be seen across the US today. Many pregnant women with substance use disorders stated that they feared testing positive for drugs. Due to mandatory reporting, they were not confident that physicians would protect them from the law.[10] And if a woman tried to stop using drugs before seeking care to avoid detection, she often ended up delaying or avoiding care.[11] The American College of Obstetricians and Gynecologists (ACOG) recognizes the fear those with substance use disorders face when seeking appropriate medical care and emphasizes that “obstetric–gynecologic care should not expose a woman to criminal or civil penalties, such as incarceration, involuntary commitment, loss of custody of her children, or loss of housing.”[12] Mandatory reporting strains the patient-physician relationship, driving a wedge between the doctor and patient. Thus, laws intended to deter people from using substances through various punishments and incarceration may be doing more harm than good. County hospitals that mainly serve lower socioeconomic patients encounter more patients without consistent health care access and those with substance use disorders.[13] These hospitals are facing the consequences of the worsening opioid pandemic. At one county hospital where I recently worked, there has been a dramatic increase in newborns with neonatal abstinence syndrome born to mothers with untreated substance use disorders during pregnancy. Infants exposed to drugs prenatally have an increased risk of complications, stillbirth, and life-altering developmental disabilities. At the hospital, I witnessed Child Protective Services removing two newborns with neonatal abstinence syndrome from their mother’s custody. Four similar cases had occurred in the preceding month. In the days leading up to their placement with a foster family, I saw both newborns go through an uncomfortable drug withdrawal. No baby should be welcomed into this world by suffering like that. Yet I felt for the new mothers and realized that heart-wrenching custody loss is not the best approach. During this period, I saw a teenager brought to the pediatric floor due to worsening psychiatric symptoms. He was born with neonatal abstinence syndrome that neither the residential program nor his foster family could manage. His past psychiatric disorders included attention deficit disorder, conduct disorder, major depressive disorder, anxiety disorder, disruptive mood dysregulation disorder, intellectual developmental disorder, and more. During his hospitalization, he was so violent towards healthcare providers that security had to intervene. And his attitude toward his foster parents was so volatile that we were never sure if having them visit was comforting or agitating. Throughout his hospital course, it was difficult for me to converse with him, and I left every interview with him feeling lost in terms of providing an adequate short- and long-term assessment of his psychological and medical requirements. What was clear, however, was that his intellectual and emotional levels did not match his age and that he was born into a society that was ill-equipped to accommodate his needs. Just a few feet away from his room, behind the nurses’ station, were the two newborns feeling the same withdrawal symptoms that this teenager likely experienced in the first few hours of his life. I wondered how similar their paths would be and if they would exhibit similar developmental delays in a few years or if their circumstance may follow the cases hyped about in the media of the 1980s and 1990s regarding “crack babies.” Many of these infants who experienced withdrawal symptoms eventually led normal lives.[14] Nonetheless, many studies have demonstrated that drug use during pregnancy can adversely impact fetal development. Excessive alcohol consumption can result in fetal alcohol syndrome, characterized by growth deficiency, facial structure abnormalities, and a wide range of neurological deficiencies.[15] Smoking can impede the development of the lungs and brain and lead to preterm deliveries or sudden infant death syndrome.[16] Stimulants like methamphetamine can also cause preterm delivery, delayed motor development, attention impairments, and a wide range of cognitive and behavioral issues.[17] Opioid use, such as oxycodone, morphine, fentanyl, and heroin, may result in neonatal opioid withdrawal syndrome, in which a newborn may exhibit tremors, irritability, sleeping problems, poor feeding, loose stools, and increased sweating within 72 hours of life.[18] In 2014, the American Association of Pediatrics (AAP) reported that one newborn was diagnosed with neonatal abstinence syndrome every 15 minutes, equating to approximately 32,000 newborns annually, a five-fold increase from 2004.[19] The AAP found that the cost of neonatal abstinence syndrome covered by Medicaid increased from $65.4 million to $462 million from 2004 to 2014.[20] In 2020, the CDC published a paper that showed an increase in hospital costs from $316 million in 2012 to $572.7 million in 2016.[21] Currently, the impact of the COVID-19 pandemic on the prevalence of newborns with neonatal abstinence syndrome is unknown. I predict that the increase in opioid and polysubstance use during the pandemic will increase the number of newborns with neonatal abstinence syndrome, thereby significantly increasing the public burden and cost.[22] In the 1990s, concerns arose about the potentially irreparable damage caused by intrauterine exposure to cocaine on the development of infants, which led to the popularization of the term “crack babies.”[23] Although no strong longitudinal studies supported this claim at the time, it was not without merit. The Maternal Lifestyle Study (NCT00059540) was a prospective longitudinal observational study that compared the outcomes of newborns exposed to cocaine in-utero to those without.[24] One of its studies revealed one month old newborns with cocaine exposure had “lower arousal, poorer quality of movements and self-regulation, higher excitability, more hypertonia, and more nonoptimal reflexes.”[25] Another study showed that at one month old, heavy cocaine exposure affected neural transmission from the ear to the brain.[26] Long-term follow up from the study showed that at seven years old, children with high intrauterine cocaine exposure were more likely to have externalizing behavior problems such as aggressive behavior, temper tantrums, and destructive acts.[27] While I have witnessed this behavior in the teenage patient during my pediatrics rotation, not all newborns with intrauterine drug exposure are inevitably bound to have psychiatric and behavioral issues later in life. NPR recorded a podcast in 2010 highlighting a mother who used substances during pregnancy and, with early intervention, had positive outcomes. After being arrested 50 times within five years, she went through STEP: Self-Taught Empowerment and Pride, a public program that allowed her to complete her GED and provided guidance and encouragement for a more meaningful life during her time in jail. Her daughter, who was exposed to cocaine before birth, had a normal childhood and ended up going to college.[28] From a public health standpoint, more needs to be done to prevent the complications of substance misuse during pregnancy. Some states consider substance misuse (and even prescribed use) during pregnancy child abuse. Officials have prosecuted countless women across 45 states for exposing their unborn children to drugs.[29] With opioid and polysubstance use on the rise, the efficacy of laws that result in punitive measures seems questionable.[30] So far, laws are not associated with a decrease in the misuse of drugs during pregnancy. Millions of dollars are being poured into managing neonatal abstinence syndrome, including prosecuting women and taking their children away. Rather than policing and criminalizing substance use, pregnant women should get the appropriate care they need and deserve. I. Misconception One: Mothers with Substance Use Disorder Can Get an Abortion If an unplanned pregnancy occurs, one course of action could be to terminate the pregnancy. On the surface, this solution seems like a quick fix. However, the reality is that obtaining an abortion can be challenging due to two significant barriers: accessibility and mandated reporting. Abortion laws vary by state, and in Tennessee, for instance, abortions are banned after six weeks of gestation, typically when fetal heart rhythms are detected. An exception to this is in cases where the mother's life is at risk.[31] Unfortunately, many women with substance use disorders are from lower socioeconomic backgrounds and cannot access pregnancy tests, which could indicate they are pregnant before the six-week cutoff. If a Tennessee woman with substance use disorder decides to seek an abortion after six weeks, she may need to travel to a neighboring state. However, this is not always a feasible option, as the surrounding states (WV, MO, AR, MI, AL, and GA) also have restrictive laws that either prohibit abortions entirely or ban them after six weeks. Moreover, she may be hesitant to visit an obstetrician for an abortion, as some states require physicians by law to report their patients' substance use during pregnancy. For example, Virginia considers substance use during pregnancy child abuse and mandates that healthcare providers report it. This would ultimately limit her to North Carolina if she wants to remain in a nearby state, but she must go before 20 weeks gestation.[32] For someone who may or may not have access to reliable transportation, traveling to another state might be impossible. Without resources or means, these restrictive laws have made it incredibly difficult to obtain the medical care they need. II. Misconception Two: Mothers with SUD are Not Fit to Care for Children If a woman cannot take care of herself, one might wonder how she can take care of another human being. Mothers with substance use disorders often face many adversities, including lack of economic opportunity, trauma from abuse, history of poverty, and mental illness.[33] Fortunately, studies suggest keeping mother and baby together has many benefits. Breastfeeding, for example, helps the baby develop a strong immune system while reducing the mother’s risk of cancer and high blood pressure.[34] Additionally, newborns with neonatal abstinence syndrome who are breastfed by mothers receiving methadone or buprenorphine require less pharmacological treatment, have lower withdrawal scores, and experience shorter hospital stays.[35] Opioid concentration in breastmilk is minimal and does not pose a risk to newborns.[36] Moreover, oxytocin, the hormone responsible for mother-baby bonding, is increased in breastfeeding mothers, reducing withdrawal symptoms and stress-induced reactivity and cravings while also increasing protective maternal instincts.[37] Removing an infant from their mother’s care immediately after birth would result in the loss of all these positive benefits for both the mother and her newborn. The newborns I observed during my pediatrics rotation probably could have benefited from breastfeeding rather than bottle feeding and being passed around from one nurse to the next. They probably would have cried less and suffered fewer withdrawal symptoms had they been given the opportunity to breastfeed. And even if the mothers were lethargic and unresponsive while going through withdrawal, it would still have been possible to breastfeed with proper support. Unfortunately, many believe mothers with substance use disorder cannot adequately care for their children. This pervasive societal bias sets them up for failure from the beginning and greatly inhibits their willingness to change and mend their relationship with their providers. It is a healthcare provider’s duty to provide non-judgmental care that prioritizes the patient’s well-being. They must treat these mothers with the same empathy and respect as any other patient, even if they are experiencing withdrawal. III. Safe Harbor and Medication-Assisted Treatment Addiction is like any other disease and society should regard treatment without stigma. There is no simple fix to this problem, given that it involves the political, legal, and healthcare systems. Punitive policies push pregnant women away from receiving healthcare and prevent them from receiving beneficial interventions. States need to enact laws that protect these women from being reported to authorities. Montana, for example, passed a law in 2019 that provides women with substance use disorders safe harbor from prosecution if they seek treatment for their condition.[38] Medication-assisted treatment with methadone or buprenorphine is the first line treatment option and should be available to all pregnant women regardless of their ability to pay for medical care.[39] To promote continuity of care, health officials could include financial incentives to motivate new mothers to go to follow-up appointments. For example, vouchers for groceries or enrollment in the Special Supplemental Nutrition Program for Women, Infants, and Children (WIC) may offset financial burdens and allow a mother to focus on taking care of her child and her recovery. IV. Mandated Substance Abuse Programs Although the number of people sentenced to state prisons for drug related crimes has been declining, it is still alarming that there were 171,300 sentencings in 2019.[40] Only 11 percent of the 65 percent of our nation’s inmates with substance use disorder receive treatment, implying that the other 89 percent were left without much-needed support to overcome their addiction.[41] It is erroneous to assume that their substance use disorder would disappear after a period without substance use while behind bars. After withdrawal, those struggling with substance use disorder may still have cravings and the likelihood of relapsing remains high without proper medical intervention. Even if they are abstinent for some time during incarceration, the underlying problem persists, and the cycle inevitably continues upon release from custody. In line with the recommendations by Global Commission on Drug Policy and the lessons learned from the failed War on Drugs, one proposed change in our criminal justice system would be to require enrollment and participation in assisted alcohol cessation programs before legal punishment. Policy makers must place emphasis on the safety of the patient and baby rather than the cessation of substance use. This would incentivize people to actively seek medical care, restore the patient-physician relationship, and ensure that they take rehabilitation programs seriously. If the patient or baby is unsafe, a caregiver could intervene while the patient re-enrolls in the program. Those currently serving sentences in prisons and jails can treat their substance use disorder through medication assisted treatment, cognitive behavioral therapy, and programs like Self Taught Empowerment and Pride (STEP). Medication assisted treatment under the supervision of medical professionals can help inmates achieve and maintain sobriety in a healthy and safe way. Furthermore, cognitive behavioral therapy can help to identify triggers and teach healthier coping mechanisms to prepare for stressors outside of jail. Finally, multimodal empowerment programs can connect people to jobs, education, and support upon release. People often leave prisons and jail without a sense of purpose, which can lead to relapse and reincarceration. Structured programs have been shown to decrease drug use and criminal behavior by helping reintegrate productive individuals into society.[42] V. Medical Education: Narcotic Treatment Programs and Suboxone Clinics Another proactive approach could be to have medical residency programs register with the Drug Enforcement Administration (DEA) as Narcotic Treatment Programs and incorporate suboxone clinics into their education and rotations. Rather than family medicine, OB/GYN, or emergency medicine healthcare workers having to refer their patients to an addiction specialist, they could treat patients with methadone for maintenance or detoxification where they would deliver their baby. Not only would this educate and prepare the future generation of physicians to handle the opioid crisis, but it would allow pregnant women to develop strong patient-physician relationships. CONCLUSION Society needs to change from the mindset of tackling a problem after it occurs to taking a proactive approach by addressing upstream factors, thereby preventing those problems from occurring in the first place. Emphasizing public health measures and adequate medical care can prevent complications and developmental issues in newborns and pregnant women with substance use disorders. Decriminalizing drug use and encouraging good health habits during pregnancy is essential, as is access to prenatal care, especially for lower socioeconomic patients. Many of the current laws and regulations that policy makers initially created due to naïve political opinion and unfounded bias to serve the War on Drugs need to be changed to provide these opportunities. To progress as a society, physicians and interprofessional teams must work together to truly understand the needs of patients with substance use disorders and provide support from prenatal to postnatal care. There should be advocation for legislative change, not by providing an opinion but by highlighting the facts and conclusions of scientific studies grounded in scientific evidence, health, security, and human rights. There can be no significant change if society continues to view those with substance use disorders as underserving of care. Only when the perspective shifts to compassion can these mothers and children receive adequate care that rehabilitates and supports their future and empowers them to raise their children. - [1] NIDA. 2023, February 15. Pregnant People with Substance Use Disorders Need Treatment, Not Criminalization. https://nida.nih.gov/about-nida/noras-blog/2023/02/pregnant-people-substance-use-disorders-need-treatment-not-criminalization [2] Substance Use Disorder Hurts Moms and Babies. National Partnership for Women and Families. June 2021 [3] All stories have been fictionalized and anonymized. [4] A History of the Drug War. Drug Policy Alliance. https://drugpolicy.org/issues/brief-history-drug-war [5] The Harrison Narcotic Act (1914) https://www.druglibrary.org/Schaffer/library/studies/cu/cu8.html [6] The War on Drugs. The Global Commission on Drug Policy. Published June 2011. https://www.globalcommissionondrugs.org/reports/the-war-on-drugs [7] Werb D, Rowell G, Guyatt G, Kerr T, Montaner J, Wood E. Effect of drug law enforcement on drug market violence: A systematic review. Int J Drug Policy. 2011;22(2):87-94. doi:10.1016/j.drugpo.2011.02.002 [8] Global Commission on Drug Policy, 2011 [9] Women NA for P. Tennessee’s Fetal Assault Law: Understanding its impact on marginalized women - New York. Pregnancy Justice. Published December 14, 2020. https://www.pregnancyjusticeus.org/tennessees-fetal-assault-law-understanding-its-impact-on-marginalized-women/ [10] Roberts SCM, Nuru-Jeter A. Women’s perspectives on screening for alcohol and drug use in prenatal care. Womens Health Issues Off Publ Jacobs Inst Womens Health. 2010;20(3):193-200. doi:10.1016/j.whi.2010.02.003 [11] Klaman SL, Isaacs K, Leopold A, et al. Treating Women Who Are Pregnant and Parenting for Opioid Use Disorder and the Concurrent Care of Their Infants and Children: Literature Review to Support National Guidance. J Addict Med. 2017;11(3):178-190. doi:10.1097/ADM.0000000000000308 [12] Substance Abuse Reporting and Pregnancy: The Role of the Obstetrician–Gynecologist. https://www.acog.org/en/clinical/clinical-guidance/committee-opinion/articles/2011/01/substance-abuse-reporting-and-pregnancy-the-role-of-the-obstetrician-gynecologist [13] R. Ghertner, G Lincoln The Opioid Crisis and Economic Opportunity: Geographic and Economic Trends. ASPE. Office of Assistant Secretary for Planning and Evaluation. DHHS Revised September 11, 2018 https://aspe.hhs.gov/reports/economic-opportunity-opioid-crisis-geographic-economic-trends [14] Midon, M. Z., Gerzon, L. R., & de Almeida, C. S. (2021). Crack and motor development of babies living in an assistance shelter. ABCS Health Sciences, 46, e021215-e021215. And for example, see Crack Babies: Twenty Years Later : NPR https://www.npr.org/templates/story/story.php?storyId=126478643 [15] Williams JF, Smith VC, the Committee on Substance Abuse. Fetal Alcohol Spectrum Disorders. Pediatrics. 2015;136(5):e20153113. doi:10.1542/peds.2015-3113 [16] CDC Tobacco Free. Smoking During Pregnancy. Centers for Disease Control and Prevention. Published April 11, 2022. https://www.cdc.gov/tobacco/basic_information/health_effects/pregnancy/index.htm [17] Abuse NI on D. What are the risks of methamphetamine misuse during pregnancy? National Institute on Drug Abuse. https://nida.nih.gov/publications/research-reports/methamphetamine/what-are-risks-methamphetamine-misuse-during-pregnancy [18] CDC. Basics About Opioid Use During Pregnancy | CDC. Centers for Disease Control and Prevention. Published July 21, 2021. https://www.cdc.gov/pregnancy/opioids/basics.html [19] Honein MA, Boyle C, Redfield RR. Public Health Surveillance of Prenatal Opioid Exposure in Mothers and Infants. Pediatrics. 2019;143(3):e20183801. doi:10.1542/peds.2018-3801 [20] Winkelman TNA, Villapiano N, Kozhimannil KB, Davis MM, Patrick SW. Incidence and Costs of Neonatal Abstinence Syndrome Among Infants with Medicaid: 2004–2014. Pediatrics. 2018;141(4):e20173520. doi:10.1542/peds.2017-3520 [21] Strahan AE, Guy GP Jr, Bohm M, Frey M, Ko JY. Neonatal Abstinence Syndrome Incidence and Health Care Costs in the United States, 2016. JAMA Pediatr. 2020;174(2):200-202. doi:10.1001/jamapediatrics.2019.4791 [22] Ghose R, Forati AM, Mantsch JR. Impact of the COVID-19 Pandemic on Opioid Overdose Deaths: a Spatiotemporal Analysis. J Urban Health Bull N Y Acad Med. 2022;99(2):316-327. doi:10.1007/s11524-022-00610-0 [23] Mayes LC, Granger RH, Bornstein MH, Zuckerman B. The Problem of Prenatal Cocaine Exposure: A Rush to Judgment. JAMA. 1992;267(3):406-408. doi:10.1001/jama.1992.03480030084043 [24] NICHD Neonatal Research Network. The Maternal Lifestyle Study. clinicaltrials.gov; 2016. https://clinicaltrials.gov/ct2/show/study/NCT00059540 [25] Lester BM, Tronick EZ, LaGasse L, et al. The maternal lifestyle study: effects of substance exposure during pregnancy on neurodevelopmental outcome in 1-month-old infants. Pediatrics. 2002;110(6):1182-1192. doi:10.1542/peds.110.6.1182 [26] Lester BM, Lagasse L, Seifer R, et al. The Maternal Lifestyle Study (MLS): effects of prenatal cocaine and/or opiate exposure on auditory brain response at one month. J Pediatr. 2003;142(3):279-285. doi:10.1067/mpd.2003.112 [27] Bada HS, Bann CM, Bauer CR, et al. Preadolescent behavior problems after prenatal cocaine exposure: Relationship between teacher and caretaker ratings (Maternal Lifestyle Study). Neurotoxicol Teratol. 2011;33(1):78-87. doi:10.1016/j.ntt.2010.06.005 [28] N, P, R. Crack Babies: Twenty Years Later. NPR. Published May 3, 2010. https://www.npr.org/templates/story/story.php?storyId=126478643 [29] Miranda L, Dixon V, September CRP on, 30, 2015. How States Handle Drug Use During Pregnancy http://projects.propublica.org/graphics/maternity-drug-policies-by-state [30] NCDAS: Substance Abuse and Addiction Statistics [2023]. NCDAS. https://drugabusestatistics.org/ [31] (Tenn. Code Ann. § 39-15-216). [32] Institute G. Interactive Map: US Abortion Policies and Access After Roe. https://states.guttmacher.org/policies/ [33] Whitesell M, Bachand A, Peel J, Brown M. Familial, Social, and Individual Factors Contributing to Risk for Adolescent Substance Use. J Addict. 2013;2013:579310. doi:10.1155/2013/579310 [34] CDC. Five Great Benefits of Breastfeeding. Centers for Disease Control and Prevention. Published July 27, 2021. https://www.cdc.gov/nccdphp/dnpao/features/breastfeeding-benefits/index.html [35] Welle-Strand GK, Skurtveit S, Jansson LM, Bakstad B, Bjarkø L, Ravndal E. Breastfeeding reduces the need for withdrawal treatment in opioid-exposed infants. Acta Paediatr. 2013;102(11):1060-1066. doi:10.1111/apa.12378 [36] Ilett KF, Hackett LP, Gower S, Doherty DA, Hamilton D, Bartu AE. Estimated dose exposure of the neonate to buprenorphine and its metabolite norbuprenorphine via breastmilk during maternal buprenorphine substitution treatment. Breastfeed Med Off J Acad Breastfeed Med. 2012;7:269-274. doi:10.1089/bfm.2011.0096 [37] Pedersen CA, Smedley KL, Leserman J, et al. Intranasal Oxytocin Blocks Alcohol Withdrawal in Human Subjects. Alcohol Clin Exp Res. 2013;37(3):484-489. doi:10.1111/j.1530-0277.2012.01958.x [38] Montana SB0289. https://leg.mt.gov/bills/2019/billhtml/SB0289.htm [39] Mullins N, Galvin SL, Ramage M, Gannon M, Lorenz K, Sager B, Coulson CC. Buprenorphine and Naloxone Versus Buprenorphine for Opioid Use Disorder in Pregnancy: A Cohort Study. J Addict Med. 2020 May/Jun;14(3):185-192. doi: 10.1097/ADM.0000000000000562. PMID: 31567599. [40] Drug Related Crime Statistics [2023]: Offenses Involving Drug Use. NCDAS. https://drugabusestatistics.org/drug-related-crime-statistics/ [41] Association APH. Online only: Report finds most U.S. inmates suffer from substance abuse or addiction. Nations Health. 2010;40(3):E11-E11. [42] Principles of Drug Addiction Treatment: A Research-Based Guide (Third Edition) | NIDA Archives. Published January 17, 2018. http://archives.nida.nih.gov/publications/principles-drug-addiction-treatment-research-based-guide-third-edition