Log in

Relevant bibliographies by topics / Gen 16S rRNA / Journal articles

To see the other types of publications on this topic, follow the link: Gen 16S rRNA.

Journal articles on the topic 'Gen 16S rRNA'

Author: Grafiati

Published: 4 June 2021

Last updated: 25 April 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic 'Gen 16S rRNA.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Akihary, Claudia Valleria, and Beivy Jonathan Kolondam. "PEMANFAATAN GEN 16S rRNA SEBAGAI PERANGKAT IDENTIFIKASI BAKTERI UNTUK PENELITIAN-PENELITIAN DI INDONESIA." PHARMACON 9, no. 1 (2020): 16. http://dx.doi.org/10.35799/pha.9.2020.27405.

Full text

Abstract:

ABSTRACTThe 16S rRNA gene has hyper variable region and different for one bacterial species to another. The gene is being used as research tool to help for accurate identification of bacteria in many fields in Indonesia. As a useful tool, the 16S rRNA gene sequence is important as to explore the potencies of a bacterial species. Sequencing of this gene is very useful for research in clinical study, fisheries, marine science, agricultural science, and animal husbandry in Indonesia. Keywords: 16S rRNA gene, research tool, bacteria, Indonesia ABSTRAKGen 16S rRNA memiliki region yang sangat bervar

APA, Harvard, Vancouver, ISO, and other styles

2

Rico Taareluan, Rico, Letha L. Wantania, Elvy L. Ginting, et al. "AMPLIFIKASI GEN 16S-rRNA BAKTERI EPIFIT PADA ALGA MERAH Kappaphycus alvarezii." JURNAL PESISIR DAN LAUT TROPIS 8, no. 1 (2020): 116. http://dx.doi.org/10.35800/jplt.8.1.2020.27696.

Full text

Abstract:

Bacteria are microscopic organism found living in marine algae. So far, species of bacteria in marine algae are not well known. In this study, epiphytic bacteria in algal species of Kappaphycus alvarezii (red algae) were isolated to amplify their 16S-rRNA gene. Sample K.alvarezii was collected from the island of Nain. The isolated epiphytic bacteria from the red algae K.alvarezii were grown in Nutrient Broth (NB) media. DNA extraction was carried out using InnuPREP DNA Mini Kit. 16SrRNA genes was performed using primer pair of 8F and 1492R. Two different character of epiphytic bacteria were su

APA, Harvard, Vancouver, ISO, and other styles

3

Dalenoh, Oktavianus, Stenly Wullur, Elvy L. Ginting, Veibe Warouw, Detty N. Rumampuk, and Henneke Pangkey. "FILOGENI MOLEKULER ISOLAT BAKTERI F0-0-3-1 DARI MEDIA PEMELIHARAAN ROTIFER." JURNAL PESISIR DAN LAUT TROPIS 8, no. 2 (2020): 73. http://dx.doi.org/10.35800/jplt.8.2.2020.29909.

Full text

Abstract:

The aim of this study was to construct molecular phylogeny of bacteria suspected to involve in decomposing the fishery waste as diet for rotifer culture. The bacteria were isolated from culture of rotifer and propagated for molecular analysis. Genomic DNA of the bacteria was extracted using DNeasy Blood and Tissue Kit (Qiagen). The 16S rRNA gene was amplified using primer pairs i.e. 8F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCCT GTTACGACTT) and sequenced. The sequences were analyzed using Sequence Scanner and MEGA 7, and BLASTed on the NCBI website (www.ncbi.nml.nih.gov). Molecular phylogeny o

APA, Harvard, Vancouver, ISO, and other styles

4

Carlier, Jean-Philippe, Guylène K'ouas, Isabelle Bonne, Alain Lozniewski, and Francine Mory. "Oribacterium sinus gen. nov., sp. nov., within the family ‘Lachnospiraceae’ (phylum Firmicutes)." International Journal of Systematic and Evolutionary Microbiology 54, no. 5 (2004): 1611–15. http://dx.doi.org/10.1099/ijs.0.63060-0.

Full text

Abstract:

A hitherto unknown anaerobic bacillus isolated from sinus pus in a young child (strain AIP 354.02T) was characterized by using phenotypic and genotypic methods. 16S rRNA gene sequence analysis indicated that this strain was phylogenetically affiliated with several sequences of cloned 16S rRNA gene inserts previously deposited in the public databases. According to their 16S rRNA gene sequence similarities, these uncultivated bacteria, together with strain AIP 354.02T, formed a separate subgroup belonging to the family ‘Lachnospiraceae’ within the phylum Firmicutes. Oribacterium gen. nov. is pro

APA, Harvard, Vancouver, ISO, and other styles

5

Puspitasari, Dhewanti, Hendro Pramono, and Oedjijono Oedjijono. "IDENTIFIKASI BAKTERI PENGOKSIDASI BESI DAN SULFUR BERDASARKAN GEN 16S rRNA DARI LAHAN TAMBANG TIMAH DI BELITUNG." Scripta Biologica 1, no. 1 (2014): 10. http://dx.doi.org/10.20884/1.sb.2014.1.1.12.

Full text

Abstract:

Heavy metals contamination disturb balance and diversity of microorganism in soil. Microorganisms which can able to survive in those conditions are bacteria capable of oxidizing heavy metals. Identification based on 16S rRNA was used to determine characteristics and phylogenetic relationship of bacteria which can oxidize iron and sulphur in tin mining areas. The aim of this research was able to determine the bacterias characteristics isolated from tin mining areas and determine the phylogenetic relation of iron-sulphur oxidizing bacteria on tin mining soil in Belitung based on 16S rRNA sequenc

APA, Harvard, Vancouver, ISO, and other styles

6

Untu, Patricia, Inneke F. M. Rumengan, and Elvy L. Ginting. "Identifikasi Mikroba yang Koeksis Dengan Ascidia Lissoclinum patella Menggunakan Sekuens Gen 16S rRNA." JURNAL PESISIR DAN LAUT TROPIS 2, no. 1 (2014): 23. http://dx.doi.org/10.35800/jplt.2.1.2014.10109.

Full text

Abstract:

Penelitian ini dilakukan dengan tujuan untuk menentukan jenis mikroba koeksis denganascidia Lissoclinum patella menggunakan sekuens gen 16S rRNA. Sampel yang digunakandalam penelitian ini diambil dari jaringan tissue pada ascidia L. patella yang diambil dariperairan Malalayang, Sulawesi Utara. Sampel mikroba diinokulasi dalam media Hirata dandikultur selama ± 1 minggu. Sampel mikroba tersebut diisolasi DNA, amplifikasi melalui PCR(Polymerase Chain Reaction), elektroforesis gel agarose dan dianalisis data DNAnyamenggunakan BLAST pada NCBI (National Center for Biotechnology Information). Identif

APA, Harvard, Vancouver, ISO, and other styles

7

Untu, Patricia, Inneke F. M. Rumengan, and Elvy L. Ginting. "Identifikasi Mikroba yang Koeksis Dengan Ascidia Lissoclinum patella Menggunakan Sekuens Gen 16S rRNA." JURNAL PESISIR DAN LAUT TROPIS 3, no. 2 (2015): 23. http://dx.doi.org/10.35800/jplt.3.2.2015.10110.

Full text

Abstract:

Penelitian ini dilakukan dengan tujuan untuk menentukan jenis mikroba koeksis denganascidia Lissoclinum patella menggunakan sekuens gen 16S rRNA. Sampel yang digunakandalam penelitian ini diambil dari jaringan tissue pada ascidia L. patella yang diambil dariperairan Malalayang, Sulawesi Utara. Sampel mikroba diinokulasi dalam media Hirata dandikultur selama ± 1 minggu. Sampel mikroba tersebut diisolasi DNA, amplifikasi melalui PCR(Polymerase Chain Reaction), elektroforesis gel agarose dan dianalisis data DNAnyamenggunakan BLAST pada NCBI (National Center for Biotechnology Information). Identif

APA, Harvard, Vancouver, ISO, and other styles

8

Trisno, Jumsu, and Yusniwati Yusniwati. "Identifikasi Rizobakteria Asal Tanaman Cabai Berdasarkan Sekuen Gen 16S rRNA." Jurnal Fitopatologi Indonesia 8, no. 3 (2016): 79–83. http://dx.doi.org/10.14692/jfi.8.3.79.

Full text

APA, Harvard, Vancouver, ISO, and other styles

9

UNER, Mahmut Celalettin, Gülşen HASÇELİK, and Hamit Kaan MÜŞTAK. "Antimicrobial Susceptibilities of Clinical Nocardia Isolates Identified by 16S rRNA Gene Sequence Analysis." Mikrobiyoloji Bulteni 50, no. 1 (2016): 11–20. http://dx.doi.org/10.5578/mb.10639.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

Wantania, Letha L., Stenly Wullur, Elvi L. Ginting, et al. "Isolation and amplification of 16S rRNA gen of Associated Microbial isolates in Red Algae Kappaphycus alvarezii from Belang, Southeast Minahasa Regency, North Sulawesi." JURNAL ILMIAH PLATAX 7, no. 1 (2019): 220. http://dx.doi.org/10.35800/jip.7.1.2019.22808.

Full text

Abstract:

This study aims to obtain isolates and amplify the associative bacterial 16SrRNA gene in K. alvarezii algae. The K. alvarezii algae was collected from seaweed cultivation area in Belang, Southeast Minahasa, North Sulawesi. Associative bacteria were sampled from K. alvarezii algae, grown in Nutrient Agar and separated based on their morphological characteristics. Each isolates were extracted their DNA genome and.the16S rRNA gene of each isolate was amplified using PCR. Eight associative bacterial from K. alvarezii algae were successfully isolated based on morphological characteristics which wer

APA, Harvard, Vancouver, ISO, and other styles

11

Suryani, Laksmi Ambarsari, and Efi Sanfitri Harahap. "AMPLIFIKASI GEN 16S-rRNA BAKTERI TERMOFILIK DARI SUMBER AIR PANAS, GUNUNG PANCAR BOGOR." Jurnal Riset Kimia 3, no. 1 (2015): 83. http://dx.doi.org/10.25077/jrk.v3i1.97.

Full text

Abstract:

ABSTRACT Exploration of thermophilic bacteria that produce thermostable enzyme is most useful in application for enzyme base industrial. The aim of of this research is to isolate and amplificate the 16S-rRNA gene from thermophilic bacteria isolate at hotspring, Mount of Pancar, Bogor. The research steps consist of bacteria isolation, chromosomal DNA extraction, and amplification of 16S-rRNA gene. The water sample as source for bacteria was collected from four cauldrons. Temperature and pH for each cauldron are red cauldron 75-80°C, pH 7; black cauldron 55°C, pH 7; white cauldron 57°C, pH 7; an

APA, Harvard, Vancouver, ISO, and other styles

12

Alfaruqi, Hamiyawati Qoimatu Dini, Nosa Septiana Anindita, and Arif Bimantara. "KAJIAN MOLEKULER PADA PROBIOTIK ASAL AIR SUSU IBU DALAM SINTESIS EKSOPOLISAKARIDA (EPS)." Jurnal Bioteknologi & Biosains Indonesia (JBBI) 8, no. 1 (2021): 114–23. http://dx.doi.org/10.29122/jbbi.v8i1.4554.

Full text

Abstract:

Molecular Studies on Probiotic of Human Breast Milk in the Synthesis of Exopolysaccharide (EPS) The glucosyltransferase (gtf) gene has an important role in exopolysaccharide (EPS) synthesis in probiotic bacteria. The EPS produced is associated with the adhesion ability of bacteria to the intestinal mucosa. Therefore, the gtf gene can be used as a parameter in the selection of potential probiotic through a molecular approach. This study was conducted to determine the presence of the gtf gene in probiotic from human breast milk using PCR technique. The methods in this study include the following

APA, Harvard, Vancouver, ISO, and other styles

13

Butet, Nurlisa A., Inge Anggraeni Bela Putri Dewi, Zairion Zairion, and Agus Alim Hakim. "Species Validation of Mole Crabs Based on Molecular Marker of 16s rRNA from Bantul and Purworejo waters." Journal of Tropical Fisheries Management 3, no. 2 (2019): 28–35. http://dx.doi.org/10.29244/jppt.v3i2.30434.

Full text

Abstract:

Undur-undur laut hidup pada habitat intertidal pantai berpasir. Identifikasi spesies akuatik sering mengalami kesalahan yang diakibatkan oleh fenomena cryptic spesies, sehingga diperlukan teknik identifikasi dengan pendekatan molekuler yaitu DNA barcoding. Penelitian ini bertujuan untuk menvalidasi dan menganalisis hubungan kekerabatan dari undur-undur laut berdasarkan marka molekuler gen 16S rRNA dari perairan Bantul dan Purworejo. Kit komersil berupa Gene Aid digunakan untuk isolasi dan ekstraksi DNA dan dihasilkan tiga DNA total dari setiap lokasi. DNA total dengan kualitas baik dilanjutkan

APA, Harvard, Vancouver, ISO, and other styles

14

Mubin, Nadzirum, Giyanto Giyanto, and Idham Sakti Harahap. "Bacillus endophyticus: Symbiotic Bacterium in Subterranean Termites Intestine (Blattodea: Termitoidae) from Bogor, Indonesia." Jurnal Ilmu Pertanian Indonesia 27, no. 2 (2022): 191–98. http://dx.doi.org/10.18343/jipi.27.2.191.

Full text

Abstract:

Rayap merupakan serangga sosial yang berperan penting dalam perputaran siklus nutrisi. Di dalam sistem pencernaan rayap, terdapat simbion yang membantu proses degradasi selulosa. Penelitian ini bertujuan mengisolasi bakteri simbion yang terdapat di dalam saluran cerna rayap tanah. Penelitian diawali dengan koleksi rayap tanah di Kampus IPB University, diikuti isolasi bakteri simbion dari saluran cerna belakang (proktodeum) yang kemudian diidentifikasi berdasarkan morfologi, fisiologi, dan molekuler menggunakan gen 16S rRNA. Enam rayap tanah yang diperoleh adalah Macrotermes gilvus, Odontoterme

APA, Harvard, Vancouver, ISO, and other styles

15

Kämpfer, Peter, Ramon Rosselló-Mora, Malte Hermansson, et al. "Undibacterium pigrum gen. nov., sp. nov., isolated from drinking water." International Journal of Systematic and Evolutionary Microbiology 57, no. 7 (2007): 1510–15. http://dx.doi.org/10.1099/ijs.0.64785-0.

Full text

Abstract:

Two Gram-negative, rod-shaped, oxidase-positive, non-spore-forming, non-motile bacteria (strains CCUG 49009T and CCUG 49012), both isolated from drinking water, were characterized. On the basis of chemotaxonomic data [major ubiquinone, Q-8; predominant polyamines, putrescine and 2-hydroxyputrescine; major polar lipids, phosphatidylethanolamine, moderate amounts of diphosphatidylglycerol and phosphatidylglycerol and minor amounts of three aminolipids and phosphatidylserine; major fatty acids, C16 : 0 and summed feature 3 (C16 : 1 ω7c/C15 : 0 iso 2-OH)] and 16S rRNA gene sequence similarities, b

APA, Harvard, Vancouver, ISO, and other styles

16

Kurniawan, Ardiansyah, Suci Puspita Sari, Euis Asriani, Andi Kurniawan, Abu Bakar Sambah, and Asep Awaludin Prihanto. "IDENTIFIKASI MOLEKULER ISOLAT BAKTERI SELULOLITIK DARI MANGROVE SUNGAILIAT DAN TUKAK SADAI DI PULAU BANGKA." JURNAL ENGGANO 3, no. 2 (2018): 250–60. http://dx.doi.org/10.31186/jenggano.3.2.250-260.

Full text

Abstract:

Bakteri selulolitik memiliki kemampuan degradasi selulosa dan membuat karbohidrat lebih mudah dicerna bagi ternak. Penelitian ini bertujuan untuk mengidentifikasi bakteri selulolitik di tanah, kayu lapuk dan daun dari mangrove pulau Bangka melalui skrining dan analisis gen 16s rRNA. Penelitian dilakukan dari September 2017 hingga Maret 2018. Isolat TSL7 dan TSS4 dari Mangrove Tukak Sadai dan SLS5 dari Mangrove Sungailiat yang memiliki kemampuan mendegradasi selulosa terbesar berdasarkan hasil skrining menjadi isolat yang diidentifikasi pada gen 16S rRNA untuk diurutkan dan analisis BLAST. Anal

APA, Harvard, Vancouver, ISO, and other styles

17

Nicklas, Werner, Magne Bisgaard, Bent Aalbæk, Peter Kuhnert, and Henrik Christensen. "Reclassification of Actinobacillus muris as Muribacter muris gen. nov., comb. nov." International Journal of Systematic and Evolutionary Microbiology 65, Pt_10 (2015): 3344–51. http://dx.doi.org/10.1099/ijsem.0.000417.

Full text

Abstract:

To reinvestigate the taxonomy of [Actinobacillus] muris, 474 strains, mainly from mice and rats, were characterized by phenotype and 130 strains selected for genotypic characterization by 16S rRNA and partial rpoB gene sequencing. The type strain was further investigated by whole-genome sequencing. Phylogenetic analysis of the DNA sequences showed one monophyletic group with intragroup similarities of 96.7 and 97.2 % for the 16S rRNA and rpoB genes, respectively. The highest 16S rRNA gene sequence similarity to a taxon with a validly published name outside the group was 95.9 %, to the type str

APA, Harvard, Vancouver, ISO, and other styles

18

Abraham, Wolf-Rainer, Carsten Strömpl, Marc Vancanneyt, et al. "Woodsholea maritima gen. nov., sp. nov., a marine bacterium with a low diversity of polar lipids." International Journal of Systematic and Evolutionary Microbiology 54, no. 4 (2004): 1227–34. http://dx.doi.org/10.1099/ijs.0.02943-0.

Full text

Abstract:

Two cauliform bacteria (CM243T and CM251) isolated by J. Poindexter from the Atlantic Ocean were characterized by 16S rRNA gene sequencing, TaqI restriction fragment length polymorphism and single-strand conformation polymorphism analyses of the internally transcribed 16S–23S rDNA spacer (ITS1) region, analysis of fatty acids from cellular lipids, mass spectrometry of polar lipids and physiological properties. The two strains showed very low diversity of polar lipids with diacyl-sulfoquinovosyl glycerols as the predominant lipids. The two bacterial strains were observed to have nearly identica

APA, Harvard, Vancouver, ISO, and other styles

19

Espejo, Luis José, Karen Lorena Rodríguez, Martha Fabiola Rodríguez, and Arlen Patricia Gómez Ramírez. "Identificación genotípica de Staphylococcus con fenotipo meticilino resistente aislados de muestras de humanos, animales y ambiente." Revista de Investigaciones Veterinarias del Perú 30, no. 1 (2019): 364–76. http://dx.doi.org/10.15381/rivep.v30i1.14614.

Full text

Abstract:

El objetivo del estudio fue dentificar el gen mecA-1 de aislados de Staphylococcus con fenotipo meticilino resistente (SMR) obtenidos de muestras biológicas y superficies de una clínica veterinaria. Se seleccionaron nueve aislamientos con fenotipo SMR clasificado por el sistema automatizado VITEK. El género y la variabilidad se corroboraron por amplificación y secuenciación de los genes 16S rRNA y tuf. También se estableció la presencia del gen mecA-1 por PCR. En los nueve aislamientos con fenotipo SMR se identificaron los genes 16S rRNA y tuf, evidenciando un 99% de similitud con cepas de ref

APA, Harvard, Vancouver, ISO, and other styles

20

Yoon, Jung-Hoon, So-Jung Kang, Yong-Taek Jung, and Tae-Kwang Oh. "Gaetbulicola byunsanensis gen. nov., sp. nov., isolated from tidal flat sediment." International Journal of Systematic and Evolutionary Microbiology 60, no. 1 (2010): 196–99. http://dx.doi.org/10.1099/ijs.0.011015-0.

Full text

Abstract:

A Gram-negative, non-motile and pleomorphic bacterial strain, SMK-114T, which belongs to the class Alphaproteobacteria, was isolated from a tidal flat sample collected in Byunsan, Korea. Strain SMK-114T grew optimally at pH 7.0–8.0 and 25–30 °C and in the presence of 2 % (w/v) NaCl. A neighbour-joining phylogenetic tree based on 16S rRNA gene sequences showed that strain SMK-114T formed a cluster with Octadecabacter species, with which it exhibited 16S rRNA gene sequence similarity values of 95.2–95.4 %. This cluster was part of the clade comprising Thalassobius species with a bootstrap resamp

APA, Harvard, Vancouver, ISO, and other styles

21

Vaz-Moreira, Ivone, M. Fernanda Nobre, Olga C. Nunes, and Célia M. Manaia. "Pseudosphingobacterium domesticum gen. nov., sp. nov., isolated from home-made compost." International Journal of Systematic and Evolutionary Microbiology 57, no. 7 (2007): 1535–38. http://dx.doi.org/10.1099/ijs.0.64950-0.

Full text

Abstract:

A bacterial strain, DC-186T, isolated from home-made compost, was characterized for its phenotypic and phylogenetic properties. The isolate was a Gram-negative rod that was able to grow at 15–36 °C and pH 5.5–8.0. Strain DC-186T was positive in tests for catalase, oxidase and β-galactosidase activities and aesculin hydrolysis. The predominant fatty acids were the summed feature C16 : 1/iso-C15 : 0 2-OH (42 %) and iso-C15 : 0 (26 %), the major respiratory quinone was menaquinone-7 and the genomic DNA G+C content was 42 mol%. 16S rRNA gene sequence analysis and phenetic characterization indicate

APA, Harvard, Vancouver, ISO, and other styles

22

Yoon, Jung-Hoon, So-Jung Kang, Sooyeon Park, and Tae-Kwang Oh. "Caenispirillum bisanense gen. nov., sp. nov., isolated from sludge of a dye works." International Journal of Systematic and Evolutionary Microbiology 57, no. 6 (2007): 1217–21. http://dx.doi.org/10.1099/ijs.0.64910-0.

Full text

Abstract:

Two Gram-negative, non-spore-forming, motile and helical-shaped bacterial strains, K92T and K93, were isolated from sludge from a dye works in Korea, and their taxonomic positions were investigated by means of a polyphasic approach. Strains K92T and K93 grew optimally at 37 °C and pH 7.0–8.0 in the presence of 0.5 % (w/v) NaCl. They contained Q-10 as the predominant ubiquinone and C18 : 1 ω7c as the major fatty acid. The major polar lipids were phosphatidylcholine, phosphatidylglycerol, diphosphatidylglycerol, phosphatidylethanolamine and two unidentified amino-group-containing lipids that wer

APA, Harvard, Vancouver, ISO, and other styles

23

Li, Yi, Shijie Bai, Caiyun Yang, et al. "Mangrovimonas yunxiaonensis gen. nov., sp. nov., isolated from mangrove sediment." International Journal of Systematic and Evolutionary Microbiology 63, Pt_6 (2013): 2043–48. http://dx.doi.org/10.1099/ijs.0.046193-0.

Full text

Abstract:

A Gram-negative, short-rod-shaped, orange-pigmented bacterium, strain LYYY01T, was isolated from a mangrove sediment sample collected from Yunxiao mangrove National Nature Reserve, Fujian Province, China. 16S rRNA gene sequence comparisons showed that strain LYYY01T is a member of the family Flavobacteriaceae , forming a distinct lineage with species of the genera Meridianimaribacter , Sediminibacter , Gelidibacter and Subsaximicrobium . The 16S rRNA gene sequence similarity between strain LYYY01T and the type strains of related species ranged from 93.9 to 90.9 %. Growth was observed at temper

APA, Harvard, Vancouver, ISO, and other styles

24

Muliani, Muliani, Nurhidayah Nurhidayah, and Muharijadi Atmomarsono. "KARAKTERISASI,ANALISIS GEN 16S-rRNA BAKTERT BL542 DAN EVALUASI EFEK BAKTERISIDANYA TERHADAP Vibrio harveyi PENYEBAB PENYAKIT PADA UDANG WINDU (penaeus monodon)." Jurnal Penelitian Perikanan Indonesia 11, no. 1 (2017): 59. http://dx.doi.org/10.15578/jppi.11.1.2005.59-71.

Full text

Abstract:

Penelitian bertujuan untuk mengetahui karakteristik, mengevaluasi efek bakterisida, dan menentukan posisi relatif isolat BL542 melalui analisis sekuen 16S-rRNA. Penelitian ini terdiri atas beberapa tahapan kerja yaitu: (1) karakterisasi fisiologi dan biokimia, (2) uji sensitivitas terhadap antibiotik, (3) uji daya hambat isolat BL542 terhadap V. Harveyi, (4) uji patogenisitas isolat BL542 terhadap larva udang, (5) uji tantang secara in vitro maupun secara in vivo isolat BL542 dengan V. Haeveyi, (6) analisis gen 16S-rRNA isolat BLS42.

APA, Harvard, Vancouver, ISO, and other styles

25

Fagen, Jennie R., Michael T. Leonard, Janelle F. Coyle, et al. "Liberibacter crescens gen. nov., sp. nov., the first cultured member of the genus Liberibacter." International Journal of Systematic and Evolutionary Microbiology 64, Pt_7 (2014): 2461–66. http://dx.doi.org/10.1099/ijs.0.063255-0.

Full text

Abstract:

The Gram-stain-negative, rod-shaped bacterial isolate BT-1T is the closest relative to the genus ‘Candidatus Liberibacter ’ cultured to date. BT-1T was recovered from the phloem sap of a defoliating mountain papaya in Puerto Rico. The BT-1T 16S rRNA gene sequence showed that strain BT-1T is most closely related to members of the genus ‘Ca. Liberibacter ’ sharing 94.7 % 16S rRNA gene sequence similarity with ‘Ca. Liberibacter americanus ’ and ‘Ca. Liberibacter asiaticus ’. Additionally, average nucleotide identity, 16S rRNA gene sequences and conserved protein sequences supported inclusion of t

APA, Harvard, Vancouver, ISO, and other styles

26

Hoefman, Sven, David van der Ha, Hiroyuki Iguchi, et al. "Methyloparacoccus murrellii gen. nov., sp. nov., a methanotroph isolated from pond water." International Journal of Systematic and Evolutionary Microbiology 64, Pt_6 (2014): 2100–2107. http://dx.doi.org/10.1099/ijs.0.057760-0.

Full text

Abstract:

Two novel methanotrophic strains, R-49797T and OS501, were isolated from pond water in South Africa and Japan, respectively. Strains R-49797T and OS501 shared 99.7 % 16S rRNA gene sequence similarity. Cells were Gram-stain-negative, non-motile cocci with a diplococcoid tendency and contained type I methanotroph intracytoplasmic membranes. The pmoA gene encoding particulate methane monooxygenase was present. Soluble methane monoooxygenase (sMMO) activity, the mmoX gene encoding sMMO and the nifH gene encoding nitrogenase were not detected. Methane and methanol were utilized as sole carbon sourc

APA, Harvard, Vancouver, ISO, and other styles

27

Nogi, Yuichi, Masaki Yoshizumi, Koei Hamana, Masayuki Miyazaki, and Koki Horikoshi. "Povalibacter uvarum gen. nov., sp. nov., a polyvinyl-alcohol-degrading bacterium isolated from grapes." International Journal of Systematic and Evolutionary Microbiology 64, Pt_8 (2014): 2712–17. http://dx.doi.org/10.1099/ijs.0.062620-0.

Full text

Abstract:

Polyvinyl-alcohol-degrading bacteria were isolated from the fruit of a grape in Yokosuka, Japan. The isolated strain, Zumi 37T, was a Gram-stain-negative, rod-shaped, motile, non-spore-forming and strictly aerobic chemo-organotroph, showing optimal growth at pH 7.5, 30 °C and 0.1 % (w/v) NaCl. The major respiratory quinone was Q-8. The predominant fatty acids were iso-C15 : 0, C16 : 0 and C16 : 1ω7c. The major polyamines were homospermidine and putrescine. The predominant polar lipids were diphosphatidylglycerol, phosphatidylglycerol and phosphatidylethanolamine. The DNA G+C content of the nov

APA, Harvard, Vancouver, ISO, and other styles

28

Rosahdi, Tina Dewi, Nurul Tafiani, and Anggita Rahmi Hafsari. "Identifikasi Spesies Isolat Bakteri K2Br5 dari Tanah Karst dengan Sistem Kekerabatan Melalui Analisis Urutan Nukleotida Gen 16S rRNA." al-Kimiya 5, no. 2 (2019): 84–88. http://dx.doi.org/10.15575/ak.v5i2.3836.

Full text

Abstract:

Bakteri adalah kelompok organisme yang tidak memiliki membran inti sel. Setiap bakteri memiliki jenis yang berbeda-beda. Perlu adanya identifikasi untuk mengetahui suatu jenis bakteri sehingga dapat dimanfaatkan secara maksimal. Identifikasi bakteri dapat dilakukan secara fenotip maupun genotip. Namun, identifikasi secara fenotip memiliki kelemahan yakni sering terjadi kesalahan dalam membedakan spesies dan galur bakteri. Tujuan dari penelitian yang dilakukan adalah untuk menentukan spesies bakteri dengan kode K2Br5 yang telah diisolasi dari kawasan tanah Karst. Pada penelitian ini dilakukan a

APA, Harvard, Vancouver, ISO, and other styles

29

Sheu, Shih-Yi, A. B. Arun, Sing-Rong Jiang, Chiu-Chung Young, and Wen-Ming Chen. "Allobacillus halotolerans gen. nov., sp. nov. isolated from shrimp paste." International Journal of Systematic and Evolutionary Microbiology 61, no. 5 (2011): 1023–27. http://dx.doi.org/10.1099/ijs.0.023341-0.

Full text

Abstract:

A novel bacterial strain designated B3AT, isolated from shrimp paste, was investigated by a polyphasic taxonomic approach. Cells stained Gram-positive and were aerobic, non-pigmented, sporulating and rod-shaped with a polar flagellum. 16S rRNA gene sequence analysis indicated that strain B3AT belonged to the class Bacilli and was a member of the family Bacillaceae. Strain B3AT shared low levels of 16S rRNA gene sequence similarity (<94.0 %) with members of other genera in the family Bacillaceae and was most closely related to Halalkalibacillus halophilus BH2T (93.8 % sequence similarity). T

APA, Harvard, Vancouver, ISO, and other styles

30

Khan, Shams Tabrez, Yasuyoshi Nakagawa, and Shigeaki Harayama. "Galbibacter mesophilus gen. nov., sp. nov., a novel member of the family Flavobacteriaceae." International Journal of Systematic and Evolutionary Microbiology 57, no. 5 (2007): 969–73. http://dx.doi.org/10.1099/ijs.0.64729-0.

Full text

Abstract:

A Gram-negative, yellow-pigmented, rod-shaped bacterial strain (Mok-17T) was isolated from marine sediment sampled in Okinawa Island, Japan. Based on analysis of the almost complete sequence of its 16S rRNA gene, strain Mok-17T was found to belong to the family Flavobacteriaceae. Strain Mok-17T showed highest 16S rRNA gene sequence similarity (91 %) to Leeuwenhoekiella marinoflava and Robiginitalea biformata. In a phylogenetic tree based on the 16S rRNA gene, strain Mok-17T formed a deep branch distinct from all other organisms in the family Flavobacteriaceae. The major quinone was MK-6 and th

APA, Harvard, Vancouver, ISO, and other styles

31

Ue, Harumi, Yoshihide Matsuo, Hiroaki Kasai, and Akira Yokota. "Miniimonas arenae gen. nov., sp. nov., an actinobacterium isolated from sea sand." International Journal of Systematic and Evolutionary Microbiology 61, no. 1 (2011): 123–27. http://dx.doi.org/10.1099/ijs.0.019596-0.

Full text

Abstract:

A Gram-positive, non-motile, coccoid- to rod-shaped, non-spore-forming bacterium, designated strain YM18-15T, was isolated from sea sand and studied using a polyphasic taxonomic approach. Strain YM18-15T grew under both aerobic and anaerobic conditions. The cell-wall peptidoglycan type was A4β and ornithine was the diagnostic diamino acid. The polar lipids were phosphatidylglycerol, diphosphatidylglycerol, phosphatidylinositol and an unknown phospholipid, MK-8(H4) was the major menaquinone and the predominant fatty acids were anteiso-C15 : 0 and C16 : 0. The DNA G+C content was 74.2 mol%. High

APA, Harvard, Vancouver, ISO, and other styles

32

Kämpfer, Peter, Stefanie Glaeser, Hans-Jürgen Busse, Tobias Eisenberg, and Holger Scholz. "Falsochrobactrum ovis gen. nov., sp. nov., isolated from a sheep." International Journal of Systematic and Evolutionary Microbiology 63, Pt_10 (2013): 3841–47. http://dx.doi.org/10.1099/ijs.0.049627-0.

Full text

Abstract:

A Gram-stain-negative, rod-shaped, oxidase-positive, non-spore-forming, non-motile bacterium (B1315T) was isolated from the placenta of a sheep with abortion. On the basis of 16S rRNA gene sequence analyses the strain was assigned to the Brucella – Ochrobactrum – Paenochrobactrum – Pseudochrobactrum group with 94.5–94.8 %, 94.3–96.1 %, 95.0–95.1 %, and 95.9–96.1 % sequence similarities to type strains of species of the four genera, respectively. Phylogenetic trees indicated a close relationship to the type strains of Ochrobactrum gallinifaecis and Ochrobactrum oryzae (95.9 and 96.1 % sequence

APA, Harvard, Vancouver, ISO, and other styles

33

Hatayama, Kouta, and Teruaki Kuno. "Croceifilum oryzae gen. nov., sp. nov., isolated from rice paddy soil." International Journal of Systematic and Evolutionary Microbiology 65, Pt_11 (2015): 4061–65. http://dx.doi.org/10.1099/ijsem.0.000537.

Full text

Abstract:

A mesophilic, aerobic, Gram-stain-positive, filamentous bacterial strain, designated ZYf1a3T, was isolated from rice paddy soil in Japan. This strain grew on a solid medium with formation of substrate mycelium; endospores were produced singly along the mycelium. Formation of aerial mycelium was not observed on any of the media tested. This strain produced a characteristic saffron yellow soluble pigment. Cloned 16S rRNA gene sequences of strain ZYf1a3T yielded three different copies (similarity between the three sequences: 99.8–99.9 %). One of these sequences had one base deletion. Phylogenetic

APA, Harvard, Vancouver, ISO, and other styles

34

Wang, Guanghua, Shuailiang Xu, Ge Dang, et al. "Poritiphilus flavus gen. nov., sp. nov., a member of the family Flavobacteriaceae isolated from coral Porites lutea." International Journal of Systematic and Evolutionary Microbiology 70, no. 11 (2020): 5620–26. http://dx.doi.org/10.1099/ijsem.0.004452.

Full text

Abstract:

A novel Gram-stain-negative, non-endospore-forming, non-motile, aerobic bacterium (strain R33T) was isolated from coral Porites lutea and subjected to a polyphasic taxonomic study. The G+C content was 44.5 mol%. The only detected respiratory quinone was menaquinone 6 (MK-6). The major cellular fatty acids were iso-C15 : 0 and iso-C15 : 1 ω6c. The major polar lipids were phosphatidylethanolamine and two unidentified lipids. Global alignment based on 16S rRNA gene sequences indicated that strain R33T shares the highest sequence identity of 93.2 % with Muriicola marianensis A6B8T in the family Fl

APA, Harvard, Vancouver, ISO, and other styles

35

Khan, Shams Tabrez, Yasuyoshi Nakagawa, and Shigeaki Harayama. "Sediminibacter furfurosus gen. nov., sp. nov. and Gilvibacter sediminis gen. nov., sp. nov., novel members of the family Flavobacteriaceae." International Journal of Systematic and Evolutionary Microbiology 57, no. 2 (2007): 265–69. http://dx.doi.org/10.1099/ijs.0.64628-0.

Full text

Abstract:

Two Gram-negative, chemoheterotrophic, non-motile strains, Mok-1-36T and MAOS-86T, were isolated from marine-sediment samples collected from the coasts of Okinawa island and the city of Odawara in Japan, respectively. Phylogenetic studies based on 16S rRNA gene sequences indicated that Mok-1-36T and MAOS-86T were members of the family Flavobacteriaceae, clustering with members of the genera Ulvibacter and Vitellibacter, respectively. Strains Mok-1-36T and MAOS-86T shared pairwise 16S rRNA gene sequence similarities of 93.5 and 89.1 % with the type strains of Ulvibacter litoralis and Vitellibac

APA, Harvard, Vancouver, ISO, and other styles

36

Halpern, Malka, Svetlana Fridman, Yana Aizenberg-Gershtein, and Ido Izhaki. "Transfer of Pseudomonas flectens Johnson 1956 to Phaseolibacter gen. nov., in the family Enterobacteriaceae , as Phaseolibacter flectens gen. nov., comb. nov." International Journal of Systematic and Evolutionary Microbiology 63, Pt_1 (2013): 268–73. http://dx.doi.org/10.1099/ijs.0.033654-0.

Full text

Abstract:

Pseudomonas flectens Johnson 1956, a plant-pathogenic bacterium on the pods of the French bean, is no longer considered to be a member of the genus Pseudomonas sensu stricto. A polyphasic approach that included examination of phenotypic properties and phylogenetic analyses based on 16S rRNA, rpoB and atpD gene sequences supported the transfer of Pseudomonas flectens Johnson 1956 to a new genus in the family Enterobacteriaceae as Phaseolibacter flectens gen. nov., comb. nov. Two strains of Phaseolibacter flectens were studied (ATCC 12775T and LMG 2186); the strains shared 99.8 % sequence simila

APA, Harvard, Vancouver, ISO, and other styles

37

Chen, Shaoxing, Yao Xu, Siqi Sun, Jingwen Liu, and Feilong Chen. "Halomicrococcus hydrotolerans gen. nov., sp. nov., an extremely halophilic archaeon isolated from a subterranean salt deposit." International Journal of Systematic and Evolutionary Microbiology 70, no. 8 (2020): 4425–31. http://dx.doi.org/10.1099/ijsem.0.003534.

Full text

Abstract:

A halophilic archaeon, strain H22T, was isolated from a subterranean salt deposit sampled at Yunnan salt mine, PR China. Colonies of strain H22T were light pink-pigmented. Cells were coccus, non-motile, Gram-stain-negative, and did not lyse in distilled water. The strain was aerobic and grew at 20–55 °C (optimum, 37 °C), in the presence of 10–30 % (w/v) NaCl (20 %) and at pH 6.5–9.0 (pH 7.0). Mg2+ was required for growth (optimum, 0.005 M). Major polar lipids were phosphatidylglycerol, phosphatidylglycerol phosphate methyl ester and sulfated mannosyl-glucosyl-glycerol diether-1. Sequence simil

APA, Harvard, Vancouver, ISO, and other styles

38

Amakata, Daiki, Yasuhiro Matsuo, Kumiko Shimono, et al. "Mitsuaria chitosanitabida gen. nov., sp. nov., an aerobic, chitosanase-producing member of the ‘Betaproteobacteria’." International Journal of Systematic and Evolutionary Microbiology 55, no. 5 (2005): 1927–32. http://dx.doi.org/10.1099/ijs.0.63629-0.

Full text

Abstract:

Four strains (3001T, 2, 12 and 13), which were isolated as chitosanase-producing bacteria from soil from Matsue city (Japan), were studied phenotypically, genotypically and phylogenetically. Based on sequence analysis of 16S rRNA genes, DNA G+C content (67·4–69·2 mol%), quinone type (UQ-8), major fatty acid composition (3-OH 10 : 0, 3-OH 14 : 0) and other phylogenetic studies, strains 3001T, 12 and 13 were found to occupy a separate position in the ‘Betaproteobacteria’. Roseateles depolymerans, Rubrivivax gelatinosus and Ideonella dechloratans were their closest neighbours (93–95 % 16S rRNA ge

APA, Harvard, Vancouver, ISO, and other styles

39

Ali, Alimuddin, and Herlina Rante. "Karakterisasi Mikrobia Rizosfer asal Tanaman Ginseng Jawa (Talinum triangulare) berdasarkan Gen Ribosomal 16S rRNA dan 18S rRNA." JURNAL BIOLOGI PAPUA 3, no. 2 (2018): 74–81. http://dx.doi.org/10.31957/jbp.552.

Full text

Abstract:

The rhizosphere is a biologically active zone of the soil around plant roots that contains soil-borne microbes including bacteria and fungi. The microbes were isolated from rhizosphere soil roots of Java ginseng. The population of microbes was estimated by plate count method. The isolates were identified based on a great variety of morphological, and cultural characteristics. The total of rhizosphere soil microbe population were 20.91(106 cfu.g−1soils) and showed that 12 isolates of bacteria, 15 isolates of actinomycetes, and 10 isolates of fungi which were found in all of soil samples. The mo

APA, Harvard, Vancouver, ISO, and other styles

40

Ekborg, Nathan A., Jose M. Gonzalez, Michael B. Howard, Larry E. Taylor, Steven W. Hutcheson, and Ronald M. Weiner. "Saccharophagus degradans gen. nov., sp. nov., a versatile marine degrader of complex polysaccharides." International Journal of Systematic and Evolutionary Microbiology 55, no. 4 (2005): 1545–49. http://dx.doi.org/10.1099/ijs.0.63627-0.

Full text

Abstract:

Gammaproteobacteria belonging and related to the genus Microbulbifer are an emerging group of complex carbohydrate-degrading marine bacteria. Previously, all of the representatives were placed within Microbulbifer or were unclassified. Recently, a new genus, Teredinibacter, represented by a single species, Teredinibacter turnerae, was formed to include an endosymbiotic branch of these organisms. In this study, based on 16S rRNA gene sequence similarity and phenotypic analyses, a new genus, Saccharophagus, is proposed to accommodate the most versatile marine carbohydrate degrader yet identified

APA, Harvard, Vancouver, ISO, and other styles

41

Khan, Shams Tabrez, Yasuyoshi Nakagawa, and Shigeaki Harayama. "Sediminicola luteus gen. nov., sp. nov., a novel member of the family Flavobacteriaceae." International Journal of Systematic and Evolutionary Microbiology 56, no. 4 (2006): 841–45. http://dx.doi.org/10.1099/ijs.0.64047-0.

Full text

Abstract:

The taxonomic position of four Gram-negative, rod-shaped, golden-yellow-coloured bacteria isolated from marine sediments was determined. Analysis of the almost complete 16S rRNA gene sequences indicated that these isolates belong to the family Flavobacteriaceae. An unclassified bacterium, NBRC 15975, was found to be the closest relative, showing 16S rRNA gene sequence similarity of 93 %; other related genera shared only 87·9–90·5 % similarity. In contrast, the four isolates shared high levels of 16S rRNA gene sequence similarity (99·3–99·7 %) and high DNA–DNA reassociation values (93–104 %). T

APA, Harvard, Vancouver, ISO, and other styles

42

Dridi, Bédis, Marie-Laure Fardeau, Bernard Ollivier, Didier Raoult, and Michel Drancourt. "Methanomassiliicoccus luminyensis gen. nov., sp. nov., a methanogenic archaeon isolated from human faeces." International Journal of Systematic and Evolutionary Microbiology 62, Pt_8 (2012): 1902–7. http://dx.doi.org/10.1099/ijs.0.033712-0.

Full text

Abstract:

During attempts to obtain novel, human-associated species of the domain Archaea , a coccoid micro-organism, designated strain B10T, was isolated in pure culture from a sample of human faeces collected in Marseille, France. On the basis of its phenotypic characteristics and 16S rRNA and mcrA gene sequences, the novel strain was classified as a methanogenic archaeon. Cells of the strain were non-motile, Gram-staining-positive cocci that were approximately 850 nm in diameter and showed autofluorescence at 420 nm. Cells were lysed by 0.1 % (w/v) SDS. With hydrogen as the electron donor, strain B10

APA, Harvard, Vancouver, ISO, and other styles

43

Maturrano, Lenin, María Valens-Vadell, Ramon Rosselló-Mora, and Josefa Antón. "Salicola marasensis gen. nov., sp. nov., an extremely halophilic bacterium isolated from the Maras solar salterns in Peru." International Journal of Systematic and Evolutionary Microbiology 56, no. 7 (2006): 1685–91. http://dx.doi.org/10.1099/ijs.0.64200-0.

Full text

Abstract:

Six strains of extremely halophilic bacteria were isolated from several crystallizer ponds of the Maras solar salterns in the Peruvian Andes. On the basis of 16S rRNA gene sequence similarity, G+C contents and DNA–DNA hybridization results, the six isolates constituted a genomically homogeneous group affiliated with the Gammaproteobacteria. The closest relatives were members of the halophilic genera Halovibrio and Halospina, which showed 16S rRNA gene sequence similarities below 97 % and whole-genome hybridization levels below 33 % for the type strain, 7Sm5T. From the genomic and phenotypic pr

APA, Harvard, Vancouver, ISO, and other styles

44

Abram, Olivia H., Trina E. Tallei, Edwin De Queljoe, and Beivy J. Kolondam. "IDENTIFICATION OF POTENTIAL DIESEL OIL-DEGRADING BACTERIA ISOLATED FROM MANADO SEA PORT BASED ON 16S rRNA GENE." JURNAL ILMIAH SAINS 14, no. 2 (2014): 73. http://dx.doi.org/10.35799/jis.14.2.2014.5932.

Full text

Abstract:

ABSTRACT Petroleum contamination and its derivate in ecosystem are considered as environmental threat all over the world. Some microorganisms exhibit potential to degrade hydrocarbon in contaminated environments. This study aims at identifying potential diesel oil-degrading bacteria grown on artificial media. Bacteria isolated from Manado Sea port were grown in nutrient agar containing artificial diesel oil plus salt water and diesel oil only, respectively. The growing bacteria were isolated and each of them was grown separately to obtain pure isolate. Three bacterial isolates namely AO2, OA3

APA, Harvard, Vancouver, ISO, and other styles

45

Sood, Sakshi, Ram Prasad Awal, Joachim Wink, et al. "Aggregicoccus edonensis gen. nov., sp. nov., an unusually aggregating myxobacterium isolated from a soil sample." International Journal of Systematic and Evolutionary Microbiology 65, Pt_3 (2015): 745–53. http://dx.doi.org/10.1099/ijs.0.061176-0.

Full text

Abstract:

A novel myxobacterium, MCy1366T (Ar1733), was isolated in 1981 from a soil sample collected from a region near Tokyo, Japan. It displayed general myxobacterial features like Gram-negative-staining, rod-shaped vegetative cells, gliding on solid surfaces, microbial lytic activity, fruiting-body-like aggregates and myxospore-like structures. The strain was mesophilic, aerobic and showed a chemoheterotrophic mode of nutrition. It was resistant to many antibiotics such as cephalosporin C, kanamycin, gentamicin, hygromycin B, polymyxin and bacitracin, and the key fatty acids of whole cell hydrolysat

APA, Harvard, Vancouver, ISO, and other styles

46

Widanarni, ,., Dewi Nurhayati, and Dinamella Wahjuningrum. "Analysis of bacterial genetic diversity in biofloc by using ARDRA 16S-rRNA gene." Jurnal Akuakultur Indonesia 12, no. 2 (2015): 128. http://dx.doi.org/10.19027/jai.12.128-135.

Full text

Abstract:

<p class="NoParagraphStyle" align="center"><strong>ABSTRACT</strong></p><p class="NoParagraphStyle" align="center"> </p><p class="NoParagraphStyle">This study aimed to analyze the genetic diversity of bacteria associated in bioflocs using 16S-rRNA polymerase chain reaction (PCR) with ARDRA technique. A total of 38 dominant bacterial isolates was obtained from bioflocs samples and of these isolates, 16S-rRNA gene was then isolated and amplified using PCR. The 16S-rRNA gene of the isolates was then cut using <em>Hae</em>III (5’-GG↓CC) and &lt

APA, Harvard, Vancouver, ISO, and other styles

47

Kandio, Engjinia Frenny, Adithya Yudistira, and John M. R. Runtuwene. "ISOLASI BAKTERI ENDOFIT SIMBION DARI SPONS Stylissa sp. DAN UJI AKTIVITAS ANTIBAKTERI SERTA IDENTIFIKASI SECARA MOLEKULER MENGGUNAKAN GEN 16S rRNA." PHARMACON 10, no. 1 (2021): 649. http://dx.doi.org/10.35799/pha.10.2021.32750.

Full text

Abstract:

ABSTRACTSponges are porous animals that are filter feeders and they become a habitat for microorganisms to nest in their bodies. The result of the symbiosis between sponges and microorganisms, especially in bacteria is the ability of the sponge to produce bioactive compounds. One of the potentials derived from these bioactive compounds is antibacterial. This study aims to isolate and test the antibacterial activity of the endophytic symbiont bacteria Stylissa sp., as well as to carry out molecular identification using the 16S rRNA gene of symbiont bacteria isolates that show the greatest antib

APA, Harvard, Vancouver, ISO, and other styles

48

Mende, Pingkan Stela, Johanis Pelealu, and Beivy Kolondam. "IDENTIFIKASI MOLEKULER BAKTERI DALAM FESES KUCING (Felis domestica) YANG DITUMBUHKAN PADA DE MANN ROGOSA SHARPE AGAR (MRSA)." PHARMACON 8, no. 1 (2019): 73. http://dx.doi.org/10.35799/pha.8.2019.29239.

Full text

Abstract:

ABSTRACTBacteria has many important role in the digestive tract of animals. Beneficial bacteria in the digestive tract are thought to be able to inhibit the growth of pathogenic bacteria, while pathogenic bacteria can cause diseases and infections. This research aimed to grow bacteria living in cat feces and to identify it with molecular method. This study used moleculer identification based on 16S rRNA gene as marker. There were three isolate if bacteria taken from the culture. Two isolates were identified as Enterococcus faecalis (with 99% and 100% in similarity compared with GenBank databas

APA, Harvard, Vancouver, ISO, and other styles

49

Chen, Shuangya, and Xiuzhu Dong. "Acetanaerobacterium elongatum gen. nov., sp. nov., from paper mill waste water." International Journal of Systematic and Evolutionary Microbiology 54, no. 6 (2004): 2257–62. http://dx.doi.org/10.1099/ijs.0.63212-0.

Full text

Abstract:

Two mesophilic anaerobic bacterial strains (Z7T and Z1) were isolated from waste water sludge of the Xinanzhang paper mill, Beijing, China. The strains were Gram-positive, non-spore-forming and motile. Cells were thin rods (0·2–0·4×4·0–8·0 μm). Growth of the strains was observed at 20–42 °C and pH 5·0–7·5. Both strains hydrolysed gelatin and aesculin and fermented several kinds of mono-, di- and oligosaccharides. The fermentation end products formed from glucose were acetate, ethanol, hydrogen and carbon dioxide. The predominant cellular fatty acids were the branched-chain fatty acids isoC15 :

APA, Harvard, Vancouver, ISO, and other styles

50

Eder, Wolfgang, Jörg Peplies, Gerhard Wanner, Anja Frühling, and Susanne Verbarg. "Hydrobacter penzbergensis gen. nov., sp. nov., isolated from purified water." International Journal of Systematic and Evolutionary Microbiology 65, Pt_3 (2015): 920–26. http://dx.doi.org/10.1099/ijs.0.000040.

Full text

Abstract:

A Gram-negative, oxidase- and catalase-positive bacterium, designated strain EM 4T, which varied in shape from rod-shaped to curved or helical with frequently observed bulb-shaped protuberances, was isolated from purified water. 16S rRNA gene sequence analysis indicated that the novel strain belongs to the family Chitinophagaceae within the phylum Bacteroidetes ; the closest relative among bacterial species with validly published names was determined to be Sediminibacterium salmoneum NBRC 103935T, with 93.4 % sequence identity. The main fatty acids of strain EM 4T were iso-C15 : 0, iso-C15 : 1

APA, Harvard, Vancouver, ISO, and other styles

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!