To see the other types of publications on this topic, follow the link: Haji pottery.
Journal articles on the topic 'Haji pottery'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 19 journal articles for your research on the topic 'Haji pottery.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Kristiana, Yustisia, Christa Bella Casey Angel, and Nadya Aurelia. "Identifikasi Potensi Wisata Kreatif di Kabupaten Serang Dan Kabupaten Pandeglang." Tourism Scientific Journal 5, no. 2 (June 26, 2020): 196–208. http://dx.doi.org/10.32659/tsj.v5i2.94.
Full textAbstract:
The number of tourists in Serang and Pandeglang Regency has not reached a high growth rate. To increase the number of tourist visits in the two regencies, the development of creative tourism is needed as a tourist attraction. The purpose of this study is to identify the potential for creative tourism and analyze the supporting factors of the development of creative tourism in Serang and Pandeglang Regencies. This research is a qualitative study using interview and observation methods. The analytical method used is the 4 As tourism component, attractions, amenities, accessibility, and ancillary services. The results of the study indicate that there is a potential for creative tourism in Serang Regency, namely Kampung Seni Yudha Asri, J2 Pottery, Sentra Pengrajin Tas dan Dompet Desa Kadugenep, Durian Jatohan Haji Arif, Sentra Pengrajin Golok Desa Seuat Jaya, Anyer Krakatau Culture Festival (AKCF) dan Bendolan Pamarayan. Creative tours in Pandeglang Regency are Agrowisata Gandamanis, Kampung Domba Juhut Pandeglang, Desa Wisata Banyubiru, Pasar Kaulinan Menes, Kampung Batik Cikadu Tanjung Lesung dan Sentra Pengrajin Kayu Desa Kertajaya. The supporting factors for the development of creative tourism are planning, human resources, conditions of tourism destinations, supporting infrastructure, and institutions. The implication of this research is as considerations for the Regional Government in the development of socialization, training and mentoring programs to increase understanding and self-development for the community regarding creative tourism.
2
Noh,Sung-Hwan. "A Study of Chosen potter in Hagi Japan." Japanese Language and Literature Association of Daehan ll, no. 47 (August 2010): 329–47. http://dx.doi.org/10.18631/jalali.2010..47.019.
Full text
3
Noh,Sung-Hwan. "A study of Korean Japanese potter in Hagi Yamaguchi." Journal of the society of Japanese Language and Literature, Japanology ll, no. 50 (August 2010): 335–58. http://dx.doi.org/10.21792/trijpn.2010..50.017.
Full text
4
노, 성환. "A Study on the Josen Potter Saeki Family in Hagi, Japan." Journal of Japanese Studies 59 (January 15, 2020): 7–22. http://dx.doi.org/10.18841/2019.59.1.
Full text
5
노, 성환. "A Study on the Josen Potter Saeki Family in Hagi, Japan." Journal of Japanese Studies 59 (January 15, 2020): 7–22. http://dx.doi.org/10.18841/2020.59.1.
Full text
6
노, 성환. "A Study on the Josen Potter Saeki Family in Hagi, Japan." Journal of Japanese Studies 59 (January 15, 2020): 7–22. http://dx.doi.org/10.18841/2016.2020.59.1.
Full text
7
Mene, Bau. "Pola Hias Gerabah Pada Situs-Situs di Kawasan Danau Sentani, Papua." Kapata Arkeologi 10, no. 2 (April 25, 2016): 67. http://dx.doi.org/10.24832/kapata.v10i2.223.
Full textAbstract:
Pottery is a type of man-made objects made with raw materials burnt clay, pottery has been known since prehistoric times. Pottery not only used as a fixture of daily needs are also often used as a burial container or as stock tomb. Fragments of pottery were found in the region of Lake Sentani rich decorative patterns including patterns of decorative lines and waves. The purpose of this study was to determine the decorative patterns found on pottery found at sites in the region of Lake Sentani and to know the techniques of pottery were found at sites in the region of Lake Sentani. The method used in this research is the method of data collection and data processing methods. Data collection was performed by means of a survey and excavation, while the data processing is done by classifying the findings for later analysis. The analysis was conducted to see the decorative patterns found on pottery and decorative techniques are used.Gerabah adalah benda jenis buatan manusia yang dibuat dengan bahan baku tanah liat yang dibakar, gerabah sudah dikenal sejak jaman prasejarah. Gerabah selain digunakan sebagai perlengkapan keperluan sehari-hari juga seringkali digunakan sebagai wadah penguburan atau sebagai bekal kubur. Fragmen gerabah yang ditemukan di kawasan Danau Sentani kaya akan pola hias diantaranya pola hias garis dan gelombang. Tujuan penelitian ini adalah untuk mengetahui pola hias yang terdapat pada gerabah yang ditemukan pada situs-situs di kawasan Danau Sentani dan untuk mengetahui teknik pembuatan gerabah yang ditemukan pada situs-situs di kawasan Danau Sentani. Metode yang digunakan dalam penelitian ini adalah metode pengumpulan data dan metode pengolahan data. Pengumpulan data dilakukan dengan cara survei dan ekskavasi sedangkan pengolahan data dilakukan dengan cara mengklasifikasi temuan untuk kemudian dianalisis. Analisis dilakukan untuk melihat pola hias yang terdapat pada gerabah dan teknik hias yang digunakan.
8
S., M. Fadlan. "Analisis Teknologi Laboratoris Tembikar dari Situs-Situs Das Bengawan Solo, Kabupaten Bojonegoro, Provinsi Jawa Timur." KALPATARU 24, no. 1 (May 31, 2015): 47. http://dx.doi.org/10.24832/kpt.v24i1.62.
Full textAbstract:
Abstrak. Tembikar merupakan salah satu sisa benda budaya yang paling sering ditemukan dalam penelitian arkeologi, yang terbuat dari tanah liat yang dibakar. Analisis teknologi laboratoris tembikar dari situs-situs di DAS Bengawan Solo Bojonegoro, bertujuan untuk memperoleh hasil yang akurat tentang sifat fisik dan sifat kimia. Melalui kajian analisis teknologi laboratoris dapat digambarkan kualitas tembikar yang dibuat oleh para pengrajin pada masa lampau. Berdasarkan hasil analisis teknologi laboratoris tembikar dari situs-situs DAS Bengawan Solo, Bojonegoro mempunyai kualitas sedang hingga kualitas baik. Tembikar-tembikar tersebut termasuk dalam kategori peralatan sehari-hari yang berfungsi untuk menampung air, mengolah makanan dan untuk penyajian makanan serta minuman. Tingkat pembakarannya mencapai 600°-800° Celcius, dan warna tembikar didominasi warna gelap (dark colors) dibanding dengan warna terang (light colors). Adanya perbedaan prosentase dari setiap unsur kimia pada tembikar tersebut, tidak terlepas dari daya tahan mineral terhadap pelapukan.Abstract. Pottery, which is made of fired clay, is the most frequently found cultural remains during archaeological researches. Technological Laboratory Analysis on pottery from sites along the Bengawan Solo (Solo River) in Bojonegoro aims at obtaining accurate results about the nature of the physical and chemical properties. Through the technological laboratory analysis can be described the quality of pottery made by craftsmen in the past. Based on the results of the analysis, pottery from the sites along the Bengawan Solo, Bojonegoro Regency, have moderate up to good qualities. The pottery belongs to a category of daily equipment that serves to store water, cook food and to serve food and drink. The rate of heat during firing was up to 600°-800° Celsius, and the color of pottery is predominantly dark colors (black colors) with only a few light colors (bright colors). The difference in the percentage of each chemical element in the pottery is due to the durability of the minerals to weathering.
9
Pertiwi, Isnaindah Jasmine, and Mega Teguh Budiarto. "Eksplorasi Etnomatematika Pada Gerabah Mlaten." Jurnal Cendekia : Jurnal Pendidikan Matematika 4, no. 2 (June 15, 2020): 438–53. http://dx.doi.org/10.31004/cendekia.v4i2.257.
Full textAbstract:
Abstract
Culture is used as a means to learn from everyday life. Mathematics can be associated with daily life, which can be learned through culture. The term mathematics in culture is called ethnomatematics. Each region has its own culture. In the village of Mlaten there is also a legacy that has been passed down, namely pottery with typical Majapahit carvings. The purpose of this study is to explore the mathematical concepts contained in the Mlaten pottery, so that they can be used as learning resources in learning mathematics. Through the study of literature, exploration, and observation, as well as by an ethnographic approach, it can be concluded that the mathematical concepts contained in the Mlaten earthenware are the concept of a circle, the concept of geometry transformation, the concept of flat shape, the concept of curved side space, the concept of function, and the concept of volume rotating objects. Ethnomatematics can make it easier for students to understand everyday problems.
Keyword: Ethnomathematics, Mathematicals concepts, Pottery
Abstrak
Budaya dijadikan sebagai sarana untuk belajar dari kehidupan sehari-hari. Matematika dapat dikaitkan dengan kehidupan sehari-hari, yaitu dapat dipelajari melalui budaya. Istilah matematika dalam budaya disebut dengan etnomatematika. Setiap daerah memiliki budaya masing-masing. Di desa Mlaten juga ada warisan yang sudah turun temurun yaitu gerabah dengan ukiran khas Majapahit. Tujuan penelitian ini adalah untuk mengeksplorasi konsep matematika yang terdapat pada gerabah Mlaten, sehingga dapat dijadikan sumber belajar dalam pembelajaran metematika. Melalui studi literatur, eksplorasi, dan observasi, serta dengan dilakukan pendekatan etnografi, maka dapat disimpulkan bahwa konsep matematika yang terdapat pada gerabah Mlaten adalah konsep lingkaran, konsep transformasi geometri, konsep bangun datar, konsep bangun ruang sisi lengkung, konsep fungsi, dan konsep volume benda putar. Etnomatematika dapat mempermudah siswa memahami permasalahan sehari-hari.
Kata kunci : Etnomatematika, Konsep Matematika, Gerabah
10
Chawari, Muhammad. "BENTENG VAN DEN BOSCH, NGAWI: TEMUAN ARTEFAKTUAL SEBAGAI CERMINAN ALAT-ALAT KEBUTUHAN SEHARI-HARI." Berkala Arkeologi 36, no. 2 (November 26, 2016): 195–210. http://dx.doi.org/10.30883/jba.v36i2.235.
Full textAbstract:
Research in Fort Van den Bosch in Ngawi, East Java Province brings about data on aspects of the buildings and artifacts that accompany it. Regarding the artifacts a number of fragments of pottery, metal, ceramics, glass, animal bones, and shells have been found. They were objects of everyday appliances, except for bones and shells. Those artefacts could show the activities of the fort’s inhabitants in the past.Penelitian di Benteng Van den Bosch di Kabupaten Ngawi, Provinsi Jawa Timur menghasilkan data baik tentang aspek bangunan benteng maupun artefak yang menyertainya. Khusus mengenai temuan artefak, telah ditemukan sejumlah fragmen gerabah, fragmen logam, fragmen keramik asing, fragmen kaca, fragmen tulang, dan fragmen kerang. Fragmen-fragmen tersebut berasal dari benda-benda peralatan sehari-hari, kecuali fragmen tulang dan fragmen kerang. Dengan mempelajari temuan artefaktual diharapkan gambaran tentang aktivitas para penghuni benteng di masa lampau dapat diketahui.
11
Kasnowihardjo, Gunadi. "Petrographic analysis on prehistoric-protohistoric pottery of Northern coastal sites of central java: “early studies of environmental archaeology”." KALPATARU 26, no. 2 (April 30, 2018): 147. http://dx.doi.org/10.24832/kpt.v26i2.312.
Full textAbstract:
AbstractPottery or often called gerabah is one of the results of technology that developed in the neolithic period, until now some people in Central Java in general and in the northern coast of Rembang regency in particular still found pottery craftsmen, one of them is in Balong Mulyo Village, Kragan District, Regency of Rembang. To get raw materials such as clay and sand, Balong Mulyo pottery craftsmen apparently make use of natural resources in their environment. As one artifact made from clay and sand materials, petrographically pottery can be analyzed type content and mineral percentage. The results of an analysis of petrographic samples of pottery fragments from prehistoric-protohistoric sites in the northern coast of Central Java such as Binangun, Leran, Plawangan and Tanjungan sites, have in common with the pottery samples from Balong Mulyo. This is one of the benefits of applying petrographic studies in archaeological research. In addition, the results of this petrographic study can provide an explanation that prehistoric-protohistoric humans in the northern coastal area of Central Java to meet their daily needs have utilized the natural resources of their environment, one of which is in pottery technology.Keywords: Pottery, Neolithic, Petrographic analysis, Raw material, Environment. Abstrak Tembikar atau sering disebut gerabah adalah salah satu hasil teknologi yang berkembang pada masa neolitik, hingga sekarang sebagian masyarakat di Jawa Tengah umumnya dan di daerah pantai utara Kabupaten Rembang khususnya masih ditemukan pengrajin tembikar, salah satu di antaranya adalah di Desa Balong Mulyo, Kecamatan Kragan, Kabupaten Rembang. Untuk mendapatkan bahan baku seperti tanah liat dan pasir, para pengrajin tembikar Balong Mulyo rupa-rupanya memanfaatkan sumberdaya alam di lingkungan mereka. Sebagai salah satu artefak yang dibuat dari bahan baku tanah liat dan pasir, secara petrografis tembikar dapat dianalisis kandungan jenis dan prosentasi mineralnya. Hasil analisis petrografi sampel fragmen tembikar dari situs-situs prasejarah-protosejarah di kawasan pantai utara Jawa Tengah seperti Situs Binangun, Leran, Plawangan, dan Tanjungan, secara garis besar memiliki kesamaan dengan sampel tembikar dari Balong Mulyo. Inilah salah satu manfaat penerapan kajian petrografi dalam penelitian arkeologi. Selain itu, hasil kajian petrografi ini dapat memberikan penjelasan bahwa manusia prasejarah-protosejarah di kawasan pantai utara Jawa Tengah untuk memenuhi kebutuhan hidup sehari-hari mereka telah memanfaatkan sumberdaya alam lingkungannya, salah satu di antaranya adalah dalam teknologi pembuatan tembikar.Kata Kunci: Tembikar, Neolitik, Analisis petrografi, Bahan baku, Lingkungan
12
Noh,Sung-Hwan. "A Study on Lee, Jak Kwang and Lee, Kyung, the Chosun Potter of Hagi, Japan." Journal of North-east Asian Cultures 1, no. 61 (December 2019): 361–79. http://dx.doi.org/10.17949/jneac.1.61.201912.021.
Full text
13
Koniherawati, Koniherawati, and Centaury Harjani. "RE-AKTUALISASI KENDIL HITAM." Corak 8, no. 1 (May 29, 2019): 13–16. http://dx.doi.org/10.24821/corak.v8i1.2687.
Full textAbstract:
“Hidup Segan Matipun Tak Mau” adalah ungkapan yang tepat untuk menggambarkan kondisi kembang-kempisnya hidup kerajinan gerabah tradisional di beberapa daerah, khususnya kerajinan kendil hitam di desa Kasongan, Kendil hitam dikenal dengan sebutan kendil gudeg, kendil ini biasa digunakan sebagai wadah makanan khas Jogja yaitu gudeg. Kendil dihasilkan oleh pengerajin gerabah melalui proses pembuatan secara“tradisional”. Pembuatan kendil hitam sangat tradisional menggunakan bahan tanah liat yang terdapat di alam sekitar, menggunakan peralatan sederhana, serta pembakaran ladang (field firing) suhu rendah berbahan bakar uwuh (daun-daundan ranting kering). Kendil sebagai wadah yang aman untuk makanan. Teknik seni gerabah tradisional ini sudah dikenal sebagai ciptaan manusia sejak jaman prasejarah untuk membuat barang kebutuhan sehari-hari dalam bertahan hidup (life survival). Teknik pembuatan tradisional diwariskan secara turun-temurun oleh nenek moyang, dan saat ini dan mulai bersaing dengan produk industri yang dibuat secara massal. Tulisan ini akan mengangkat keistimewaan kendil hitam dalam bertahan hidup memenuhi kebutuhan untuk wadah makanan gudeg di jaman milenial ini. Studi pustaka, observasi, dan wawancara dengan pendekatan etnografi digunakan sebagai metode penelitian. Hasil dari penelitian diharapkan berguna untuk melengkapi pengetahuan akademik khususnya bagi mahasiswa jurusan keramik, yang selama ini hanya mengenal pembuatan keramik modern dengan peralatan canggih (modern).Kata Kunci: gerabah tradisional, bertahan hidup, era milenial. "Hidup Segan Matipun Tak Mau" is an expression that describes the struggling conditions of conserving traditional pottery crafting in several regions, especially black kendil in Kasongan village. This black kendil, known as gudeg kendil, is commonly used as a container used for storing one of Jogja's most traditional dish, namely gudeg. Kendil is produced by pottery craftsmen through a "traditional" manufacturing process. Black kendil is traditionally made out of clay that is discovered easily in surroundings areas, and by using simple equipment, that is then burnt in the field with low-temperature (field firing) using dried leaves and twigs (uwuh) to produce containers that are food-safe. This traditional pottery art technique has been known as one of human’s creations used in order to produce daily necessities for life survival since the pre-historic times. These traditional manufacturing techniques have been passed down from ancestors to the current generation, and now competes with mass industrial production. This paper will highlight the features of maintaining the use of black kendil as gudeg food containers in this current millennial era. Literature studies, observations, and interviews with the ethnographic approach are used as the methods of research. The results of the study are expected to be useful for academics, particularly students of ceramics major, who are more exposed to modern ceramic manufacturing through the use of advanced equipment. Key-word: traditional pottery, life survival, millenial era.
14
Shen, Y. M., T. C. Huang, C. H. Chao, and H. L. Liu. "First Report of Bacterial Spot Caused by Xanthomonas arboricola pv. pruni on Japanese Plum in Taiwan." Plant Disease 97, no. 6 (June 2013): 835. http://dx.doi.org/10.1094/pdis-11-12-1094-pdn.
Full textAbstract:
Prunus salicina Lindl., also known as Japanese plum, is a temperate-zone fruit tree grown in mountainous areas of Taiwan. The planted area in Taiwan is approximately 3,000 ha. In June 2011, more than 20% of plum fruits harvested in an orchard in Lishan (elevation about 2,000 m) showed black, mostly circular, sunken necrotic lesions. Leaves with a shot-hole appearance and cankered branches were found when investigating the orchard. Bacteria were isolated from symptomatic fruits, leaves, and branches. Isolation on nutrient agar detected colonies that were yellow, mucoid, gram-negative, Xanthomonas-like, and induced hypersensitive responses on tomatoes. Three voucher isolates, BCRC80476, BCRC80478, and BCRC80481, obtained from the fruit, leaf, and branch, respectively, were deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Molecular analyses were conducted for species identification. Sequences of the gyrB gene of the three voucher isolates (GenBank Accession Nos. KC202288, KC202289, and KC202287) were 100% identical to that of Xanthomonas arboricola pv. pruni pathotype strain ICMP51 (2). In addition, DNA fragments of the xopE3 gene (an X. arboricola pv. pruni specific T3E gene, approximately 381 bp) were PCR amplified using the primer pair fw-5′CCGACATTGCCGTCAGCGATCACG3′ and rv-5′AGCGTTCTTGGGTGTGTTGAGCATTTG3′ (1). The bacterial isolates were identified as X. arboricola pv. pruni on the basis of the colony characteristics, sequence homology, and the specific PCR assay. Pathogenicity was confirmed by inoculation of greenhouse-potted P. salicina plants with strains BCRC80476, BCRC80478, and BCRC80481 using bacterial suspensions (6.7 × 108 CFU per ml) in 0.01% Tween 20. Five plants were evenly sprayed with inoculum of each bacterial isolate and covered with plastic bags for 3 days. One week post inoculation, at an average temperature of 19°C, the 15 inoculated plants produced brown-purple spots delimited by a chlorotic margin on the leaves. Three weeks post inoculation, the necrotic leaf spots completely deteriorated, leaving a shot-hole appearance, and the branches showed lesions similar to those observed in the fields. The pathogen was reisolated from the symptomatic tissues, fulfilling Koch's postulates. Control plants sprayed with 0.01% Tween 20 remained symptomless. To our knowledge, this is the first record of X. arboricola pv. pruni causing bacterial spot on P. salicina in Taiwan. References: (1) A. Hajri et al. Appl. Environ. Microbiol. 78:371, 2012. (2) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.
15
Boucharlat, Rémy. "Zohreh Zehbari, Reza Mehr Afarin, Seyyed Rasul Musavi Haji. « Studies on the Structural Characteristics of Achaemenid Pottery from Dahan-E Gholaman »." Abstracta Iranica, Volume 37-38-39 (March 10, 2018). http://dx.doi.org/10.4000/abstractairanica.47273.
Full text
16
Turyati, Turyati, and Nani Sriwardani. "Pertunjukan Seni Talawengkar sebagai Atraksi Seni Budaya di Desa Sitiwinangun Kabupaten Cirebon." Panggung 30, no. 3 (September 28, 2020). http://dx.doi.org/10.26742/panggung.v30i3.1270.
Full textAbstract:
ABSTRACTPottery is a tool or device made of clay and is usually used in everyday life. Pottery is one of the works that was born from the past and still survives today. In the past, pottery was a container for storing crops, foodstuffs, and other consumables. Apart from having functional and historical value, the pottery also has aesthetic value. This pottery is the inspiration for the creation of Talawengkar performance art. Talawengker is defined as shards of pottery, from which the fragments are reused as a medium for children’s play. The object of study is in Sitiwinangun because this area is a location for pottery handicrafts. This article describes the collaborative creative process in research participatory action research. The purpose of creating this artwork is an effort to empower the people of Sitiwinangun Village. The results of the research are in the form of works of art through the Talawengkar performance art attraction pattern using floor patterns and dynamic motion.Keywords: Talawengkar Performance, Pottery, Attractions, Cultural ArtsABSTRAKGerabah merupakan alat atau perangkat yang terbuat dari tanah liat dan biasanya digunakan di kehidupan sehari-hari. Gerabah salah satu karya yang lahir dari masa lalu dan masih bertahan sampai sekarang. Di masa lampau, gerabah merupakan perabotan wadah penyimpanan hasil tanam, bahan makanan, hingga barang pakai lainnya. Selain memiliki nilai fungsi dan sejarah, gerabah juga memiliki nilai estetika. Gerabah inilah yang menjadi latar belakang inspirasi sebagai penciptaan seni pertunjukan Talawengkar. Talawengker diartikan sebagai pecahanpecahan gerabah, dari pecahan itulah yang dimanfaatkan kembali menjadi media permainan anak. Objek studi berada di Sitiwinangun, karena daerah ini merupakan lokasi kerajinan gerabah. Artikel ini memaparkan proses kreatif kolaboratif dalam penelitian participation action reseach. Tujuan penciptaan karya seni ini adalah sebagai upaya pemberdayaan masyarakat Desa Sitiwinangun. Hasil penelitian berupa karya seni melalui pola atraksi seni pertunjukan Talawengkar mengunakan pola lantai dan gerak dinamis.Kata kunci: Pertunjukan Talawengkar, Gerabah, Atraksi, Seni Budaya
17
FR, Fadlillah, Demes Nurmayanti, and Fitri Rokhmalia. "PEMANFAATAN LIMBAH MARMER SEBAGAI BAHAN CAMPURAN UNTUK PEMBUATAN PAVING BLOCK." GEMA LINGKUNGAN KESEHATAN 16, no. 2 (August 1, 2018). http://dx.doi.org/10.36568/kesling.v16i2.834.
Full textAbstract:
Sampai saat ini pemanfaatan limbah marmer kurang maksimal. Perminggu dapat menghasilkan limbah ± 1 sampai 10 ton. Paving block pada umumnya menggunakan campuran pasir dan semen dengan perbandingan 1 : 5. Tujuan penelitian ini mengetahui adanya pengaruh perbedaan kuat tekan dan serap air dengan komposisi berbeda dan pengujian hari dengan mengacu standart (SNI 03-0691-1996).Disini mencoba memanfaatkan limbah digunakan untuk Paving block dengan 4 variasi campuran 1 Pc : 5 Ps, 1 Pc : 5 Lm, 1 Pc : 3 Lm : 2 Ps, 1 Pc : 2 Lm : 3 Ps dengan uji kuat tekan dan serap air hari ke-7, 14, 21 dan 28 hari. Penelitian ini merupakan penelitian eksperimen dengan menggunakan rancangan Pottest Only Control Group Design dan data di analisis dengan uji One Way Anova.Hasil penelitian menunjukkan uji kuat tekan pada kontrol dan 4 variasi paling tinggi hari ke-28 sebesar 2,10 MPa dan variasi kode B 0,86, kode C 1,47 dan kode D 2,09 (MPa). Hasil uji serap air memenuhi standart maksimal penyerapan 10%. Berdasarkan uji statistik signifikan menunjukkan 0,001 < 0,05, yang berarti Ho ditolak ada perbedaan kuat tekan dan serap air Paving block dengan ketiga variasi kelompok.Kesimpulan kuat tekan Paving block kontrol dan 4 variasi paling tinggi hari ke-28 2,10 MPa dan komposisi D 2,09 MPa tetapi masih di bawah standart. Uji serap air Paving block memenuhi standart. Disarankan peneliti selanjutnya menambah campuran 2 Pc : 3 Lm : 5 Ps dan penambahan umur 35 hari. Kata Kunci : Limbah Marmer, Kuat Tekan, Serap Air, Paving Block
18
Hidayah, Euis Nurul, Shofi Nasyi'atul Hikmah, and Muhammad Firdaus Kamal. "EFEKTIVITAS MEDIA FILTER DALAM MENURUNKAN TSS DAN LOGAM Fe PADA AIR SUMUR GALI." Jukung (Jurnal Teknik Lingkungan) 5, no. 2 (October 31, 2019). http://dx.doi.org/10.20527/jukung.v5i2.7313.
Full textAbstract:
Masyarakat Desa Tambak Rejo, Kecamatan Waru, Kabupaten Sidoarjo, masih mengunakan air sumur sebagai kebutuhan sehari-hari. Air sumur perlu dilakukan pengolahan agar layak dikonsumsi dengan menggunakan berbagai jenis media melalui proses filtrasi. Tujuan penelitian adalah mengetahui pengaruh jenis media terhadap penurunan TSS dan logam Fe yang terkandung pada air sumur gali dengan single media filter. Reaktor yang digunakan yaitu slow sand filter dengan aliran down flow kecepatan 0,4 m/jam. Parameter yang diuji adalah Total Suspended Solid (TSS) dan logam Fe. Variasi dalam penelitian ini yaitu jenis dan ketinggian media filter. Media yang digunakan yaitu pecahan gerabah, pasir bancar, dan manganese greensand dengan ketinggian media 20 dan 30 cm. Sampel yang digunakan adalah air sumur gali daerah Tambak Rejo, Waru Sidoarjo. Analisis TSS dengan metode Gravimetri dan Fe dengan Spektrofotometri. Hasil yang diperoleh menunjukan media pasir bancar mampu bekerja lebih baik daripada media yang lainnya. Persentase penurunan konsentrasi TSS pada ketinggian 20 dan 30 cm sebesar 76,92% dan 80,00% dan penurunan konsentrasi Fe pada ketinggian 20 dan 30 cm sebesar 80,00% dan 84,19%. Hal ini menunjukan bahwa variasi jenis dan ketinggian media berpengaruh terhadap penurunan konsentrasi TSS dan Fe. Air yang dihasilkan telah memenuhi baku mutu air bersih sehingga aman untuk memenuhi kebutuhan rumah tangga. Kata kunci: Fe, pasir bancar, pecahan gerabah, manganese greensand, total suspended solidThe citizen of Tambak Rejo Village, Waru District, Sidoarjo Regency, still use well water as their daily activities. Well water needs to be processed so that it is suitable for consumption by using various types of media through the screening process. The purpose of the study was to determine the effect of the type of media in decrease TSS and Fe contained in well water dug with a single media filter. The reactor used is a slow sand filter with a downflow speed of 0.4 m/hour. The parameters tested were Total Suspended Solid (TSS) and Fe. Variations in this study are the type and height of the filter media. The media used are pottery fragments, bancar sand, and manganese greensand with media heights of 20 and 30 cm. The sample used was well water dug in the area of Tambak Rejo Village, Waru District, Sidoarjo Regency. TSS analysis with Gravimetric and Fe methods with Spectrophotometry. The results obtained show that bancar sand media is able to work better than other media. The percentage decrease in TSS concentration at the height of 20 and 30 cm was 76.92% and 80.00% and a decrease in Fe concentration at the height of 20 and 30 cm was 80.00% and 84.19%.This shows that variations in the type and height of the media influence the decrease in TSS and Fe concentrations. The water produced meets the quality standards of clean water so it is safe to meet daily activities. Keywords: Fe, bancar sand, pottery fragments, manganese greensand, total suspended solid
19
Zhu, Jiangsong, Jian Ma, Fan Zhang, Yinqiu Cui, Marcella Festa, Tongyuan Xi, Meng Ren, Yinchen Wang, Ben Li, and Feixiang Huang. "The Baigetuobie cemetery: New discovery and human genetic features of Andronovo community’s diffusion to the Eastern Tianshan Mountains (1800–1500 BC)." Holocene, December 7, 2020, 095968362097026. http://dx.doi.org/10.1177/0959683620970260.
Full textAbstract:
Andronovo has been regarded as one of the most powerful cultures in Central Asia, which reflected frequent cultural interflow, people migration, and technique diffusion on the Bronze Age Eurasian steppes. In the past decade, many new discoveries in Xinjiang, such as Adunqiaolu and Jartai, have drawn broad attention to the communication of the Andronovo culture in the central Tianshan Mountains. However, systematic study is still insufficient on the communication and influence of the Andronovo culture or the “Andronovo phenomenon” along the Tianshan Mountains. Based on our comprehensive investigation of tomb structure, funeral rituals and assemblages, this article reclassifies relevant Andronovo remains in Xinjiang into five categories. Two categories represented by the Xiabandi cemetery and the Adunqiaolu show clear resemblance to those at Semirech’ye in all aspects, which indicated people in these regions may have maintained close and consistent interaction. Other three categories in the Kuokesuxi and Tangbalesayi cemetery have different tomb structures and funeral rituals from those typical discoveries of the Andronovo cultures in Central Asia in spite of the their similarity in pottery and bronze ornaments, which can be considered as the result of product exchange or technical communication, rather than population migration. New discovery of the Baigetuobie cemetery with evidence of tomb structure, dating, and human genetic features in the Balikun grassland suggested that there might be a small group of people, probably came from the central Tianshan Mountains or Semirech’ye or further west, had migrated to the Eastern Tianshan Mountains about 1600 BC, which was likely facilitated by the relatively warm and humid environment. They had preserved their traditional tomb architecture and were not active in cultural interaction and population fusion with people of Hami Oasis in the south. Due to some reason unknown, people of Baigetuobie had faded away from Balikun grassland after a short time.