Log in

Relevant bibliographies by topics / Identity Testing in Number Fields

Contents

Journal articles

Academic literature on the topic 'Identity Testing in Number Fields'

Author: Grafiati

Published: 11 January 2025

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Identity Testing in Number Fields.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Journal articles on the topic "Identity Testing in Number Fields"

1

Mérai, László. "Values of rational functions in small subgroups of finite fields and the identity testing problem from powers." International Journal of Number Theory 16, no. 02 (2019): 219–31. http://dx.doi.org/10.1142/s1793042120500128.

Full text

Abstract:

Motivated by some algorithmic problems, we give lower bounds on the size of the multiplicative groups containing rational function images of low-dimensional affine subspaces of a finite field [Formula: see text] considered as a linear space over a subfield [Formula: see text]. We apply this to the recently introduced algorithmic problem of identity testing of “hidden” polynomials [Formula: see text] and [Formula: see text] over a high degree extension of a finite field, given oracle access to [Formula: see text] and [Formula: see text].

APA, Harvard, Vancouver, ISO, and other styles

2

Karpinski, Marek, László Mérai, and Igor E. Shparlinski. "Identity testing and interpolation from high powers of polynomials of large degree over finite fields." Journal of Complexity 49 (December 2018): 74–84. http://dx.doi.org/10.1016/j.jco.2018.07.006.

Full text

APA, Harvard, Vancouver, ISO, and other styles

3

MacKenzie, Tyler D. B., Manphool S. Fageria, Xianzhou Nie, and Mathuresh Singh. "Effects of Crop Management Practices on Current-Season Spread of Potato virus Y." Plant Disease 98, no. 2 (2014): 213–22. http://dx.doi.org/10.1094/pdis-04-13-0403-re.

Full text

Abstract:

The current-season spread of Potato virus Y (PVY) was monitored in 19 fields under various management practices in New Brunswick, Canada, through the 2011 and 2012 growing seasons. The focus of this study was to evaluate the role of seedborne PVY inoculum, aphid vector abundance, and the numbers, timing, and types of insecticide and mineral oil sprays, and to confirm the reliability and forecasting capacity of midseason PVY testing. In each field, 100 to 110 virus-free plants were identified shortly after emergence and were assessed four times from early July to early September (after top-kill

APA, Harvard, Vancouver, ISO, and other styles

4

Agussalim, Muliana Djafar, and Andi Syam Rizal. "Analisis Potensi Debit Air Tanah Melalui Pumping Test Metode Step Draw Down pada Sumur Bor Irigasi di Desa Bonto Rannu, Kecamatan Kajang, Kabupaten Bulukumba, Sulawesi Selatan." JFT: Jurnal Fisika dan Terapannya 9, no. 2 (2022): 127–37. http://dx.doi.org/10.24252/jft.v9i2.32277.

Full text

Abstract:

The rice fields in Bonto Rannu Village, Kajang District, Bulukumba Regency are dominated by rainfed rice fields. This species has limitations in the dry season because irrigation/agricultural irrigation completely depends on rainwater. Therefore, it is necessary to identify alternative irrigation sources to sustain farmers' farming activities in Bonto Rannu Village. This study aims to analyze the number of groundwater wells by testing in the form of a pump test (pumping test) with the step draw-down method. The optimum discharge (Qopt) of well 1 is 0.01876 m3/s or 67.53 m3/hour with an optimum

APA, Harvard, Vancouver, ISO, and other styles

5

Bazanova, E. M., A. V. Gorizontova, N. N. Gribova, T. M. Chikake, and A. V. Samosyuk. "Development and Prospects of National Intelligent System for Testing General Language Competencies Deployed Through Neural Network Solutions." Vysshee Obrazovanie v Rossii = Higher Education in Russia 32, no. 8-9 (2023): 147–66. http://dx.doi.org/10.31992/0869-3617-2023-32-8-9-147-166.

Full text

Abstract:

The article presents the results of approbation of the intellectual system for testing general language competences (ISTOK) developed by testologists, linguists, specialists in methodology of teaching foreign languages and in artificial intelligence. This system includes a range of tests assessing language ability at levels from A2 to C1 of the Common European Framework of Reference (CEFR), as well as an adaptive placement test. All test materials are calibrated according to the CEFR. ISTOK is an adaptive testing system deployed through neural network solutions and providing assessment of rece

APA, Harvard, Vancouver, ISO, and other styles

6

Kotsiubivska, Kateryna, Olena Tymoshenko, Kostiantyn Bulyha, and Ihor Yarokhno. "Application of Pseudo-Random Numbers in System Design." Digital Platform: Information Technologies in Sociocultural Sphere 6, no. 1 (2023): 53–62. http://dx.doi.org/10.31866/2617-796x.6.1.2023.283945.

Full text

Abstract:

The purpose of the article is to study and search for optimal strategies for modelling information systems using pseudo-random numbers to improve the performance of information systems and to determine the optimal parameters of random number distributions; to analyze efficient algorithms for generating pseudo-random numbers. The research methods are based on the application of a systematic approach to analyzing the benefits of using pseudorandom numbers in the design of information systems. Scientific novelty. The article analyses the advantages of stochastic modelling of information systems u

APA, Harvard, Vancouver, ISO, and other styles

7

Kurbanismailov, Z. M., A. T. Tarlanov, and E. M. Akimov. "The technique of point visualization of the electric field in space and time." Russian Technological Journal 9, no. 3 (2021): 58–65. http://dx.doi.org/10.32362/2500-316x-2021-9-3-58-65.

Full text

Abstract:

Testing of electronic devices is an integral part of the technological process of any manufacturer of such equipment. In this case, an electronic device is understood as an energy-intensive unit such as a mobile phone, data center or spacecraft. One of the key stages of testing is to identify the effect of electric fields on various electronic components of the device. This stage often requires making a mock-up of some part of an unfinished device in order to fix interference with special equipment. This requires time, financial and human resource costs. In order to reduce these costs in the m

APA, Harvard, Vancouver, ISO, and other styles

8

Fajri, Muhammad. "Penerapan Digital Signature Untuk Identitas File Audio Dengan Metode Snefru." Management of Information System Journal 1, no. 1 (2022): 19–28. http://dx.doi.org/10.47065/mis.v1i1.397.

Full text

Abstract:

In the era of information technology that is developing very rapidly, the use of signatures has been widely applied digitally through digital signatures. Digital signatures along with the times have led to the need for authentication of data or files that are used digitally. Its use also aims to avoid counterfeiting or interference. Currently, the use of digital signatures has been widely applied to software distribution, financial transactions, file transfers. The crime of falsifying audio files is a serious problem in various fields. Audio authenticity testing is important and significant in

APA, Harvard, Vancouver, ISO, and other styles

9

Nuthakki, Siddhartha, Sai Kalyana pranitha buddiga, and Sonika Koganti. "Exploring Deep Learning Models for Image Recognition: A Comparative Review." Signal & Image Processing : An International Journal 15, no. 3 (2024): 01–10. http://dx.doi.org/10.5121/sipij.2024.15301.

Full text

Abstract:

Image recognition, which comes under Artificial Intelligence (AI) is a critical aspect of computer vision, enabling computers or other computing devices to identify and categorize objects within images. Among numerous fields of life, food processing is an important area, in which image processing plays a vital role, both for producers and consumers. This study focuses on the binary classification of strawberries, where images are sorted into one of two categories. We Utilized a dataset of strawberry images for this study; we aim to determine the effectiveness of different models in identifying

APA, Harvard, Vancouver, ISO, and other styles

10

Martin, R. R., I. E. Tzanetakis, J. E. Barnes, and J. F. Elmhirst. "First Report of Strawberry latent ringspot virus in Strawberry in the United States and Canada." Plant Disease 88, no. 5 (2004): 575. http://dx.doi.org/10.1094/pdis.2004.88.5.575a.

Full text

Abstract:

Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5′ CCTCTCCAACC-TGCTAGACT 3′) and SLRSV R (5′ AAGCGCATGAAGGTGTAACT 3′) that amplify a 497-bp fragment of RNA 2 of Strawber

APA, Harvard, Vancouver, ISO, and other styles

More sources

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!