Academic literature on the topic 'Kuril Islands (R.S.F.S.R.)'

The floodplain tall-herb forests occur in insular part of northeastern Asia along about 2 000 km the latitude gradient from temperate forest zone of Hokkaido (Japan) to boreal zone of central Kamchatka (Russia), including Sakhalin and the Kuril Islands. The climate is oceanic or suboceanic, and monsoons are expressed. Spring snowmelt and abundant rainfall during tropical cyclones cause flooding (Vasilyev, 1979). Climatic and landscape conditions allow tall herbs (also called “giant herbs”) to form herb communities (ass. Cirsio kamtschaticae–Polygonetum sachalinensis (Ohba 1973) Ohba et Sugawara 1982,class Filipendulo–Artemisietea montanae Ohba 1973) as well, and herb layer in forests (Ohba, Sugawara, 1982; Morozov, 1994). The aim of our research is to describe floodplain tall herb forests on Sakhalin Isl. and identify their syntaxonomic position in phytosociological system of northeastern Asia. The field work was carried out in 2015–2017 in the floodplains of 24 rivers (the basin of 15 river systems) in Central and South Sakhalin. In total 81 relevés were completed at 10×10 m and 5×20 m sample plots. The plant cover (in percent) was determined visually. The following scale was used to transfer these figures into abundance scores for Table format: 7 —76–100 %, 6 — 51–75 %, 5 — 26–50 %, 4 — 11–25 %, 3 — 6–10 %, 2 — 2–5 %, 1 — 1 %, + — <1 %, r — <0.1 %. Clustering (flexible-beta, -0.25) was used for grouping with Bray-Curtis dissimilarity in JUICE 7.0. Only vascular plant species were involved in the analysis, because bryophytes were not identified in the each rele­vé. 22 relevés were removed from analysis, because they did not clearly belong to homogeneous vegetation groups. After clustering 6 groups of relevés were recognized, which were interpreted in a rank of subassociations. We made synoptic Table with the original vegetation data of Sakhalin and 16 published relevés from Kamchatka (Neshatayeva, 2009), and 19 from Hokkaido (Vegetation…, 1988). We describe the new alliance Filipendulo camtschaticae–Salicion udensis (holotypus — the ass. Petasito ampli–Salicetum udensis, Table 2) of class Salicetea sachalinensis Ohba 1973 (syn. Salicetea schwerinii Achtyamov 2001). The alliance includes tall herb forest communities of the insular part of northeastern Asia with Salix spp., Alnus hirsuta, and Populus suaveolens dominance. Differential species combination: Carex dispalata, Cirsium kamtschaticum, Filipendula camtschatica, Heracleum lanatum, Senecio cannabifolius, Urtica platyphylla. Main dominant species: A. hirsuta, Salix udensis, Filipendula camtschatica, Matteuccia struthiopteris, Urtica platyphylla. Communities of the ass. Petasito ampli–Salicetum udensis (holotypus — relevé 20, Table 2) occur in the southern part of Sakhalin Isl., Southern Kuril Islands, and Hokkaido in floodplain habitats on the alluvial soils and occasionally on wet slopes. The dominant species in tree layer are Alnus hirsuta and Salix udensis (median height is 12–13 m, canopy cover is 55 %). The shrub layer is absent or moderately developed (cover is 2 %). The main shrub species is Sambucus racemosa. The tall herbs often suppress the growth of shrubs. The herb layer consist of three sublayers (total cover is 100 %). The moss layer is not deve­loped (co­ver less 1 %). Differential species combination: Alnus hirsuta, Angelica ursina, Parasenecio hastatus subsp. orientalis, Petasites amplus, Salix udensis, Symplocarpus renifolius. The subass. Petasito ampli–Salicetum udensis lysichitonetosum camtschatcensis (holotypus — relevé 3, Table 2) includes communities with Lysichiton camtschatcense, Caltha fistulosa, and Carex rhynchophysa (differential species combination) on the wettest sites of the rivers’ valleys and along the banks of tributary streams on alluvial groundwater and hydromorphic soils. The subass. Petasito ampli–Salicetum udensis ulmetosum laciniatae is described as nomen provisorium. We found communities on the rarely flooding sites of river terraces in the mountain river valleys in South Sakhalin. Ulmus laciniata dominates in tree layer together with Alnus hitsuta and Salix udensis. Eleutherococcus senticosus and Actinidia kolomikta (shrub form) occasionally form the shrub layer. The communities are similar to those of Japanese azonal union Ulmion davidianae Suz.-Tok. 1954, azonal order Fraxino-Ulmetalia Suz.-Tok. 1967 of zonal deciduous temperate forest class Fagetea crenatae Miyawaki, Ohba et Murase 1964. Differential species combination: Actinidia kolomikta, Eleutherococcus senticosus, Ulmus laciniata. The communities of the ass. Filipendulo palmatae–Salicetum udensis (holotypus — relevé 4, Table 3) are distributed in the central part of Sakhalin Isl. We found them in the basins of the two largest Sakhalin rivers — Tym and Poronay, and in small river valleys in the East Sakhalin Mountains. The tree layer consist of Alnus hirsuta and Salix udensis (height is 11–14 m, canopy density is 60 %), and with Chosenia arbutifolia, Populus suaveolens, Fraxinus mandshurica, Ulmus japonica in phytosociological units of the lower rank. Padus avium, Rosa amblyotis, Swida alba, Sorbaria sorbifolia, Sambucus racemosa are more or less abundant in the shrub layer (cover is 13 %). The herb layer consists of two or three sublayers (cover is 65 %). The cover of bryophytes is uneven, median cover is less 1 %. Differential species combination: Carex sordida, Filipendula palmata, Fimbripetalum radians, Ligularia fischeri, Padus avium, Parasenecio hastatus, Rosa amblyotis. Differential species combination of the subass. Filipendulo palmatae–Salicetum udensis typicum: Aconitum karafutense, Galium triflorum, Lactuca sibirica, Parasenecio auriculatus, Trautvetteria japonica, Trientalis europaea, Viola epipsiloides. The subass. Filipendulo palmatae–Salicetum udensis populetosum suaveolentis (holotypus — ­relevé 21, Table 3) unites the forests with Chosenia arbutifolia and Populus suaveolens. They can be renewed on alluvial pebble beds. The mature forest stands are often located in the middle part of the floodplains between the abandoned channels. Differential species combination: Chosenia arbutifolia, Crataegus chlorosarca, Populus suaveolens, Sorbaria sorbifolia. Subass. Filipendulo palmatae–Salicetum udensis ulmetosum japonicae is described as nomen provisorium. The communities are developed in the Tym River valley on the high, rarely flooding river benches. The location of the communities is nearby to the northeastern area distribution of broad-leaved trees. Fraxinus mandshurica and Ulmus japonica form tree canopy with Alnus hirsuta, Salix rorida, and Salix udensis. The syntaxonomical position of the subassociation could be changed after getting more data. Diffe­rential species combination: F. mandshurica, Salix rorida, U. japonica. We describe the ass. Phalarido arundinaceae–Salicetum schwerinii (holotypus — relevé 23, table 20 in Vegetation…, 1988; tables are attached to the original publication in a form of separate sheets without page numbers) instead of Salicetum petsusu–sachalinensis subass. von Phalaris arundinacea Okuda in Miyawaki 1988 nom. inval. (2d, 3o) (union Salicion subfragilis Okuda 1978, order Sedo–Salic­etalia subfragilis Okuda 1978, class Salicetea sacha­linensis). After analysis of phytosociological data, we’ve reached the conclusion, that the earlier described original names Salicetum petsusu–sachalinensis ­subass. typicum Okuda in Miyawaki 1988 nom. inval. and subass. von Angelica ursina Okuda in Miyawaki 1988 nom. inval. (relevés 24–34, Table 20; Vegetation…, 1988) have to be considered as subass. Petasito ampli–Salicetum udensis typicum. These communities do not contain Salix nipponica (= S. subfragilis auct. Fl. Japon., non Andersson) — diagnostic species of the alliance Salicion subfragilis Okuda 1978 and the order Sedo-Salicetalia subfragilis Okuda 1978.

Hemicycla (Adiverticula) diegoi n. sp. from the westernmost part of the Teno massif above the Lighthouse at Punta de Teno, Tenerife, Canary Islands is described and compared to conchologically and anatomically similar species in the genus Hemicycla Swainson, 1840. The validity of the new species is corroborated by a phylogenetic analysis including several congeneric species, interand intraspecific genetic distances and a morphometric comparison by means of a discriminant function analysis. Hemicycla cf. paivanopsis (Mabille, 1882) and Hemicycla quadricincta quadricincta (Morelet, 1864) from La Gomera and Hemicycla berkeleii (R. T. Lowe, 1861) from Gran Canaria are tentatively placed in Hemicycla s. str. on the basis of a phylogenetic analysis. Furthermore, Eobania vermiculata (O. F. Müller, 1774) is reported as an introduced species in Gran Canaria for the first time.

Kasim F, Kadim MK, Nursinar S, Karim Z, Lamalango A. 2019. Comparison of true mangrove stands in Dudepo and Ponelo Islands, North Gorontalo District, Indonesia. Biodiversitas 20: 259-266. This study aimed to investigate and compare the current status of mangrove areas, as well as the composition and species diversity of mangrove stands in both regions of Dudepo and Ponelo Islands. The results showed that the mangrove areas calculated using the segmentation method in classifying image of Landsat-8 OLI (acquisition on September 2017) were 279.46 ha (Dudepo Island) and 113.35 ha (Ponelo Island) respectively. A total of 13 species of true mangrove were recorded from both islands, using survey method from 9 transect lines (TL), with a distance ranging from 40 to 210 meters (1-6 quadrats) per transect. The mean densities of trees were 2133 ± 329.78 ha-1 (Dudepo Island) and 2111 ± 234.28 ha-1 (Ponelo Island), while those of saplings and seedlings were 58 ± 13.48 ha-1 and 1425 ± 113.96 ha-1 (Dudepo Island), and 79 ± 14.51 ha-1 and 2963 ± 443.22 ha-1 (Ponelo Island). The mean diameter and basal area were 19.73 ± 10.65 cm and 84.22 ± 67.67 m2ha-1 (Dudepo Island), 17.04 ± 1.46 cm and 60.07 ± 15.12 m2ha-1 (Ponelo Island), respectively. The Importance Value Index (IVI) ranged between 3.97-114.87 (Dudepo Island) and 6.04-82.18 (Ponelo Island). The dominant and codominant species based on IVI in both islands were Rhizophora apiculata Blume and R. stylosa Griff. The indexes of diversity, richness, and evenness of mangrove species in both islands were 0.34-1.70, 0.48-1.18, 0.47-0.94 (trees), 0.00-1.10, 0.00-1.82, 0.00-1.00 (saplings), and 0.00.-1.48, 0.00-1.44, 0.72-1.00 (seedlings), respectively. The Bray-Curtis similarity index between Dudepo and Ponelo Islands, based on the overall values of community attributes, was 0.75.

A conference having the title The Three Galileos: the Man, the Spacecraft, the Telescope, was held at the University of Padova from 7-10 January 1997. The conference was jointly organized by the U.S. space agency NASA, JPL, the German space agency DARA, the University and Astronomical Observatory of Padova, and the Telescopio Nazionale Galileo, with the added support of the International Astronomical Union. The scientific committee was composed of: C. Barbieri (Chairman, University of Padova), S. Atreya (University of Michigan), E. Bellone (University of Padova), M. Belton (NOAO), P. Benvenuti (ESA), F. Bertola (University of Padova), M. Calvani (Astronomical Observatory of Padova), G. Cariolaro (University of Padova), W. Ip (Max-Planck-Institute for Aeronomy), T. Johnson (JPL), T. Owen (University of Hawaii), J. Rahe (NASA), and R. West (ESO). The purpose was to discuss the discovery of the Medicean Moons by Galileo Galilei in Padova from 7-15 January 1610, the results of the Galileo spacecraft during the cruise phase and while orbiting the Jovian system, and the construction of the 3.5-m active-optics Italian telescope Galileo (TNG) in the Canary Islands.

ABSTRACT Mycoplasma genitalium is a human pathogen that mediates cell adhesion by a complex structure known as the attachment organelle. This structure is composed of cytadhesins and cytadherence-associated proteins, but few data are available about the specific role of these proteins in M. genitalium cytadherence. We have deleted by homologous recombination the mg191 and mg192 genes from the MgPa operon encoding the P140 and P110 cytadhesins. Molecular characterization of these mutants has revealed a reciprocal posttranslational stabilization between the two proteins. Loss of either P140 or P110 yields a hemadsorption-negative phenotype and correlates with decreased or increased levels of cytoskeleton-related proteins MG386 and DnaK, respectively. Scanning electron microscopy analysis reveals the absolute requirement of P140 and P110 for the proper development of the attachment organelle. The phenotype described for these mutants resembles that of the spontaneous class I and class II cytadherence-negative mutants [G. R. Mernaugh, S. F. Dallo, S. C. Holt, and J. B. Baseman, Clin. Infect. Dis. 17(Suppl. 1):S69-S78, 1993], whose genetic basis remained undetermined until now. Complementation assays and sequencing analysis demonstrate that class I and class II mutants are the consequence of large deletions affecting the mg192 and mg191-mg192 genes, respectively. These deletions originated from single-recombination events involving sequences of the MgPa operon and the MgPa island located immediately downstream. We also demonstrate the translocation of MgPa sequences to a particular MgPa island by double-crossover events. Based on these observations, we propose that in addition to being a source of antigenic variation, MgPa islands could be also involved in a general phase variation mechanism switching on and off, in a reversible or irreversible way, the adhesion properties of M. genitalium.

Abstract One of the hallmarks of apoptosis is the caspase-dependent exposure of phosphatidylserine (PtdSer) on cell surface, which is recognized by macrophages for engulfment of dead cells (1). How PtdSer is exposed to the cell surface had been elusive for a long time. We recently identified two membrane proteins (TMEM16F and Xkr8) that are involved in scrambling of phospholipids in plasma membrane (2, 3). TMEM16F carries 8 transmembrane regions, and requires Ca2+ to mediate phospholipid scrambling. It plays a role in the PtdSer-exposure in activated platelets for blood clotting, and patients of Scott Syndrome who suffer bleeding disorder carry a mutation in TMEM16F gene. Xkr8 is a protein carrying 6 transmembrane regions. Caspase 3 and 7 cleave off the C-terminal tail of Xkr8, and the cleaved Xkr8 promotes the PtdSer-exposure. In addition to the activation of scramblase, the flippase that translocates PtdSer from outer to inner leaflets was thought to be inactivated during apoptosis. In fact, we recently found that a pair of molecules, ATP11C of a P4-type ATPase and its chaperon CDC50A work as a flippase at plasma membrane (4, 5). ATP11C carries three caspase recognition sites in the middle of the molecule, and is cleaved during apoptosis. When ATP11C gene is mutated, the cells lose most of the flippase activity, but the asymmetrical distribution of PtdSer was still maintained at plasma membrane. Whereas, the cells lacking CDC50A completely lost the flippase activity and constitutively exposed PtdSer. The PtdSer-exposing living CDC50A-null cells were engulfed by thioglycollate-elicited macrophages, indicating that PtdSer exposed on the cell surface is necessary and sufficient to be recognized by macrophages for engulfment. Several molecules such as MFG-E8, Tim-4, Gas6, and Protein S specifically bind to PtdSer with high affinity, and promote the engulfment of PtdSer-exposing cells. However, how they work for the engulfment of apoptotic cells in certain macrophages has not been clear. We recently found that that resident peritoneal macrophages require both Tim4 and Protein S for engulfment, and Tim4, PtdSer-receptor, was involved in tethering of apoptotic cells, while Protein S promoted the engulfment of apoptotic cells by binding to MerTK, a tyrosine kinase receptor (6, 7). Here, I discuss how PdtSer is exposed during apoptotic cell death, and how dead cells are engulfed by macrophages. 1. Nagata S, Hanayama R, Kawane K. Autoimmunity and the clearance of dead cells. Cell. 2010;140:619-630. 2. Suzuki J, Umeda M, Sims PJ, Nagata S. Calcium-dependent phospholipid scrambling by TMEM16F. Nature. 2010;468:834-838. 3. Suzuki J, Denning DP, Imanishi E, Horvitz HR, Nagata S. Xk-related protein 8 and CED-8 promote phosphatidylserine exposure in apoptotic cells. Science. 2013;341:403-406. 4. Segawa K, Suzuki J, Nagata S. Flippases and scramblases in the plasma membrane. Cell Cycle. 2014;13:2990-2991. 5. Segawa K, Kurata S, Yanagihashi Y, Brummelkamp T, Matsuda F, Nagata S. Caspase-mediated cleavage of phospholipid flippase for apoptotic phosphatidylserine exposure. Science. 2014;344:1164-1168. 6. Nishi C, Toda S, Segawa K, Nagata S. Tim4- and MerTK-mediated engulfment of apoptotic cells by mouse resident peritoneal macrophages. Mol Cell Biol. 2014;34:1512-1520. 7. Toda S, Segawa K, Nagata S. MerTK-mediated engulfment of pyrenocytes by central macrophages in erythroblastic islands. Blood. 2014;123:3963-3971. Disclosures No relevant conflicts of interest to declare.

Onion (Allium cepa L.) is an important vegetable crop in Pakistan. According to the Food and Agricultural Organization (FAO), Pakistan is the world's fifth largest onion producer. The area and production is 127.8 thousand hectares and 1.7 million tons, respectively, with a yield of 13.8 tons per hectare during 2012. The agro-ecological diversity in the country enables onion production almost year round. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus), transmitted principally by Thrips tabaci, is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (1,3). In Asia, IYSV has been reported in India and Sri Lanka (2,4). During March to May 2012, as part of a survey for tospoviruses in vegetables, symptoms suspected to be caused by IYSV were observed on bulb and seed onions grown in farmers' fields in Faisalabad, Nankana, Sheikhupura, and Sialkot districts of Punjab. Symptoms consisted of spindle-shaped, straw colored, irregular chlorotic lesions with occasional green islands on the leaves. Approximately 60% of the fields surveyed had about 30% of the plants with these symptoms. The presence of the virus was confirmed with an IYSV-specific ELISA kit (Bioreba). IYSV infection was verified by RT-PCR with primers IYSV-F (TAAAACAAACATTCAAACAA) and IYSV-R (CTCTTAAACACATTTAACAAGCA) as forward and reverse primers, respectively. Amplicons of approximately 1,100 bp were obtained from the symptomatic samples, but not from healthy and water controls. The amplicons were cloned and sequenced. The IYSV-Pakistan isolates (GenBank Accession Nos. KF171103, KF171104, and KF171105) had the highest nucleotide sequence identity of 99% with the corresponding region of an IYSV isolate from Chile (DQ150107). To our knowledge, this is the first report of IYSV infecting onion in Pakistan. The relatively widespread occurrence of IYSV underscores the need for systematic surveys to assess its incidence and impact on onion bulb and seed crops so that appropriate management tactics can be developed. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004. (2) B. Mandal et al. Plant Dis. 94:468, 2012. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) K. S. Ravi et al. Plant Pathol. 55:288, 2006.

Climate change induced sea-level rise (SLR) is on its increase globally. Regionally the lowlands of China, Vietnam, Bangladesh, and islands of the Malaysian, Indonesian and Philippine archipelagos are among the world’s most threatened regions. Sea-level rise has major impacts on the ecosystems and society. It threatens coastal populations, economic activities, and fragile ecosystems as mangroves, coastal salt-marches and wetlands. This paper provides a summary of the current state of knowledge of sea level-rise and its effects on both human and natural ecosystems. The focus is on coastal urban areas and low lying deltas in South-East Asia and Vietnam, as one of the most threatened areas in the world. About 3 mm per year reflects the growing consensus on the average SLR worldwide. The trend speeds up during recent decades. The figures are subject to local, temporal and methodological variation. In Vietnam the average values of 3.3 mm per year during the 1993-2014 period are above the worldwide average. Although a basic conceptual understanding exists that the increasing global frequency of the strongest tropical cyclones is related with the increasing temperature and SLR, this relationship is insufficiently understood. Moreover the precise, complex environmental, economic, social, and health impacts are currently unclear. SLR, storms and changing precipitation patterns increase flood risks, in particular in urban areas. Part of the current scientific debate is on how urban agglomeration can be made more resilient to flood risks. Where originally mainly technical interventions dominated this discussion, it becomes increasingly clear that proactive special planning, flood defense, flood risk mitigation, flood preparation, and flood recovery are important, but costly instruments. Next to the main focus on SLR and its effects on resilience, the paper reviews main SLR associated impacts: Floods and inundation, salinization, shoreline change, and effects on mangroves and wetlands. The hazards of SLR related floods increase fastest in urban areas. This is related with both the increasing surface major cities are expected to occupy during the decades to come and the increasing coastal population. In particular Asia and its megacities in the southern part of the continent are increasingly at risk. The discussion points to complexity, inter-disciplinarity, and the related uncertainty, as core characteristics. An integrated combination of mitigation, adaptation and resilience measures is currently considered as the most indicated way to resist SLR today and in the near future.References Aerts J.C.J.H., Hassan A., Savenije H.H.G., Khan M.F., 2000. Using GIS tools and rapid assessment techniques for determining salt intrusion: Stream a river basin management instrument. Physics and Chemistry of the Earth, Part B: Hydrology, Oceans and Atmosphere, 25, 265-273. Doi: 10.1016/S1464-1909(00)00014-9. Alongi D.M., 2002. Present state and future of the world’s mangrove forests. Environmental Conservation, 29, 331-349. Doi: 10.1017/S0376892902000231 Alongi D.M., 2015. The impact of climate change on mangrove forests. Curr. Clim. Change Rep., 1, 30-39. Doi: 10.1007/s404641-015-0002-x. Anderson F., Al-Thani N., 2016. Effect of sea level rise and groundwater withdrawal on seawater intrusion in the Gulf Coast aquifer: Implications for agriculture. Journal of Geoscience and Environment Protection, 4, 116-124. Doi: 10.4236/gep.2016.44015. Anguelovski I., Chu E., Carmin J., 2014. Variations in approaches to urban climate adaptation: Experiences and experimentation from the global South. Global Environmental Change, 27, 156-167. Doi: 10.1016/j.gloenvcha.2014.05.010. Arustienè J., Kriukaitè J., Satkunas J., Gregorauskas M., 2013. Climate change and groundwater - From modelling to some adaptation means in example of Klaipèda region, Lithuania. In: Climate change adaptation in practice. P. Schmidt-Thomé, J. Klein Eds. John Wiley and Sons Ltd., Chichester, UK., 157-169. Bamber J.L., Aspinall W.P., Cooke R.M., 2016. A commentary on “how to interpret expert judgement assessments of twenty-first century sea-level rise” by Hylke de Vries and Roderik S.W. Van de Wal. Climatic Change, 137, 321-328. Doi: 10.1007/s10584-016-1672-7. Barnes C., 2014. Coastal population vulnerability to sea level rise and tropical cyclone intensification under global warming. BSc-thesis. Department of Geography, University of Lethbridge, Alberta Canada. Be T.T., Sinh B.T., Miller F., 2007. Challenges to sustainable development in the Mekong Delta: Regional and national policy issues and research needs. The Sustainable Mekong Research Network, Bangkok, Thailand, 1-210. Bellard C., Leclerc C., Courchamp F., 2014. Impact of sea level rise on 10 insular biodiversity hotspots. Global Ecology and Biogeography, 23, 203-212. Doi: 10.1111/geb.12093. Berg H., Söderholm A.E., Sönderström A.S., Nguyen Thanh Tam, 2017. Recognizing wetland ecosystem services for sustainable rice farming in the Mekong delta, Vietnam. Sustainability Science, 12, 137-154. Doi: 10.1007/s11625-016-0409-x. Bilskie M.V., Hagen S.C., Medeiros S.C., Passeri D.L., 2014. Dynamics of sea level rise and coastal flooding on a changing landscape. Geophysical Research Letters, 41, 927-934. Doi: 10.1002/2013GL058759. Binh T.N.K.D., Vromant N., Hung N.T., Hens L., Boon E.K., 2005. Land cover changes between 1968 and 2003 in Cai Nuoc, Ca Mau penisula, Vietnam. Environment, Development and Sustainability, 7, 519-536. Doi: 10.1007/s10668-004-6001-z. Blankespoor B., Dasgupta S., Laplante B., 2014. Sea-level rise and coastal wetlands. Ambio, 43, 996- 005.Doi: 10.1007/s13280-014-0500-4. Brockway R., Bowers D., Hoguane A., Dove V., Vassele V., 2006. A note on salt intrusion in funnel shaped estuaries: Application to the Incomati estuary, Mozambique.Estuarine, Coastal and Shelf Science, 66, 1-5. Doi: 10.1016/j.ecss.2005.07.014. Cannaby H., Palmer M.D., Howard T., Bricheno L., Calvert D., Krijnen J., Wood R., Tinker J., Bunney C., Harle J., Saulter A., O’Neill C., Bellingham C., Lowe J., 2015. Projected sea level rise and changes in extreme storm surge and wave events during the 21st century in the region of Singapore. Ocean Sci. Discuss, 12, 2955-3001. Doi: 10.5194/osd-12-2955-2015. Carraro C., Favero A., Massetti E., 2012. Investment in public finance in a green, low carbon economy. Energy Economics, 34, S15-S18. Castan-Broto V., Bulkeley H., 2013. A survey ofurban climate change experiments in 100 cities. Global Environmental Change, 23, 92-102. Doi: 10.1016/j.gloenvcha.2012.07.005. Cazenave A., Le Cozannet G., 2014. Sea level rise and its coastal impacts. GeoHealth, 2, 15-34. Doi: 10.1002/2013EF000188. Chu M.L., Guzman J.A., Munoz-Carpena R., Kiker G.A., Linkov I., 2014. A simplified approach for simulating changes in beach habitat due to the combined effects of long-term sea level rise, storm erosion and nourishment. Environmental modelling and software, 52, 111-120. Doi.org/10.1016/j.envcsoft.2013.10.020. Church J.A. et al., 2013. Sea level change. In: Climate change 2013: The physical science basis. Contribution of working group I to the fifth assessment report of Intergovernmental Panel on Climate Change. Eds: Stocker T.F., Qin D., Plattner G.-K., Tignor M., Allen S.K., Boschung J., Nauels A., Xia Y., Bex V., Midgley P.M., Cambridge University Press, Cambridge, UK. Connell J., 2016. Last days of the Carteret Islands? Climate change, livelihoods and migration on coral atolls. Asia Pacific Viewpoint, 57, 3-15. Doi: 10.1111/apv.12118. Dasgupta S., Laplante B., Meisner C., Wheeler, Yan J., 2009. The impact of sea level rise on developing countries: A comparative analysis. Climatic Change, 93, 379-388. Doi: 10.1007/s 10584-008-9499-5. Delbeke J., Vis P., 2015. EU climate policy explained, 136p. Routledge, Oxon, UK. DiGeorgio M., 2015. Bargaining with disaster: Flooding, climate change, and urban growth ambitions in QuyNhon, Vietnam. Public Affairs, 88, 577-597. Doi: 10.5509/2015883577. Do Minh Duc, Yasuhara K., Nguyen Manh Hieu, 2015. Enhancement of coastal protection under the context of climate change: A case study of Hai Hau coast, Vietnam. Proceedings of the 10th Asian Regional Conference of IAEG, 1-8. Do Minh Duc, Yasuhara K., Nguyen Manh Hieu, Lan Nguyen Chau, 2017. Climate change impacts on a large-scale erosion coast of Hai Hau district, Vietnam and the adaptation. Journal of Coastal Conservation, 21, 47-62. Donner S.D., Webber S., 2014. Obstacles to climate change adaptation decisions: A case study of sea level rise; and coastal protection measures in Kiribati. Sustainability Science, 9, 331-345. Doi: 10.1007/s11625-014-0242-z. Driessen P.P.J., Hegger D.L.T., Bakker M.H.N., Van Renswick H.F.M.W., Kundzewicz Z.W., 2016. Toward more resilient flood risk governance. Ecology and Society, 21, 53-61. Doi: 10.5751/ES-08921-210453. Duangyiwa C., Yu D., Wilby R., Aobpaet A., 2015. Coastal flood risks in the Bangkok Metropolitan region, Thailand: Combined impacts on land subsidence, sea level rise and storm surge. American Geophysical Union, Fall meeting 2015, abstract#NH33C-1927. Duarte C.M., Losada I.J., Hendriks I.E., Mazarrasa I., Marba N., 2013. The role of coastal plant communities for climate change mitigation and adaptation. Nature Climate Change, 3, 961-968. Doi: 10.1038/nclimate1970. Erban L.E., Gorelick S.M., Zebker H.A., 2014. Groundwater extraction, land subsidence, and sea-level rise in the Mekong Delta, Vietnam. Environmental Research Letters, 9, 1-20. Doi: 10.1088/1748-9326/9/8/084010. FAO - Food and Agriculture Organisation, 2007.The world’s mangroves 1980-2005. FAO Forestry Paper, 153, Rome, Italy. Farbotko C., 2010. Wishful sinking: Disappearing islands, climate refugees and cosmopolitan experimentation. Asia Pacific Viewpoint, 51, 47-60. Doi: 10.1111/j.1467-8373.2010.001413.x. Goltermann D., Ujeyl G., Pasche E., 2008. Making coastal cities flood resilient in the era of climate change. Proceedings of the 4th International Symposium on flood defense: Managing flood risk, reliability and vulnerability, 148-1-148-11. Toronto, Canada. Gong W., Shen J., 2011. The response of salt intrusion to changes in river discharge and tidal mixing during the dry season in the Modaomen Estuary, China.Continental Shelf Research, 31, 769-788. Doi: 10.1016/j.csr.2011.01.011. Gosian L., 2014. Protect the world’s deltas. Nature, 516, 31-34. Graham S., Barnett J., Fincher R., Mortreux C., Hurlimann A., 2015. Towards fair outcomes in adaptation to sea-level rise. Climatic Change, 130, 411-424. Doi: 10.1007/s10584-014-1171-7. COASTRES-D-12-00175.1. Güneralp B., Güneralp I., Liu Y., 2015. Changing global patterns of urban expoàsure to flood and drought hazards. Global Environmental Change, 31, 217-225. Doi: 10.1016/j.gloenvcha.2015.01.002. Hallegatte S., Green C., Nicholls R.J., Corfee-Morlot J., 2013. Future flood losses in major coastal cities. Nature Climate Change, 3, 802-806. Doi: 10.1038/nclimate1979. Hamlington B.D., Strassburg M.W., Leben R.R., Han W., Nerem R.S., Kim K.-Y., 2014. Uncovering an anthropogenic sea-level rise signal in the Pacific Ocean. Nature Climate Change, 4, 782-785. Doi: 10.1038/nclimate2307. Hashimoto T.R., 2001. Environmental issues and recent infrastructure development in the Mekong Delta: Review, analysis and recommendations with particular reference to large-scale water control projects and the development of coastal areas. Working paper series (Working paper No. 4). Australian Mekong Resource Centre, University of Sydney, Australia, 1-70. Hibbert F.D., Rohling E.J., Dutton A., Williams F.H., Chutcharavan P.M., Zhao C., Tamisiea M.E., 2016. Coral indicators of past sea-level change: A global repository of U-series dated benchmarks. Quaternary Science Reviews, 145, 1-56. Doi: 10.1016/j.quascirev.2016.04.019. Hinkel J., Lincke D., Vafeidis A., Perrette M., Nicholls R.J., Tol R.S.J., Mazeion B., Fettweis X., Ionescu C., Levermann A., 2014. Coastal flood damage and adaptation costs under 21st century sea-level rise. Proceedings of the National Academy of Sciences, 111, 3292-3297. Doi: 10.1073/pnas.1222469111. Hinkel J., Nicholls R.J., Tol R.S.J., Wang Z.B., Hamilton J.M., Boot G., Vafeidis A.T., McFadden L., Ganapolski A., Klei R.J.Y., 2013. A global analysis of erosion of sandy beaches and sea level rise: An application of DIVA. Global and Planetary Change, 111, 150-158. Doi: 10.1016/j.gloplacha.2013.09.002. Huong H.T.L., Pathirana A., 2013. Urbanization and climate change impacts on future urban flooding in Can Tho city, Vietnam. Hydrol. Earth Syst. Sci., 17, 379-394. Doi: 10.5194/hess-17-379-2013. Hurlimann A., Barnett J., Fincher R., Osbaldiston N., Montreux C., Graham S., 2014. Urban planning and sustainable adaptation to sea-level rise. Landscape and Urban Planning, 126, 84-93. Doi: 10.1016/j.landurbplan.2013.12.013. IMHEN-Vietnam Institute of Meteorology, Hydrology and Environment, 2011. Climate change vulnerability and risk assessment study for Ca Mau and KienGiang provinces, Vietnam. Hanoi, Vietnam Institute of Meteorology, Hydrology and Environment (IMHEN), 250p. IMHEN-Vietnam Institute of Meteorology, Hydrology and Environment, Ca Mau PPC, 2011. Climate change impact and adaptation study in The Mekong Delta - Part A: Ca Mau Atlas. Hanoi, Vietnam: Institute of Meteorology, Hydrology and Environment (IMHEN), 48p. IPCC-Intergovernmental Panel on Climate Change, 2014. Fifth assessment report. Cambridge University Press, Cambridge, UK. Jevrejeva S., Jackson L.P., Riva R.E.M., Grinsted A., Moore J.C., 2016. Coastal sea level rise with warming above 2°C. Proceedings of the National Academy of Sciences, 113, 13342-13347. Doi: 10.1073/pnas.1605312113. Junk W.J., AN S., Finlayson C.M., Gopal B., Kvet J., Mitchell S.A., Mitsch W.J., Robarts R.D., 2013. Current state of knowledge regarding the world’s wetlands and their future under global climate change: A synthesis. Aquatic Science, 75, 151-167. Doi: 10.1007/s00027-012-0278-z. Jordan A., Rayner T., Schroeder H., Adger N., Anderson K., Bows A., Le Quéré C., Joshi M., Mander S., Vaughan N., Whitmarsh L., 2013. Going beyond two degrees? The risks and opportunities of alternative options. Climate Policy, 13, 751-769. Doi: 10.1080/14693062.2013.835705. Kelly P.M., Adger W.N., 2000. Theory and practice in assessing vulnerability to climate change and facilitating adaptation. Climatic Change, 47, 325-352. Doi: 10.1023/A:1005627828199. Kirwan M.L., Megonigal J.P., 2013. Tidal wetland stability in the face of human impacts and sea-level rice. Nature, 504, 53-60. Doi: 10.1038/nature12856. Koerth J., Vafeidis A.T., Hinkel J., Sterr H., 2013. What motivates coastal households to adapt pro actively to sea-level rise and increased flood risk? Regional Environmental Change, 13, 879-909. Doi: 10.1007/s10113-12-399-x. Kontgis K., Schneider A., Fox J;,Saksena S., Spencer J.H., Castrence M., 2014. Monitoring peri urbanization in the greater Ho Chi Minh City metropolitan area. Applied Geography, 53, 377-388. Doi: 10.1016/j.apgeogr.2014.06.029. Kopp R.E., Horton R.M., Little C.M., Mitrovica J.X., Oppenheimer M., Rasmussen D.J., Strauss B.H., Tebaldi C., 2014. Probabilistic 21st and 22nd century sea-level projections at a global network of tide-gauge sites. Earth’s Future, 2, 383-406. Doi: 10.1002/2014EF000239. Kuenzer C., Bluemel A., Gebhardt S., Quoc T., Dech S., 2011. Remote sensing of mangrove ecosystems: A review.Remote Sensing, 3, 878-928. Doi: 10.3390/rs3050878. Lacerda G.B.M., Silva C., Pimenteira C.A.P., Kopp Jr. R.V., Grumback R., Rosa L.P., de Freitas M.A.V., 2013. Guidelines for the strategic management of flood risks in industrial plant oil in the Brazilian coast: Adaptive measures to the impacts of sea level rise. Mitigation and Adaptation Strategies for Global Change, 19, 104-1062. Doi: 10.1007/s11027-013-09459-x. Lam Dao Nguyen, Pham Van Bach, Nguyen Thanh Minh, Pham Thi Mai Thy, Hoang Phi Hung, 2011. Change detection of land use and river bank in Mekong Delta, Vietnam using time series remotely sensed data. Journal of Resources and Ecology, 2, 370-374. Doi: 10.3969/j.issn.1674-764x.2011.04.011. Lang N.T., Ky B.X., Kobayashi H., Buu B.C., 2004. Development of salt tolerant varieties in the Mekong delta. JIRCAS Project, Can Tho University, Can Tho, Vietnam, 152. Le Cozannet G., Rohmer J., Cazenave A., Idier D., Van de Wal R., de Winter R., Pedreros R., Balouin Y., Vinchon C., Oliveros C., 2015. Evaluating uncertainties of future marine flooding occurrence as sea-level rises. Environmental Modelling and Software, 73, 44-56. Doi: 10.1016/j.envsoft.2015.07.021. Le Cozannet G., Manceau J.-C., Rohmer J., 2017. Bounding probabilistic sea-level projections with the framework of the possible theory. Environmental Letters Research, 12, 12-14. Doi.org/10.1088/1748-9326/aa5528.Chikamoto Y., 2014. Recent Walker circulation strengthening and Pacific cooling amplified by Atlantic warming. Nature Climate Change, 4, 888-892. Doi: 10.1038/nclimate2330. Lovelock C.E., Cahoon D.R., Friess D.A., Gutenspergen G.R., Krauss K.W., Reef R., Rogers K., Saunders M.L., Sidik F., Swales A., Saintilan N., Le Xuan Tuyen, Tran Triet, 2015. The vulnerability of Indo-Pacific mangrove forests to sea-level rise. Nature, 526, 559-563. Doi: 10.1038/nature15538. MA Millennium Ecosystem Assessment, 2005. Ecosystems and human well-being: Current state and trends. Island Press, Washington DC, 266p. Masterson J.P., Fienen M.N., Thieler E.R., Gesch D.B., Gutierrez B.T., Plant N.G., 2014. Effects of sea level rise on barrier island groundwater system dynamics - ecohydrological implications. Ecohydrology, 7, 1064-1071. Doi: 10.1002/eco.1442. McGanahan G., Balk D., Anderson B., 2007. The rising tide: Assessing the risks of climate changes and human settlements in low elevation coastal zones.Environment and urbanization, 19, 17-37. Doi: 10.1177/095624780707960. McIvor A., Möller I., Spencer T., Spalding M., 2012. Reduction of wind and swell waves by mangroves. The Nature Conservancy and Wetlands International, 1-27. Merryn T., Pidgeon N., Whitmarsh L., Ballenger R., 2016. Expert judgements of sea-level rise at the local scale. Journal of Risk Research, 19, 664-685. Doi.org/10.1080/13669877.2015.1043568. Monioudi I.N., Velegrakis A.F., Chatzipavlis A.E., Rigos A., Karambas T., Vousdoukas M.I., Hasiotis T., Koukourouvli N., Peduzzi P., Manoutsoglou E., Poulos S.E., Collins M.B., 2017. Assessment of island beach erosion due to sea level rise: The case of the Aegean archipelago (Eastern Mediterranean). Nat. Hazards Earth Syst. Sci., 17, 449-466. Doi: 10.5194/nhess-17-449-2017. MONRE - Ministry of Natural Resources and Environment, 2016. Scenarios of climate change and sea level rise for Vietnam. Publishing House of Environmental Resources and Maps Vietnam, Hanoi, 188p. Montz B.E., Tobin G.A., Hagelman III R.R., 2017. Natural hazards. Explanation and integration. The Guilford Press, NY, 445p. Morgan L.K., Werner A.D., 2014. Water intrusion vulnerability for freshwater lenses near islands. Journal of Hydrology, 508, 322-327. Doi: 10.1016/j.jhydrol.2013.11.002. Muis S., Güneralp B., Jongman B., Aerts J.C.H.J., Ward P.J., 2015. Science of the Total Environment, 538, 445-457. Doi: 10.1016/j.scitotenv.2015.08.068. Murray N.J., Clemens R.S., Phinn S.R., Possingham H.P., Fuller R.A., 2014. Tracking the rapid loss of tidal wetlands in the Yellow Sea. Frontiers in Ecology and Environment, 12, 267-272. Doi: 10.1890/130260. Neumann B., Vafeidis A.T., Zimmermann J., Nicholls R.J., 2015a. Future coastal population growth and exposure to sea-level rise and coastal flooding. A global assessment. Plos One, 10, 1-22. Doi: 10.1371/journal.pone.0118571. Nguyen A. Duoc, Savenije H. H., 2006. Salt intrusion in multi-channel estuaries: a case study in the Mekong Delta, Vietnam. Hydrology and Earth System Sciences Discussions, European Geosciences Union, 10, 743-754. Doi: 10.5194/hess-10-743-2006. Nguyen An Thinh, Nguyen Ngoc Thanh, Luong Thi Tuyen, Luc Hens, 2017. Tourism and beach erosion: Valuing the damage of beach erosion for tourism in the Hoi An, World Heritage site. Journal of Environment, Development and Sustainability. Nguyen An Thinh, Luc Hens (Eds.), 2018. Human ecology of climate change associated disasters in Vietnam: Risks for nature and humans in lowland and upland areas. Springer Verlag, Berlin.Nguyen An Thinh, Vu Anh Dung, Vu Van Phai, Nguyen Ngoc Thanh, Pham Minh Tam, Nguyen Thi Thuy Hang, Le Trinh Hai, Nguyen Viet Thanh, Hoang Khac Lich, Vu Duc Thanh, Nguyen Song Tung, Luong Thi Tuyen, Trinh Phuong Ngoc, Luc Hens, 2017. Human ecological effects of tropical storms in the coastal area of Ky Anh (Ha Tinh, Vietnam). Environ Dev Sustain, 19, 745-767. Doi: 10.1007/s/10668-016-9761-3. Nguyen Van Hoang, 2017. Potential for desalinization of brackish groundwater aquifer under a background of rising sea level via salt-intrusion prevention river gates in the coastal area of the Red River delta, Vietnam. Environment, Development and Sustainability. Nguyen Tho, Vromant N., Nguyen Thanh Hung, Hens L., 2008. Soil salinity and sodicity in a shrimp farming coastal area of the Mekong Delta, Vietnam. Environmental Geology, 54, 1739-1746. Doi: 10.1007/s00254-007-0951-z. Nguyen Thang T.X., Woodroffe C.D., 2016. Assessing relative vulnerability to sea-level rise in the western part of the Mekong River delta. Sustainability Science, 11, 645-659. Doi: 10.1007/s11625-015-0336-2. Nicholls N.N., Hoozemans F.M.J., Marchand M., Analyzing flood risk and wetland losses due to the global sea-level rise: Regional and global analyses.Global Environmental Change, 9, S69-S87. Doi: 10.1016/s0959-3780(99)00019-9. Phan Minh Thu, 2006. Application of remote sensing and GIS tools for recognizing changes of mangrove forests in Ca Mau province. In Proceedings of the International Symposium on Geoinformatics for Spatial Infrastructure Development in Earth and Allied Sciences, Ho Chi Minh City, Vietnam, 9-11 November, 1-17. Reise K., 2017. Facing the third dimension in coastal flatlands.Global sea level rise and the need for coastal transformations. Gaia, 26, 89-93. Renaud F.G., Le Thi Thu Huong, Lindener C., Vo Thi Guong, Sebesvari Z., 2015. Resilience and shifts in agro-ecosystems facing increasing sea-level rise and salinity intrusion in Ben Tre province, Mekong Delta. Climatic Change, 133, 69-84. Doi: 10.1007/s10584-014-1113-4. Serra P., Pons X., Sauri D., 2008. Land cover and land use in a Mediterranean landscape. Applied Geography, 28, 189-209. Shearman P., Bryan J., Walsh J.P., 2013.Trends in deltaic change over three decades in the Asia-Pacific Region. Journal of Coastal Research, 29, 1169-1183. Doi: 10.2112/JCOASTRES-D-12-00120.1. SIWRR-Southern Institute of Water Resources Research, 2016. Annual Report. Ministry of Agriculture and Rural Development, Ho Chi Minh City, 1-19. Slangen A.B.A., Katsman C.A., Van de Wal R.S.W., Vermeersen L.L.A., Riva R.E.M., 2012. Towards regional projections of twenty-first century sea-level change based on IPCC RES scenarios. Climate Dynamics, 38, 1191-1209. Doi: 10.1007/s00382-011-1057-6. Spencer T., Schuerch M., Nicholls R.J., Hinkel J., Lincke D., Vafeidis A.T., Reef R., McFadden L., Brown S., 2016. Global coastal wetland change under sea-level rise and related stresses: The DIVA wetland change model. Global and Planetary Change, 139, 15-30. Doi:10.1016/j.gloplacha.2015.12.018. Stammer D., Cazenave A., Ponte R.M., Tamisiea M.E., 2013. Causes of contemporary regional sea level changes. Annual Review of Marine Science, 5, 21-46. Doi: 10.1146/annurev-marine-121211-172406. Tett P., Mee L., 2015. Scenarios explored with Delphi. In: Coastal zones ecosystems services. Eds., Springer, Berlin, Germany, 127-144. Tran Hong Hanh, 2017. Land use dynamics, its drivers and consequences in the Ca Mau province, Mekong delta, Vietnam. PhD dissertation, 191p. VUBPRESS Brussels University Press, ISBN 9789057186226, Brussels, Belgium. Tran Thuc, Nguyen Van Thang, Huynh Thi Lan Huong, Mai Van Khiem, Nguyen Xuan Hien, Doan Ha Phong, 2016. Climate change and sea level rise scenarios for Vietnam. Ministry of Natural resources and Environment. Hanoi, Vietnam. Tran Hong Hanh, Tran Thuc, Kervyn M., 2015. Dynamics of land cover/land use changes in the Mekong Delta, 1973-2011: A remote sensing analysis of the Tran Van Thoi District, Ca Mau province, Vietnam. Remote Sensing, 7, 2899-2925. Doi: 10.1007/s00254-007-0951-z Van Lavieren H., Spalding M., Alongi D., Kainuma M., Clüsener-Godt M., Adeel Z., 2012. Securing the future of Mangroves. The United Nations University, Okinawa, Japan, 53, 1-56. Water Resources Directorate. Ministry of Agriculture and Rural Development, 2016. Available online: http://www.tongcucthuyloi.gov.vn/Tin-tuc-Su-kien/Tin-tuc-su-kien-tong-hop/catid/12/item/2670/xam-nhap-man-vung-dong-bang-song-cuu-long--2015---2016---han-han-o-mien-trung--tay-nguyen-va-giai-phap-khac-phuc. Last accessed on: 30/9/2016. Webster P.J., Holland G.J., Curry J.A., Chang H.-R., 2005. Changes in tropical cyclone number, duration, and intensity in a warming environment. Science, 309, 1844-1846. Doi: 10.1126/science.1116448. Were K.O., Dick O.B., Singh B.R., 2013. Remotely sensing the spatial and temporal land cover changes in Eastern Mau forest reserve and Lake Nakuru drainage Basin, Kenya. Applied Geography, 41, 75-86. Williams G.A., Helmuth B., Russel B.D., Dong W.-Y., Thiyagarajan V., Seuront L., 2016. Meeting the climate change challenge: Pressing issues in southern China an SE Asian coastal ecosystems. Regional Studies in Marine Science, 8, 373-381. Doi: 10.1016/j.rsma.2016.07.002. Woodroffe C.D., Rogers K., McKee K.L., Lovdelock C.E., Mendelssohn I.A., Saintilan N., 2016. Mangrove sedimentation and response to relative sea-level rise. Annual Review of Marine Science, 8, 243-266. Doi: 10.1146/annurev-marine-122414-034025.

-Leslie G. Desmangles, Joan Dayan, Haiti, history, and the Gods. Berkeley: University of California Press, 1995. xxiii + 339 pp.-Barry Chevannes, James T. Houk, Spirits, blood, and drums: The Orisha religion in Trinidad. Philadelphia: Temple University Press, 1995. xvi + 238 pp.-Barry Chevannes, Walter F. Pitts, Jr., Old ship of Zion: The Afro-Baptist ritual in the African Diaspora. New York: Oxford University Press, 1993. xvi + 199 pp.-Robert J. Stewart, Lewin L. Williams, Caribbean theology. New York: Peter Lang, 1994. xiii + 231 pp.-Robert J. Stewart, Barry Chevannes, Rastafari and other African-Caribbean worldviews. London: Macmillan, 1995. xxv + 282 pp.-Michael Aceto, Maureen Warner-Lewis, Yoruba songs of Trinidad. London: Karnak House, 1994. 158 pp.''Trinidad Yoruba: From mother tongue to memory. Tuscaloosa: University of Alabama Press, 1996. xviii + 279 pp.-Erika Bourguignon, Nicola H. Götz, Obeah - Hexerei in der Karibik - zwischen Macht und Ohnmacht. Frankfurt am Main: Peter Lang, 1995. 256 pp.-John Murphy, Hernando Calvo Ospina, Salsa! Havana heat: Bronx Beat. London: Latin America Bureau, 1995. viii + 151 pp.-Donald R. Hill, Stephen Stuempfle, The steelband movement: The forging of a national art in Trinidad and Tobago. Philadelphia: University of Pennsylvania Press, 1995. xx + 289 pp.-Hilary McD. Beckles, Jay R. Mandle ,Caribbean Hoops: The development of West Indian basketball. Langhorne PA: Gordon and Breach, 1994. ix + 121 pp., Joan D. Mandle (eds)-Edmund Burke, III, Lewis R. Gordon ,Fanon: A critical reader. Oxford: Blackwell, 1996. xxi + 344 pp., T. Denean Sharpley-Whiting, Renée T. White (eds)-Keith Alan Sprouse, Ikenna Dieke, The primordial image: African, Afro-American, and Caribbean Mythopoetic text. New York: Peter Lang, 1993. xiv + 434 pp.-Keith Alan Sprouse, Wimal Dissanayake ,Self and colonial desire: Travel writings of V.S. Naipaul. New York : Peter Lang, 1993. vii + 160 pp., Carmen Wickramagamage (eds)-Yannick Tarrieu, Moira Ferguson, Jamaica Kincaid: Where the land meets the body: Charlottesville: University Press of Virginia, 1994. xiii + 205 pp.-Neil L. Whitehead, Vera Lawrence Hyatt ,Race, discourse, and the origin of the Americas: A new world view. Washington DC: Smithsonian Institution Press, 1995. xiii + 302 pp., Rex Nettleford (eds)-Neil L. Whitehead, Patricia Seed, Ceremonies of possession in Europe's conquest of the new world, 1492-1640. Cambridge: Cambridge University Press, 1995. viii + 199 pp.-Livio Sansone, Michiel Baud ,Etnicidad como estrategia en America Latina y en el Caribe. Arij Ouweneel & Patricio Silva. Quito: Ediciones Abya-Yala, 1996. 214 pp., Kees Koonings, Gert Oostindie (eds)-D.C. Griffith, Linda Basch ,Nations unbound: Transnational projects, postcolonial predicaments, and deterritorialized nation-states. Langhorne PA: Gordon and Breach, 1994. vii + 344 pp., Nina Glick Schiller, Cristina Szanton Blanc (eds)-John Stiles, Richard D.E. Burton ,French and West Indian: Martinique, Guadeloupe and French Guiana today. Charlottesville: University Press of Virginia; London: Macmillan Caribbean, 1995. xii + 202 pp., Fred Réno (eds)-Frank F. Taylor, Dennis J. Gayle ,Tourism marketing and management in the Caribbean. New York: Routledge, 1993. xxvi + 270 pp., Jonathan N. Goodrich (eds)-Ivelaw L. Griffith, John La Guerre, Structural adjustment: Public policy and administration in the Caribbean. St. Augustine: School of continuing studies, University of the West Indies, 1994. vii + 258 pp.-Luis Martínez-Fernández, Kelvin A. Santiago-Valles, 'Subject People' and colonial discourses: Economic transformation and social disorder in Puerto Rico, 1898-1947. Albany: State University of New York Press, 1994. xiii + 304 pp.-Alicia Pousada, Bonnie Urciuoli, Exposing prejudice: Puerto Rican experiences of language, race, and class. Boulder: Westview Press, 1996. xiv + 222 pp.-David A.B. Murray, Ian Lumsden, Machos, Maricones, and Gays: Cuba and homosexuality. Philadelphia: Temple University Press, 1996. xxvii + 263 pp.-Robert Fatton, Jr., Georges A. Fauriol, Haitian frustrations: Dilemmas for U.S. policy. Washington DC: Center for strategic & international studies, 1995. xii + 236 pp.-Leni Ashmore Sorensen, David Barry Gaspar ,More than Chattel: Black women and slavery in the Americas. Bloomington: Indiana University Press, 1996. xi + 341 pp., Darlene Clark Hine (eds)-A. Lynn Bolles, Verene Shepherd ,Engendering history: Caribbean women in historical perspective. Kingston: Ian Randle; London: James Currey, 1995. xxii + 406 pp., Bridget Brereton, Barbara Bailey (eds)-Bridget Brereton, Mary Turner, From chattel slaves to wage slaves: The dynamics of labour bargaining in the Americas. Kingston: Ian Randle; Bloomington: Indiana University Press; London: James Currey, 1995. x + 310 pp.-Carl E. Swanson, Duncan Crewe, Yellow Jack and the worm: British Naval administration in the West Indies, 1739-1748. Liverpool: Liverpool University Press, 1993. x + 321 pp.-Jerome Egger, Wim Hoogbergen, Het Kamp van Broos en Kaliko: De geschiedenis van een Afro-Surinaamse familie. Amsterdam: Prometheus, 1996. 213 pp.-Ellen Klinkers, Lila Gobardhan-Rambocus ,De erfenis van de slavernij. Paramaribo: Anton de Kom Universiteit, 1995. 297 pp., Maurits S. Hassankhan, Jerry L. Egger (eds)-Kevin K. Birth, Sylvia Moodie-Kublalsingh, The Cocoa Panyols of Trinidad: An oral record. London & New York: British Academic Press, 1994. xiii + 242 pp.-David R. Watters, C.N. Dubelaar, The Petroglyphs of the Lesser Antilles, the Virgin Islands and Trinidad. Amsterdam: Foundation for scientific research in the Caribbean region, 1995. vii + 492 pp.-Suzannah England, Mitchell W. Marken, Pottery from Spanish shipwrecks, 1500-1800. Gainesville: University Press of Florida, 1994. xvi + 264 pp.

-Peter Hulme, Simon Gikandi, Writing in limbo: Modernism and Caribbean literature. Ithaca: Cornell University Press, 1992. x + 260 pp.-Charles V. Carnegie, Alistair Hennessy, Intellectuals in the twentieth-century Caribbean (Volume 1 - Spectre of the new class: The Commonwealth Caribbean). London: Macmillan, 1992. xvii 204 pp.-Nigel Rigby, Anne Walmsley, The Caribbean artists movement, 1966-1972: A literary and cultural history. London: New Beacon Books, 1992. xx + 356 pp.-Carl Pedersen, Tyrone Tillery, Claude McKay: A black poet's struggle for identity. Amherst: University of Massachusetts Press, 1992. xii + 235 pp.-Simone Dreyfus, Irving Rouse, The Tainos: Rise and decline of the people who greeted Columbus. New Haven: Yale University Press, 1992. xii + 211 pp.-Louis Allaire, Antonio M. Stevens-Arroyo, Cave of the Jagua: The mythological world of the Taino. Alburquerque: University of New Mexico Press, 1988. xiii + 282 pp.-Irving Rouse, William F. Keegan, The people who discovered Columbus: The prehistory of the Bahamas. Gainesville: University of Florida Press, 1992. xx + 279 pp.-Neil L. Whitehead, Philip P. Boucher, Cannibal encounters: Europeans and Island Caribs, 1492-1763. Baltimore: John Hopkins University Press, 1992. xii + 217 pp.-Peter Kloos, Kaliña, des amérindiens à Paris: Photographies du prince Roland. Présentées par Gérard Collomb. Paris: Créaphis, 1992. 119 pp.-Maureen Warner-Lewis, Alan Gregor Cobley ,The African-Caribbean connection: Historical and cultural perspectives. Bridgetown, Barbados: Department of History, University of the West Indies, Cave Hill, 1990. viii + 171 pp., Alvin Thompson (eds)-H. Hoetink, Jean-Luc Bonniol, La couleur comme maléfice: une illustration créole de la généalogie des 'Blancs' et des 'Noirs'. Paris: Albin Michel, 1992. 304 pp.-Michael Aceto, Richard Price ,Two evenings in Saramaka. Chicago and London: University of Chicago Press, 1991. xvi + 417 pp., Sally Price (eds)-Jorge Pérez Rolón, Vernon W. Boggs, Salsiology: Afro-Cuban music and the evolution of Salsa in New York City. New York: Greenwood, 1992. xvii + 387 pp.-Martin F. Murphy, Sherri Grasmuck ,Between two islands: Dominican international migration. Berkeley: University of California Press, 1991. xviii + 247 pp., Patricia R. Pessar (eds)-Rosario Espinal, Richard S. Hillman ,Distant neighbors in the Caribbean: The Dominican Republic and Jamaica in comparative perspective. New York: Praeger, 1992. xviii + 199 pp., Thomas D'Agostino (eds)-Svend E. Holsoe, Neville A.T. Hall, Slave society in the Danish West Indies: St. Thomas, St. John and St. Croix. Edited by B.W. Higman. Mona, Jamaica: University of the West Indies Press, 1992. xxiv + 287 pp.-Light Townsend Cummins, Francisco Morales Padrón, The journal of Don Francisco Saavedra de Sangronis 1780-1783. Translated by Aileen Moore Topping. Gainesville: University of Florida Press, 1989. xxxvii + 380 pp.-Francisco A. Scarano, Laird W. Bergad, Cuban rural society in the nineteenth century: The social and economic history of monoculture in Matanzas. Princeton: Princeton University Press, 1990. xxi + 425 pp.-Robert L. Paquette, Larry R. Jensen, Children of colonial despotism: Press, politics, and culture in Cuba, 1790-1840. Tampa: University of South Florida Press, 1988. xviii + 211 pp.-Robert L. Paquette, Anton L. Allahar, Class, politics, and sugar in colonial Cuba. Lewiston NY; The Edwin Mellen Press, 1990. xi + 217 pp.-Aline Helg, Josef Opatrny, U.S. Expansionism and Cuban annexationism in the 1850s. Prague: Charles University, 1990. 271 pp.-Rita Giacalone, Humberto García Muñiz ,Bibliografía militar del Caribe. Río Piedras PR: Centro de Investigaciones Históricas, Universidad de Puerto Rico, 1992. 177 pp., Betsaida Vélez Natal (eds)-Carlos E. Santiago, Irma Tirado de Alonso, Trade issues in the Caribbean. Philadelphia: Gordon & Breach, 1992. xv + 231 pp.-Drexel G. Woodson, Frantz Pratt, Haiti: Guide to the periodical literature in English, 1800-1990. Westport CT: Greenwood, 1991. xiv + 313 pp.-Gary Brana-Shute, Livio Sansone, Hangen boven de oceaan: het gewone overleven van Creoolse jongeren in Paramaribo. Amsterdam: Het Spinhuis, 1992. 58 pp.-Ronald Gill, Dolf Huijgers ,Landhuizen van Curacao en Bonaire. Amsterdam: Persimmons Management. 1991. 286 pp., Lucky Ezechiëls (eds)-Alex van Stipriaan, Waldo Heilbron, Colonial transformations and the decomposition of Dutch plantation slavery in Surinam. Amsterdam: Amsterdam centre for Caribbean studies (AWIC), University of Amsterdam, 1992. 133 pp.-Rosemarijn Hoefte, Bea Lalmahomed, Hindostaanse vrouwen: de geschiedenis van zes generaties. Utrecht: Jan van Arkel, 1992. 159 pp.-Aart G. Broek, Peter Hoefnagels ,Antilliaans spreekwoordenboek. Amsterdam: Thomas Rap, 1991. 92 pp., Shon Wé Hoogenbergen (eds)

The tourist city has been a space with few and weak reflections from the urban discipline. The developed planning, at best, has been uncritically exported from the residential city. However, in these cities, almost 12% of Spanish GDP is generated. The vast majority of Spanish coasts, especially on the Mediterranean coast and in the archipelagos, are occupied by large areas of holiday cities. Many of them were born in the first boom of Spanish tourism in the 60's. The mass tourism model, predominant in our coast, also generates a mass city. The morphology of this city does not follow the common and more consolidated patterns of the residential city. Today many of these tourist destinations begin to show of obsolescence. For this reason, the analysis of its urban form is a valuable tool in the face of its renovation project. In this work, we propose the analysis of the tourist micro-destinations of the Canarian archipelago. In order to this we will identify the main morphological patterns and characterize them from the analysis of a set of descriptive indicators related to public and private space. References Gaja, F. (ed.) (2012) DeCoastruction (Universidad Politécnica de Valencia, Valencia). Pié, R. and Rosa, C. (eds.) (2013) Turismo líquido (Instituto Hábitat Turismo Territorio, UPC and UM, Barcelona). Simancas Cruz, M. R. and Hernández Martín R. (Eds.) (2015) Reinventando alojamientos turísticos. Casos de éxito y soluciones innovadoras (Cátedra de Turismo de Cajacanarias - ASAHOTEL - Universidad de La Laguna, Tenerife Simancas Cruz, M. R. and García Cruz, J. I. (2015): ‘La modelización territorial de un espacio urbano-turístico de litoral: una propuesta para el plan de rehabilitación de las infraestructuras turísticas de Puerto de la Cruz (España)’, in GeoFocus, nº 15, p 105-132. Temes R. and Tuset, J., R. (eds.) (2015) Orilla marítima. Territorio litoral (General de ediciones de Arquitectura, Valencia).