Journal articles on the topic 'Leith Brown'

Sabal bermudana, known as the Sabal palm, is, at over 200 years of age, frequently listed as the oldest living specimen growing at the Royal Botanic Garden Edinburgh (Bown, 1992; Fletcher & Brown, 1970; Govier et al., 2001; Rae, 2011; RBGE, 2012). Edmondson & Rowley (1998) even speculated that the Sabal dated from John Hope’s time as Regius Keeper of RBGE between 1760 and 1786. However, the earliest date most commonly cited is 1822, the year that the plant was transferred, along with much of the collection, from the Leith Walk garden to RBGE’s current site at Inverleith. This article is a summary of its history and cultivation, and offers a description of recent horticultural activities to replace existing supports using novel and possibly unique materials.

O doce de leite é consumido em países do Mercosul e composto de água, proteínas, lipídeos, minerais e açúcar. A acidez titulável (AT) do leite, teor de lactose e de gordura alteram as características sensoriais e de coloração do produto. O objetivo foi evidenciar, em aula prática, a importância da qualidade da matéria-prima na elaboração do doce de leite. Os leites pasteurizados (integral, desnatado ou zero lactose) foram avaliados quanto a AT antes e após adição de ácido lático ou bicarbonato de sódio. Após, foi adicionado 20% de açúcar (seis formulações diferentes), seguido de aquecimento até o ponto final. Na avaliação dos produtos foi observada textura, coloração e grau de doçura (56 alunos). F1(controle) apresentou coloração caramelo média, textura lisa, sem grumos, e sabor doce característico. Em F2 havia um excesso de AT no leite, com doce de leite de uma tonalidade mais clara e granuloso. F3 foi elaborada com excesso de bicarbonato de sódio, produzindo um doce escuro, sem chegar ao ponto final, e sabor amargo. Em F4 foi utilizado creme de leite (17% de gordura), com cor caramelo médio, liso e menos doce. Na F5 foi utilizado leite desnatado, produzindo um doce de leite caramelo médio, liso e sabor doce um pouco mais acentuado. Já F6 utilizou leite zero lactose, produzindo um doce de leite marrom escuro, firme, com grumos e doçura marcante. Esta aula prática evidenciou a importância da qualidade da matéria-prima para o doce de leite e trouxe a realidade das Indústrias beneficiadoras, que a recebem com qualidade variada.
 
 Palavras-chave: Pós-Graduação. Leite e Derivados. Acidez.
 
 Abstract
 Dulce de leche is consumed in the Mercosul countries, and it is composed by water, proteins, lipids, minerals and sugar. Milk titratable acidity, lactose and fat contents change the product sensorial and color characteristic. The objective was to evidence, in a practical class, to Master level students, the importance of raw material in the dulce de leche manufacture. Pasteurized milk (whole, skimmed or lactose free) were evaluated for titratable acidity, before and after the lactic acid or sodium bicarbonate addition. Then, 20% of sugar was added to the milk (six different formulations), and it was heated until dulce de leche final point. In the products evaluation, texture, coloration and sweetness degree were evaluated by 56 students. F1 (control) presented medium caramel color, smooth texture, and characteristic sweet flavor. F2 presented an excess of titratable acidity, with lighter and grainy dulce de leche. F3 was elaborated with sodium bicarbonate excess, producing a dark dulce de leche, without reaching the final point, and bitter taste. F4 was produced with cream (17% fat), and presented a medium caramel color, smooth and less sweet. In F5 skimmed milk was used, resulting in a dulce de leche with medium caramel color, smooth and a slightly more pronounced sweet flavor. F6 was produced with lactose free milk, producing a dark brown dulce de leche, with lumps and marked sweetness. This practical class highlighted the importance of the raw material quality for dulce de leche production and brought the reality of the beneficiary industries, which receive raw materials of varying quality.
 
 Keywords: Post Graduation. Milk and Derivatives. Titratable Acidity.

Foi avaliado o desempenho produtivo de vacas da raça Holandesa mantidas em pastagem consorciada de milheto (Pennisetum glaucum (L.) R. Brown) e feijão miúdo (Vigna unguiculata L.), recebendo ou não suplementação diária, durante o período de 18/12/2000 a 20/02/2001. Foram utilizadas 12 vacas multíparas, selecionadas pelo potencial produtivo, peso vivo e fase de lactação. Após estratificação, os animais foram distribuídos aleatoriamente em dois grupos que foram manejados em dois sistemas alimentares: pastagem consorciada de milheto e feijão miúdo à vontade (MFM); e pastagem consorciada à vontade + suplementação diária (MFM+S). Utilizou-se delineamento experimental inteiramente casualizado. A disponibilidade de matéria seca (MS) da forragem foi, em média, de 2.469,6 e 1.554,8 kg ha-1, respectivamente, na entrada e na saída dos animais dos piquetes. O valor nutritivo do pasto apresentou valores médios de 70,25 dag kg-1 de digestibilidade in vitro da matéria orgânica; 16,5 dag kg-1 de proteína bruta e 68,5 dag kg-1 de fibra detergente neutro. O feijão miúdo apresentou participação média de 12% na composição total do pasto. Houve diferença significativa (P<0,01) na produção de leite entre as vacas mantidas nos dois sistemas alimentares, sendo a produção média de leite de 19,56 e 23,40 kg vaca-1dia-1, respectivamente, no sistema MFM e MFM+S. A produção de leite dos animais que receberam suplementação foi mais estável entre os períodos de avaliação.

En el presente trabajo se hace referencia al compromiso de los participantes en la empresa familiar y su relación con el clima organizacional en los municipios de Rioverde y el refugio Ciudad Fernández, siendo este el objetivo principal de estudio. La investigación se realizó con el fin de identificar los factores del clima organizacional (apoyo del superior inmediato, claridad del rol, contribución personal, reconocimiento, expresión de los propios sentimientos y trabajo como reto), según Brown y Leigh (1996), que más contribuyen con el compromiso organizacional desde la perspectiva de los trabajadores, siendo analizado el compromiso organizacional en sus tres dimensiones: el compromiso afectivo, de continuidad y el normativo (Meyer, Allen y Smith, 1993) y la relación con algunas variables sociodemográficas.

Stingless bee Trigona spinipes (Hymenoptera: Apidae) is an important pest of calla lily, Zantedeschia aethiopica (L.), damaging flowers, especially the spadix. The aim was to identify the most efficient packaging for bagging calla lily inflorescences, aiming to protect against the attack of stingless bee and to maintain postharvest quality. The experiment was carried out in a calla lily plantation cultivated in soil under 50% shading screen. Treatments consisted in bagging calla lily flowers with: 1) brown kraft paper bag, 2) non-woven fabric (NWF) bag; 3) transparent plastic bag, 4) transparent micro-perforated plastic bag and 5) control (without bagging). The experimental design was completely randomized with 25 replicates and one inflorescence per plot. Inflorescences received treatments when they presented definitive color, but still with completely closed spathe. Seven days after bagging, inflorescences were collected and evaluated for damages caused by insects in the field and the postharvest characteristics. Postharvest quality evaluations of inflorescences were performed for 12 days, observing expansion of the spathe in length and width, stem weight and visual quality expressed by the number of days that remained in each class. The bagging of calla lily inflorescences was efficient in the control of stingless bee, regardless of packaging used, because under these conditions, no inflorescence presented damage. In control, 84% of damaged inflorescences were observed. Differences in postharvest characteristics were observed and inflorescences remained for longer periods in the process of spathe opening, which is characterized by the measurement of their length and width, when packed. Among packages, NWF allowed longer spathe length at the 6th day of evaluation, larger width at 7th day of evaluation and less fresh mass loss at the end of the experiment (8%). In control, reduction of spathe measurements from the first day of evaluation and loss of 11% of fresh mass were observed. It was concluded that NWF is an efficient packaging to protect calla lily against the attack of stingless bee without compromising the postharvest quality of inflorescences.

El propósito del estudio fue identificar el nivel de percepción del clima organizacional de los empleados de mantenimiento del taller de una minera de San Luis Potosí, así como determinar la relación de la percepción sobre las dimensiones del clima organizacional según sus características sociodemográficas. Es un estudio de enfoque cuantitativo, de alcance descriptivo, correlacional y de diseño transversal, se integró por 78 empleados, aplicándose un censo, participando el 100% de los empleados del área de mantenimiento, el personal se clasificó de acuerdo a su puesto de trabajo como: Jefatura, Supervisor, Mecánico, Soldador y Auxiliar de mecánico. La técnica aplicada fue la encuesta autoadministrada, utilizando el instrumento de Brown & Leigh (1996), la confiabilidad del instrumento fue de 0.875. Se encontró que el nivel de clima es aceptable según los empleados de la minera, destacando las dimensiones trabajo como reto y claridad el rol, las dimensiones con un promedio más bajo fueron reconocimiento y expresión de los propios sentimientos, aunque todas tuvieron un promedio arriba de 3 puntos. También se presentó correlación entre algunas dimensiones del clima organizacional con la edad y la antigüedad en la empresa.

In this study it was aimed to adapt Psychological Climate Scale (Brown & Leigh, 1996) into Turkish. It was originally developed for business organizations but while adapting it into Turkish the items were adjusted to educational settings. There were 745 teachers in two different study groups. To test the language validity of the scale, Pearson Correlation coefficient between English and Turkish versions was calculated. They were responded by English teachers with a two week interval. Findings indicated a high correlation (r=,859; p<,01) which means that Turkish version has language validity. Exploratory Factor Analysis (EFA) and Confirmatory Factor Analysis (CFA) were conducted to test the construct validity. Cronbach’s Alpha coefficients were an indication of reliability which was calculated separately for the scale and sub-dimensions (ranges from α= ,912 to α= ,738). In item analysis, item total correlations and the correlations among sub-dimensions of the scale were calculated. Additionally, significance of difference between lower and upper 27 % groups was checked. The findings of EFA manifested a construct with five sub dimesions which was different from original scale and this dimensions were named in Turkish based on the original scale. On the other hand, ‘Challenge’ sub dimension did not meet reliability criteria. Therefore, it was taken out from adapted version. The item total correlations met the criteria in the literature. The difference between lower-upper 27 % groups was statistically significant. The total scale and its sub-dimensions had also statistically significant correlations (ranging from ,879 to ,455) indicating internal consistency. The model was validated by CFA. The findings of this study showed that Turkish version of Psychological Climate Scale has validity and reliability which means the scale can be applied in educational organizations. Extended English abstract is in the end of PDF (TURKISH) file. ÖzetBu çalışma ile İngilizce Psikolojik İklim Ölçeğinin (Brown & Leigh, 1996) Türkçe’ye uyarlanması amaçlanmıştır. Ölçeğin orijinali iş örgütleri için geliştirilmiş olmakla birlikte, uyarlama esnasında maddeler eğitim örgütlerine uygun hale getirilmiştir. Araştırma iki farklı çalışma grubu üzerinde yürütülmüş olup; bu gruplar toplam 745 öğretmenden oluşmaktadır. Ölçeğin dil yönünden geçerliğini doğrulamak amacıyla İngilizce ve Türkçe versiyonlar iki hafta ara ile İngilizce öğretmenlerinden oluşan bir gruba uygulanarak; bu ölçümler arasındaki Pearson Korelasyon katsayısı hesaplanmıştır. Elde edilen bulgu ölçümler arasında yüksek düzeyli bir ilişkinin mevcudiyetini ifade etmektedir (r=,859; p<,01) ki bu da ölçeğin Türkçe versiyonun dil yönünden geçerli olduğunu kanıtlamaktadır. Ölçeğin yapı geçerliğini belirlemek amacıyla ise Açımlayıcı Faktör Analizi (AFA) ve Doğrulayıcı Faktör Analizi (DFA) yürütülmüştür. Ölçeğin geneli ve alt boyutları için ayrı ayrı hesaplanan Cronbach’s Alpha katsayısıları güvenirliği işaret etmektedir (α= ,912- α= ,738 arasında). Madde analizi bağlamında, madde toplam korelasyonları, ölçeğin alt boyutları arasındaki ilişkiler ve alt-üst % 27’lik gruplar arasındaki farkın anlamlılığı ortaya konmuştur. AFA’dan elde edilen sonuçlar orijinal ölçekten farklı olarak beş boyutlu bir yapıya işaret etmektedir. Bu boyutlar ölçeğin İngilizce versiyonuna sadık kalınarak Türkçe’ye çevrilmiştir. Diğer taraftan, ‘Mesleki Zorluk’ alt boyutu gerekli güvenirlik kriterini sağlayamadığı için ölçeğin Türkçe versiyonunda yer almamaktadır. Madde toplam korelasyonları alan yazında ortaya konan ölçütleri karşılamıştır. Alt-üst % 27’lik gruplar arasındaki fark istatistiksel olarak anlamlıdır. Ölçek geneli ve alt boyutları arasındaki istatiksel açıdan anlamlı ilişkiler iç tutarlılığın göstergesidir (,879-,455). Modelin geçerliliği DFA ile doğrulanmıştır. Çalışma sonucunda Psikolojik İklim Ölçeği’nin Türkçe’ye uyarlandığında geçerli ve güvenilir olduğu görülmüştür. Bu bağlamda, söz konusu ölçme aracı eğitim örgütlerinde uygulanabilir. // // // //

Xanthomonas axonopodis pv. vesicatoria, causal agent of bacterial spot of tomato (Lycopersicon esculentum L.) and sweet pepper (Capsicum annuum L.) was isolated from tomato and pepper plants in greenhouse production in the Province of Antalya, in southwestern Turkey. Disease incidence was less than 4% of plants observed in 2001 and ranged from 1 to 20% in 2002. Eleven seedling-producing companies and 26 greenhouses that produce tomato and pepper were surveyed during the rainy seasons of 2001 and 2002. The increase in disease incidence in 2002 is an indication that this disease is becoming more prevalent on tomato and pepper plants grown in greenhouses in southwestern Turkey. A gram-negative bacterium producing yellow-pigmented colonies on nutrient agar was consistently isolated from brown, circular spots on leaflets of tomato and sweet pepper seedlings. Five isolates were pathogenic on commercial cultivars of tomato and pepper when bacterial suspensions (108 CFU/ml) were infiltrated into the intercellular spaces of leaves to determine race by using procedures described by Bouzar et al. (1). All the isolates produced hypersensitive reaction responses on tomato genotype cv. Hawaii 7998 and pepper genotype cvs. 20 R and 30 R and were designated tomato race 1 pepper race 1 (T1P1) (1). Fatty acid analysis of the strains identified them as X. axonopodis vesicatoria with similarity index values of 0.872 to 0.933. In addition, the strains were tested with X. axonopodis vesicatoria-specific polymerase chain reaction primers (RST 2/3 and RST 9/10) (2). The isolates were determined to be X. axonopodis vesicatoria. Although bacterial spot of tomato has been suspected in Turkey for a number of years, to our knowledge, this is the first report of the bacterium on tomato. References: (1) H. Bouzar et al. Phytopathology 84:663, 1994. (2) R. P. Leite, Jr. et al. Appl. Env. Microbiol. 60:1068, 1994.

Lesions were observed on leaves and stems of alfalfa (Medicago sativa L.) growing as weeds in Pullman, Washington in June of 2001. Lesions appeared similar to those described for spring black stem and leaf spot caused by Phoma medicaginis Malbr. & Roum. in Roum. var. medicaginis Boerema (synonyms Phoma herbarum Westend. var. medicaginis Fckl. and Ascochyta imperfecta Peck). Sporulation was induced by placing surface-disinfested pieces of infected tissue on 3% water agar (WA) for 24 h under fluorescent light with a 12-h photoperiod. Single-conidial isolations were made by streaking conidia on 3% WA and picking germinated conidia after 18 h. Isolates had cultural and conidial morphology similar to descriptions of P. medicaginis and isolate ATCC52798 when grown on V8 agar and PDA at room temperature (3). Distinction between P. medicaginis var. medicaginis and P. medicaginis var. macrospora was not attempted. Conidial suspensions (1 × 106 conidia/ml) of isolates AS1, AS2, AS3, and AS4 were spray inoculated to runoff onto 3-week-old plants. PI lines 536535 and 536534 of M. sativa subsp. sativa (4-trifolate stage) and PI lines 442896 and 577609 of M. truncatula (5- to 7-trifolate stage) from the USDA Western Region Plant Introduction Station, Pullman, Washington were inoculated, with at least two replicate plants inoculated per isolate. Plants were incubated in a dew chamber at 20°C in the dark for 24 h to promote infection and then transferred to a growth chamber at 18°C with a 12-h photoperiod. Lesions were apparent on M. sativa subsp. sativa plants 4 days postinoculation (dpi) and 7 dpi on M. truncatula plants. At 12 dpi, many dark brown lesions with chlorotic halos were noted on leaves of M. sativa subsp. sativa, occasionally killing the entire trifoliate leaf and progressing approximately 1 cm down the stem. According to the previously published 1-to-5 visual rating scale for this disease (4), disease scores on both genotypes of M. sativa subsp. sativa were 4 (susceptible), while disease ratings on M. truncatula were 1-2 (resistant) with a few dark brown lesions noted on leaves and stems generally restricted to less than 2 mm in diameter. DNA was extracted from isolates AS1 and AS4, and PCR was performed using gpd-1 and gpd-2 primers for the glyceraldehyde-3-phosphate dehydrogenase gene (G3PD) (1), and EF1-728F and EF1-986R primers for the translation elongation factor 1-alpha gene (EF) (2), resulting in amplification of an approximately 600-bp fragment from each primer set. Amplicons were direct-sequenced on both strands, and BLAST searches of the NCBI nucleotide database were conducted with consensus G3PD and EF sequences of both isolates AS1 and AS4. Closest matches obtained for the G3PD and EF sequences were P. medicaginis isolate ATCC52798 (Accession No. DQ525740) and P. medicaginis var. medicaginis CBS316.90 (Accession No. AY831548), respectively. The G3PD and EF sequences for these isolates have been deposited in GenBank database (Accession Nos. EU394712–EU394715). To our knowledge, this is the first confirmed report of spring black stem and leaf spot of alfalfa in Washington State supported by Koch's postulates, cultural morphology, and multigene sequencing. References: (1) M. L. Berbee et al. Mycologia 91:964, 1999. (2) I. Carbone and L. M. Kohn. Mycologia 91:553, 1999. (3) G. C. Kinsey. No. 1503 in: IMI Descriptions of Fungi and Bacteria. CABI Bioscience, Surrey, UK, 2002. (4) R. M. Salter and K. L. Leath. Spring blackstem and leafspot resistance. Online publication. North American Alfalfa Improvement Conference, Beltsville, MD, 1992.

O aleitamento materno é um dos fatores primordiais tanto para o recém-nascido como para a mãe, de um lado se depreende a sua função de alimentação dos bebês, por outro lado o desmame precoce se torna um problema para órgãos oficiais de saúde. O presente estudo consiste em uma pesquisa bibliográfica, de natureza descritiva, com o objetivo de identificar os trabalhos publicados e relacionados em destacar a importância da amamentação e dos fatores, que determinam a atuação do enfermeiro na promoção dessa prática. A pesquisa reafirma a importância do aleitamento materno, e igualmente destaca os fatores que se interpõem à prática da amamentação, tais como: a atuação dos serviços de saúde, a educação materna, a classe sócio-econômica, as crenças, o apelo do comércio e da indústria de leite e de bicos artificiais e o retorno precoce das nutrizes ao trabalho. A ação educativa e assistencial do enfermeiro é imprescindível para a modificação de comportamento de gestantes e puérperas, para que frente às intercorrências, possam obter êxito, amamentando por um período suficiente, para o pleno desenvolvimento físico e psíquico do bebê.Palavras-chave: Aleitamento Materno. Educação. Papel do Profissional de Enfermagem.AbstractThe maternal lactation is one of the primordial factors not only for the newly-bron but also for the mother, on the one hand its function of feeding the babies, on the other . The present study consists of a bibliographical research, of descriptive nature, with the objective to identify the works already published and related to highlighting the importance of breast-feeding and the factors that determine the nurse’s performance in the promotion of this practice. It can be verified that all material collected reaffirms the importance of the maternal lactation, and equally highlights the factors that are interposed e to the practice one of breast-feeding, such as, the health services performance, the maternal education, the socio-economic class, the beliefs, the dairy industry commercial appeal and the artificial peaks and the precocious return of the breastfeeding mothers to work. The educative and assistance action of the nurse is essential for the modification of behavior of pregnant woman and parturient, so that before the intercurrent, they can reach success, suckling for a enough period, for the full physical and psychic development of the baby.Keywords: Maternal Lactation. Education. Nurse’s Role.

About 10,000 ha of pumpkins [Cucurbita pepo L. and Cucurbita moschata (Duchesne) Duchesne ex Poir] are produced annually in Illinois. In 2010 and 2011, severe leaf and fruit symptoms typical of bacterial spot caused by Xanthomonas cucurbitae (ex Bryan) Vauterin et al. were observed in pumpkin fields in Illinois, resulting in estimated yield losses of 3 to 90%. Leaf infection was observed from the time of spreading vines until harvest, and infection of fruit occurred from when fruit weights were 0.25 kg until harvest. Leaves had small (2 to 4 mm), angular, yellow spots (1). Fruit had small (1 to 3 mm in diameter), slightly sunken, circular spots, each with a beige center and dark brown halo (1). A survey in 2010 showed that bacterial spot occurred in 40 of 50 pumpkin fields with symptoms on 3 to 94% of fruit in a field (average 34%). A survey in 2011 showed fruit with bacterial spot symptoms in 57 of 65 pumpkin fields, with lesions on 3 to 87% of the fruit in a field (average 24%). Six to twelve symptomatic pumpkins were collected from each field, and X. cucurbitae was isolated from the fruit by surface-disinfesting an area of the fruit with lesions with paper tissue soaked in 95% ethanol. One or two lesions/fruit were cut out with a sterile blade, inserted into an eppendorf tube containing 1 ml of sterile distilled water (SDW), the tubes shaken manually, and a loopful of the bacterial suspension from each tube streaked onto nutrient agar (NA). The plates were incubated at 24°C for 3 to 4 days. Single colonies of each of the isolated bacterium were prepared by streaking isolated colonies onto additional plates of NA and selecting well-separated colonies. The colonies were identified as X. cucurbitae by culturing on yeast extract-dextrose–CaCO3 (YDC) agar, on which xanthomonas-like yellow colonies with mucoid growth developed. The isolates were gram-negative, O+ and F– in the oxidative and fermentative test, oxidase negative, and motile. The isolates hydrolyzed starch and esculin, but did not hydrolyze nitrate, and grew on YDC agar at 33°C. Confirmation of the species identity was achieved using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay (2), which produced a 1,500-bp band. Koch's postulates were carried out for 40 isolates of X. cucurbitae from 40 different fields on pumpkin cv. Howden in a greenhouse. Koch's postulates for five of the isolates were also conducted in a field. Bacterial inoculum was cultured on Luria Broth agar medium and a suspension of 108 cfu/ml prepared in SDW. Pumpkin leaves and fruit were spray-inoculated. In the greenhouse test, each isolate was inoculated onto five leaves of each of four plants. In the field, each isolate was inoculated onto 10 leaves and one fruit of each of 10 plants. A positive control treatment consisted of inoculating pumpkin leaves and fruit with a known X. cucurbitae isolate. A negative control treatment entailed using SDW for inoculation. Lesions developed on leaves and fruit of plants inoculated with the positive control and suspected X. cucurbitae isolates. X. cucurbitae was reisolated from symptomatic leaves and fruit and identified by culturing on YDC agar, and using the PCR assay. No symptoms developed on leaves or fruit sprayed with SDW, and attempts to isolate X. cucurbitae from these plants did not result in development of any bacterial colonies. References: (1) Babadoost et al. Univ. of Illinois Extension C1392, 2004. (2) Leite et al. Appl. Environ. Microbiol. 60:1068, 1994.

Background:Under European Union (EU) Clinical Trial regulations,1clinical research sponsors (CRSs) must ensure all studies performed in the EU are accompanied by a trial summary for laypersons, published within 1 year of study completion. These lay summaries should disseminate clinical trial results in an easy-to-understand way for trial participants, patient and caregiver communities, and the general public. The European Patients Forum (EPF)2and European Patients’ Academy on Therapeutic Innovation (EUPATI)3encourage CRSs to engage with patient organisations (POs) in the development of lay summaries. This recognises the patients’ contribution to clinical research and supports the development of patient-focused material.Objectives:We share learnings from a collaboration between scleroderma POs and a CRS to create the SENSCIS® trial (NCT02597933) written and video lay summaries.Methods:A community advisory board (CAB), comprising representatives from 11 scleroderma POs covering a range of countries/regions, was formed based on the EURORDIS charter for collaboration in clinical research.4Through three structured meetings, over a seven-month period, the CAB provided advice on lay summary materials (written and video) drafted by the CRS’ Lay Summary Group (Fig. 1). At each review cycle, the CAB advice was addressed to make content more understandable and more relevant for patients and the general public.Results:The CAB advised that the existence of lay summaries is not well known in the patient community and also recommended the development of trial-specific lay summary videos to further improve understandability of the clinical trial results for the general public. Videos are a key channel of communication, enabling access to information for people with specific health needs and lower literacy levels. Following CAB advice, the CRS developed a stand-alone video entitled“What are lay summaries?”and a trial-specific lay summary video. Revisions to lay summary content (written and video) included colour schemes, iconography and language changes to make content more understandable. For videos, adjustments to animation speed, script and voiceover were implemented to improve clarity and flow of information (Fig. 2). Approved final versions of lay summary materials are publicly available on the CRS website. Translation into languages representing trial-site countries is in progress to widen access to non-English speakers and, where possible, local versions are being reviewed by the patient community.Conclusion:Structured collection and implementation of CAB advice can make lay summary materials more understandable for the patient community and wider general public.References:[1]EU. Summaries of clinical trial results for laypersons. 2018[2]EPF. EPF position: clinical trial results – communication of the lay summary. 2015[3]EUPATI. Guidance for patient involvement in ethical review of clinical trials. 2018[4]EURORDIS. Charter for Collaboration in Clinical Research in Rare Diseases. 2009Disclosure of Interests:Joep Welling Speakers bureau: Four times as a patient advocate for employees of BII and BI MIDI with a fixed amount of € 150,00 per occasion., Annelise Roennow: None declared, Maureen Sauvé Grant/research support from: Educational grants from Boehringer Ingelheim and Janssen., EDITH BROWN: None declared, Ilaria Galetti: None declared, Alex Gonzalez Consultant of: Payment made to the patient organisation (Scleroderma Research Foundation) for participation in advisory boards, Alexandra Paula Portales Guiraud: None declared, Ann Kennedy Grant/research support from: AS FESCA aisbl, Catarina Leite: None declared, Robert J. Riggs: None declared, Alison Zheng Grant/research support from: We get grants from Lorem Vascular; BI China,; Jianke Pharmaceutical Co., Ltd.; Kangjing Biological Co., Ltd.; COFCO Coca-Cola to organize national scleroderma meetings, offer patients service, holding academic meetings and other public activities, there is also a small part of the grants used to pay the workers in our organization., Consultant of: I worked as a paid consultant for BI. Pay-per-job., Speakers bureau: I was invited once to be a speaker at BI China’s internal meeting and they paid me., Matea Perkovic Popovic: None declared, Annie Gilbert Consultant of: I have worked as a paid consultant with BI International for over 3 years, since Sept 2016., Lizette Moros Employee of: Lizette Moros is an employee of Boehringer Ingelheim, Kamila Sroka-Saidi Employee of: Paid employee of Boehringer Ingelheim., Thomas Schindler Employee of: Employee of Boehringer Ingelheim Pharma, Henrik Finnern Employee of: Paid employee of Boehringer Ingelheim.

Background:The SENSCIS® trial (2015–18) was a large clinical trial (n=576) investigating the efficacy and safety of nintedanib in patients with systemic sclerosis-associated interstitial lung disease.1 The clinical research sponsors (CRS) collaborated with the scleroderma patient community advisory board (CAB) regarding the design, implementation and conduct of the trial.2 As part of this collaboration, the CRS and CAB developed a post-trial survey for SENSCIS® participants. The use of the developed patient-centric materials was optional for the sites.Objectives:The objectives of the SENSCIS® post-trial survey were to gain experience in collecting real-world information and trial satisfaction data from patients to inform and improve future patient centric clinical research.Methods:SENSCIS® trial participants who were involved in the extension trial SENSCIS®-ON completed a post-trial survey covering nine multiple-choice questions about three main topics:[1]Recruitment – Where do patients usually search for clinical trials and how did they become aware of SENSCIS®?[2]Motivation & Retention – What motivated patients to start and continue participation in SENSCIS®?[3]Challenges & Wishes – What were the challenges during trial participation and how can future clinical trials be improved regarding patient centricity?Results:A total of 125 participants completed all survey questions. Participants could select more than one option. A total of 51 patients reported that they are usually not actively looking for trials. For those actively searching, the most common sources to learn about trials were specialists/general practitioners (GPs) (46 patients) and internet search engines (20 patients), followed by patient organisations (12 patients). Of note, 78 patients would pay attention to printed materials, such as a card/flyer/poster in a doctor’s office and get in touch with a trial/study site.Back in 2015–2017, during recruitment for the SENSCIS® trial, the majority of the patients who answered the survey were made aware via their specialist/GP (116 patients), whereas 5 were made aware via patient organisations and 4 via the internet.The most frequent motivations to join the trial were ‘hope to receive an improved therapy’ (98 patients), to help other patients (64 patients), and on the recommendation of their specialist/GP (81 patients). Similarly, the most liked aspects of the trial were the ‘opportunity to receive an improved therapy’ (92 patients) and ‘to support the development of an improved therapy for my illness’ (90 patients). More than half of patients reported ‘continuous observation of general health’ (72 patients) and ‘advice from GPs/specialists’ (71 patients) as motivation to stay in the trial (Figure 1).‘Concerns about side effects’ (72 patients) and ‘not knowing whether the trial medication will work for me’ (63 patients) were reported as the least liked aspects of the trial. Travel to the site was reported as a challenge by 21 patients.To improve clinical trials, patients requested more patient-friendly information (50 patients) and multiple formats of information material (46 patients). Finally, 48 patients expressed the desire to communicate with other trial participants.Conclusion:The SENSCIS® post-trial survey is a unique approach to receive real-world feedback from trial participants, and these pilot data will help improve future clinical trials and communication. The results highlight the importance of reaching patients who may not be actively looking for clinical trials.Figure 1.Motivation to stay in the SENSCIS® trial1,21More than one option could be selected.2Data collected on 9th January 2021References:[1]Distler O et al. N Engl J Med. 2019 Jun 27;380(26):2518-2528. doi: 10.1056/NEJMoa1903076.[2]Roennow A et al. BMJ Open. 2020 Dec 16;10(12):e039473. doi: 10.1136/bmjopen-2020-039473.Acknowledgements:Sue Farrington (Federation of European Scleroderma Associations [FESCA] Belgium), Luke Evnin (Scleroderma Research Foundation, United States), Beatriz Garcia (Asociacion Espanola de Esclerodermia, Spain), Catarina Leite (Associacao Portuguesa de Doentes com Esclerodermia, Portugal), Alison Zheng (Chinese Organisation for Scleroderma), Matea Perković Popović (Hrvatska udruga oboljelih od sklerodermije, Croatia), Tina Ampudia (Asociacion Mexicana de Orientacion Apoyo y Lucha Contra la Esclerodermia, AC, Mexico), Stephanie Munoz (Norsk Revmatikerforbund, Diagnosegruppen for Systemisk Sklerose, Norway), Monica Holmner (Reumatikerförbundet Riksföreningen för systemisk skleros, Sweden).Disclosure of Interests:Ilaria Galetti: None declared, EDITH BROWN: None declared, Ann Kennedy Consultant of: I have been a member of the CAB (Community Patient Advisory Board) described in the accompanying abstract under discussion. My patient organisation has been paid for its participation in the CAB., Grant/research support from: It is not myself personally, but FESCA (Federation of European Scleroderma Associations) aisbl., that has received project grants for awareness raising and education. I was President of this Federation., Robert J Riggs: None declared, Annelise Roennow: None declared, Maureen Sauvé: None declared, Joep Welling Speakers bureau: BI MIDI and BI International, Sanofi, Henrik Finnern Employee of: I am employee of Boehringer Ingelheim International GmbH, Annie Gilbert Consultant of: I am a paid consultant for Bohringer Ingelheim since 2016, Martina Gahlemann Employee of: I am employed by Boehringer Ingelheim (Schweiz) GmbH, Basel, Switzerland, Wiebke Sauter Employee of: I am employer of Boehringer-Ingelheim

AbstractA revisionary synopsis is presented for the familyTrypetheliaceae, based on a separately published phylogenetic analysis of a large number of species, morpho-anatomical and chemical study of extensive material, and revision of numerous type specimens. A total of 418 species is formally accepted in this synopsis, distributed among 15 genera as follows:Aptrootia(3),Architrypethelium(7),Astrothelium(242),Bathelium(16),Bogoriella(29),Constrictolumina(9),Dictyomeridium(7),Distothelia(3),Marcelaria(3),Nigrovothelium(2),Novomicrothelia(1),Polymeridium(50),Pseudopyrenula(20),Trypethelium(16), andViridothelium(10). All accepted genera, including new genera described separately in this issue, are keyed out and briefly described and discussed, and keys are provided for all accepted species within each genus. Entries with full synonymy and brief descriptions, and in part also discussions, are provided for all accepted species, except those newly described elsewhere in this issue, which are cross-referenced in the corresponding keys. The description of the newly defined genera takes into account phylogeny in combination with morpho-anatomical features with the result that they are mostly recognizable by a combination of thallus, ascoma and ascospore features. Most species previously assigned to the generaAstrothelium,Campylothelium,Cryptothelium, andTrypethelium, based on a schematic concept of ascoma morphology and ascospore septation, are now included in a single genus,Astrothelium, with highly variable ascoma morphology and ascospore septation but invariably with astrothelioid ascospores (at least when young), that is diamond-shaped lumina, and a well-developed, corticate, usually olive-green thallus that often covers the ascomata. While the generaAptrootia(large, brown, muriform ascospores),Architrypethelium(large, mostly 3-septate ascospores), andPseudopyrenula(ecorticate, white thalli and astrothelioid ascospores) are maintained,Trypetheliumis redefined to include species with raised, pseudostromatic ascomata and multiseptate ascospores with thin septa. The sister group ofTrypetheliumis the genusMarcelaria, with brightly coloured pseudostromata and muriform ascospores.Batheliumis now limited to species with strongly raised, fully exposed pseudostromata and septate to muriform ascospores with thin septa. Several genera are recognized for more basal lineages with mostly ecorticate, white thalli and solitary, exposed ascomata previously assigned toArthopyrenia,MycomicrotheliaandPolymeridium, viz. Bogoriella,Constrictolumina,Dictyomeridium, andNovomicrothelia. In addition, separate genera are accepted for theTrypethelium tropicum(Nigrovothelium) andT. virens(Viridothelium) groups. In addition, a refined species concept resulting from phylogenetic studies is employed which pays particular attention to morphological features of the thallus and ascomata. Of a total of 526 names checked, 107 remain synonyms of accepted names and a further eight are newly excluded from the family. Based on these redispositions, the following 146 new combinations are proposed, including reinstatement of numerous names previously subsumed into synonymy:Architrypethelium columbianum(Nyl.) Aptroot & Lücking comb. nov.,A. grande(Kremp.) Aptroot & Lücking comb. nov.,Astrothelium aeneum(Eschw.) Aptroot & Lücking comb. nov.,A. alboverrucum(Makhija & Patw.) Aptroot & Lücking comb. nov.,A. amazonum(R. C. Harris) Aptroot & Lücking comb. nov.,A. ambiguum(Malme) Aptroot & Lücking comb. nov.,A. andamanicum(Makhija & Patw.) Aptroot comb. nov.,A. annulare(Spreng.) Aptroot & Lücking comb. nov.,A. aurantiacum(Makhija & Patw) Aptroot & Lücking comb. nov.,A. auratum(R. C. Harris) Aptroot & Lücking comb. nov.,A. aureomaculatum(Vain.) Aptroot & Lücking comb. nov.,A. basilicum(Kremp.) Aptroot & Lücking comb. nov.,A. bicolor(Taylor) Aptroot & Lücking comb. nov.,A. buckii(R. C. Harris) Aptroot & Lücking comb. nov.,A. calosporum(Müll. Arg.) Aptroot & Lücking comb. nov.,A. cartilagineum(Fée) Aptroot & Lücking comb. nov.,A. cecidiogenum(Aptroot & Lücking) Aptroot & Lücking comb. nov.,A. ceratinum(Fée) Aptroot & Lücking comb. nov.,A. chapadense(Malme) Aptroot & Lücking comb. nov.,A. chrysoglyphum(Vain.) Aptroot & Lücking comb. nov.,A. chrysostomum(Vain.) Aptroot & Lücking comb. nov.,A. cinereorosellum(Kremp.) Aptroot & Lücking comb. nov.,A. cinereum(Müll. Arg.) Aptroot & Lücking comb. et stat. nov.,A. confluens(Müll. Arg.) Aptroot & Lücking comb. nov.,A. consimile(Müll. Arg.) Aptroot & Lücking comb. nov.,A. deforme(Fée) Aptroot & Lücking comb. nov.,A. defossum(Müll. Arg.) Aptroot & Lücking comb. nov.,A. degenerans(Vain.) Aptroot & Lücking comb. nov.,A. dissimilum(Makhija & Patw.) Aptroot & Lücking comb. nov.,A. effusum(Aptroot & Sipman) Aptroot & Lücking comb. nov.,A. endochryseum(Vain.) Aptroot & Lücking comb. nov.,A. exostemmatis(Müll. Arg.) Aptroot & Lücking comb. nov.,A. feei(C. F. W. Meissn.) Aptroot & Lücking comb. nov.,A. ferrugineum(Müll. Arg.) Aptroot & Lücking comb. nov.,A. galligenum(Aptroot) Aptroot & Lücking comb. nov.,A. gigantosporum(Müll. Arg.) Aptroot & Lücking comb. nov.,A. indicum(Upreti & Ajay Singh) Aptroot & Lücking comb. nov.,A. infossum(Nyl.) Aptroot & Lücking comb. nov.,A. infuscatulum(Müll. Arg.) Aptroot & Lücking comb. nov.,A. irregulare(Müll. Arg.) Aptroot & Lücking comb. nov.,A. keralense(Upreti & Ajay Singh) Aptroot & Lücking comb. nov.,A. kunzei(Fée) Aptroot & Lücking comb. nov.,A. leioplacum(Müll. Arg.) Aptroot & Lücking comb. nov.,A. lugescens(Nyl.) Aptroot & Lücking comb. nov.,A. luridum(Zahlbr.) Aptroot & Lücking comb. nov.,A. macrocarpum(Fée) Aptroot & Lücking comb. nov.,A. macrosporum(Makhija & Patw.) Aptroot & Lücking comb. nov.,A. marcidum(Fée) Aptroot & Lücking comb. nov.,A. megaleium(Kremp.) Aptroot & Lücking comb. nov.,A. megalophthalmum(Müll. Arg.) Aptroot & Lücking comb. nov.,A. megalostomum(Vain.) Aptroot & Lücking comb. nov.,A. megaspermum(Mont.) Aptroot & Lücking comb. nov.,A. meiophorum(Nyl.) Aptroot & Lücking comb. nov.,A. meristosporoides(P. M. McCarthy & Vongshew.) Aptroot & Lücking comb. nov.,A. meristosporum(Mont. & Bosch) Aptroot & Lücking comb. nov.,A. neogalbineum(R. C. Harris) Aptroot & Lücking comb. nov.,A. nigratum(Müll. Arg.) Aptroot & Lücking comb. et stat. nov.,A. nigrorufum(Makhija & Patw.) Aptroot & Lücking comb. nov.,A. nitidiusculum(Nyl.) Aptroot & Lücking comb. nov.,A. octosporum(Vain.) Aptroot & Lücking comb. nov.,A. oligocarpum(Müll. Arg.) Aptroot & Lücking comb. nov.,A. olivaceofuscum(Zenker) Aptroot & Lücking comb. nov.,A. papillosum(P. M. McCarthy) Aptroot & Lücking comb. nov.,A. papulosum(Nyl.) Aptroot & Lücking comb. nov.,A. peranceps(Kremp.) Aptroot & Lücking comb. nov.,A. phaeothelium(Nyl.) Aptroot & Lücking comb. nov.,A. phlyctaenua(Fée) Aptroot & Lücking comb. nov.,A. porosum(Ach.) Aptroot & Lücking comb. nov.,A. praetervisum(Müll. Arg.) Aptroot & Lücking comb. nov.,A. pseudoplatystomum(Makhija & Patw.) Aptroot & Lücking comb. nov.,A. pseudovariatum(Upreti & Ajay Singh) Aptroot & Lücking comb. nov.,A. puiggarii(Müll. Arg.) Aptroot & Lücking comb. nov.,A. pulcherrimum(Fée) Aptroot & Lücking comb. nov.,A. pupula(Ach.) Aptroot & Lücking comb. nov.,A. purpurascens(Müll. Arg.) Aptroot & Lücking comb. nov.,A. pustulatum(Vain.) Aptroot & Lücking comb. nov.,A. rufescens(Müll. Arg.) Aptroot & Lücking comb. et stat. nov.,A. sanguinarium(Malme) Aptroot & Lücking comb. nov.,A. santessonii(Letr.-Gal.) Aptroot & Lücking comb. nov.,A. saxicola(Malme) Aptroot & Lücking comb. nov.,A. scoria(Fée) Aptroot & Lücking comb. nov.,A. scorizum(Müll. Arg.) Aptroot & Lücking comb. nov.,A. sierraleonense(C. W. Dodge) Aptroot & Lücking comb. nov.,A. sikkimense(Makhija & Patw.) Aptroot & Lücking comb. nov.,A. spectabile(Aptroot & Ferraro) Aptroot & Lücking comb. nov.,A. sphaerioides(Mont.) Aptroot & Lücking comb. nov.,A. stramineum(Malme) Aptroot & Lücking comb. nov.,A. straminicolor(Nyl.) Aptroot & Lücking comb. nov.,A. subcatervarium(Malme) Aptroot & Lücking comb. nov.,A. subdiscretum(Nyl.) Aptroot & Lücking comb. nov.,A. subdisjunctum(Müll. Arg.) Aptroot & Lücking comb. nov.,A. subdissocians(Nyl. ex Vain.) Aptroot & Lücking comb. et stat. nov.,A. superbum(Fr.) Aptroot & Lücking comb. nov.,A. tenue(Aptroot) Aptroot & Lücking comb. nov.,A. thelotremoides(Nyl.) Aptroot & Lücking comb. nov.,A. trypethelizans(Nyl.) Aptroot & Lücking comb. nov.,A. tuberculosum(Vain.) Aptroot & Lücking comb. nov.,A. ubianense(Vain.) Aptroot & Lücking comb. nov.,A. variatum(Nyl.) Aptroot & Lücking comb. nov.,A. vezdae(Makhija & Patw.) Aptroot & Lücking comb. nov.,Bathelium austroafricanum(Zahlbr.) Aptroot & Lücking comb. nov.,B. nigroporum(Makhija & Patw.) Aptroot & Lücking comb. nov.,Bogoriella alata(Groenh. ex Aptroot) Aptroot & Lücking comb. nov.,B. annonacea(Müll. Arg.) Aptroot & Lücking comb. nov.,B. apposita(Nyl.) Aptroot & Lücking comb. nov.,B. captiosa(Kremp.) Aptroot & Lücking comb. nov.,B. collospora(Vain.) Aptroot & Lücking comb. nov.,B. confluens(Müll. Arg.) Aptroot & Lücking comb. nov.,B. conothelena(Nyl.) Aptroot & Lücking comb. nov.,B. decipiens(Müll. Arg.) Aptroot & Lücking comb. nov.,B. exigua(Müll. Arg.) Aptroot & Lücking comb. nov.,B. fumosula(Zahlbr.) Aptroot & Lücking comb. nov.,B. hemisphaerica(Müll. Arg.) Aptroot & Lücking comb. nov.,B. lateralis(Sipman) Aptroot & Lücking comb. nov.,B. leuckertii(D. Hawksw. & J. C. David) Aptroot & Lücking comb. nov.,B. macrocarpa(Komposch, Aptroot & Hafellner) Aptroot & Lücking comb. nov.,B. megaspora(Aptroot & M. Cáceres) Aptroot & Lücking comb. nov.,B. miculiformis(Nyl. ex Müll. Arg.) Aptroot & Lücking comb. nov.,B. minutula(Zahlbr.) Aptroot & Lücking comb. nov.,B. modesta(Müll. Arg.) Aptroot & Lücking comb. nov.,B. nonensis(Stirt.) Aptroot & Lücking comb. nov.,B. obovata(Stirt.) Aptroot & Lücking comb. nov.,B. pachytheca(Sacc. & Syd.) Aptroot & Lücking comb. nov.,B. punctata(Aptroot) Aptroot & Lücking comb. nov.,B. queenslandica(Müll. Arg.) Aptroot & Lücking comb. nov.,B. socialis(Zahlbr.) Aptroot & Lücking comb. nov.,B. striguloides(Sérus. & Aptroot) Aptroot & Lücking comb. nov.,B. subfallens(Müll. Arg.) Aptroot & Lücking comb. nov.,B. thelena(Ach.) Aptroot & Lücking comb. nov.,B. triangularis(Aptroot) Aptroot & Lücking comb. nov.,B. xanthonica(Komposch, Aptroot & Hafellner) Aptroot & Lücking comb. nov.,Constrictolumina esenbeckiana(Fée) Lücking, M. P. Nelsen & Aptroot comb. nov.,C. leucostoma(Müll. Arg.) Lücking, M. P. Nelsen & Aptroot comb. nov.,C. lyrata(R. C. Harris) Lücking, M. P. Nelsen & Aptroot comb. nov.,C. majuscula(Nyl.) Lücking, M. P. Nelsen & Aptroot comb. nov.,C. malaccitula(Nyl.) Lücking, M. P. Nelsen & Aptroot comb. nov.,C. porospora(Vain.) Lücking, M. P. Nelsen & Aptroot comb. nov.,Dictyomeridium amylosporum(Vain.) Aptroot, M. P. Nelsen & Lücking comb. nov.,D. campylothelioides(Aptroot & Sipman) Aptroot, M. P. Nelsen & Lücking comb. nov.,D. immersum(Aptroot, A. A. Menezes & M. Cáceres) Aptroot, M. P. Nelsen & Lücking comb. nov.,D. isohypocrellinum(Xavier-Leite, M. Cáceres & Aptroot) Aptroot, M. P. Nelsen & Lücking comb. nov.,D. paraproponens(Aptroot, M. Cáceres & E. L. Lima) Aptroot, M. P. Nelsen & Lücking comb. nov.,Distothelia rubrostoma(Aptroot) Aptroot & Lücking comb. nov.,Phyllobathelium chlorogastricum(Müll. Arg.) Aptroot & Lücking comb. nov.,Pseudopyrenula cubana(Müll. Arg.) Aptroot & Lücking comb. nov.,Viridothelium cinereoglaucescens(Vain.) Lücking, M. P. Nelsen & Aptroot comb. nov.,V. indutum(Stirt.) Aptroot & Lücking comb. nov., andV. megaspermum(Makhija & Patw.) Aptroot & Lücking comb. nov. In addition, six replacement names are proposed:Astrothelium campylocartilagineumAptroot & Lücking nom. nov.,A. grossoidesAptroot & Lücking nom. nov.,A. octosporoidesAptroot & Lücking nom. nov.,A. scoriotheliumAptroot & Lücking nom. nov.,A. pyrenastrosulphureumAptroot & Lücking nom. nov., andBathelium pruinolucensAptroot & Lücking nom. et stat. nov. Along with this, 57 lectotypes are newly designated. Most species (392 out of 418) are illustrated, with a total of 697 images in 59 plates, including 406 type specimens. Where appropriate, taxa are briefly discussed. New country or continental records are listed for many species in their revised circumscription. A checklist of taxa described or placed in genera belonging inTrypetheliaceaebut previously excluded from the family, and their current names, is also provided.

Penelitian ini bertujuan untuk mengetahui pengaruh modal psikologis, komitmen organisasi, dan iklim psikologis terhadap kesiapan dalam menghadapi perubahan. Sampel berjumlah 162 orang yang diambil dengan teknik accidental sampling. Penulis memodifikasi Measuring Readiness for Change yang dibuat oleh Holt, Armenakis, Field, dan Haris (2007), modal psikologis questionare (PCQ) yang dibuat oleh Luthans, Youssef, dan Avolio (2007), measuring komitmen organisasi yang dibuat oleh Allen dan Mayer (1990), dan iklim psikologis scale yang dibuat oleh Brown dan Leigh (1996). Uji validitas alat ukur menggunakan teknik confirmatory factor analysis (CFA). Uji hipotesis penelitian menggunakan teknik analisis regresi berganda. Hasil penelitian menunjukkan bahwa ada pengaruh yang signifikan modal psikologis, komitmen organisasi, dan iklim psikologis terhadap kesiapan dalam menghadapi perubahan. Penulis berharap implikasi dari penelitian ini dapat dikaji kembali dan dikembangkan pada penelitian selanjutnya.

Este trabalho teve como objetivo formular três diferentes tipos de biscoito tipo “cookies” e compará-los em relação ao custo e qualidade. Os ingredientes foram: farinha de trigo, amêndoa de castanha-do-brasil, manteiga, açúcar, ovos, aveia em flocos, leite em pó integral, sal, fermento químico e bicarbonato de sódio, em proporções definidas para cada tipo de cookies. Estes, após homogeneização foram modelados no formato redondo e assados em forno elétrico industrial a 200 ºC por 15 minutos. Depois de resfriados, os cookies foram decorados com chocolate granulado de diversas cores, pesados e embalados. Trinta amostras de cada tipo foram avaliadas em relação ao peso (antes e depois do assamento), volume específico, espessura, diâmetro, índice de expansão, coeficiente de embebição, pH e características físicas (cor externa, simetria, textura e cor interna). Os resultados mostraram que os cookies processados com castanha-do-brasil e adição de açúcar mascavo foram superiores aos demais, tanto em relação ao custo como ao rendimento. Todos os parâmetros físicos dos cookies tipo 1, 2 e 3 avaliados somaram 37,0, 35,0 e 33,5 pontos, respectivamente, considerando 40 pontos como a pontuação máxima. Sugere-se seu processamento em escala comercial e difusão de suas propriedades nutritivas, especialmente o elevado teor protéico. BRAZILIAN CHESTNUT COOKIES PROCESSING Abstract This work had as objective to formulate three different types of cookies and to compare them in relation to cost and quality. The ingredients were: wheat flour, almond of Brazilian chestnut, butter, sugar, eggs, oat meal, whole milk powder, baking powder and sodium bicarbonate, in defined proportions for each type of cookie. This, after homogenization were modeled in round shape and baked in industrial electric oven at 200 °C for 15 minutes. After cooling, the cookies were decorated with diverse colors of granulated chocolate, weighted and packed. Thirty samples of each type were evaluated in relation to weight (before an after baking), specific volume, thickness, diameter, expansion index, embedding coefficient, pH and physical characteristics (external color, symmetry, texture and internal color). The results showed that the processed cookies with Brazilian chestnut and addition of brown sugar were superior to others as in relation to cost and yield. All physical parameters of the cookies type 1, 2 and 3 evaluated added 37,0, 35,0 and 33,5 points, respectively, considering 40 points as maximal grade. The commercial scale processing suggested and diffusion of its nutritive properties, mainly the high protein level.

Objetivo: caracterizar clínica e epidemiologicamente os pacientes atendidos por um programa público de atenção domiciliar na cidade de Montes Claros, Minas Gerais, Brasil. Métodos: Estudo transversal e exploratório, realizado entre junho de 2017 e janeiro de 2018, com 131 pacientes cadastrados e atendidos pelo Serviço de Atenção Domiciliar - Melhor em Casa. Para o levantamento dos dados utilizou-se um instrumento contendo variáveis sociodemográficas, clínicas e funcionais. Os dados foram analisados por estatística descritiva. Resultados: A maioria dos pacientes eram idosos (67,9%), do sexo feminino (55%), pardos (47,3%), casados (31,3%) e/ou solteiros (31,3%), restritos ao leito (71%) e alimentavam-se via oral (68,7%). As doenças vasculares (42%) foram as mais prevalentes, 45,8% dos pacientes apresentavam lesão por pressão e o atendimento domiciliar foi realizado principalmente pelo enfermeiro (83,2%) e médico (82,4%). Conclusão: A identificação do perfil clínico e epidemiológico é fundamental para planejar e implementar cuidados adequados às necessidades específicas dos pacientes.Descritores: Pacientes Domiciliares; Serviços de Assistência Domiciliar; Perfil de Saúde; Idoso.CLINICAL AND EPIDEMIOLOGICAL CHARACTERIZATION OF PATIENTS TREATED BY A PUBLIC HOME CARE PROGRAMObjective: to characterize clinically and epidemiologically the patients attended by a public home care program in the city of Montes Claros, Minas Gerais, Brazil. Methodology: A cross - sectional and exploratory study was carried out between June 2017 and January 2018, with 131 patients enrolled and attended by the Home Care Service - Better at Home. Data were collected using an instrument containing sociodemographic, clinical and functional variables and were analyzed by descriptive statistics. Results: The majority of the patients were elderly (67.9%), female (55%), brown (47.3%), married (31.3%) and / or unmarried to bed (71%) and were fed orally (68.7%). Vascular diseases (42%) were the most prevalent, 45.8% of the patients had pressure lesions, and home care was performed mainly by the nurse (83.2%) and the physician (82.4%). Conclusion: The characterization of the profile, besides describing problems, contributes to patient care, impacting on the planning and implementation of appropriate interventions.Descriptors: Homebound Persons; Home Care Services; Health Profile; Aged.CARACTERIZACIÓN CLÍNICA Y EPIDEMIOLÓGICA DE PACIENTES ATENDIDOS POR UN PROGRAMA PÚBLICO DE ATENCIÓN DOMICILIARIAObjetivo: caracterizar clínica y epidemiológicamente a los pacientes atendidos por un programa público de atención domiciliaria en la ciudad de Montes Claros, Minas Gerais, Brasil. Metodología: Estudio transversal y exploratorio, realizado entre junio de 2017 y enero de 2018, con 131 pacientes catastrados y atendidos por el Servicio de Atención Domiciliar - Mejor en Casa. Para el levantamiento de los datos se utilizó un instrumento que contenía variables sociodemográficas, clínicas y funcionales, analizados por estadística descriptiva. Resultados: La mayoría de los pacientes eran ancianos (67,9%), del sexo femenino (55%), pardos (47,3%), casados (31,3%) y / o solteros (31,3%), restringidos al lecho (71%) y se alimentaban vía oral (68,7%). Las enfermedades vasculares (42%) fueron las más prevalentes, el 45,8% de los pacientes presentaban lesión por presión y la atención domiciliaria fue realizada principalmente por el enfermero (83,2%) y médico (82,4%). Conclusión: La caracterización del perfil, además de describir problemas, contribuye al cuidado del paciente, impactando en la planificación e implementación de intervenciones adecuadas.Descriptores: Personas Imposibilitadas; Servicios de Atención de Salud a Domicilio; Anciano.

My three-year term as editor of Journal of Marketing concludes with the October 2005 issue. On the basis of my interactions with various people in the marketing community, I believe that marketing science and practice are in transition, bringing change to the content and boundaries of the discipline. Thus, I invited some distinguished scholars to contribute short essays on the current challenges, opportunities, and imperatives for improving marketing thought and practice. Each author chose his or her topic and themes. However, in a collegial process, the authors read and commented on one another's essays, after which each author had an opportunity to revise his or her essay. The result is a thoughtful and constructive set of essays that are related to one another in interesting ways and that should be read together. I have grouped the essays as follows: •What is the domain of marketing? This question is addressed in four essays by Stephen W. Brown, Frederick E. Webster Jr., Jan-Benedict E.M. Steenkamp, and William L. Wilkie. •How has the marketing landscape (i.e., content) changed? This question is addressed in two essays, one coauthored by Jagdish N. Sheth and Rajendra S. Sisodia and the other by Roger A. Kerin. •How should marketing academics engage in research, teaching, and professional activities? This question is addressed in five essays by Debbie MacInnis; Leigh McAlister; Jagmohan S. Raju; Ronald J. Bauerly, Don T. Johnson, and Mandeep Singh; and Richard Staelin. Another interesting way to think about the essays, as Jan-Benedict E.M. Steenkamp suggests, is to group the essays according to whether they address issues of content, publishing, or impact (see Table 1 ). These 11 essays strike a common theme: They urge marketers—both scientists and practitioners—to expand their horizontal vision. What do I mean by horizontal vision? In The Great Influenza, Barry (2004) describes the enormous strides that were made in medical science early in the twentieth century. His depiction of William Welch, an extremely influential scientist who did not (as a laboratory researcher) generate important findings, includes a characterization of the “genius” that produces major scientific achievements. The research he did was first-rate. But it was only first-rate—thorough, rounded, and even irrefutable, but not deep enough or provocative enough or profound enough to set himself or others down new paths, to show the world in a new way, to make sense out of great mysteries…. To do this requires a certain kind of genius, one that probes vertically and sees horizontally. Horizontal vision allows someone to assimilate and weave together seemingly unconnected bits of information. It allows an investigator to see what others do not see and to make leaps of connectivity and creativity. Probing vertically, going deeper and deeper into something, creates new information. (p. 60) At my request, each author has provided thoughtful and concrete suggestions for how marketing academics and practitioners, both individually and collectively (through our institutions), can work to improve our field. Many of their suggestions urge people and institutions to expand their horizontal vision and make connections, thereby fulfilling their potential to advance the science and practice of marketing. In his essay, Richard Staelin writes (p. 22), “I believe that it is possible to influence directly the generation and adoption of new ideas.” I agree. I ask the reader to think about the ideas in these essays and to act on them. Through our actions, we shape our future. —Ruth N. Bolton

The variable incivility is an indicator used to describe violations of communication norms. These norms can be social norms established within a society, a culture or parts of a society (e.g. a social class, milieu or group) or democratic norms established within a democratic society. In this sense incivility is associated with behaviors that threaten a collective face or a democratic society, deny people their personal freedoms, and stereotype individuals or social groups. Furthermore, some scholars include impoliteness into the concept of incivility and argue that the two concepts have no clear boundaries (e.g. Seely, 2017). They therefore describe incivility as aggressive, offensive or derogatory communication expressed directly or indirectly to other individuals or parties. In many studies a message is classified as uncivil if the message contains at least one instance of incivility (e.g. one violent threat). The direction of an uncivil statement is coded as ‘interpersonal’/‘personal’ or ‘other-oriented’/‘impersonal’ or sometimes also as ‘neutral’, meaning it is not directed at any group or individual. Field of application/theoretical foundation: One unifying element to communication that is labelled as incivility is that it has to be a violation of an existing norm. Which norms are seen as violated depends on the theoretical tradition. Incivility research is related to theories on social norms of communication and conversation: conversational-maxims (Grice, 1975), face-saving concepts (Brown & Levinson, 1987; Goffman, 1989) or conversational-contract theories (Fraser, 1990). Further, incivility research has ties to theories that view public communication as part of democratic opinion formation and decision-making processes, e.g. theories on deliberative democracy and deliberation (Dryzek, 2000; Gutmann & Thompson, 1996; Habermas, 1994). References/combination with other methods of data collection: Incivility is examined through content analysis and sometimes combined with comparative designs (e.g., Rowe, 2015) or experimental designs (Muddiman, 2017; Oz, Zheng, & Chen, 2017). In addition, content analyses can be accompanied by interviews or surveys, for example to validate the results of the content analysis (Erjavec & Kova?i?, 2012). Example studies: Research question/research interest: Previous studies have been interested in the extent, levels and direction of incivility in online communication (e.g. in one specific online discussion, in discussions on a specific topic, in discussions on a specific platform or on different platforms comparatively). Object of analysis: Previous studies have investigated incivility in user comments on political newsgroups, news websites, social media platforms (e.g. Twitter, Facebook), political blogs, science blogs or online consultation platforms. Timeframe of analysis: Many studies investigate incivility in user comments focusing on periods between 2 months and 1 year. It is common to use constructed weeks. Level of analysis: Most manual content analyses measure incivility on the level of a message, for example on the level of user comments. On a higher level of analysis, the level of incivility for a whole discussion thread or online platform can be measured or estimated. On a lower level of analysis incivility can be measured on the level of utterances, sentences or words which are the preferred levels of analysis in automated content analyses. Table 1. Previous manual content analysis studies and measures of incivility Example study Construct Dimensions/Variables Explanation/example Reliability Papacharissi (2004) incivility (separate from impoliteness) threat to democracy e.g. propose to overthrow a democratic government by force Ir = .89 stereotype e.g. association of a person with a group by using labels, whether those are mild – “liberal”, or more offensive – “faggot”)? Ir = .91 threat to other individuals’ rights e.g. personal freedom, freedom to speak Ir = .86 incivility Ir = .89 Coe, Kenski, and Rains (2014) incivility (impoliteness is included) name-calling mean-spirited or disparaging words directed at a person or group of people K-? = .67 aspersion mean-spirited or disparaging words directed at an idea, plan, policy, or behavior K-? = .61 reference to lying stating or implying that an idea, plan, or policy was disingenuous K-? = .73 vulgarity using profanity or language that would not be considered proper (e.g., “pissed”, “screw”) in professional discourse K-? = .91 pejorative for speech disparaging remark about the way in which a person communicates K-? = .74 incivility / impoliteness K-? = .73 Rowe (2015) incivility (separate from impoliteness) threat to democracy proposes to overthrow the government (e.g. proposes a revolution) or advocates an armed struggle in opposition to the government (e.g. threatens the use of violence against the government) ? = .66 threat to individual rights advocates restricting the rights or freedoms of certain members of society or certain individuals ? = .86 stereotype asserts a widely held but fixed and oversimplified image or idea of a particular type of person ? = .80 incivility ? = .77 Seely (2017) incivility(impoliteness is included) insulting language name calling and other derogatory remarks often seen in pejorative speech and aspersions K-? = .84 vulgarity e.g. “lazy f**kers”, “a**holes” K-? = 1 stereotyping of political party/ideology e.g. “typical lying lefties” K-? = .88 stereotyping using “isms”/discriminatory language e.g. “if we don’t get rid of idiotic Muslim theologies, we will have growing problems” K-? = 1 other stereotyping language e.g. “GENERALS LIKE TO HAVE A MALE SOLDIER ON THEIR LAP AT ALL TIMES.” K-? = .78 sarcasm e.g. “betrayed again by the Repub leadership . . . what a shock” K-? = .79 accusations of lying e.g. “typical lying lefties” K-? = .80 shouting excessive capitalization and/or exclamation points K-? = .83 incivility / impoliteness K-? = .81 Note: Previous studies used different inter-coder reliability statistics; Ir = reliability index by Perreault and Leigh (1989); K-? = Krippendorff’s-?; ? = Cohen’s Kappa Codebook used in the study Rowe (2015) is available under: https://www.tandfonline.com/doi/full/10.1080/1369118X.2014.940365 References Brown, P., & Levinson, S. C. (1987). Politeness: Some universals in language usage. Cambridge: Cambridge University Press. Coe, K., Kenski, K., & Rains, S. A. (2014). Online and Uncivil? Patterns and Determinants of Incivility in Newspaper Website Comments. Journal of Communication, 64(4), 658–679. https://doi.org/10.1111/jcom.12104 Dryzek, J. S. (2000). Deliberative democracy and beyond: Liberals, Critics, Contestations. Oxford political theory. Oxford, New York: Oxford University Press. Erjavec, K., & Kova?i?, M. P. (2012). “You Don't Understand, This is a New War! ” Analysis of Hate Speech in News Web Sites' Comments. Mass Communication and Society, 15(6), 899–920. https://doi.org/10.1080/15205436.2011.619679 Fraser, B. (1990). Perspectives on politeness. Journal of Pragmatics, 14(2), 219–236. https://doi.org/10.1016/0378-2166(90)90081-n Goffman, E. (1989). Interaction ritual: Essays on face-to-face behavior. New York: Pantheon Books. Grice, P. H. (1975). Logic and conversation. In P. Cole (Ed.), Syntax and Semantics: Speech acts (pp. 41–58). New York: Academic Press. Gutmann, A., & Thompson, D. F. (1996). Democracy and disagreement. Cambridge, Massachusetts: Belknap Press of Harvard University Press. Habermas, J. (1994). Three Normative Models of Democracy. Constellations, 1(1), 1–10. Muddiman, A. (2017). : Personal and public levels of political incivility. International Journal of Communication, 11, 3182–3202. Oz, M., Zheng, P., & Chen, G. M. (2017). Twitter versus Facebook: Comparing incivility, impoliteness, and deliberative attributes. New Media & Society, 20(9), 3400–3419. https://doi.org/10.1177/1461444817749516 Papacharissi, Z. (2004). Democracy online: Civility, politeness, and the democratic potential of online political discussion groups. New Media & Society, 6(2), 259–283. https://doi.org/10.1177/1461444804041444 Rowe, I. (2015). Civility 2.0: A comparative analysis of incivility in online political discussion. Information, Communication & Society, 18(2), 121–138. https://doi.org/10.1080/1369118X.2014.940365 Seely, N. (2017). Virtual Vitriol: A Comparative Analysis of Incivility Within Political News Discussion Forums. Electronic News, 12(1), 42–61. https://doi.org/10.1177/1931243117739060

The variable impoliteness is an indicator used to describe violations of communication norms. These norms can be social norms established within a society, a culture or parts of a society (e.g. a social class, milieu or group). In this sense impoliteness is associated with, among other things, aggressive, offensive or derogatory communication expressed directly or indirectly to other individuals or parties. More specifically name calling, vulgar expressions or aspersions are classified as examples of impolite statements (e.g. Papacharissi, 2004; Seely, 2017). While some scholars distinguish between impoliteness and incivility and argue that impoliteness is more spontaneous, unintentional and more frequently regretted than incivility (e.g. Papacharissi, 2004; Rowe, 2015), other scholars include impoliteness into the concept of incivility and argue that the two concepts have no clear boundaries (Coe, Kenski, & Rains, 2014; e.g. Seely, 2017). In many studies a message is classified as impolite if the message contains at least one instance of impoliteness (e.g. a swear word). The direction of an impolite statement is coded as ‘interpersonal’/‘personal’ or ‘other-oriented’/‘impersonal’ or sometimes also as ‘neutral’, meaning it is not directed at any group or individual. Field of application/theoretical foundation: Impoliteness is a broader concept of violations of norms in communication that, in digital communication research, is often referred to in studies on incivility. Politeness can be related to theories on social norms of communication and conversation, for example conversational-maxims (Grice, 1975), face-saving concepts (Brown & Levinson, 1987; Goffman, 1989) or conversational-contract theories (Fraser, 1990). References/combination with other methods of data collection: Impoliteness is examined through content analysis and is sometimes combined with comparative designs (e.g., Rowe, 2015) or experimental designs (Muddiman, 2017; Oz, Zheng, & Chen, 2017). In addition, content analyses can be accompanied by interviews or surveys, for example to validate the results of the content analysis (Erjavec & Kova?i?, 2012). Example studies: Research question/research interest: Previous studies have been interested in the extent, levels and direction of impoliteness in online communication (e.g. in one specific online discussion, in discussions on a specific topic, in discussions on a specific platform or on different platforms comparatively). Object of analysis: Previous studies have investigated impoliteness in user comments on political newsgroups, news websites, social media platforms (e.g. Twitter, Facebook), political blogs, science blogs or online consultation platforms. Timeframe of analysis: Content analysis studies investigate impoliteness in user comments focusing on periods between 2 months and 1 year (Coe et al., 2014; Rowe, 2015; Seely, 2017). It is common to use constructed weeks. Level of analysis: Most manual content analysis studies measure impoliteness on the level of a message, for example on the level of user comments. On a higher level of analysis, the level of impoliteness for a whole discussion thread or online platform could be measured or estimated. On a lower level of analysis impoliteness can be measured on the level of utterances, sentences or words which are the preferred levels of analysis in automated content analyses. Table 1. Previous manual content analysis studies and measures of impoliteness Example study Construct Dimensions/Variables Explanation/example Reliability Papacharissi (2004) impoliteness (separate from incivility) name-calling e.g. “weirdo”, “traitor”, “crackpot” Ir = .91 aspersion e.g. “reckless”, “irrational”, “un-American” Ir = .91 synonyms for liar e.g. “hoax”, “farce” N/A hyperboles e.g. “outrageous”, “heinous” N/A non-cooperation - N/A pejorative speak - N/A vulgarity e.g. ”shit”, “damn”, “hell” Ir = .89 sarcasm - N/A all-capital letters used online to reflect shouting N/A impoliteness Ir = .90 Coe et al. (2014) impoliteness (included in incivility) name-calling mean-spirited or disparaging words directed at a person or group of people K-? = .67 aspersion mean-spirited or disparaging words directed at an idea, plan, policy, or behavior K-? = .61 reference to lying stating or implying that an idea, plan, or policy was disingenuous K-? = .73 vulgarity using profanity or language that would not be considered proper (e.g., “pissed”, “screw”) in professional discourse K-? = .91 pejorative for speech disparaging remark about the way in which a person communicates K-? = .74 impoliteness/incivility K-? = .73 Rowe (2015) impoliteness (separate from incivility) name-calling e.g., “gun-nut”, “idiot”, “fool” ? = .82 aspersion comments containing an attack on the reputation or integrity of someone or something ? = .72 lying comments implying disingenuousness N/A vulgarity e.g., “crap”, “shit”, any swear-words/cursing, sexual innuendo ? = 1 pejorative comments containing language which disparage the manner in which someone communicates (e.g., blather, crying, moaning) ? = 1 hyperbole a massive overstatement (e.g., makes pulling teeth with pliers look easy) ? = .75 non-cooperation a situation in a discussion in terms of a stalemate ? = .66 sarcasm - ? = .71 other impoliteness any other type of impoliteness ? = .72 impoliteness ? = .78 Seely (2017) impoliteness (included in incivility) insulting language name calling and other derogatory remarks often seen in pejorative speech and aspersions K-? = .84 vulgarity e.g. “lazy f**kers”, “a**holes” K-? = 1 stereotyping of political party/ideology e.g. “typical lying lefties” K-? = .88 stereotyping using “isms”/discriminatory language e.g. “if we don’t get rid of idiotic Muslim theologies, we will have growing problems” K-? = 1 other stereotyping language e.g. “GENERALS LIKE TO HAVE A MALE SOLDIER ON THEIR LAP AT ALL TIMES.” K-? = .78 sarcasm e.g. “betrayed again by the Repub leadership . . . what a shock” K-? = .79 accusations of lying e.g. “typical lying lefties” K-? = .80 shouting excessive capitalization and/or exclamation points K-? = .83 impoliteness/incivility K-? = .81 Note: Previous studies used different inter-coder reliability statistics: Ir = reliability index by Perreault and Leigh (1989); K-? = Krippendorff’s-?; ? = Cohen’s Kappa Codebook used in the study Rowe (2015) is available under: https://www.tandfonline.com/doi/full/10.1080/1369118X.2014.940365 References Brown, P., & Levinson, S. C. (1987). Politeness: Some universals in language usage. Cambridge: Cambridge University Press. Coe, K., Kenski, K., & Rains, S. A. (2014). Online and Uncivil? Patterns and Determinants of Incivility in Newspaper Website Comments. Journal of Communication, 64(4), 658–679. https://doi.org/10.1111/jcom.12104 Erjavec, K., & Kova?i?, M. P. (2012). “You Don't Understand, This is a New War! ” Analysis of Hate Speech in News Web Sites' Comments. Mass Communication and Society, 15(6), 899–920. https://doi.org/10.1080/15205436.2011.619679 Fraser, B. (1990). Perspectives on politeness. Journal of Pragmatics, 14(2), 219–236. https://doi.org/10.1016/0378-2166(90)90081-n Goffman, E. (1989). Interaction ritual: Essays on face-to-face behavior. New York: Pantheon Books. Grice, P. H. (1975). Logic and conversation. In P. Cole (Ed.), Syntax and Semantics: Speech acts (pp. 41–58). New York: Academic Press. Muddiman, A. (2017). : Personal and public levels of political incivility. International Journal of Communication, 11, 3182–3202. Oz, M., Zheng, P., & Chen, G. M. (2017). Twitter versus Facebook: Comparing incivility, impoliteness, and deliberative attributes. New Media & Society, 20(9), 3400–3419. https://doi.org/10.1177/1461444817749516 Papacharissi, Z. (2004). Democracy online: Civility, politeness, and the democratic potential of online political discussion groups. New Media & Society, 6(2), 259–283. https://doi.org/10.1177/1461444804041444 Rowe, I. (2015). Civility 2.0: A comparative analysis of incivility in online political discussion. Information, Communication & Society, 18(2), 121–138. https://doi.org/10.1080/1369118X.2014.940365 Seely, N. (2017). Virtual Vitriol: A Comparative Analysis of Incivility Within Political News Discussion Forums. Electronic News, 12(1), 42–61. https://doi.org/10.1177/1931243117739060

IntroductionDespite claims that the importance of distance has been reduced due to technological and communications improvements (Cairncross; Friedman; O’Brien), the ‘power of place’ still resonates, often intensifying the role of geography (Christopherson et al.; Morgan; Pratt; Scott and Storper). Within the film industry, there has been a decentralisation of production from Hollywood, but there remains a spatial logic which has preferenced particular centres, such as Toronto, Vancouver, Sydney and Prague often led by a combination of incentives (Christopherson and Storper; Goldsmith and O’Regan; Goldsmith et al.; Miller et al.; Mould). The emergence of high end television, television programming for which the production budget is more than £1 million per television hour, has presented new opportunities for screen hubs sharing a very similar value chain to the film industry (OlsbergSPI with Nordicity).In recent years, interventions have proliferated with the aim of capitalising on the decentralisation of certain activities in order to attract international screen industries production and embed it within local hubs. Tools for building capacity and expertise have proliferated, including support for studio complex facilities, infrastructural investments, tax breaks and other economic incentives (Cucco; Goldsmith and O’Regan; Jensen; Goldsmith et al.; McDonald; Miller et al.; Mould). Yet experience tells us that these will not succeed everywhere. There is a need for a better understanding of both the capacity for places to build a distinctive and competitive advantage within a highly globalised landscape and the relative merits of alternative interventions designed to generate a sustainable production base.This article first sets out the rationale for the appetite identified in the screen industries for co-location, or clustering and concentration in a tightly drawn physical area, in global hubs of production. It goes on to explore the latest trends of decentralisation and examines the upturn in interventions aimed at attracting mobile screen industries capital and labour. Finally it introduces the Scottish screen industries and explores some of the ways in which Scotland has sought to position itself as a recipient of screen industries activity. The paper identifies some key gaps in infrastructure, most notably a studio, and calls for closer examination of the essential ingredients of, and possible interventions needed for, a vibrant and sustainable industry.A Compulsion for ProximityIt has been argued that particular spatial and place-based factors are central to the development and organisation of the screen industries. The film and television sector, the particular focus of this article, exhibit an extraordinarily high degree of spatial agglomeration, especially favouring centres with global status. It is worth noting that the computer games sector, not explored in this article, slightly diverges from this trend displaying more spatial patterns of decentralisation (Vallance), although key physical hubs of activity have been identified (Champion). Creative products often possess a cachet that is directly associated with their point of origin, for example fashion from Paris, films from Hollywood and country music from Nashville – although it can also be acknowledged that these are often strategic commercial constructions (Pecknold). The place of production represents a unique component of the final product as well as an authentication of substantive and symbolic quality (Scott, “Creative cities”). Place can act as part of a brand or image for creative industries, often reinforcing the advantage of being based in particular centres of production.Very localised historical, cultural, social and physical factors may also influence the success of creative production in particular places. Place-based factors relating to the built environment, including cheap space, public-sector support framework, connectivity, local identity, institutional environment and availability of amenities, are seen as possible influences in the locational choices of creative industry firms (see, for example, Drake; Helbrecht; Hutton; Leadbeater and Oakley; Markusen).Employment trends are notoriously difficult to measure in the screen industries (Christopherson, “Hollywood in decline?”), but the sector does contain large numbers of very small firms and freelancers. This allows them to be flexible but poses certain problems that can be somewhat offset by co-location. The findings of Antcliff et al.’s study of workers in the audiovisual industry in the UK suggested that individuals sought to reconstruct stable employment relations through their involvement in and use of networks. The trust and reciprocity engendered by stable networks, built up over time, were used to offset the risk associated with the erosion of stable employment. These findings are echoed by a study of TV content production in two media regions in Germany by Sydow and Staber who found that, although firms come together to work on particular projects, typically their business relations extend for a much longer period than this. Commonly, firms and individuals who have worked together previously will reassemble for further project work aided by their past experiences and expectations.Co-location allows the development of shared structures: language, technical attitudes, interpretative schemes and ‘communities of practice’ (Bathelt, et al.). Grabher describes this process as ‘hanging out’. Deep local pools of creative and skilled labour are advantageous both to firms and employees (Reimer et al.) by allowing flexibility, developing networks and offsetting risk (Banks et al.; Scott, “Global City Regions”). For example in Cook and Pandit’s study comparing the broadcasting industry in three city-regions, London was found to be hugely advantaged by its unrivalled talent pool, high financial rewards and prestigious projects. As Barnes and Hutton assert in relation to the wider creative industries, “if place matters, it matters most to them” (1251). This is certainly true for the screen industries and their spatial logic points towards a compulsion for proximity in large global hubs.Decentralisation and ‘Sticky’ PlacesDespite the attraction of global production hubs, there has been a decentralisation of screen industries from key centres, starting with the film industry and the vertical disintegration of Hollywood studios (Christopherson and Storper). There are instances of ‘runaway production’ from the 1920s onwards with around 40 per cent of all features being accounted for by offshore production in 1960 (Miller et al., 133). This trend has been increasing significantly in the last 20 years, leading to the genesis of new hubs of screen activity such as Toronto, Vancouver, Sydney and Prague (Christopherson, “Project work in context”; Goldsmith et al.; Mould; Miller et al.; Szczepanik). This development has been prompted by a multiplicity of reasons including favourable currency value differentials and economic incentives. Subsidies and tax breaks have been offered to secure international productions with most countries demanding that, in order to qualify for tax relief, productions have to spend a certain amount of their budget within the local economy, employ local crew and use domestic creative talent (Hill). Extensive infrastructure has been developed including studio complexes to attempt to lure productions with the advantage of a full service offering (Goldsmith and O’Regan).Internationally, Canada has been the greatest beneficiary of ‘runaway production’ with a state-led enactment of generous film incentives since the late 1990s (McDonald). Vancouver and Toronto are the busiest locations for North American Screen production after Los Angeles and New York, due to exchange rates and tax rebates on labour costs (Miller et al., 141). 80% of Vancouver’s production is attributable to runaway production (Jensen, 27) and the city is considered by some to have crossed a threshold as:It now possesses sufficient depth and breadth of talent to undertake the full array of pre-production, production and post-production services for the delivery of major motion pictures and TV programmes. (Barnes and Coe, 19)Similarly, Toronto is considered to have established a “comprehensive set of horizontal and vertical media capabilities” to ensure its status as a “full function media centre” (Davis, 98). These cities have successfully engaged in entrepreneurial activity to attract production (Christopherson, “Project Work in Context”) and in Vancouver the proactive role of provincial government and labour unions are, in part, credited with its success (Barnes and Coe). Studio-complex infrastructure has also been used to lure global productions, with Toronto, Melbourne and Sydney all being seen as key examples of where such developments have been used as a strategic priority to take local production capacity to the next level (Goldsmith and O’Regan).Studies which provide a historiography of the development of screen-industry hubs emphasise a complex interplay of social, cultural and physical conditions. In the complex and global flows of the screen industries, ‘sticky’ hubs have emerged with the ability to attract and retain capital and skilled labour. Despite being principally organised to attract international production, most studio complexes, especially those outside of global centres need to have a strong relationship to local or national film and television production to ensure the sustainability and depth of the labour pool (Goldsmith and O’Regan, 2003). Many have a broadcaster on site as well as a range of companies with a media orientation and training facilities (Goldsmith and O’Regan, 2003; Picard, 2008). The emergence of film studio complexes in the Australian Gold Coast and Vancouver was accompanied by an increasing role for television production and this multi-purpose nature was important for the continuity of production.Fostering a strong community of below the line workers, such as set designers, locations managers, make-up artists and props manufacturers, can also be a clear advantage in attracting international productions. For example at Cinecitta in Italy, the expertise of set designers and experienced crews in the Barrandov Studios of Prague are regarded as major selling points of the studio complexes there (Goldsmith and O’Regan; Miller et al.; Szczepanik). Natural and built environments are also considered very important for film and television firms and it is a useful advantage for capturing international production when cities can double for other locations as in the cases of Toronto, Vancouver, Prague for example (Evans; Goldsmith and O’Regan; Szczepanik). Toronto, for instance, has doubled for New York in over 100 films and with regard to television Due South’s (1994-1998) use of Toronto as Chicago was estimated to have saved 40 per cent in costs (Miller et al., 141).The Scottish Screen Industries Within mobile flows of capital and labour, Scotland has sought to position itself as a recipient of screen industries activity through multiple interventions, including investment in institutional frameworks, direct and indirect economic subsidies and the development of physical infrastructure. Traditionally creative industry activity in the UK has been concentrated in London and the South East which together account for 43% of the creative economy workforce (Bakhshi et al.). In order, in part to redress this imbalance and more generally to encourage the attraction and retention of international production a range of policies have been introduced focused on the screen industries. A revised Film Tax Relief was introduced in 2007 to encourage inward investment and prevent offshoring of indigenous production, and this has since been extended to high-end television, animation and children’s programming. Broadcasting has also experienced a push for decentralisation led by public funding with a responsibility to be regionally representative. The BBC (“BBC Annual Report and Accounts 2014/15”) is currently exceeding its target of 50% network spend outside London by 2016, with 17% spent in Scotland, Wales and Northern Ireland. Channel 4 has similarly committed to commission at least 9% of its original spend from the nations by 2020. Studios have been also developed across the UK including at Roath Lock (Cardiff), Titanic Studios (Belfast), MedicaCity (Salford) and The Sharp Project (Manchester).The creative industries have been identified as one of seven growth sectors for Scotland by the government (Scottish Government). In 2010, the film and video sector employed 3,500 people and contributed £120 million GVA and £120 million adjusted GVA to the economy and the radio and TV sector employed 3,500 people and contributed £50 million GVA and £400 million adjusted GVA (The Scottish Parliament). Beyond the direct economic benefits of sectors, the on-screen representation of Scotland has been claimed to boost visitor numbers to the country (EKOS) and high profile international film productions have been attracted including Skyfall (2012) and WWZ (2013).Scotland has historically attracted international film and TV productions due to its natural locations (VisitScotland) and on average, between 2009-2014, six big budget films a year used Scottish locations both urban and rural (BOP Consulting, 2014). In all, a total of £20 million was generated by film-making in Glasgow during 2011 (Balkind) with WWZ (2013) and Cloud Atlas (2013), representing Philadelphia and San Francisco respectively, as well as doubling for Edinburgh for the recent acclaimed Scottish films Filth (2013) and Sunshine on Leith (2013). Sanson (80) asserts that the use of the city as a site for international productions not only brings in direct revenue from production money but also promotes the city as a “fashionable place to live, work and visit. Creativity makes the city both profitable and ‘cool’”.Nonetheless, issues persist and it has been suggested that Scotland lacks a stable and sustainable film industry, with low indigenous production levels and variable success from year to year in attracting inward investment (BOP Consulting). With regard to crew, problems with an insufficient production base have been identified as an issue in maintaining a pipeline of skills (BOP Consulting). Developing ‘talent’ is a central aspect of the Scottish Government’s Strategy for the Creative Industries, yet there remains the core challenge of retaining skills and encouraging new talent into the industry (BOP Consulting).With regard to film, a lack of substantial funding incentives and the absence of a studio have been identified as a key concern for the sector. For example, within the film industry the majority of inward investment filming in Scotland is location work as it lacks the studio facilities that would enable it to sustain a big-budget production in its entirety (BOP Consulting). The absence of such infrastructure has been seen as contributing to a drain of Scottish talent from these industries to other areas and countries where there is a more vibrant sector (BOP Consulting). The loss of Scottish talent to Northern Ireland was attributed to the longevity of the work being provided by Games of Thrones (2011-) now having completed its six series at the Titanic Studios in Belfast (EKOS) although this may have been stemmed somewhat recently with the attraction of US high-end TV series Outlander (2014-) which has been based at Wardpark in Cumbernauld since 2013.Television, both high-end production and local broadcasting, appears crucial to the sustainability of screen production in Scotland. Outlander has been estimated to contribute to Scotland’s production spend figures reaching a historic high of £45.8 million in 2014 (Creative Scotland ”Creative Scotland Screen Strategy Update”). The arrival of the program has almost doubled production spend in Scotland, offering the chance for increased stability for screen industries workers. Qualifying for UK High-End Television Tax Relief, Outlander has engaged a crew of approximately 300 across props, filming and set build, and cast over 2,000 supporting artist roles from within Scotland and the UK.Long running drama, in particular, offers key opportunities for both those cutting their teeth in the screen industries and also by providing more consistent and longer-term employment to existing workers. BBC television soap River City (2002-) has been identified as a key example of such an opportunity and the programme has been credited with providing a springboard for developing the skills of local actors, writers and production crew (Hibberd). This kind of pipeline of production is critical given the work patterns of the sector. According to Creative Skillset, of the 4,000 people in Scotland are employed in the film and television industries, 40% of television workers are freelance and 90% of film production work in freelance (EKOS).In an attempt to address skills gaps, the Outlander Trainee Placement Scheme has been devised in collaboration with Creative Scotland and Creative Skillset. During filming of Season One, thirty-eight trainees were supported across a range of production and craft roles, followed by a further twenty-five in Season Two. Encouragingly Outlander, and the books it is based on, is set in Scotland so the authenticity of place has played a strong component in the decision to locate production there. Producer David Brown began his career on Bill Forsyth films Gregory’s Girl (1981), Local Hero (1983) and Comfort and Joy (1984) and has a strong existing relationship to Scotland. He has been very vocal in his support for the trainee program, contending that “training is the future of our industry and we at Outlander see the growth of talent and opportunities as part of our mission here in Scotland” (“Outlander fast tracks next generation of skilled screen talent”).ConclusionsThis article has aimed to explore the relationship between place and the screen industries and, taking Scotland as its focus, has outlined a need to more closely examine the ways in which the sector can be supported. Despite the possible gains in terms of building a sustainable industry, the state-led funding of the global screen industries is contested. The use of tax breaks and incentives has been problematised and critiques range from use of public funding to attract footloose media industries to the increasingly zero sum game of competition between competing places (Morawetz; McDonald). In relation to broadcasting, there have been critiques of a ‘lift and shift’ approach to policy in the UK, with TV production companies moving to the nations and regions temporarily to meet the quota and leaving once a production has finished (House of Commons). Further to this, issues have been raised regarding how far such interventions can seed and develop a rich production ecology that offers opportunities for indigenous talent (Christopherson and Rightor).Nonetheless recent success for the screen industries in Scotland can, at least in part, be attributed to interventions including increased decentralisation of broadcasting and the high-end television tax incentives. This article has identified gaps in infrastructure which continue to stymie growth and have led to production drain to other centres. Important gaps in knowledge can also be acknowledged that warrant further investigation and unpacking including the relationship between film, high-end television and broadcasting, especially in terms of the opportunities they offer for screen industries workers to build a career in Scotland and notable gaps in infrastructure and the impact they have on the loss of production.ReferencesAntcliff, Valerie, Richard Saundry, and Mark Stuart. Freelance Worker Networks in Audio-Visual Industries. University of Central Lancashire, 2004.Bakhshi, Hasan, John Davies, Alan Freeman, and Peter Higgs. "The Geography of the UK’s Creative and High–Tech Economies." 2015.Balkind, Nicola. World Film Locations: Glasgow. Intellect Books, 2013.Banks, Mark, Andy Lovatt, Justin O’Connor, and Carlo Raffo. "Risk and Trust in the Cultural Industries." Geoforum 31.4 (2000): 453-464.Barnes, Trevor, and Neil M. Coe. “Vancouver as Media Cluster: The Cases of Video Games and Film/TV." Media Clusters: Spatial Agglomeration and Content Capabilities (2011): 251-277.Barnes, Trevor, and Thomas Hutton. "Situating the New Economy: Contingencies of Regeneration and Dislocation in Vancouver's Inner City." Urban Studies 46.5-6 (2009): 1247-1269.Bathelt, Harald, Anders Malmberg, and Peter Maskell. "Clusters and Knowledge: Local Buzz, Global Pipelines and the Process of Knowledge Creation." Progress in Human Geography 28.1 (2004): 31-56.BBC Annual Report and Accounts 2014/15 London: BBC (2015)BOP Consulting Review of the Film Sector in Glasgow: Report for Creative Scotland. Edinburgh: BOP Consulting, 2014.Champion, Katherine. "Problematizing a Homogeneous Spatial Logic for the Creative Industries: The Case of the Digital Games Industry." Changing the Rules of the Game. Palgrave Macmillan UK, 2013. 9-27.Cairncross, Francis. The Death of Distance London: Orion Business, 1997.Channel 4. Annual Report. London: Channel 4, 2014.Christopherson, Susan. "Project Work in Context: Regulatory Change and the New Geography of Media." Environment and Planning A 34.11 (2002): 2003-2015.———. "Hollywood in Decline? US Film and Television Producers beyond the Era of Fiscal Crisis." Cambridge Journal of Regions, Economy and Society 6.1 (2013): 141-157.Christopherson, Susan, and Michael Storper. "The City as Studio; the World as Back Lot: The Impact of Vertical Disintegration on the Location of the Motion Picture Industry." Environment and Planning D: Society and Space 4.3 (1986): 305-320.Christopherson, Susan, and Ned Rightor. "The Creative Economy as “Big Business”: Evaluating State Strategies to Lure Filmmakers." Journal of Planning Education and Research 29.3 (2010): 336-352.Christopherson, Susan, Harry Garretsen, and Ron Martin. "The World Is Not Flat: Putting Globalization in Its Place." Cambridge Journal of Regions, Economy and Society 1.3 (2008): 343-349.Cook, Gary A.S., and Naresh R. Pandit. "Service Industry Clustering: A Comparison of Broadcasting in Three City-Regions." The Service Industries Journal 27.4 (2007): 453-469.Creative Scotland Creative Scotland Screen Strategy Update. 2016. <http://www.creativescotland.com/__data/assets/pdf_file/0008/33992/Creative-Scotland-Screen-Strategy-Update-Feb2016.pdf>.———. Outlander Fast Tracks Next Generation of Skilled Screen Talent. 2016. <http://www.creativescotland.com/what-we-do/latest-news/archive/2016/02/outlander-fast-tracks-next-generation-of-skilled-screen-talent>.Cucco, Marco. "Blockbuster Outsourcing: Is There Really No Place like Home?" Film Studies 13.1 (2015): 73-93.Davis, Charles H. "Media Industry Clusters and Public Policy." Media Clusters: Spatial Agglomeration and Content Capabilities (2011): 72-98.Drake, Graham. "‘This Place Gives Me Space’: Place and Creativity in the Creative Industries." Geoforum 34.4 (2003): 511-524.EKOS. “Options for a Film and TV Production Space: Report for Scottish Enterprise.” Glasgow: EKOS, March 2014.Evans, Graeme. "Creative Cities, Creative Spaces and Urban Policy." Urban Studies 46.5-6 (2009): 1003-1040.Freidman, Thomas. "The World Is Flat." New York: Farrar, Straus and Giroux, 2006.Goldsmith, Ben, and Tom O’Regan. “Cinema Cities, Media Cities: The Contemporary International Studio Complex.” Screen Industry, Culture and Policy Research Series. Sydney: Australian Film Commission, Sep. 2003.Goldsmith, Ben, Susan Ward, and Tom O’Regan. "Global and Local Hollywood." InMedia. The French Journal of Media and Media Representations in the English-Speaking World 1 (2012).Grabher, Gernot. "The Project Ecology of Advertising: Tasks, Talents and Teams." Regional Studies 36.3 (2002): 245-262.Helbrecht, Ilse. "The Creative Metropolis Services, Symbols and Spaces." Zeitschrift für Kanada Studien 18 (1998): 79-93.Hibberd, Lynne. "Devolution in Policy and Practice: A Study of River City and BBC Scotland." Westminster Papers in Communication and Culture 4.3 (2007): 107-205.Hill, John. "'This Is for the Batmans as Well as the Vera Drakes': Economics, Culture and UK Government Film Production Policy in the 2000s." Journal of British Cinema and Television 9.3 (2012): 333-356.House of Commons Scottish Affairs Committee. “Creative Industries in Scotland.” Second Report of Session 2015–16. London: House of Commons, 2016.Hutton, Thomas A. "The New Economy of the Inner City." Cities 21.2 (2004): 89-108.Jensen, Rodney J.C. "The Spatial and Economic Contribution of Sydney's Visual Entertainment Industries." Australian Planner 48.1 (2011): 24-36.Leadbeater, Charles, and Kate Oakley. Surfing the Long Wave: Knowledge Entrepreneurship in Britain. London: Demos, 2001.McDonald, Adrian H. "Down the Rabbit Hole: The Madness of State Film Incentives as a 'Solution' to Runaway Production." University of Pennsylvania Journal of Business Law 14.85 (2011): 85-163.Markusen, Ann. "Sticky Places in Slippery Space: A Typology of Industrial Districts." Economic Geography (1996): 293-313.———. "Urban Development and the Politics of a Creative Class: Evidence from a Study of Artists." Environment and Planning A 38.10 (2006): 1921-1940.Miller, Toby, N. Govil, J. McMurria, R. Maxwell, and T. Wang. Global Hollywood 2. London: BFI, 2005.Morawetz, Norbert, et al. "Finance, Policy and Industrial Dynamics—The Rise of Co‐productions in the Film Industry." Industry and Innovation 14.4 (2007): 421-443.Morgan, Kevin. "The Exaggerated Death of Geography: Learning, Proximity and Territorial Innovation Systems." Journal of Economic Geography 4.1 (2004): 3-21.Mould, Oli. "Mission Impossible? Reconsidering the Research into Sydney's Film Industry." Studies in Australasian Cinema 1.1 (2007): 47-60.O’Brien, Richard. "Global Financial Integration: The End of Geography." London: Royal Institute of International Affairs, Pinter Publishers, 2002.OlsbergSPI with Nordicity. “Economic Contribution of the UK’s Film, High-End TV, Video Game, and Animation Programming Sectors.” Report presented to the BFI, Pinewood Shepperton plc, Ukie, the British Film Commission and Pact. London: BFI, Feb. 2015.Pecknold, Diane. "Heart of the Country? The Construction of Nashville as the Capital of Country Music." Sounds and the City. London: Palgrave Macmillan UK, 2014. 19-37.Picard, Robert G. Media Clusters: Local Agglomeration in an Industry Developing Networked Virtual Clusters. Jönköping International Business School, 2008.Pratt, Andy C. "New Media, the New Economy and New Spaces." Geoforum 31.4 (2000): 425-436.Reimer, Suzanne, Steven Pinch, and Peter Sunley. "Design Spaces: Agglomeration and Creativity in British Design Agencies." Geografiska Annaler: Series B, Human Geography 90.2 (2008): 151-172.Sanson, Kevin. Goodbye Brigadoon: Place, Production, and Identity in Global Glasgow. Diss. University of Texas at Austin, 2011.Scott, Allen J. "Creative Cities: Conceptual Issues and Policy Questions." Journal of Urban Affairs 28.1 (2006): 1-17.———. Global City-Regions: Trends, Theory, Policy. Oxford University Press, 2002.Scott, Allen J., and Michael Storper. "Regions, Globalization, Development." Regional Studies 41.S1 (2007): S191-S205.The Scottish Government. The Scottish Government Economic Strategy. Edinburgh: Scottish Government, 2015.———. Growth, Talent, Ambition – the Government’s Strategy for the Creative Industries. Edinburgh: Scottish Government, 2011.The Scottish Parliament Economy, Energy and Tourism Committee. The Economic Impact of the Film, TV and Video Games Industries. Edinburgh: Scottish Parliament, 2015.Sydow, Jörg, and Udo Staber. "The Institutional Embeddedness of Project Networks: The Case of Content Production in German Television." Regional Studies 36.3 (2002): 215-227.Szczepanik, Petr. "Globalization through the Eyes of Runners: Student Interns as Ethnographers on Runaway Productions in Prague." Media Industries 1.1 (2014).Vallance, Paul. "Creative Knowing, Organisational Learning, and Socio-Spatial Expansion in UK Videogame Development Studios." Geoforum 51 (2014): 15-26.Visit Scotland. “Scotland Voted Best Cinematic Destination in the World.” 2015. <https://www.visitscotland.com/blog/films/scotland-voted-best-cinematic-destination-in-the-world/>.

As the old technologies become automatic and invisible, we find ourselves more concerned with fighting or embracing what’s new”—Dennis Baron, From Pencils to Pixels:The Stage of Literacy Technologies Increasingly, cultural study is villainised by defenders of the academic tradition for luring English students away from the high-brow texts of the literary canon, a condition exacerbated by institutions' need for economic survival. In Britain in 1995 there were 1500 fewer English A-Level students than in 1994, whereas cultural studies students increased by approximately the same number (Cartmel et al. 1). Modern students of English are preferring more readily digestible on-screen texts which subvert the role of the author in favour of the role of the genre, a preference that allows readers/viewers to pay more attention to their own tastes, beliefs and identities than those of figures that produced great books, and their contemporaries. Modern cultural studies have a somewhat self-indulgent quality that many academics find distasteful, a kind of narcissistic celebration of the fact that media and mass culture operate as reflections of ourselves today instead of as windows into brilliant minds and historically significant moments. One of the most frustrating forms of this for defenders of traditional English studies is the adaptation of classic literature into commercial film and the ensuing analyses. The task of 'doing justice' to a classic novel in a modern film is fundamentally impossible. Whatever authenticity is strived for in an adaptation, the economic necessities of the modern film (sex appeal, celebrity, luridness) are bound to collide with academic notions of the original text and subsequently cause damage and widen the literature/media divide. A recent remake by Gus Van Sant of one of the most celebrated films ever made, Alfred Hitchcock's Psycho (1960), has added new flavour to this debate. Van Sant's Psycho (1999) operates more as an homage to the classic film and as a piece of 'conceptual art' than as a simple remake (Romney 31). Almost every shot, every word, every piece of music from the original has been recreated in an attempt to celebrate rather than claim credit for the ideas which made Hitchcock's film such a pillar of the film canon, much in the same way as a screen adaptation of a classic novel validates itself via its established worth. What is interesting about the reaction to this film is that as far as I can tell most critics hated it. The new Psycho has been labelled a vulgar hack job, a grossly immodest attempt to improve on the unimprovable. What is it about the original film that has caused this reaction to the remake, and what does it suggest about critical/academic readings versus popular ones? In order to answer this question, we must look closely at the original film, and at what is different or similar about the new one, and most importantly, consider the source of this uneasiness that pervades the adaptation of one fictitious body into another. The plot of Psycho is pretty straightforward. Marion Crane (Janet Leigh), a disenchanted and fatally scatty secretary that wants to marry her lover Sam (John Gavin) steals forty thousand dollars from her boss so they can afford to do so. She skips town and stops at a motel run by Norman Bates (Anthony Perkins) whose mother can be glimpsed and heard in a house nearby. Bates spies on Marion while she undresses, and just when she seems like she's going to return the stolen money she gets brutally stabbed in the shower. Norman finds her body and puts it in the car which he pushes into a swamp. Marion's sister Lila and Sam go looking for her, as does Arbogast, a PI who has been hired to find the money. Arbogast questions Norman and also gets brutally stabbed to death. When he fails to return, Lila and Sam go to the sheriff who tells them among other things that Mrs. Bates has been dead for ten years after killing the man she was involved with and then killing herself. All the while, we hear Norman talking to his mother and insisting on taking her down to the cellar. Lila and Sam search the hotel and eventually Lila finds a woman's stuffed corpse and Norman, dressed in old women's clothes, tries to stab her. Later a psychiatrist explains that the now incarcerated Norman is schizophrenic and had murdered his possessive mother because he was jealous of her lover. He had taken on her personality when drawn to a woman such as the fated Marion. What makes the film extraordinary is the use of action codes and an uneasiness that occupies the narrative through shot structure, real time, lighting, editing and sound. Hitchcock also deliberately disrupts the equilibrium audiences have come to expect from classic film narratives. The film opens as a crime story, turns into a murder mystery in which the lead character is the victim well before the end of the film. Psycho has a perplexing closure that denies the audience knowledge of the lost forty thousand dollars and Norman's unknown victims, and displaces sympathies and identities normally attached to lead roles. Norman's monstrous inner is developed with strange, angular lighting and a repressed homosexuality. The story unfolds in a very impersonal way, where the camera's omnipotence occasionally betrays the thoughts of its subjects. One brilliant moment involves the camera tracking between Marion while undressing and the money on the bed, reminding the audience of her deviousness and temptations, a mood heightened by her sexuality. The same technique is repeated after the shower scene, where the camera moves with Norman's gaze around the room towards the money, creating a bridge between the minds of the two enigmatic protagonists. All of these features of the original are reproduced in Van Sant's restaging in a manner that "subverts all audience wisdom about audience expectation" (Romney 31). The conversion from black and white into colour is the major technical innovation, cleverly highlighting details which speak volumes, such as Marion's telling bra's move from femme fatale black to aggressive orange. But it is the qualities of the film that remain the same which play on audience expectation, such as the shifty dialogue whose anachronistic sound reinforces the sinister subtext. The shower scene is bloodier, and Vince Vaughn's Norman is more blatantly homosexual, but the film is above all else a bold experiment and a deliberate challenge to accepted notions of originality. Perhaps the most critical moment for this intention is the retelling of the shower scene, the most famous horror scene in cinema history. Audience reaction to the shower scene was extreme when the film was first released in 1960. Hitchcock is said to have asked Paramount to allow him to remix the sound in the successive shots to accommodate audiences' "residual howling" (Branston & Stafford 49). The shower scene is the climactic moment for Van Sant's artistic intention: the absence of the same impact due to the audience's expectations of it questions what authority the critical reading has over the interpretation of antique films which are canonised and labelled as sophisticated or arty. What we come to expect from a remake that goes shot for shot is dismantled by the poignant illustration of the changes that have occurred since audiences have acquired a postmodern manner of regarding the on-screen world, particularly with the prevalence of films which stress the audience's participation in the attribution of meaning and value to the text, such as The Truman Show (1998), Scream (1997) or The Faculty (1999). Van Sant's Psycho uses the old-school to point out how our current attitude towards sexuality, violence and dementia have changed alongside our media culture, and most importantly he points the finger back to the audience, forcing us to recognise our new criteria for being frightened or aroused and our resistance to being inert receptacles of fictitious events and ideologies. John O. Thompson boils down the academic aversion to adaptation from book to film to four key points of resistance, three of which are applicable to the Psycho question: authenticity (the original is authentic, the adaptation is simulacrum), fidelity (the adaptation is a deformation or a dilution of the original), and massification (the original must be harder, more cognitively demanding, or the latter would not be the more popular for an 'unskilled' mass audience; Thompson 11). This last consideration is central to the critical response to Psycho. The overwhelmingly negative critical reaction to the film has given the audience very little credit for its ability to distance itself from the immediate narrative, a skill that is learned by default as we as viewers of postmodern media are exposed to more and more material that cleverly puts itself into a cultural context. The new Psycho may have surrendered its mysterious and disturbing nature but it has done so in favour of demonstrating how much we have changed, and in so doing has also managed to point out how critical appraisal of postmodern films fails to acknowledge the symbiotic relationship between mass audience and cinema art form. References Branston, Gill, and Roy Stafford, eds. The Media Student's Book. New York: Routledge, 1996. Cartmel, Deborah, I.Q. Hunter, Heidi Kaye and Imelda Whelehan, eds. Pulping Fictions: Consuming Culture across the Literature/Media Divide. London: Pluto Press, 1996. Romney, Jonathan. Guardian Weekly 17 Jan. 1999: 31. Thompson, John O. "Vanishing Worlds: Film Adaptation and the Mystery of the Original." Pulping Fictions: Consuming Culture across the Literature/Media Divide. London: Pluto Press, 1996. Citation reference for this article MLA style: Ben King. "Retelling Psycho." M/C: A Journal of Media and Culture 2.1 (1999). [your date of access] <http://www.uq.edu.au/mc/9902/psycho.php>. Chicago style: Ben King, "Retelling Psycho," M/C: A Journal of Media and Culture 2, no. 1 (1999), <http://www.uq.edu.au/mc/9902/psycho.php> ([your date of access]). APA style: Ben King. (199x) Retelling Psycho. M/C: A Journal of Media and Culture 2(1). <http://www.uq.edu.au/mc/9902/psycho.php> ([your date of access]).

IntroductionNew digital technologies hold promise for equalising access to information and communication for the Deaf community. SMS technology, for example, has helped to equalise deaf peoples’ access to information and made it easier to communicate with both deaf and hearing people (Tane Akamatsu et al.; Power and Power; Power, Power, and Horstmanshof; Valentine and Skelton, "Changing", "Umbilical"; Harper). A wealth of anecdotal evidence and some recent academic work suggests that new media technology is also reshaping deaf peoples’ sense of local and global community (Breivik "Deaf"; Breivik, Deaf; Brueggeman). One focus of research on new media technologies has been on technologies used for point to point communication, including communication (and interpretation) via video (Tane Akamatsu et al.; Power and Power; Power, Power, and Horstmanshof). Another has been the use of multimedia technologies in formal educational setting for pedagogical purposes, particularly English language literacy (e.g. Marshall Gentry et al.; Tane Akamatsu et al.; Vogel et al.). An emphasis on the role of multimedia in deaf education is understandable, considering the on-going highly politicised contest over whether to educate young deaf people in a bilingual environment using a signed language (Swanwick & Gregory). However, the increasing significance of social and participatory media in the leisure time of Westerners suggests that such uses of Web 2.0 are also worth exploring. There have begun to be some academic accounts of the enthusiastic adoption of vlogging by sign language users (e.g. Leigh; Cavander and Ladner) and this paper seeks to add to this important work. Web 2.0 has been defined by its ability to, in Denise Woods’ word, “harness collective intelligence” (19.2) by providing opportunities for users to make, adapt, “mash up” and share text, photos and video. As well as its well-documented participatory possibilities (Bruns), its re-emphasis on visual (as opposed to textual) communication is of particular interest for Deaf communities. It has been suggested that deaf people are a ‘visual variety of the human race’ (Bahan), and the visually rich presents new opportunities for visually rich forms of communication, most importantly via signed languages. The central importance of signed languages for Deaf identity suggests that the visual aspects of interactive multimedia might offer possibilities of maintenance, enhancement and shifts in those identities (Hyde, Power and Lloyd). At the same time, the visual aspects of the Web 2.0 are often audio-visual, such that the increasingly rich resources of the net offer potential barriers as well as routes to inclusion and community (see Woods; Ellis; Cavander and Ladner). In particular, lack of captioning or use of Auslan in video resources emerges as a key limit to the accessibility of the visual Web to deaf users (Cahill and Hollier). In this paper we ask to what extent contemporary digital media might create moments of permeability in what Krentz has called “the hearing line, that invisible boundary separating deaf and hearing people”( 2)”. To provide tentative answers to these questions, this paper will explore the use of participatory digital media by a group of young Deaf people taking part in a small-scale digital moviemaking project in Sydney in 2009. The ProjectAs a starting point, the interdisciplinary research team conducted a video-making course for young deaf sign language users within the Department of Media, Music and Cultural Studies at Macquarie University. The research team was comprised of one deaf and four hearing researchers, with expertise in media and cultural studies, information technology, sign language linguistics/ deaf studies, and signed language interpreting. The course was advertised through the newsletter of partner organization the NSW Deaf Society, via a Sydney bilingual deaf school and through the dense electronic networks of Australian deaf people. The course attracted fourteen participants from NSW, Western Australia and Queensland ranging in age from 10 to 18. Twelve of the participants were male, and two female. While there was no aspiration to gather a representative group of young people, it is worth noting there was some diversity within the group: for example, one participant was a wheelchair user while another had in recent years moved to Sydney from Africa and had learned Auslan relatively recently. Students were taught a variety of storytelling techniques and video-making skills, and set loose in groups to devise, shoot and edit a number of short films. The results were shared amongst the class, posted on a private YouTube channel and made into a DVD which was distributed to participants.The classes were largely taught in Auslan by a deaf teacher, although two sessions were taught by (non-deaf) members of Macquarie faculty, including an AFI award winning director. Those sessions were interpreted into Auslan by a sign language interpreter. Participants were then allowed free creative time to shoot video in locations of their choice on campus, or to edit their footage in the computer lab. Formal teaching sessions lasted half of each day – in the afternoons, participants were free to use the facilities or participate in a range of structured activities. Participants were also interviewed in groups, and individually, and their participation in the project was observed by researchers. Our research interest was in what deaf young people would choose to do with Web 2.0 technologies, and most particularly the visually rich elements of participatory and social media, in a relatively unstructured environment. Importantly, our focus was not on evaluating the effectiveness of multimedia for teaching deaf young people, or the level of literacy deployed by deaf young people in using the applications. Rather we were interested to discover the kinds of stories participants chose to tell, the ways they used Web 2.0 applications and the modalities of communication they chose to use. Given that Auslan was the language of instruction of the course, would participants draw on the tradition of deaf jokes and storytelling and narrate stories to camera in Auslan? Would they use the format of the “mash-up”, drawing on found footage or photographs? Would they make more filmic movies using Auslan dialogue? How would they use captions and text in their movies: as subtitles for Auslan dialogue? As an alternative to signing? Or not at all? Our observations from the project point to the great significance of the visual dimensions of Web 2.0 for the deaf young people who participated in the project. Initially, this was evident in the kind of movies students chose to make. Only one group – three young people in their late teens which included both of the young women in the class - chose to make a dialogue heavy movie, a spoof of Charlie’s Angels, entitled Deaf Angels. This movie included long scenes of the Angels using Auslan to chat together, receiving instruction from “Charlie” in sign language via videophone and recruiting “extras”, again using Auslan, to sign a petition for Auslan to be made an official Australian language. In follow up interviews, one of the students involved in making this film commented “my clip is about making a political statement, while the other [students in the class] made theirs just for fun”. The next group of (three) films, all with the involvement of the youngest class member, included signed storytelling of a sort readily recognisable from signed videos on-line: direct address to camera, with the teller narrating but also taking on the roles of characters and presenting their dialogue directly via the sign language convention of “role shift” - also referred to as constructed action and constructed dialogue (Metzger). One of these movies was an interesting hybrid. The first half of the four minute film had two young actors staging a hold-up at a vending machine, with a subsequent chase and fight scene. Like most of the films made by participants in the class, it included only one line of signed dialogue, with the rest of the narrative told visually through action. However, at the end of the action sequence, with the victim safely dead, the narrative was then retold by one of the performers within a signed story, using conventions typically observed in signed storytelling - such as role shift, characterisation and spatial mapping (Mather & Winston; Rayman; Wilson).The remaining films similarly drew on action and horror genres with copious use of chase and fight scenes and melodramatic and sometimes quite beautiful climactic death tableaux. The movies included a story about revenging the death of a brother; a story about escaping from jail; a short story about a hippo eating a vet; a similar short comprised of stills showing a sequence of executions in the computer lab; and a ghost story. Notably, most of these movies contained very little dialogue – with only one or two lines of signed dialogue in each four to five minute video (with the exception of the gun handshape used in context to represent the object liberally throughout most films). The kinds of movies made by this limited group of people on this one occasion are suggestive. While participants drew on a number of genres and communication strategies in their film making, the researchers were surprised at how few of the movies drew on traditions of signed storytelling or jokes– particularly since the course was targeted at deaf sign language users and promoted as presented in Auslan. Consequently, our group of students were largely drawn from the small number of deaf schools in which Auslan is the main language of instruction – an exceptional circumstance in an Australian setting in which most deaf young people attend mainstream schools (Byrnes et al.; Power and Hyde). Looking across the Hearing LineWe can make sense of the creative choices made by the participants in the course in a number of ways. Although methods of captioning were briefly introduced during the course, iMovie (the package which participants were using) has limited captioning functionality. Indeed, one student, who was involved in making the only clip to include captioning which contextualised the narrative, commented in follow-up interviews that he would have liked more information about captioning. It’s also possible that the compressed nature of the course prevented participants from undertaking the time-consuming task of scripting and entering captions. As well as being the most fun approach to the projects, the use of visual story telling was probably the easiest. This was perhaps exacerbated by the lack of emphasis on scriptwriting (outside of structural elements and broad narrative sweeps) in the course. Greater emphasis on that aspect of film-making would have given participants a stronger foundational literacy for caption-based projectsDespite these qualifications, both the movies made by students and our observations suggest the significance of a shared visual culture in the use of the Web by these particular young people. During an afternoon when many of the students were away swimming, one student stayed in the lab to use the computers. Rather than working on a video project, he spent time trawling through YouTube for clips purporting to show ghost sightings and other paranormal phenomena. He drew these clips to the attention of one of the research team who was present in the lab, prompting a discussion about the believability of the ghosts and supernatural apparitions in the clips. While some of the clips included (uncaptioned) off-screen dialogue and commentary, this didn’t seem to be a barrier to this student’s enjoyment. Like many other sub-genres of YouTube clips – pranks, pratfalls, cute or alarmingly dangerous incidents involving children and animals – these supernatural videos as a genre rely very little on commentary or dialogue for their meaning – just as with the action films that other students drew on so heavily in their movie making. In an E-Tech paper entitled "The Cute Cat Theory of Digital Activism", Ethan Zuckerman suggests that “web 1.0 was invented to allow physicists to share research papers and web 2.0 was created to allow people to share pictures of cute cats”. This comment points out both the Web 2.0’s vast repository of entertaining material in the ‘funny video’genre which is visually based, dialogue free, entertaining material accessible to a wide range of people, including deaf sign language users. In the realm of leisure, at least, the visually rich resources of Web 2.0’s ubiquitous images and video materials may be creating a shared culture in which the line between hearing and deaf people’s entertainment activities is less clear than it may have been in the past. The ironic tone of Zuckerman’s observation, however, alerts us to the limits of a reliance on language-free materials as a route to accessibility. The kinds of videos that the participants in the course chose to make speaks to the limitations as well as resources offered by the visual Web. There is still a limited range of captioned material on You Tube. In interviews, both young people and their teachers emphasised the central importance of access to captioned video on-line, with the young people we interviewed strongly favouring captioned video over the inclusion on-screen of simultaneous signed interpretations of text. One participant who was a regular user of a range of on-line social networking commented that if she really liked the look of a particular movie which was uncaptioned, she would sometimes contact its maker and ask them to add captions to it. Interestingly, two student participants emphasised in interviews that signed video should also include captions so hearing people could have access to signed narratives. These students seemed to be drawing on ideas about “reverse discrimination”, but their concern reflected the approach of many of the student movies - using shared visual conventions that made their movies available to the widest possible audience. All the students were anxious that hearing people could understand their work, perhaps a consequence of the course’s location in the University as an overwhelmingly hearing environment. In this emphasis on captioning rather than sign as a route to making media accessible, we may be seeing a consequence of the emphasis Krentz describes as ubiquitous in deaf education “the desire to make the differences between deaf and hearing people recede” (16). Krentz suggests that his concept of the ‘hearing line’ “must be perpetually retested and re-examined. It reveals complex and shifting relationships between physical difference, cultural fabrication and identity” (7). The students’ movies and attitudes emphasised the reality of that complexity. Our research project explored how some young Deaf people attempted to create stories capable of crossing categories of deafness and ‘hearing-ness’… unstable (like other identity categories) while others constructed narratives that affirmed Deaf Culture or drew on the Deaf storytelling traditions. This is of particular interest in the Web 2.0 environment, given that its technologies are often lauded as having the politics of participation. The example of the Deaf Community asks reasonable questions about the validity of those claims, and it’s hard to escape the conclusion that there is still less than appropriate access and that some users are more equal than others.How do young people handle the continuing lack of material available to the on the Web? The answer repeatedly offered by our young male interviewees was ‘I can’t be bothered’. As distinct from “I can’t understand” or “I won’t go there” this answer, represented a disengagement from demands to identify your literacy levels, reveal your preferred means of communication; to rehearse arguments about questions of access or expose attempts to struggle to make sense of texts that fail to employ readily accessible means of communicating. Neither an admission of failure or a demand for change, CAN’T-BE-BOTHERED in this context offers a cool way out of an accessibility impasse. This easily-dismissed comment in interviews was confirmed in a whole-group discussions, when students came to a consensus that if when searching for video resources on the Net they found video that included neither signing nor captions, they would move on to find other more accessible resources. Even here, though, the ground continues to shift. YouTube recently announced that it was making its auto-captioning feature open to everybody - a machine generated system that whilst not perfect does attempt to make all YouTube videos accessible to deaf people. (Bertolucci).The importance of captioning of non-signed video is thrown into further significance by our observation from the course of the use of YouTube as a search engine by the participants. Many of the students when asked to research information on the Web bypassed text-based search engines and used the more visual results presented on YouTube directly. In research on deaf adolescents’ search strategies on the Internet, Smith points to the promise of graphical interfaces for deaf young people as a strategy for overcoming the English literacy difficulties experienced by many deaf young people (527). In the years since Smith’s research was undertaken, the graphical and audiovisual resources available on the Web have exploded and users are increasingly turning to these resources in their searches, providing new possibilities for Deaf users (see for instance Schonfeld; Fajardo et al.). Preliminary ConclusionsA number of recent writers have pointed out the ways that the internet has made everyday communication with government services, businesses, workmates and friends immeasurably easier for deaf people (Power, Power and Horstmanshof; Keating and Mirus; Valentine and Skelton, "Changing", "Umbilical"). The ready availability of information in a textual and graphical form on the Web, and ready access to direct contact with others on the move via SMS, has worked against what has been described as deaf peoples’ “information deprivation”, while everyday tasks – booking tickets, for example – are no longer a struggle to communicate face-to-face with hearing people (Valentine and Skelton, "Changing"; Bakken 169-70).The impacts of new technologies should not be seen in simple terms, however. Valentine and Skelton summarise: “the Internet is not producing either just positive or just negative outcomes for D/deaf people but rather is generating a complex set of paradoxical effects for different users” (Valentine and Skelton, "Umbilical" 12). They note, for example, that the ability, via text-based on-line social media to interact with other people on-line regardless of geographic location, hearing status or facility with sign language has been highly valued by some of their deaf respondents. They comment, however, that the fact that many deaf people, using the Internet, can “pass” minimises the need for hearing people in a phonocentric society to be aware of the diversity of ways communication can take place. They note, for example, that “few mainstream Websites demonstrate awareness of D/deaf peoples’ information and communication needs/preferences (eg. by incorporating sign language video clips)” ("Changing" 11). As such, many deaf people have an enhanced ability to interact with a range of others, but in a mode favoured by the dominant culture, a culture which is thus unchallenged by exposure to alternative strategies of communication. Our research, preliminary as it is, suggests a somewhat different take on these complex questions. The visually driven, image-rich approach taken to movie making, Web-searching and information sharing by our participants suggests the emergence of a certain kind of on-line culture which seems likely to be shared by deaf and hearing young people. However where Valentine and Skelton suggest deaf people, in order to participate on-line, are obliged to do so, on the terms of the hearing majority, the increasingly visual nature of Web 2.0 suggests that the terrain may be shifting – even if there is still some way to go.AcknowledgementsWe would like to thank Natalie Kull and Meg Stewart for their research assistance on this project, and participants in the course and members of the project’s steering group for their generosity with their time and ideas.ReferencesBahan, B. "Upon the Formation of a Visual Variety of the Human Race. In H-Dirksen L. Baumann (ed.), Open Your Eyes: Deaf Studies Talking. London: University of Minnesota Press, 2007.Bakken, F. “SMS Use among Deaf Teens and Young Adults in Norway.” In R. Harper, L. Palen, and A. Taylor (eds.), The Inside Text: Social, Cultural and Design Perspectives on SMS. Netherlands: Springe, 2005. 161-74. Berners-Lee, Tim. Weaving the Web. London: Orion Business, 1999.Bertolucci, Jeff. “YouTube Offers Auto-Captioning to All Users.” PC World 5 Mar. 2010. 5 Mar. 2010 < http://www.macworld.com/article/146879/2010/03/YouTube_captions.html >.Breivik, Jan Kare. Deaf Identities in the Making: Local Lives, Transnational Connections. Washington, D.C.: Gallaudet University Press, 2005.———. “Deaf Identities: Visible Culture, Hidden Dilemmas and Scattered Belonging.” In H.G. Sicakkan and Y.G. Lithman (eds.), What Happens When a Society Is Diverse: Exploring Multidimensional Identities. Lewiston, New York: Edwin Mellen Press, 2006. 75-104.Brueggemann, B.J. (ed.). Literacy and Deaf People’s Cultural and Contextual Perspectives. Washington, DC: Gaudellet University Press, 2004. Bruns, Axel. Blogs, Wikipedia, Second Life and Beyond: From Production to Produsage. New York: Peter Lang, 2008.Byrnes, Linda, Jeff Sigafoos, Field Rickards, and P. Margaret Brown. “Inclusion of Students Who Are Deaf or Hard of Hearing in Government Schools in New South Wales, Australia: Development and Implementation of a Policy.” Journal of Deaf Studies and Deaf Education 7.3 (2002): 244-257.Cahill, Martin, and Scott Hollier. Social Media Accessibility Review 1.0. Media Access Australia, 2009. Cavender, Anna, and Richard Ladner. “Hearing Impairments.” In S. Harper and Y. Yesilada (eds.), Web Accessibility. London: Springer, 2008.Ellis, Katie. “A Purposeful Rebuilding: YouTube, Representation, Accessibility and the Socio-Political Space of Disability." Telecommunications Journal of Australia 60.2 (2010): 1.1-21.12.Fajardo, Inmaculada, Elena Parra, and Jose J. Canas. “Do Sign Language Videos Improve Web Navigation for Deaf Signer Users?” Journal of Deaf Studies and Deaf Education 15.3 (2009): 242-262.Harper, Phil. “Networking the Deaf Nation.” Australian Journal of Communication 30.3 (2003): 153-166.Hyde, M., D. Power, and K. Lloyd. "W(h)ither the Deaf Community? Comments on Trevor Johnston’s Population, Genetics and the Future of Australian Sign Language." Sign Language Studies 6.2 (2006): 190-201. Keating, Elizabeth, and Gene Mirus. “American Sign Language in Virtual Space: Interactions between Deaf Users of Computer-Mediated Video.” Language in Society 32.5 (Nov. 2003): 693-714.Krentz, Christopher. Writing Deafness: The Hearing Line in Nineteenth-Century Literature. Chapel Hill, NC: University of North Carolina Press, 2007.Leigh, Irene. A Lens on Deaf Identities. Oxford: Oxford UP. 2009.Marshall Gentry, M., K.M. Chinn, and R.D. Moulton. “Effectiveness of Multimedia Reading Materials When Used with Children Who Are Deaf.” American Annals of the Deaf 5 (2004): 394-403.Mather, S., and E. Winston. "Spatial Mapping and Involvement in ASL Storytelling." In C. Lucas (ed.), Pinky Extension and Eye Gaze: Language Use in Deaf Communities. Washington, DC: Gallaudet University Press, 1998. 170-82.Metzger, M. "Constructed Action and Constructed Dialogue in American Sign Language." In C. Lucas (ed.), Sociolinguistics in Deaf Communities. Washington, DC: Gallaudet University Press, 1995. 255-71.Power, Des, and G. Leigh. "Principles and Practices of Literacy Development for Deaf Learners: A Historical Overview." Journal of Deaf Studies and Deaf Education 5.1 (2000): 3-8.Power, Des, and Merv Hyde. “The Characteristics and Extent of Participation of Deaf and Hard-of-Hearing Students in Regular Classes in Australian Schools.” Journal of Deaf Studies and Deaf Education 7.4 (2002): 302-311.Power, M., and D. Power “Everyone Here Speaks TXT: Deaf People Using SMS in Australia and the Rest of the World.” Journal of Deaf Studies and Deaf Education 9.3 (2004). Power, M., D. Power, and L. Horstmanshof. “Deaf People Communicating via SMS, TTY, Relay Service, Fax, and Computers in Australia.” Journal of Deaf Studies and Deaf Education 12.1 (2007): 80-92. Rayman, J. "Storytelling in the Visual Mode: A Comparison of ASL and English." In E. Wilson (ed.), Storytelling & Conversation: Discourse in Deaf Communities. Washington, DC: Gallaudet University Press, 2002. 59-82.Schonfeld, Eric. "ComScore: YouTube Now 25 Percent of All Google Searches." Tech Crunch 18 Dec. 2008. 14 May 2009 < http://www.techcrunch.com/2008/12/18/comscore-YouTube-now-25-percent-of-all-google-searches/?rss >.Smith, Chad. “Where Is It? How Deaf Adolescents Complete Fact-Based Internet Search Tasks." American Annals of the Deaf 151.5 (2005-6).Swanwick, R., and S. Gregory (eds.). Sign Bilingual Education: Policy and Practice. Coleford: Douglas McLean Publishing, 2007.Tane Akamatsu, C., C. Mayer, and C. Farrelly. “An Investigation of Two-Way Text Messaging Use with Deaf Students at the Secondary Level.” Journal of Deaf Studies and Deaf Education 11.1 (2006): 120-131.Valentine, Gill, and Tracy Skelton. “Changing Spaces: The Role of the Internet in Shaping Deaf Geographies.” Social and Cultural Geography 9.5 (2008): 469-85.———. “‘An Umbilical Cord to the World’: The Role of the Internet in D/deaf People’s Information and Communication Practices." Information, Communication and Society 12.1 (2009): 44-65.Vogel, Jennifer, Clint Bowers, Cricket Meehan, Raegan Hoeft, and Kristy Bradley. “Virtual Reality for Life Skills Education: Program Evaluation.” Deafness and Education International 61 (2004): 39-47.Wilson, J. "The Tobacco Story: Narrative Structure in an ASL Story." In C. Lucas (ed.), Multicultural Aspects of Sociolinguistics in Deaf Communities. Washington, DC: Gallaudet University Press, 1996. 152-80.Winston (ed.). Storytelling and Conversation: Discourse in Deaf Communities. Washington, D.C: Gallaudet University Press. 59-82.Woods, Denise. “Communicating in Virtual Worlds through an Accessible Web 2.0 Solution." Telecommunications Journal of Australia 60.2 (2010): 19.1-19.16YouTube Most Viewed. Online video. YouTube 2009. 23 May 2009 < http://www.YouTube.com/browse?s=mp&t=a >.

IntroductionFestivals, according to Chris Gibson and John Connell, are like “glue”, temporarily sticking together various stakeholders, economic transactions, and networks (9). Australia’s First Nations peoples see festivals as an opportunity to display cultural vitality (Henry 586), and to challenge a history which has rendered them absent (587). The 2017 Australia Council for the Arts Showcasing Creativity report indicates that performing arts by First Nations peoples are under-represented in Australia’s mainstream venues and festivals (1). Large Aboriginal cultural festivals have long thrived in Australia’s northern half, but have been under-developed in the south. Each regional happening develops a cultural landscape connected to a long and intimate relationship with the natural environment.The Far South East coast and mountainous hinterland of New South Wales is rich in pristine landscapes that ground the Yuin and Monaro Nations to Country as the Monaroo Bobberrer Gadu (Peoples of the Mountains and the Sea). This article highlights cross-sector interaction between Koori and mainstream organisations in producing the Giiyong (Guy-Yoong/Welcoming) Festival. This, the first large festival to be held within the Yuin Nation, took place on Aboriginal-owned land at Jigamy, via Eden, on 22 September 2018. Emerging regional artists joined national headline acts, most notably No Fixed Address (one of the earliest Aboriginal bands to break into the Australian mainstream music industry), and hip-hop artist Baker Boy (Danzal Baker, Young Australian of the Year 2019). The festival followed five years of sustained community preparation by South East Arts in association with Grow the Music, Twofold Aboriginal Corporation, the Eden Local Aboriginal Land Council, and its Elders. We offer dual understandings of the Giiyong Festival: the viewpoints of a male Yuin Elder wedded to an Australian woman of European descent. We acknowledge, and rely upon, key information, statistics, and photographs provided by the staff of South East Arts including Andrew Gray (General Manager), Jasmin Williams (Aboriginal Creative and Cultural Engagement Officer and Giiyong Festival Project Manager), and Kate Howarth (Screen Industry Development Officer). We are also grateful to Wiradjuri woman Alison Simpson (Program Manager at Twofold Aboriginal Corporation) for valuable feedback. As community leaders from First Nations and non-First Nations backgrounds, Simpson and Williams complement each other’s talents for empowering Indigenous communities. They plan a 2020 follow-up event on the basis of the huge success of the 2018 festival.The case study is informed by our personal involvement with community. Since the general population barely comprehends the number and diversity of Australia’s Indigenous ‘nations’, the burgeoning Indigenous festival movement encourages First Nations and non-First Nations peoples alike to openly and confidently refer to the places they live in according to Indigenous names, practices, histories, and knowledge. Consequently, in the mental image of a map of the island-continent, the straight lines and names of state borders fade as the colours of the Indigenous ‘Countries’ (represented by David Horton’s wall map of 1996) come to the foreground. We reason that, in terms of ‘regionality,’ the festival’s expressions of “the agency of country” (Slater 141) differ vastly from the centre-periphery structure and logic of the Australian colony. There is no fixed centre to the mutual exchange of knowledge, culture, and experience in Aboriginal Australia. The broader implication of this article is that Indigenous cultural festivals allow First Nations peoples cultures—in moments of time—to assume precedence, that is to ‘stitch’ back together the notion of a continent made up of hundreds of countries, as against the exploitative structure of ‘hub and region’ colonial Australia.Festival Concepts and ContextsHoward Becker observed that cultural production results from an interplay between the person of the artist and a multitude of support personnel whose work is not frequently studied: “It is through this network of cooperation that the art work we eventually see or hear comes to be and continues to be” (1). In assisting arts and culture throughout the Bega Valley, Eurobodalla, and Snowy Monaro, South East Arts delivers positive achievements in the Aboriginal arts and cultural sector. Their outcomes are significant in the light of the dispossession, segregation, and discrimination experienced by Aboriginal Australians. Michael Young, assisted by Indigenous authors Ellen Mundy and Debbie Mundy, recorded how Delegate Reserve residents relocating to the coast were faced with having their lives controlled by a Wallaga Lake Reserve manager or with life on the fringes of the towns in shacks (2–3). But as discovered in the records, “their retention of traditional beliefs, values and customs, reveal that the accommodation they were forced to make with the Europeans did not mean they had surrendered. The proof of this is the persistence of their belief in the value of their culture” (3–4). The goal of the Twofold Aboriginal Corporation is to create an inclusive place where Aboriginal people of the Twofold Bay Region can be proud of their heritage, connect with the local economy, and create a real future for their children. When Simpson told Williams of the Twofold Aboriginal Corporation’s and Eden Local Aboriginal Land Council’s dream of housing a large cultural festival at Jigamy, Williams rigorously consulted local Indigenous organisations to build a shared sense of community ownership of the event. She promoted the festival as “a rare opportunity in our region to learn about Aboriginal culture and have access to a huge program of Aboriginal musicians, dancers, visual artists, authors, academics, storytellers, cooks, poets, creative producers, and films” (McKnight).‘Uncle Ossie’ Cruse of Eden envisaged that the welcoming event would enliven the longstanding caring and sharing ethos of the Yuin-Monaro people. Uncle Ossie was instrumental in establishing Jigamy’s majestic Monaroo Bobberrer Gudu Keeping Place with the Eden Local Aboriginal Land Council in 1994. Built brick by brick by Indigenous workers, it is a centre for the teaching and celebration of Aboriginal culture, and for the preservation of artefacts. It represents the local community's determination to find their own solutions for “bridging the gap” by creating education and employment opportunities. The centre is also the gateway to the Bundian Way, the first Aboriginal pathway to be listed on the NSW State Heritage Register. Festival Lead-Up EventsEden’s Indigenous students learn a revived South Coast language at Primary and Secondary School. In 2015, Uncle Ossie vitally informed their input into The Black Ducks, a hip-hop song filmed in Eden by Desert Pea Media. A notable event boosting Koori musical socialisation was a Giiyong Grow the Music spectacle performed at Jigamy on 28 October 2017. Grow the Music—co-founded by Lizzy Rutten and Emily White—specialises in mentoring Indigenous artists in remote areas using digital recording equipment. Eden Marine High School students co-directed the film Scars as part of a programme of events with South East Arts and the Giiyong Festival 2018. The Eden Place Project and Campbell Page also create links between in- and out-of-school activities. Eden’s Indigenous students thus perform confidently at NAIDOC Week celebrations and at various festivals. Preparation and PersonnelAn early decision was made to allow free entry to the Giiyong Festival in order to attract a maximum number of Indigenous families. The prospect necessitated in-kind support from Twofold Aboriginal Corporation staff. They galvanised over 100 volunteers to enhance the unique features of Jigamy, while Uncle Ossie slashed fields of bushes to prepare copious parking space. The festival site was spatially focused around two large stages dedicated to the memory of two strong supporters of cultural creativity: Aunty Doris Kirby, and Aunty Liddy Stewart (Image 1). Image 1: Uncle Ossie Cruse Welcomes Festival-Goers to Country on the Aunty Liddy Stewart Stage. Image Credit: David Rogers for South East Arts, Reproduction Courtesy of South East Arts.Cultural festivals are peaceful weapons in a continuing ontological political contest (Slater 144). In a panel discussion, Uncle Ossie explained and defended the Makarrata: the call for a First Nations Voice to be enshrined in the Constitution.Williams also contracted artists with a view to capturing the past and present achievements of Aboriginal music. Apart from her brilliant centrepiece acts No Fixed Address and Baker Boy, she attracted Pitjantjatjara singer Frank Yamma (Image 2), Yorta Yorta singer/songwriter Benny Walker, the Central Desert Docker River Band, and Jessie Lloyd’s nostalgic Mission Songs Project. These stellar acts were joined by Wallaga Lake performers Robbie Bundle, Warren Foster, and Alison Walker as well as Nathan Lygon (Eden), Chelsy Atkins (Pambula), Gabadoo (Bermagui), and Drifting Doolgahls (Nowra). Stage presentations were technologically transformed by the live broadcast of acts on large screens surrounding the platforms. Image 2: Singer-Songwriter Frank Yamma Performs at Giiyong Festival 2018. Image Credit: David Rogers for South East Arts, Reproduction Courtesy of South East Arts.Giiyong Music and Dance Music and dance form the staple components of Indigenous festivals: a reflection on the cultural strength of ancient ceremony. Hundreds of Yuin-Monaro people once attended great corroborees on Mumbulla Mountain (Horton 1235), and oral history recorded by Janet Mathews evidences ceremonies at Fishy Flats, Eden, in the 1850s. Today’s highly regarded community musicians and dancers perform the social arrangements of direct communication, sometimes including their children on stage as apprentices. But artists are still negotiating the power structures through which they experience belonging and detachment in the representation of their musical identity.Youth gain positive identities from participating alongside national headline acts—a form of learning that propels talented individuals into performing careers. The One Mob Dreaming Choir of Koori students from three local schools were a popular feature (Image 3), as were Eden Marine student soloists Nikai Stewart, and Nikea Brooks. Grow the Music in particular has enabled these youngsters to exhibit the roots of their culture in a deep and touching way that contributes to their life-long learning and development. Image 3: The One Mob Dreaming Choir, Directed by Corinne Gibbons (L) and Chelsy Atkins (R). Image Credit: David Rogers for South East Arts, Reproduction Courtesy of South East Arts. Brydie-Leigh Bartleet describes how discourses of pride emerge when Indigenous Australian youth participate in hip-hop. At the Giiyong Festival the relationship between musical expression, cultural representation, and political positioning shone through the songs of Baker Boy and Gabadoo (Image 4). Channelling emotions into song, they led young audiences to engage with contemporary themes of Indigeneity. The drones launched above the carpark established a numerical figure close on 6,000 attendees, a third of whom were Indigenous. Extra teenagers arrived in time for Baker Boy’s evening performance (Williams), revealing the typical youthful audience composition associated with the hip-hop craze (Image 5).Image 4: Bermagui Resident Gabadoo Performs Hip-Hop at the Giiyong Festival. Image Credit: David Rogers for South East Arts, Reproduced Courtesy South East Arts.Image 5: A Youthful Audience Enjoys Baker Boy’s Giiyong Festival Performance. Image Credit: David Rogers for South East Arts, Reproduced Courtesy South East Arts.Wallaga Lake’s traditional Gulaga Dancers were joined by Bermagui’s Gadhu Dancers, Eden’s Duurunu Miru Dancers, and Narooma’s Djaadjawan Dancers. Sharon Mason founded Djaadjawan Dancers in 2015. Their cultural practice connects to the environment and Mingagia (Mother Earth). At their festival tent, dancers explained how they gather natural resources from Walbanja Country to hand-make traditional dance outfits, accessories, and craft. They collect nuts, seeds, and bark from the bush, body paint from ancient ochre pits, shells from beaches, and bird feathers from fresh roadkill. Duurunu Miru dancer/didjeriduist Nathan Lygon elaborates on the functions of the Far South East Coast dance performance tradition:Dance provides us with a platform, an opportunity to share our stories, our culture, and our way of being. It demonstrates a beautiful positivity—a feeling of connection, celebration, and inclusion. The community needs it. And our young people need a ‘space’ in which they can grow into the knowledge and practices of their culture. The festival also helped the wider community to learn more about these dimensions. (n.p.)While music and dance were at the heart of the festival, other traditional skills were included, for example the exhibitions mounted inside the Keeping Place featured a large number of visual artists. Traditional bush cooking took place near Lake Pambula, and yarn-ups, poetry, and readings were featured throughout the day. Cultural demonstrations in the Bunaan Ring (the Yuin name for a corroboree circle) included ‘Gum Leaf Playing.’ Robin Ryan explained how the Yuin’s use of cultural elements to entertain settlers (Cameron 79) led to the formation of the Wallaga Lake Gum Leaf Band. As the local custodian of this unique musical practice, Uncle Ossie performed items and conducted a workshop for numerous adults and children. Festival Feedback and Future PlanningThe Giiyong Festival gained huge Indigenous cultural capital. Feedback gleaned from artists, sponsors, supporters, volunteers, and audiences reflected on how—from the moment the day began—the spirit of so many performers and consumers gathered in one place took over. The festival’s success depended on its reception, for as Myers suggests: “It is the audience who create the response to performance and if the right chemistry is achieved the performers react and excel in their presentation” (59). The Bega District News, of 24 September 2018, described the “incredibly beautiful event” (n.p.), while Simpson enthused to the authors:I believe that the amount of people who came through the gates to attend the Giiyong Festival was a testament to the wider need and want for Aboriginal culture. Having almost double the population of Eden attend also highlights that this event was long overdue. (n.p.)Williams reported that the whole festival was “a giant exercise in the breaking down of walls. Some signed contracts for the first time, and all met their contracts professionally. National artists Baker Boy and No Fixed Address now keep in touch with us regularly” (Williams). Williams also expressed her delight that local artists are performing further afield this year, and that an awareness, recognition, and economic impact has been created for Jigamy, the Giiyong Festival, and Eden respectively:We believe that not only celebrating, but elevating these artists and Aboriginal culture, is one of the most important things South East Arts can do for the overall arts sector in the region. This work benefits artists, the economy and cultural tourism of the region. Most importantly it feeds our collective spirit, educates us, and creates a much richer place to live. (Giiyong Festival Report 1)Howarth received 150 responses to her post-event survey. All respondents felt welcome, included, and willing to attend another festival. One commented, “not even one piece of rubbish on the ground.” Vanessa Milton, ABC Open Producer for South East NSW, wrote: “Down to the tiniest detail it was so obvious that you understood the community, the audience, the performers and how to bring everyone together. What a coup to pull off this event, and what a gift to our region” (Giiyong Festival Report 4).The total running cost for the event was $257,533, including $209,606 in government grants from local, state, and federal agencies. Major donor Create NSW Regional Partnerships funded over $100,000, and State Aboriginal Affairs gave $6,000. Key corporate sponsors included Bendigo Bank, Snowy Hydro and Waterway Constructions, Local Land Services Bega, and the Eden Fisherman’s Club. Funding covered artists’ fees, staging, the hiring of toilets, and multiple generators, including delivery costs. South East Arts were satisfied with the funding amount: each time a new donation arrived they were able to invite more performers (Giiyong Festival Report 2; Gray; Williams). South East Arts now need to prove they have the leadership capacity, financial self-sufficiency, and material resources to produce another festival. They are planning 2020 will be similar to 2018, provided Twofold Aboriginal Corporation can provide extra support. Since South East Arts exists to service a wider area of NSW, they envisage that by 2024, they would hand over the festival to Twofold Aboriginal Corporation (Gray; Williams). Forthcoming festivals will not rotate around other venues because the Giiyong concept was developed Indigenously at Jigamy, and “Jigamy has the vibe” (Williams). Uncle Ossie insists that the Yuin-Monaro feel comfortable being connected to Country that once had a traditional campsite on the east side. Evaluation and ConclusionAlthough ostensibly intended for entertainment, large Aboriginal festivals significantly benefit the educational, political, and socio-economic landscape of contemporary Indigenous life. The cultural outpourings and dissemination of knowledges at the 2018 Giiyong Festival testified to the resilience of the Yuin-Monaro people. In contributing to the processes of Reconciliation and Recognition, the event privileged the performing arts as a peaceful—yet powerful truth-telling means—for dealing with the state. Performers representing the cultures of far-flung ancestral lands contributed to the reimagining of a First Nations people’s map representing hundreds of 'Countries.’It would be beneficial for the Far South East region to perpetuate the Giiyong Festival. It energised all those involved. But it took years of preparation and a vast network of cooperating people to create the feeling which made the 2018 festival unique. Uncle Ossie now sees aspects of the old sharing culture of his people springing back to life to mould the quality of life for families. Furthermore, the popular arts cultures are enhancing the quality of life for Eden youth. As the cross-sector efforts of stakeholders and volunteers so amply proved, a family-friendly, drug and alcohol-free event of the magnitude of the Giiyong Festival injects new growth into an Aboriginal arts industry designed for the future creative landscape of the whole South East region. AcknowledgementsMany thanks to Andrew Gray and Jasmin Williams for supplying a copy of the 2018 Giiyong Festival Report. We appreciated prompt responses to queries from Jasmin Williams, and from our editor Rachel Franks. We are humbly indebted to our two reviewers for their expert direction.ReferencesAustralian Government. Showcasing Creativity: Programming and Presenting First Nations Performing Arts. Australia Council for the Arts Report, 8 Mar. 2017. 20 May 2019 <https://tnn.org.au/2017/03/showcasing-creativity-programming-and-presenting-first-nations-performing-arts-australia-council/>.Bartleet, Brydie-Leigh. “‘Pride in Self, Pride in Community, Pride in Culture’: The Role of Stylin’ Up in Fostering Indigenous Community and Identity.” The Festivalization of Culture. Eds. Andy Bennett, Jodie Taylor, and Ian Woodward. New York: Routledge, 2014.Becker, Howard S. Art Worlds. 25th anniversary edition. Berkeley: U of California P, 2008.Brown, Bill. “The Monaroo Bubberer [Bobberer] Gudu Keeping Place: A Symbol of Aboriginal Self-determination.” ABC South East NSW, 9 Jul. 2015. 20 May 2019 <http://www.abc.net.au/local/photos/2015/07/09/4270480.htm>.Cameron, Stuart. "An Investigation of the History of the Aborigines of the Far South Coast of NSW in the 19th Century." PhD Thesis. Canberra: Australian National U, 1987. Desert Pea Media. The Black Ducks “People of the Mountains and the Sea.” <https://www.youtube.com/watch?v=8fbJNHAdbkg>.“Festival Fanfare.” Eden Magnet 28 June 2018. 1 Mar. 2019 <edenmagnet.com.au>.Gibson, Chris, and John Connell. Music Festivals and Regional Development in Australia. Aldershot: Ashgate, 2012.Gray, Andrew. Personal Communication, 28 Mar. 2019.Henry, Rosita. “Festivals.” The Oxford Companion to Aboriginal Art and Culture. Eds. Syvia Kleinert and Margot Neale. South Melbourne: Oxford UP, 586–87.Horton, David R. “Yuin.” Encyclopaedia of Aboriginal Australia. Ed. David R. Horton. Canberra: Aboriginal Studies Press, 1994.———. Aboriginal Australia Wall Map Compiled by David Horton. Aboriginal Studies Press, 1996.Lygon, Nathan. Personal Communication, 20 May 2019.Mathews, Janet. Albert Thomas Mentions the Leaf Bands That Used to Play in the Old Days. Cassette recorded at Wreck Bay, NSW on 9 July 1964 for the Australian Institute of Aboriginal and Torres Strait Islanders (AIATSIS). LAA1013. McKnight, Albert. “Giiyong Festival the First of Its Kind in Yuin Nation.” Bega District News 17 Sep. 2018. 1 Mar. 2019 <https://www.begadistrictnews.com.au/story/5649214/giiyong-festival-the-first-of-its-kind-in-yuin-nation/?cs=7523#slide=2>. ———. “Giiyong Festival Celebrates Diverse, Enduring Cultures.” Bega District News 24 Sep. 2018. 1 Mar. 2019 <https://www.begadistrictnews.com.au/story/5662590/giiyong-festival-celebrates-diverse-enduring-cultures-photos-videos/>.Myers, Doug. “The Fifth Festival of Pacific Arts.” Australian Aboriginal Studies 1 (1989): 59–62.Simpson, Alison. Personal Communication, 9 Apr. 2019.Slater, Lisa. “Sovereign Bodies: Australian Indigenous Cultural Festivals and Flourishing Lifeworlds.” The Festivalization of Culture. Eds. Andy Bennett, Jodie Taylor, and Ian Woodward. London: Ashgate, 2014. 131–46.South East Arts. "Giiyong Festival Report." Bega: South East Arts, 2018.———. Giiyong Grow the Music. Poster for Event Produced on Saturday, 28 Oct. 2017. Bega: South East Arts, 2017.Williams, Jasmin. Personal Communication, 28 Mar. 2019.Young, Michael, with Ellen, and Debbie Mundy. The Aboriginal People of the Monaro: A Documentary History. Sydney: NSW National Parks and Wildlife Service, 2000.

In Australian universities, many courses provide lecture notes as a standard learning resource; however, captions and transcripts of these lectures are not usually provided unless requested by a student through dedicated disability support officers (Worthington). As a result, to date their use has been limited. However, while the requirement for—and benefits of—captioned online lectures for students with disabilities is widely recognised, these captions or transcripts might also represent further opportunity for a personalised approach to learning for the mainstream student population (Podszebka et al.; Griffin). This article reports findings of research assessing the usefulness of captioned recorded lectures as a mainstream learning tool to determine their usefulness in enhancing inclusivity and learning outcomes for the disabled, international, and broader student population.Literature ReviewCaptions have been found to be of benefit for a number of different groups considered at-risk. These include people who are D/deaf or hard of hearing, those with other learning difficulties, and those from a non-English speaking background (NESB).For students who are D/deaf or hard of hearing, captions play a vital role in providing access to otherwise inaccessible audio content. Captions have been found to be superior to sign language interpreters, note takers, and lip reading (Stinson et al.; Maiorana-Basas and Pagliaro; Marschark et al.).The use of captions for students with a range of cognitive disabilities has also been shown to help with student comprehension of video-based instruction in a higher education context (Evmenova; Evmenova and Behrmann). This includes students with autism spectrum disorder (ASD) (Knight et al.; Reagon et al.) and students with dyslexia (Alty et al.; Beacham and Alty). While, anecdotally, captions are also seen as of benefit for students with attention deficit hyperactivity disorder (ADHD) (Kent et al.), studies have proved inconclusive (Lewis and Brown).The third group of at-risk students identified as benefiting from captioning recorded lecture content are those from a NESB. The use of captions has been shown to increase vocabulary learning (Montero Perez, Peters, Clarebout, and Desmet; Montero Perez, Van Den Noortgate, and Desmet) and to assist with comprehension of presenters with accents or rapid speech (Borgaonkar, 2013).In addition to these three main groups of at-risk students, captions have also been demonstrated to increase the learning outcomes for older students (Pachman and Ke, 2012; Schmidt and Haydu, 1992). Captions also have demonstrable benefits for the broader student cohort beyond these at-risk groups (Podszebka et al.; Griffin). For example, a recent study found that the broader student population utilised lecture captions and transcripts in order to focus, retain information, and overcome poor audio quality (Linder). However, the same study revealed that students were largely unaware about the availability of captions and transcripts, nor how to access them.MethodologyIn 2016 students in the Curtin University unit Web Communications (an introductory unit for the Internet Communications major) and its complementary first year unit, Internet and Everyday Life, along with a second year unit, Web Media, were provided with access to closed captions for their online recorded lectures. The latter unit was added to the study serendipitously when its lectures were required to be captioned through a request from the Curtin Disability Office during the study period. Recordings and captions were created using the existing captioning system available through Curtin’s lecture recording platform—Echo360. As well as providing a written caption of what is being said during the lectures, this system also offers a sophisticated search functionality, as well as access to a total transcript of the lecture. The students were provided access to an online training module, developed specifically for this study, to explain the use of this system.Enrolled Curtin students, both on-campus and online, Open Universities Australia (OUA) students studying through Curtin online, teaching staff, and disability officers were then invited to participate in a survey and interviews. The study sought to gain insights into students’ use of both recorded lectures and captioned video at the time of the survey, and their anticipated future usage of these services (see Kent et al.).A total of 50 students—of 539 enrolled across the different instances of the three units—completed the survey. In addition, five follow-up interviews with students, teaching staff, and disability support staff were conducted once the surveys had been completed. Staff interviewed included tutors and unit coordinators who taught and supervised units in which the lecture captions were provided. The interviews assessed the awareness, use, and perceived validity of the captions system in the context of both learning and teaching.ResultsA number of different questions were asked regarding students’ demographics, their engagement with online unit materials, including recorded lectures, their awareness of Echo360’s lecture captions, as well as its additional features, their perceived value of online captions for their studies, and the future significance of captions in a university context.Of the 50 participants in the survey, only six identified themselves as a person with a disability—almost 90 per cent did not identify as disabled. Additionally, 45 of the 50 participants identified English as their primary language. Only one student identified as a person with both a disability and coming from a NESB.Engagement with Online Unit Materials and Recorded LecturesThe survey results provide insight into the ways in which participants interact with the Echo360 lecture system. Over 90 per cent of students had accessed the recorded lectures via the Echo360 system. While this might not seem notable at first, given such materials are essential elements of the units surveyed, the level of repeated engagement seen in these results is important because it indicates the extent to which students are revising the same material multiple times—a practice that captions are designed to facilitate and assist. For instance, one lecture was recorded per week for each unit surveyed, and most respondents (70 per cent) were viewing these lectures at least once or twice a week, while 10 per cent were viewing the lectures multiple times a week. Over half of the students surveyed reported viewing the same lecture more than once. Out these participants, 19 (or 73 per cent) had viewed a lecture twice and 23 per cent had viewed it three times or more. This illustrates that frequent revision is taking place, as students watch the same lecture repeatedly to absorb and clarify its contents. This frequency of repeated engagement with recorded unit materials—lectures in particular—indicates that students were making online engagement and revision a key element of their learning process.Awareness of the Echo360 Lecture Captions and Additional FeaturesHowever, while students were highly engaged with both the online learning material and the recorded lectures, there was less awareness of the availability of the captioning system—only 34 per cent of students indicated they were aware of having access to captions. The survey also asked students whether or not they had used additional features of the Echo360 captioning system such as the search function and downloadable lecture transcripts. Survey results confirm that these features were being used; however, responses indicated that only a minority of students using the captions system used these features, with 28 per cent using the search function and 33 per cent making use of the transcripts. These results can be seen as an indication that additional features were useful for revision, albeit for the minority of students who used them. A Curtin disability advisor noted in their interview that:transcripts are particularly useful in addition to captions as they allow the user to quickly skim the material rather than sit through a whole lecture. Transcripts also allow translation into other languages, highlighting text and other features that make the content more accessible.Teaching staff were positive about these features and suggested that providing transcripts saved time for tutors who are often approached to provide these to individual students:I typically receive requests for lecture transcripts at the commencement of each study period. In SP3 [during this study] I did not receive any requests.I feel that lecture transcripts would be particularly useful as this is the most common request I receive from students, especially those with disabilities.I think transcripts and keyword searching would likely be useful to many students who access lectures through recordings (or who access recordings even after attending the lecture in person).However, the one student who was interviewed preferred the keyword search feature, although they expressed interest in transcripts as well:I used the captions keyword search. I think I would like to use the lecture transcript as well but I did not use that in this unit.In summary, while not all students made use of Echo360’s additional features for captions, those who did access them did so frequently, indicating that these are potentially useful learning tools.Value of CaptionsOf the students who were aware of the captions, 63 per cent found them useful for engaging with the lecture material. According to one of the students:[captions] made a big difference to me in terms on understanding and retaining what was said in the lectures. I am not sure that many students would realise this unless they actually used the captions…I found it much easier to follow what was being said in the recorded lectures and I also found that they helped stay focussed and not become distracted from the lecture.It is notable that the improvements described above do not involve assistance with hearing or language issues, but the extent to which captions improve a more general learning experience. This participant identified themselves as a native English speaker with no disabilities, yet the captions still made a “big difference” in their ability to follow, understand, focus on, and retain information drawn from the lectures.However, while over 60 per cent of students who used the captions reported they found them useful, it was difficult to get more detailed feedback on precisely how and why. Only 52.6 per cent reported actually using them when accessing the lectures, and a relatively small number reported taking advantage of the search and transcripts features available through the Echo360 system. Exactly how they were being used and what role they play in student learning is therefore an area to pursue in future research, as it will assist in breaking down the benefits of captions for all learners.Teaching staff also reported the difficulty in assessing the full value of captions—one teacher interviewed explained that the impact of captions was hard to monitor quantitatively during regular teaching:it is difficult enough to track who listens to lectures at all, let alone who might be using the captions, or have found these helpful. I would like to think that not only those with hearing impairments, but also ESL students and even people who find listening to and taking in the recording difficult for other reasons, might have benefitted.Some teaching staff, however, did note positive feedback from students:one student has given me positive feedback via comments on the [discussion board].one has reported that it helps with retention and with times when speech is soft or garbled. I suspect it helps mediate my accent and pitch!While 60 per cent claiming captions were useful is a solid majority, it is notable that some participants skipped this question. As discussed above, survey answers indicate that this was because these 37 students did not think they had access to captions in their units.Future SignificanceOverall, these results indicate that while captions can provide a benefit to students’ engagement with online lecture learning material, there is a need for more direct and ongoing information sharing to ensure both students and teaching staff are fully aware of captions and how to use them. Technical issues—such as the time delay in captions being uploaded—potentially dissuade students from using this facility, so improving the speed and reliability of this tool could increase the number of learners keen to use it. All staff interviewed agreed that implementing captions for all lectures would be beneficial for everyone:any technology that can assist in making lectures more accessible is useful, particularly in OUA [online] courses.it would be a good example of Universal Design as it would make the lecture content more accessible for students with disabilities as well as students with other equity needs.YES—it benefits all students. I personally find that I understand and my attention is held more by captioned content.it certainly makes my role easier as it allows effective access to recorded lectures. Captioning allows full access as every word is accessible as opposed to note taking which is not verbatim.DiscussionThe results of this research indicate that captions—and their additional features—available through the Echo360 captions system are an aid to student learning. However, there are significant challenges to be addressed to make students aware of these features and their potential benefits.This study has shown that in a cohort of primarily English speaking students without disabilities, over 60 per cent found captions a useful addition to recorded lectures. This suggests that the implementation of captions for all recorded lectures would have widespread benefits for all learners, not only those with hearing or language difficulties. However, at present, only “eligible” students who approach the disability office would be considered for this service, usually students who are D/deaf or hard of hearing. Yet it can be argued that these benefits—and challenges—could also extend to other groups that are might traditionally have been seen to benefit from the use of captions such as students with other disabilities or those from a NESB.However, again, a lack of awareness of the training module meant that this potential cohort did not benefit from this trial. In this study, none of the students who identified as having a disability or coming from a NESB indicated that they had access to the training module. Further, five of the six students with disabilities reported that they did not have access to the captions system and, similarly, only two of the five NESB students. Despite these low numbers, all the students who were part of these two groups and who did access the captions system did find it useful.It can therefore be seen that the main challenge for teaching staff is to ensure all students are aware of captions and can access them easily. One option for reducing the need for training or further instructions might be having captions always ON by default. This means students could incorporate them into their study experience without having to take direct action or, equally, could simply choose to switch them off.There are also a few potential teething issues with implementing captions universally that need to be noted, as staff expressed some concerns regarding how this might alter the teaching and learning experience. For example:because the captioning is once-off, it means I can’t re-record the lectures where there was a failure in technology as the new versions would not be captioned.a bit cautious about the transcript as there may be problems with students copying that content and also with not viewing the lectures thinking the transcripts are sufficient.Despite these concerns, the survey results and interviews support the previous findings showing that lecture captions have the potential to benefit all learners, enhancing each student’s existing capabilities. As one staff member put it:in the main I just feel [captions are] important for accessibility and equity in general. Why should people have to request captions? Recorded lecture content should be available to all students, in whatever way they find it most easy (or possible) to engage.Follow-up from students at the end of the study further supported this. As one student noted in an email at the start of 2017:hi all, in one of my units last semester we were lucky enough to have captions on the recorded lectures. They were immensely helpful for a number of reasons. I really hope they might become available to us in this unit.ConclusionsWhen this project set out to investigate the ways diverse groups of students could utilise captioned lectures if they were offered it as a mainstream learning tool rather than a feature only disabled students could request, existing research suggested that many accommodations designed to assist students with disabilities actually benefit the entire cohort. The results of the survey confirmed this was also the case for captioning.However, currently, lecture captions are typically utilised in Australian higher education settings—including Curtin—only as an assistive technology for students with disabilities, particularly students who are D/deaf or hard of hearing. In these circumstances, the student must undertake a lengthy process months in advance to ensure timely access to essential captioned material. Mainstreaming the provision of captions and transcripts for online lectures would greatly increase the accessibility of online learning—removing these barriers allows education providers to harness the broad potential of captioning technology. Indeed, ensuring that captions were available “by default” would benefit the educational outcomes and self-determination of the wide range of students who could benefit from this technology.Lecture captioning and transcription is increasingly cost-effective, given technological developments in speech-to-text or automatic speech recognition software, and the increasing re-use of content across different iterations of a unit in online higher education courses. At the same time, international trends in online education—not least the rapidly evolving interpretations of international legislation—provide new incentives for educational providers to begin addressing accessibility shortcomings by incorporating captions and transcripts into the basic materials of a course.Finally, an understanding of the diverse benefits of lecture captions and transcripts needs to be shared widely amongst higher education providers, researchers, teaching staff, and students to ensure the potential of this technology is accessed and used effectively. Understanding who can benefit from captions, and how they benefit, is a necessary step in encouraging greater use of such technology, and thereby enhancing students’ learning opportunities.AcknowledgementsThis research was funded by the Curtin University Teaching Excellence Development Fund. Natalie Latter and Kai-ti Kao provided vital research assistance. We also thank the students and staff who participated in the surveys and interviews.ReferencesAlty, J.L., A. Al-Sharrah, and N. Beacham. “When Humans Form Media and Media Form Humans: An Experimental Study Examining the Effects Different Digital Media Have on the Learning Outcomes of Students Who Have Different Learning Styles.” Interacting with Computers 18.5 (2006): 891–909.Beacham, N.A., and J.L. Alty. “An Investigation into the Effects That Digital Media Can Have on the Learning Outcomes of Individuals Who Have Dyslexia.” Computers & Education 47.1 (2006): 74–93.Borgaonkar, R. “Captioning for Classroom Lecture Videos.” University of Houston 2013. <https://uh-ir.tdl.org/uh-ir/handle/10657/517>.Evmenova, A. “Lights. Camera. Captions: The Effects of Picture and/or Word Captioning Adaptations, Alternative Narration, and Interactive Features on Video Comprehension by Students with Intellectual Disabilities.” Ph.D. thesis. Virginia: George Mason U, 2008.Evmenova, A., and M. Behrmann. “Enabling Access and Enhancing Comprehension of Video Content for Postsecondary Students with Intellectual Disability.” Education and Training in Autism and Developmental Disabilities 49.1 (2014): 45–59.Griffin, Emily. “Who Uses Closed Captions? Not Just the Deaf or Hard of Hearing.” 3PlayMedia Aug. 2015 <http://www.3playmedia.com/2015/08/28/who-uses-closed-captions-not-just-the-deaf-or-hard-of-hearing/>.Kent, Mike, Katie Ellis, Gwyneth Peaty, Natalie Latter, and Kathryn Locke. Mainstreaming Captions for Online Lectures in Higher Education in Australia: Alternative Approaches to Engaging with Video Content. Perth: National Centre for Student Equity in Higher Education (NCSEHE), Curtin U, 2017. <https://www.ncsehe.edu.au/publications/4074/?doing_wp_cron=1493183232.7519669532775878906250>.Knight, V., B.R. McKissick, and A. Saunders. “A Review of Technology-Based Interventions to Teach Academic Skills to Students with Autism Spectrum Disorder.” Journal of Autism and Developmental Disorders 43.11 (2013): 2628–2648. <https://doi.org/10.1007/s10803-013-1814-y>.Linder, Katie. Student Uses and Perceptions of Closed Captions and Transcripts: Results from a National Study. Corvallis, OR: Oregon State U Ecampus Research Unit, 2016.Lewis, D., and V. Brown. “Multimedia and ADHD Learners: Are Subtitles Beneficial or Detrimental?” Annual Meeting of the AECT International Convention, The Galt House, Louisville 2012. <http://www.aect.org/pdf/proceedings12/2012/12_17.pdf>.Maiorana-Basas, M., and C.M. Pagliaro. “Technology Use among Adults Who Are Deaf and Hard of Hearing: A National Survey.” Journal of Deaf Studies and Deaf Education 19.3 (2014): 400–410. <https://doi.org/10.1093/deafed/enu005>.Marschark, Marc, Greg Leigh, Patricia Sapere, Denis Burnham, Carol Convertino, Michael Stinson, Harry Knoors, Mathijs P. J. Vervloed, and William Noble. “Benefits of Sign Language Interpreting and Text Alternatives for Deaf Students’ Classroom Learning.” Journal of Deaf Studies and Deaf Education 11.4 (2006): 421–437. <https://doi.org/10.1093/deafed/enl013>.Montero Perez, M., E. Peters, G. Clarebout, and P. Desmet. “Effects of Captioning on Video Comprehension and Incidental Vocabulary Learning.” Language Learning & Technology 18.1 (2014): 118–141.Montero Perez, M., W. Van Den Noortgate, and P. Desmet. “Captioned Video for L2 Listening and Vocabulary Learning: A Meta-Analysis.” System 41.3 (2013): 720–739. <https://doi.org/10.1016/j.system.2013.07.013>.Pachman, M., and F. Ke. “Environmental Support Hypothesis in Designing Multimedia Training for Older Adults: Is Less Always More?” Computers & Education 58.1 (2012): 100–110. <https://doi.org/10.1016/j.compedu.2011.08.011>.Podszebka, Darcy, Candee Conklin, Mary Apple, and Amy Windus. “Comparison of Video and Text Narrative Presentations on Comprehension and Vocabulary Acquisition”. Paper presented at SUNY – Geneseo Annual Reading and Literacy Symposium. New York: Geneseo, May 1998. <https://dcmp.org/caai/nadh161.pdf>.Reagon, K.A., T.S. Higbee, and K. Endicott. “Using Video Instruction Procedures with and without Embedded Text to Teach Object Labeling to Preschoolers with Autism: A Preliminary Investigation.” Journal of Special Education Technology 22.1 (2007): 13–20.Schmidt, M.J., and M.L. Haydu. “The Older Hearing‐Impaired Adult in the Classroom: Real‐Time Closed Captioning as a Technological Alternative to the Oral Lecture.” Educational Gerontology 18.3 (1992): 273–276. <https://doi.org/10.1080/0360127920180308>.Stinson, M.S., L.B. Elliot, R.R. Kelly, and Y. Liu. “Deaf and Hard-of-Hearing Students’ Memory of Lectures with Speech-to-Text and Interpreting/Note Taking Services.” The Journal of Special Education 43.1 (2009): 52–64. <https://doi.org/10.1177/0022466907313453>.Worthington, Tom. “Are Australian Universities Required to Caption Lecture Videos?” Higher Education Whisperer 14 Feb. 2015. <http://blog.highereducationwhisperer.com/2015/02/are-australian-universities-required-to.html>.