To see the other types of publications on this topic, follow the link: Library of Momus.
Journal articles on the topic 'Library of Momus'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Library of Momus.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Mary Walters, Carolyn, and Elizabeth Ann Van Gordon. "Get it in writing: MOUs and library/IT partnerships." Reference Services Review 35, no. 3 (August 7, 2007): 388–94. http://dx.doi.org/10.1108/00907320710774265.
Full text
2
Knuth, Heidi. "BookBins: The “Waiting Room in a Box” of Outreach." Children and Libraries 15, no. 2 (June 15, 2017): 32. http://dx.doi.org/10.5860/cal.15n2.32.
Full textAbstract:
In fall 2015, the Bloomingdale (IL) Public Library was increasing community outreach at an incredible rate, Little Free Libraries were all the buzz, both in library circles and among community activists and beautifiers, and I happened to be in a cell phone store . . . watching a small child do everything in her three year old power to alleviate her boredom.She was running circles around the desk, pulling packaged accessories off displays, and patting at mom’s leg for attention . . . all to no avail. I eventually left the store without having my needs met—much like that little girl—and as I drove back to the library, a solution presented itself.
3
Raper, Diane. "40 Years On – Ensuring an Academic Law Library is Fit for Purpose." Legal Information Management 9, no. 3 (September 2009): 163–67. http://dx.doi.org/10.1017/s1472669609990260.
Full textAbstract:
AbstractThe Kent Law School at the University of Kent celebrated its 40thAnniversary in 2008 and Diane Raper, the current law librarian, reviews the changes that have taken place over the years in relation to user comment and feedback, and external drivers which have ensured the provision of a first-class library and information service for staff and students. She also considers the major changes in the modus operandi of the service over the last 40 years.
4
Arnsperger, Christian, and Emmanuel B. Picavet. "More than Modus Vivendi, less than Overlapping Consensus: towards a Political Theory of Social Compromise." Social Science Information 43, no. 2 (June 2004): 167–204. http://dx.doi.org/10.1177/0539018404042579.
Full textAbstract:
Political theory often relies on a definite vision of the lack of consensus,which does not necessarily exclude the possibility of some modus vivendi. It turns out however that a mere modus vivendi is widely felt to be insufficient to warrant political stability and a well-ordered society. Starting from distributive-justice issues and problems of ethical conflict in democratic society, it is argued that the middle ground between a mere modus vivendi and full-blown consensus has room for a useful concept of compromise which accounts for basic aspects of the dynamics of political arrangements.
5
Kelley, Heather, Quinn Galbraith, and Jessica Strong. "Working moms: Motherhood penalty or motherhood return?" Journal of Academic Librarianship 46, no. 1 (January 2020): 102075. http://dx.doi.org/10.1016/j.acalib.2019.102075.
Full text
6
González de Gómez, Maria Nélida. "Novos cenários políticos para a informação." Ciência da Informação 31, no. 1 (January 2002): 27–40. http://dx.doi.org/10.1590/s0100-19652002000100004.
Full textAbstract:
Poderíamos dizer que hoje, nos cenários mundiais, a economia do conhecimento é proposta, sem mais nem menos, como o novo conteúdo e referência da política da informação ou, em certa forma, da totalidade do político. Consideramos que contribui, para essa subversão de sentido, um terceiro termo, que para uns seria "infra-estrutura", e para outros, "sociedade da informação". Se o modus operandi dessa virada estratégica seria a transubstanciação do informacional e semiótico no econômico, através da mediação tecnológica e dos mercados, optamos por considerar as mudanças do papel do Estado - como modus cognoscendi dessas transformações, que afetam profundamente o que, até agora, denominara-se - em sentido restrito - "Política de informação". Nossa análise remiter-se-á à revisão do conceito "governança", adotando como apoio argumentativo o conceito de "regime de informação". A partir da consideração de alguns dos pressupostos da governança, indagaremos quais estruturas de informação poderiam sustentar os processos de formação, circulação e institucionalização do poder, em um horizonte democrático.
7
Hasan, Ariba, Pirzada Jamal Ahmed Siddiqui, Shabir Ali Amir, and Jean-Dominique Durand. "DNA Barcoding of Mullets (Family Mugilidae) from Pakistan Reveals Surprisingly High Number of Unknown Candidate Species." Diversity 13, no. 6 (May 26, 2021): 232. http://dx.doi.org/10.3390/d13060232.
Full textAbstract:
The mullets are a widespread group of ecologically and economically important fishes of disputed taxonomy due to their uniform external morphology. Barcoding and phylogenetic studies from various locations around the world largely highlighted the species diversity underestimation using morphological criteria used to establish the taxonomy of the family. Here, we investigated the mullet species diversity from Pakistan, a biogeographic area where nearly no mullet species were genetically characterized. Morphological examination of 40 mullets reveals 6 known species (Planiliza macrolepis, P. klunzingeri, P. subviridis, Crenimugil seheli, Ellochelon vaigiensis, and Mugil cephalus). Using a references DNA barcode library, the DNA barcode-based species identification flagged eight molecular operational taxonomic units (MOTUs) belonging to five genera (Crenimugil, Ellochelon, Mugil, Osteomugil, and Planiliza). Among these MOTUs, only one was already present in Barcode of Life Data system, all other representing new Barcode Index Numbers (BIN). These results emphasize the importance of the recognition of cryptic species and the necessity to re-evaluate the overall diversity by the genetic characterization of different species of this family. DNA barcoding is an effective tool to reveal cryptic species that need to be considered in conservation and management measures of fisheries in Pakistan.
8
Dahruddin, Hadi, Arni Sholihah, Tedjo Sukmono, Sopian Sauri, Ujang Nurhaman, Daisy Wowor, Dirk Steinke, and Nicolas Hubert. "Revisiting the Diversity of Barbonymus (Cypriniformes, Cyprinidae) in Sundaland Using DNA-Based Species Delimitation Methods." Diversity 13, no. 7 (June 23, 2021): 283. http://dx.doi.org/10.3390/d13070283.
Full textAbstract:
Biodiversity hotspots often suffer from a lack of taxonomic knowledge, particularly those in tropical regions. However, accurate taxonomic knowledge is needed to support sustainable management of biodiversity, especially when it is harvested for human sustenance. Sundaland, the biodiversity hotspot encompassing the islands of Java, Sumatra, Borneo, and Peninsular Malaysia, is one of those. With more than 900 species, its freshwater ichthyofauna includes a large number of medium- to large-size species, which are targeted by inland fisheries. Stock assessment requires accurate taxonomy; however, several species groups targeted by inland fisheries are still poorly known. One of those cases is the cyprinid genus Barbonymus. For this study, we assembled a consolidated DNA barcode reference library for Barbonymus spp. of Sundaland, consisting of mined sequences from BOLD, as well as newly generated sequences for hitherto under-sampled islands such as Borneo. A total of 173 sequences were analyzed using several DNA-based species delimitation methods. We unambiguously detected a total of 6 Molecular Operational Taxonomic Units (MOTUs) and were able to resolve several conflicting assignments to the species level. Furthermore, we clarified the identity of MOTUs occurring in Java.
9
Yao, Fei, Chengyu Zhang, and Wu Chen. "Smart talking robot Xiaotu: participatory library service based on artificial intelligence." Library Hi Tech 33, no. 2 (June 15, 2015): 245–60. http://dx.doi.org/10.1108/lht-02-2015-0010.
Full textAbstract:
Purpose – The purpose of this paper is to introduce a participatory library service based on artificial intelligence (AI). Design/methodology/approach – AI technologies and various technologies for facilitating the use of the currently existing libraries and the third-party resources are combined in the new mobile and social networking environments to provide an innovative real-time virtual reference service. Special aesthetic design and library marketing measures are adopted to expand the gains of the service. Questionnaire survey, in-depth interview, and statistical analysis are conducted to evaluate the effects of the service. Findings – A smart talking robot called Xiaotu (female) is developed. This robot is regarded as a promising new online reference service modus operandi. Four factors contribute to the success of the robot, namely, AI, self-learning, vivid logo and language, and modular architecture. Practical implications – Xiaotu presents a participatory library service, in which users participate in the resources collection and become content co-creators. Her presence at anytime and anywhere on any kind of terminal maximizes her potential for the delivery of virtual reference services. Xiaotu has the potential to be a general reference robot or a costumed institute robot. Originality/value – AI is adopted in libraries to form an innovative online reference service. The participatory library service is practiced through a high-featured interactive communication. The aesthetic design of Xiaotu and the related promotions are new in libraries as well.
10
Lubis, Nasrul Rizal. "Data elektronik; kejahatan duniamaya; perpustakaan digital." Jurnal Pari 6, no. 2 (February 10, 2021): 151. http://dx.doi.org/10.15578/jp.v6i2.9738.
Full textAbstract:
Perkembangan teknologi informasi saat ini semakin cepat berkembang. Perpustakaan digital dapat dibilang sebagai bentuk baru dalam pelayanan informasi untuk penguna perpustakaan, sehinga dalam bentuk pelayanan dapat dirambah oleh hal layak. Modus dan motif kian kompleks,dan tidak ada jaminan keamanan cyberspace, dan tidak ada sistem keamanan komputer yang mampu melindungi data yang ada yang dimiliki perpustakaan. Langkah yang baik untuk menghadapi hal tersebut adalah dengan memutakhirkan pengetahuan SDM perpustakaan digital, meng-update dan mengupgrade sistem keamanan komputer, dan kerjasama dengan dengan instansi terkait dalam menangani masalah cybercrime.The development of information technology is now growing rapidly. Digital libraries can be regarded as a new form of information services for library users, so that in the form of services can be encroached by decent things. The mode and motive are increasingly complex, and there is no guarantee of cyberspace security, and no computer security system is able to protect the existingdata the library has. A good way to deal with this is by updating the digital library’s human resource knowledge, updating and upgrading computer security systems, and cooperation with relevant agencies in handling cybercrime issues
11
Milhous, Judith, and Robert D. Hume. "The London Theatre Cartel of the 1720s: British Library Additional Charters 9306 and 9308." Theatre Survey 26, no. 1 (May 1985): 21–37. http://dx.doi.org/10.1017/s0040557400000302.
Full textAbstract:
One of the basic facts of eighteenth-century London theatre history is the disinclination of the managers of the patent theatres to engage in serious competition of any sort following the Licensing Act of 1737. This preference for peaceful coexistence was not, in fact, a new development: a strong inclination toward a modus vivendi can be proven as early as 1720. The evidence is a pair of almost entirely neglected manuscript charters (contracts) preserved in the British Library. In both instances we find the managers of the two theatres attempting to restrict actor transfers. The first contract (dating from September 1720) was apparently never formally concluded, but the second (dated April 1722) was duly signed and sealed, and evidently remained in effect until about 1730. Taken together, the two charters shed considerable light on the accommodation eventually reached between the two companies after the reestablishment of competition in 1714, and they also give us lists of performers in 1720 and 1722 that add significantly to the company rosters in The London Stage.
12
Hastri, Evi Dwi, and Rusfandi Rusfandi. "CONFLICT INTEREST YANG DISEBABKAN MORAL HAZARD DALAM PERUMUSAN KEBIJAKAN MORATORIUM PAILIT DAN PKPU." Jurnal Jendela Hukum 8, no. 2 (September 15, 2021): 64–74. http://dx.doi.org/10.24929/fh.v8i2.1579.
Full textAbstract:
Konsep moral hazard dikonotasikan sebagai perilaku ketidakjujuran seseorang yang dapat meningkatkan kemungkinan terjadinya kerugian. Kerugian yang dimaksud adalah tidak mampu melakukan kewajiban pembayaran utang terhadap beberapa kreditor yang telah cukup waktu untuk dibayarkan. Perilaku moral hazard ini dapat dijadikan sebagai modus untuk menyelesaiakan permasalahan utang terutama ditengah pandemi Covid-19. Masalah moral hazard merupakan bentuk penyimpangan. Sehingga dari kondisi yuridis inilah dapat diketemukan suatu permasalahan lain yakni ketika model atau cara moral hazard dalam konflik kepentingan (Conflict Interest) dijadikan sebagai modus untuk memanfaatkan adanya perumusan kebijakan moratorium pailit dan PKPU berdasarkan Undang – Undang Nomor 37 Tahun 2004 Tentang Kepailitan Dan Penundaan Kewajiban Pembayaran Utang. Metode penelitian hukum yang digunakan adalah yuridis normatif dengan pendekatan perundang – undangan (Statute Approach). Metode pengumpulan dan pengolahan bahan hukum menggunakan Library Research. Analisis bahan hukum yang dipergunakan yaitu deskriptif analitis. Perumusan kebijakan moraturium pailit dan PKPU bukan merupakan hal yang urgen untuk diberlakukan dalam bentuk Perppu. Apabila kebijakan ini diberlakukan maka secara yuridis otoritas legal untuk permohonan pengajuan pailit dan permohonan PKPU berada di tangan Pemerintah. Berdasarkan konsep Law As Tool Of Social Control, maka sudah sejatinya produk hukum yang dilahirkan tidak hanya ditujukan untuk keuntungan pihak yang berkepentingan. Melaikan dapat dijadikan anomali berperilaku yang tidak menyebabkan kerugian pihak lain.
13
Yu, Hsiao-Ming. "International Collaboration on Digitization of Rare Chinese Books at National Central Library: Models and Outcomes." International Journal of Humanities and Arts Computing 8, supplement (March 2014): 124–51. http://dx.doi.org/10.3366/ijhac.2014.0103.
Full textAbstract:
With a collection of unique and rare books and extensive experience in their digitization, National Central Library (NCL) has since 2001 established itself as a leader in this effort. As such the Asian Division of the Library of Congress (LC) invited NCL to collaborate on digitizing important rare Chinese books in its collection. NCL had previously established an objective to collect unique and valuable resources on Chinese studies from around the world, and thus engage in international projects to digitize collections of rare Chinese books. The collaboration with LC marked one of the first of NCL's digitization project. The project began in 2005 and ended in 2012, during which a total of 2,025 titles of rare books were digitized and made available on the internet. In 2010 and 2011, the University of Washington and the University of California Berkeley also signed an agreement with NCL to collaborate on additional rare Chinese books digitization projects. This paper outlines NCL's current modus operandi, cites successful examples, and delineates current fruitful outcomes and value-added applications. It is hoped that this may serve as useful information for others who are also seeking international collaboration projects for digital archives.
14
Pinto, Maria, Andrés Fernández-Ramos, and Anne-Vinciane Doucet. "Measuring Students’ Information Literacy Skills through Abstracting: Case Study from a Library & Information Science Perspective." College & Research Libraries 69, no. 2 (March 1, 2008): 132–54. http://dx.doi.org/10.5860/crl.69.2.132.
Full textAbstract:
New education models based essentially on competencies and skills are gradually displacing the old systems based on teacher instruction and passive and memory-based learning in students, as these new competencies allow the student to learn actively with better levels of performance. We consider abstracting as a transcendent learning tool to analyze the basic role of information analysis and synthesis skills within the learning processes and their relation to the abstracting processes. Using an action-research methodology, we analyze the abstracting skill of students on the first and final courses of the Faculty of Library and Information Science at the University of Granada (Spain). Based on postulates from information literacy, analysis and synthesis competencies are studied through the students' modus operandi at the different abstracting stages. Similarities and differences between the two groups of students are perceived and displayed, with reference to the relation between the learned subjects and the levels of competence and skill. In the light of these results, meaningful patterns and recommendations for improving students' skill levels are proposed.
15
Jorgensen, Anna, and Arianna Lechan. "Not Your Mom's Graphic Novels: Giving Girls a Choice Beyond Wonder Woman." Technical Services Quarterly 30, no. 3 (July 2013): 266–84. http://dx.doi.org/10.1080/07317131.2013.785779.
Full text
16
Versteegh, Kees. "Maarten Mous. 2003. The Making of a mixed Language: The case of Ma’a/Mbugu [Creole Language Library 26]." Studies in Language 31, no. 4 (August 14, 2007): 891–900. http://dx.doi.org/10.1075/sl.31.4.10ver.
Full text
17
Sagita, Afrianto. "Pembalikan Beban Pembuktian Sebagai Kebijakan Hukum Pidana Dalam Undang-Undang Tindak Pidana Korupsi." Jurnal Hukum Respublica 17, no. 1 (November 11, 2017): 21–43. http://dx.doi.org/10.31849/respublica.v17i1.1449.
Full textAbstract:
Tujuan penelitian ini untuk menjelaskan urgensi pembalikan beban pembuktian sebagai kebijakan hukum pidana dalam undang-undang tindak pidana korupsi serta menjelaskan pengaturan pembalikan beban pembuktian sebagai upaya mendukung penanggulangan korupsi? Metode penelitian menggunakan metode penelitian yuridis normatif, bersumber dari penelitian kepustakaan atau Library research. Hasil penelitian ini dapat dijelaskan aturan-aturan hukum dalam rangka pemberantasan korupsi pun seharusnya selalu dikembangkan secara progresif sesuai perkembangan zaman, agar tidak ketinggalan dan kalah dengan modus-modus korupsi yang semakin mutakhir. Perlu adanya suatu formula baik dari perspektif teoritis, yuridis, filosofis dan praktik, mengenai bagaimana pembalikan beban pembuktian ini dapat diterapkan, baik ditataran kebijakan legislasi maupun aplikasi. Pembalikan beban pembuktian keseimbangan kemungkinan (balanced probability of principles), dapat dijadikan muatan utama perubahan Undang-Undang Pemberantasan Tindak Pidana Korupsi di Indonesia. Simpulan, pertama urgensi penerapan pembalikan beban menjadi sangat urgen untuk diterapkan dalam rangka mengungkap kebenaran menyangkut harta-harta terdakwa kasus korupsi yang patut diduga diperoleh dari hasil korupsi yang merugikan keuangan negara. Kedua, pengaturan mengenai pembalikan beban pembuktian dalam Undang-Undang Pemberantasan Tindak Pidana Korupsi telah mampu mendukung upaya penanggulangan korupsi di negeri ini, hanya saja masih terdapat kelemahan. Kelemahan tersebut mengenai pengaturan pembalikan beban pembuktian dalam Undang-Undang Pemberantasan Tindak Pidana Korupsi yang bersifat terbatas atau berimbang, dalam hal ini terdakwa juga dibebankan melakukan pembuktian mengenai unsur-unsur kesalahan (schuld) dari terdakwa.
18
Andrade, Sonia Cruz-Riascos de. "Processo de inclusão digital em rede empresarial do segmento de suprimentos industriais: utilização de tecnologias de informação e comunicação." Ciência da Informação 35, no. 1 (April 2006): 7–15. http://dx.doi.org/10.1590/s0100-19652006000100001.
Full textAbstract:
Apresenta resultados de estudo realizado com 17 empresas de representação comercial do segmento de suprimentos industriais de produtos técnicos de borracha. Foram aplicados questionários e os resultados delinearam o modus operandi das empresas quanto à gestão da informação considerando infra-estrutura tecnológica e utilização de tecnologias de informação e comunicação. Aborda questões como gestão da informação para a tomada de decisão, redes de informação em pequenas e médias empresas, gestão do conhecimento e educação corporativa. Finaliza com ferramentas tecnológicas que apóiam o ensino-aprendizagem e sugere a inclusão empresarial como alternativa de capacitação para o desenvolvimento e promoção da cidadania na nova sociedade da informação e do conhecimento.
19
Haselwanter, Thomas. "“e-Infrastructures Austria Plus”. Kurzfassung des Abschlussberichts über das HRSM-Projekt für das Schaffen, Ansiedeln und Vernetzen von Infrastruktur zum Erstellen und Verwalten von Projektanträgen und Forschungsdaten." Mitteilungen der Vereinigung Österreichischer Bibliothekarinnen und Bibliothekare 73, no. 1 (April 13, 2020): 71–117. http://dx.doi.org/10.31263/voebm.v73i1.3373.
Full textAbstract:
In den „Orientations towards the first Strategic Plan for Horizon Europe“, dem Stategiepapier der EU-Kommission zum 9. EU-Forschungsrahmenprogramm findet sich zur Bedeutung von Open Science der folgende Satz: „Open science practices will be mainstreamed as the new modus operandi for EU research and innovation.“ Open Science wird die Vorgabe, wie Forschung zukünftig mit Hilfe von digitalen Werkzeugen und Netzwerken getätigt werden soll. Die EU-Kommission ist hier zwar Vorreiter, lokale Fördergeber folgen dem Beispiel allerdings bereits. Für Forschungseinrichtungen bedeutet dies, dass die institutionelle Forschungsinfrastruktur weiterentwickelt werden muss um diesen Vorgaben zu genügen. Im Projekt „e-Infrastructures Austria Plus“ wurden in sieben Arbeitspaketen damit begonnen Know-How und technische Infrastrukturen aufzubauen, die dafür benötigt werden.
20
BAKEWELL, KEN, John A. Vickers, and Geraldine Beare. "Symposium: How indexers operate." Indexer: The International Journal of Indexing: Volume 17, Issue 4 17, no. 4 (October 1, 1991): 280–83. http://dx.doi.org/10.3828/indexer.1991.17.4.15.
Full textAbstract:
The Indexer of October 1979 included a symposium of indexers’ various working methods, ‘Indexers at work’ (11 (4), 213-19). In the intervening twelve years, new information technology has made great difference to the working methods of many, and it seems appropriate now to repeat such a symposium. Several members of the Society of Indexers describe below their modus operandi.
21
Sousa, Fernanda Santos de Oliveira, Paulo Nadanovsky, Izabel Monteiro Dhyppolito, and Ana Paula Pires dos Santos. "Um ano de e-mails não solicitados: o modus operandi de revistas e editoras predatórias." Revista da Faculdade de Odontologia de Porto Alegre 62, no. 1 (August 9, 2021): 71–81. http://dx.doi.org/10.22456/2177-0018.114115.
Full textAbstract:
Objectives: To quantify, characterize and analyze e-mail from predatory journals (PJ) received by an academic in dentistry. Materials and methods: E-mails received in 2019 and suspected of being potentially predatory were pre-selected. The Ottawa Hospital Research Institute (OHRI) checklist was applied to identify the suspected biomedical PJ, including the following criteria: article processing charge (APC), fake impact factor, the journal being listed in the Directory of Open Access Journals (DOAJ) and the Committee on Publication Ethics (COPE). We also extracted information on the lack of an impact factor on Journal Citations Reports, non-journal affiliated contact e-mail address, flattering language, article and/or personal citation, unsubscribe link, being listed in the National Library of Medicine (NLM) current catalog and indexed on Medline. Results: A total of 2,812 unsolicited suspected e-mails were received, and 1,837 requested some sort of manuscript; among these, 1,751 met some of the OHRI criteria. Less than half (780/1,837, 42%) referred to some area of dentistry. The median APC was US$399. A false impact factor was mentioned in 11% (201/1,837) of the e-mails, and 27% (504/1,837) corresponded to journals currently listed in the NLM catalog. Journals listed in DOAJ and COPE sent 89 e-mails. Conclusions: The email campaign from PJ was high and recurrent. Researchers should be well informed about PJ’ modus operandi to protect their own reputation as authors and that of science.
22
Rajab, H. "MODUS OPERANDI KORUPSI DAN KAITANNYA DENGAN APARATUR NEGARA DALAM HADIS-HADIS NABI DAN PERUNDANG-UNDANGAN DI INDONESIA." AL QUDS : Jurnal Studi Alquran dan Hadis 5, no. 1 (April 25, 2021): 99. http://dx.doi.org/10.29240/alquds.v5i1.1936.
Full textAbstract:
The Modus Operandi of Corruption and its Relation to the State Apparatus in the Prophet's Hadiths and Legislation in IndonesiaThis paper aims to explain the modes of corruption and their relation to the state apparatus in the Prophet's traditions and legislation in Indonesia. So far, when many people talk about corruption, their memory is only of the laws that govern it, as if only the laws and regulations regulate corruption. In fact, long before the legislation was made, the Prophet, through his hadiths, have provided clues about corruption. This research is qualitative descriptive using a literature study that relies on library sources in the form of classic books, books, scientific journals, and other literature sources that are considered relevant. This study finds similarities between the Prophet's hadiths and Indonesian legislation in linking corruption (al-gulūl) to the state apparatus ('āmil) and that the modes of corruption are budget fraud, abuse of authority, embezzlement, and gratification and bribe. The mode then increases and develops with the times. Hopefully, through this writing, there will be awareness again that involvement in corruption is not only a violation of laws but also a violation of religious teachings and its legal consequences not only in the world but also in the hereafter.
23
Wang, X. B., J. Deng, J. T. Zhang, Q. S. Zhou, Y. Z. Zhang, and S. A. Wu. "DNA barcoding of common soft scales (Hemiptera: Coccoidea: Coccidae) in China." Bulletin of Entomological Research 105, no. 5 (May 20, 2015): 545–54. http://dx.doi.org/10.1017/s0007485315000413.
Full textAbstract:
AbstractThe soft scales (Hemiptera: Coccoidea: Coccidae) are a group of sap-sucking plant parasites, many of which are notorious agricultural pests. The quarantine and economic importance of soft scales necessitates rapid and reliable identification of these taxa. Nucleotide sequences of the mitochondrial cytochrome c oxidase subunit I (COI) gene (barcoding region) and 28S rDNA were generated from 340 individuals of 36 common soft scales in China. Distance-based [(best match, Automated Barcode Gap Discovery (ABGD)], tree-based (neighbor-joining, Bayesian inference), Klee diagrams, and general mixed Yule coalescent (GMYC) models were used to evaluate barcoding success rates in the data set. Best match showed that COI and 28S sequences could provide 100 and 95.52% correct identification, respectively. The average interspecific divergences were 19.81% for COI data and 20.38% for 28S data, and mean intraspecific divergences were 0.56 and 0.07%, respectively. For COI data, multiple methods (ABGD, Klee, and tree-based methods) resulted in general congruence with morphological identifications. However, GMYC analysis tended to provide more molecular operational taxonomic units (MOTUs). Twelve MOTUs derived from five morphospecies (Rhodococcus sariuoni, Pulvinaria vitis, Pulvinaria aurantii, Parasaissetia nigra, and Ceroplastes rubens) were observed using the GMYC approach. In addition, tree-based methods showed that 28S sequences could be used for species-level identification (except for Ceroplastes ceriferus – Ceroplastes pseudoceriferus), even with low genetic variation (<1%). This report demonstrates the robustness of DNA barcoding for species discrimination of soft scales with two molecular markers (COI and 28S) and provides a reliable barcode library and rapid diagnostic tool for common soft scales in China.
24
Abreu, Joel Gomes de, and Silvana Drumond Monteiro. "Matrizes da linguagem e a organização virtual do conhecimento." Ciência da Informação 39, no. 2 (August 2010): 9–26. http://dx.doi.org/10.1590/s0100-19652010000200001.
Full textAbstract:
Os signos e as linguagens foram investigados para a organização virtual do conhecimento por meio dos mecanismos de busca. Fundamentou-se na teoria das matrizes da linguagem-pensamento, postuladas por Santaella (2005), na qual se perscrutou as linguagens sonora, visual e verbal. O objetivo da investigação foi estabelecer uma categorização dos mecanismos de busca a partir da correspondência dessas matrizes da linguagem com a indexação virtual e o modus análogo de busca. Os resultados da investigação indicam ser adequada a categorização dos mecanismos de busca sob o critério dos paradigmas semiótico da linguagem em três matrizes, dado o seu modo de ser e sua operacionalidade, sendo eles baseados em conteúdos sonoros, visuais e verbais. Sinteticamente, a sintaxe é a representação do sonoro, a forma é a representação do visível e o discurso é a representação do conhecimento verbal.
25
Nadhifah, Khusnun. "KEBUTUHAN BELAJAR TENAGA PENGELOLA PERPUSTAKAAN DI UPT PERPUSTAKAAN UNIVERSITAS JEMBER." Jurnal Pustaka Ilmiah 5, no. 2 (March 19, 2020): 908. http://dx.doi.org/10.20961/jpi.v5i2.37607.
Full textAbstract:
The learning needs of library management personnel at UPT Library of Jember University is a description of the level of concern and responsibility that become indicators of professionalism in work. Readers need a fast and accurate information service with respect to course materials, research, publications, journals, and more. Library as well as a container of various disciplines that also support science or as a means of educating the life of the nation especially in the field of education. It takes a study that can describe the level of learning needs of library managers. This study aims to identify the learning needs of library management personnel at UPT Library of Jember University.<p>The research method uses descriptive design because it wants to describe the level of learning needs of the library management personnel. The population in this research is the entire library management staff at UPT Jember University Library obtained by total sampling or census technique. Using a closed questionnaire research instrument of 20 questions that describe the needs of the information of the reader.</p><p>The result of the research has been done, it is known that the learning needs of library management staff in UPT Library of Jember University are in the category of Specialties, Very Good and Good as many as 30 personnels (69,76%). Learning Needs Good Enough, Enough, Less and Very Less as many as 13 personnels (30.24%). The maximal, minimum, median, mode, mean and standard deviation values are as follows: 95, 45, 50, 80, 74.77 and 13.68</p><p>Motivation and guidance to improve the learning needs of library management personnel need to be done with various learning strategies, especially on the learning needs group Good Enough, Enough, Less and Very Less.</p><p> </p><p>Kebutuhan belajar tenaga pengelola perpustakaan di UPT Perpustakaan Universitas Jember merupakan gambaran tingkat kepedulian dan tanggung jawab yang menjadi indikator profesionalisme dalam bekerja. Pemustaka membutuhkan layanan informasi yang cepat dan tepat berkenaan dengan materi kuliah, penelitian, publikasi, jurnal, dan lain-lain. Perpustakaan sekaligus sebagai wadah dari berbagai disiplin ilmu pengetahuan yang juga menunjang atau sebagai sarana dalam mencerdaskan kehidupan bangsa khususnya di bidang pendidikan Dibutuhkan suatu penelitian yang dapat menggambarkan tingkat kebutuhan belajar tenaga pengelola perpustakaan. Penelitian ini bertujuan mengidentifikasi kebutuhan belajar tenaga pengelola perpustakaan di UPT Perpustakaan Universitas Jember.</p><p>Metode penelitian menggunakan desain deskriptif karena ingin menggambarkan tingkat kebutuhan belajar tenaga pengelola perpustakaan. Populasi dalam penelitian ini adalah seluruh tenaga pengelola perpustakaan di UPT Perpustakaan Universitas Jember yang didapat dengan teknik total sampling atau sensus. Menggunakan instrumen penelitian berbentuk kuesioner tertutup sejumlah 20 pernyataan yang menggambarkan kebutuhan informasi pemustaka.</p><p>Hasil penelitian yang telah dilakukan, diketahui bahwa kebutuhan belajar tenaga pengelola perpustakaan di UPT Perpustakaan Universitas Jember berada dalam kategori Istimewa, Sangat baik dan Baik sebanyak 30 orang (69,76%). Kebutuhan belajar Cukup Baik, Cukup, Kurang dan Sangat Kurang sebanyak 13 orang (30,24%). Nilai maximal, minimal, median, modus, mean dan standar deviasi adalah sebagai berikut 95, 45, 50, 80, 74.77 dan 13.68</p><p>Motivasi dan pembinaan untuk meningkatkan kebutuhan belajar tenaga pengelola perpustakaan perlu dilakukan dengan berbagai strategi pembelajaran terutama pada kelompok kebutuhan belajar Cukup Baik, Cukup, Kurang dan Sangat Kurang.</p>
26
Wang, G. F., K. Praphat, G. L. Xie, B. Zhu, B. Li, B. Liu, and Q. Zhou. "Bacterial Wilt of Mulberry (Morus alba) Caused by Enterobacter cloacae in China." Plant Disease 92, no. 3 (March 2008): 483. http://dx.doi.org/10.1094/pdis-92-3-0483b.
Full textAbstract:
In August of 2006, a new bacterial disease was noted in Hangzhou mulberry orchards of Zhejiang Province, China where bacterial wilt of mulberry caused by Ralstonia solanacearum was previously reported (3). In the summer, the disease caused severe wilt, especially on 1- or 2-year-old mulberry plants, that resulted in premature plant death. Leaf wilt symptoms generally started on older leaves at the bottom of the plant and spread to the younger leaves. The leaves of infected plants became withered and dry, turned dark brown, and eventually the plants became defoliated. The root xylem of infected plants was moist and discolored with brown stripes. The phloem was asymptomatic, however, in severe infections, the phloem was decayed. The observation of wilting proceeding from the bottom of the plant to the top distinguishes this disease from bacterial wilt caused by R. solanacearum. Five bacterial strains isolated from infected mulberry plants showed characteristics similar to those of the standard reference strain of Enterobacter cloacae subsp. cloacae IBJ0611from China, but differed from R. solanacearum IBJ35, E. cancerogenus LMG2693T, and E. cloacae subsp. dissolvens LMG2683T from the University of Gent, Belgium in phenotypic tests, including the Biolog Identification System version 4.2 (Biolog Inc., Hayward CA), pathogenicity tests, transmission electron microscopy (TEM,KYKY-1000B, Japan) observation, and gas chromatographic analysis of fatty acid methyl esters (FAMEs) using the Microbial Identification System (MIDI Company, Newark, DE) with the aerobic bacterial library (TABA50). Isolates were gram negative, facultative anaerobic, rod shaped, 0.3 to 1.0 × 1.0 to 3.0 μm with peritrichous flagella. Colonies on nutrient agar were light yellow, smooth, circular, entire, and convex with no green fluorescent diffusible pigment on King's medium B (3). Weak hypersensitive reaction was observed on tobacco 3 days after inoculation. All five strains were identified as E. cloacae with Biolog similarity of 0.662 to 0.863 and FAMEs similarity of 0.632 to 0.701. Inoculation of 10 6-month-old intact mulberry plants of cv Husang with cell suspensions containing 109 CFU/ml by pinprick at the base of the stem reproduced symptoms observed in natural infections. No symptoms were noted on the two control plants inoculated by the same method but with sterilized distilled water. The bacterium was reisolated from the symptomatic mulberry plants. E. cloacae has been reported from the United States as the cause of internal yellowing of papaya fruits (1) and rhizome rot of edible ginger (2). To our knowledge, this is the first report of mulberry wilt caused by E. cloacae in China. References: (1) K. Nishijima et al. Plant Dis. 71:1029, 1987. (2) K. Nishijima et al. Plant Dis. 88:1318, 2004. (3) L. Xu et al. Acta Phytophylacica. Sin. 34:141, 2007.
27
Wibowo, Arif, Nicolas Hubert, Hadi Dahruddin, Dirk Steinke, Rezki Antoni Suhaimi, Samuel, Dwi Atminarso, et al. "Assessing Temporal Patterns and Species Composition of Glass Eel (Anguilla spp.) Cohorts in Sumatra and Java Using DNA Barcodes." Diversity 13, no. 5 (April 29, 2021): 193. http://dx.doi.org/10.3390/d13050193.
Full textAbstract:
Anguillid eels are widely acknowledged for their ecological and socio-economic value in many countries. Yet, knowledge regarding their biodiversity, distribution and abundance remains superficial—particularly in tropical countries such as Indonesia, where demand for anguillid eels is steadily increasing along with the threat imposed by river infrastructure developments. We investigated the diversity of anguillid eels on the western Indonesian islands of Sumatra and Java using automated molecular classification and genetic species delimitation methods to explore temporal patterns of glass eel cohorts entering inland waters. A total of 278 glass eels were collected from monthly samplings along the west coast of Sumatra and the south coast of Java between March 2017 and February 2018. An automated, DNA-based glass eel identification was performed using a DNA barcode reference library consisting of 64 newly generated DNA barcodes and 117 DNA barcodes retrieved from BOLD for all nine Anguilla species known to occur in Indonesia. Species delimitation methods converged in delineating eight Molecular Operational Taxonomic Units (MOTUs), with A. nebolusa and A. bengalensis being undistinguishable by DNA barcodes. A total of four MOTUs were detected within the glass eel samples, corresponding to Anguilla bicolor, A. interioris, A. marmorata, and A. nebulosa/A. bengalensis. Monthly captures indicated that glass eel recruitment peaks in June, during the onset of the dry season, and that A. bicolor is the most prevalent species. Comparing indices of mitochondrial genetic diversity between yellow/silver eels, originating from several sites across the species range distribution, and glass eels, collected in West Sumatra and Java, indicated a marked difference. Glass eels displayed a much lower diversity than yellow/silver eels. Implications for the management of glass eel fisheries and species conservation are discussed.
28
Gunawan, Dheri. "PERTANGGUNGJAWABAN PELAKU TINDAK PIDANA PENGGELAPAN TERHADAP KENDARAAN RODA EMPAT DENGAN MODUS SEWA RENTAL (STUDI PUTUSAN NO 69/PID.B/2020/PN.BBU)." IBLAM LAW REVIEW 1, no. 2 (June 30, 2021): 30–44. http://dx.doi.org/10.52249/ilr.v1i2.24.
Full textAbstract:
The convenience provided by rental car owners is often abused by irresponsible tenants, car damage due to improper use, used as a means of committing crimes even to embezzlement of the car by way of selling or being pawned is a risk that can befall the car owner at any time. rental. As was the case with Effendi Bin Bunyamin, a resident of Palm Raya village, Indralaya Subdistrict, Ogan Ilir Regency, South Sumatra Province, who committed embezzlement of a four-wheeled vehicle belonging to Muhammad Sholeh using rental rental mode. The research method used in this thesis research is a normative juridical approach and an empirical approach. Data collection based on library research and field studies. Resource persons in this study include investigators, public prosecutors, and judges. The factor that caused the defendant to embezzle four-wheeled vehicles was due to economic factors. Where the defendant needed an amount of money to be used for the cost of marrying his child so that this situation forced the victim to commit the crime of embezzlement as in decision no 69 / Pid.B / 2020 / Pn.Bbu. Criminal responsibility for the defendant, namely that the defendant was secured by members of the Way Kanan resort police, was then detained during the investigation and trial process and then sentenced to prison for one year and five months as stated in decision number 69 / Pid.B / 2020 / Pn.Bbu.
29
Mancinelli, Matteo. "“Non potest auctoritatem habere sermo qui non iuvatur exemplo”. Las fuentes del Examen del Antídoto de Francisco Fernández de Córdoba, abad de Rute." Creneida. Anuario de Literaturas Hispánicas 6 (December 30, 2018): 366–401. http://dx.doi.org/10.21071/calh.v6i.11552.
Full textAbstract:
El presente artículo pasa revista a las fuentes del Examen del Antídoto o Apología por las Soledades de don Luis de Góngora contra el autor del Antídoto (1617), defensa erudita de las silvas del racionero compuesta por Francisco Fernández de Córdoba, al objeto de responder a los ataques del Antídoto contra la pestilente poesía de las Soledades (1615) de Juan de Jáuregui. Con el propósito de reconstruir la biblioteca del abad de Rute, identificando –siempre que resulte posible– las ediciones cotejadas por el mismo clérigo, presentaré primero su modus operandi y, para mantener cierto orden, dividiré el acervo librario del que se valió para la redacción del Examen en dos secciones principales, que reúnen, respectivamente, textos de la tradición grecolatina y obras de clásicos modernos.
30
Gilbert, Catherine. "Point, Click and Save: Mashup Mom’s Guide to Saving and Making Money Online.By Rachel Singer Gordon. Medford, NJ: Information Today/CyberAge Books, 2010. 288 pp. US$19.95 soft cover ISBN 0780910965866." Australian Library Journal 60, no. 3 (August 2011): 267–68. http://dx.doi.org/10.1080/00049670.2011.10722633.
Full text
31
Jordan, Catherine M., Patricia A. Lee, Ruth Olkon, and Phyllis L. Pirie. "Messages From Moms: Barriers to and Facilitators of Behavior Change in a Lead Poisoning Preventive Education Project." Journal of Health Communication 12, no. 8 (November 13, 2007): 771–86. http://dx.doi.org/10.1080/10810730701672520.
Full text
32
Handayani, Khilda, and Bismar Parlindungan Siregar. "TINJAUAN TERHADAP PERTANGGUNGJAWABAN SEORANG TERDAKWA PENGEDAR SEDIAAN FARMASI (Studi Putusan Mahkamah Agung NO. 39 K/PID.SUS/2010)." Jurnal Ilmiah METADATA 2, no. 1 (August 13, 2020): 22–43. http://dx.doi.org/10.47652/metadata.v2i1.19.
Full textAbstract:
Perkembangan teknologi dibidang Sediaan Farmasi memunculkan dampak positif dan negatif terhadap kesehatan masyarakat. Dampak positifnya adalah tingkat kesehatan masyarakat menjadi lebih baik, karena Sediaan Farmasi yang dihasilkan saat ini terbukti telah memberikan kontribusi yang signifikan pada dunia kesehatan. Sedangkan dampak negatif yang dirasakan masyarakat terhadap kemajuan teknologi ini adalah banyaknya pemalsuan Sediaan Farmasi maupun penyalahgunaan Sediaan Farmasi sehingga menghasilkan Sediaan Farmasi yang tidak layak edar dan dapat mengganggu kesehatan. Dalam penulisan penelitian ini penulis menggunakan metode telaah pustaka (library research) untuk mentelaah data-data sekunder dan penelitian lapangan (field research) yaitu dengan melakukan wawancara dengan Hakim Pengadilan Negeri Klas I A Medan. Modus operandi tindak pidana mengedarkan sediaan farmasi tanpa izin edar biasanya dilakukan dengan mencampurkan obat-obatan yang dijual dengan zat-zat kimia yang berbahaya bagi kesehatan masyarakat dengan tujuan untuk memperoleh keuntungan bagi pelaku atau produsen obat. Latar belakang tindak pidana mengedarkan sediaan farmasi tanpa izin edar disebabkan oleh berbagai faktor seperti faktor kurangnya pendidikan agama, faktor keluarga, faktor lingkungan dan juga disebabkan karena faktor desan kebutuhan ekonomi sehingga seseorang melakukan kejahatan mengedarkan sediaan farmasi tanpa izin edar yang disertai. Berdasarkan permasalahan yang dikemukakan, maka ditarik kesimpulan bahwa usaha-usaha yang dilakukan untuk menanggulangi kejahatan mengedarkan sediaan farmasi tanpa izin edar adalah: Penjatuhan hukuman yang berat atas perkara mengedarkan sediaan farmasi tanpa izin edar. Serta peran serta masyarakat sangat diharapkan dalam mengatasi masalah kejahatan mengedarkan sediaan farmasi tanpa izin edar dengan memberikan informasi kepada masyarakat jika menemukan peredaran obat-obatan tanpa izin edar dari pihak yang berwenang.
33
Wahyuni, Indah Suasani, Irna Sufiawati, Wipawee Nittayananta, Irma Melyani Puspitasari, and Jutti Levita. "Efficacy and safety of plant-based therapy on recurrent aphthous stomatitis and oral mucositis in the past decade: a systematic review." Journal of Herbmed Pharmacology 10, no. 2 (January 5, 2021): 179–87. http://dx.doi.org/10.34172/jhp.2021.19.
Full textAbstract:
Oral mucosal inflammation is one of the oral diseases causing pain and reducing the quality of human life. The types of oral mucosal inflammation that commonly found were recurrent aphthous stomatitis (RAS) and oral mucositis (OM). Anti-inflammatory drugs, both synthetic and plant-based, have been used to treat RAS and OM. Plant-based drugs have been attracted the attention of some researchers to minimize the side effects of synthetic drugs. However, a comprehensive review addressing the use of plant-based drugs for RAS and OM therapy, including drug formulation and species of plant, has not yet been reported. Here, we reported the article review of 9 publications derived from the databases of PubMed, ScienceDirect, Cochrane Library, and other additional relevant works, in order to find the effectiveness and safety of plant-based drugs for RAS and OM therapy. This review was written by following the PRISMA guidelines, and the risk of bias of the articles was evaluated using the Oxford Quality Scoring System. It was found that the effective and safe drugs for RAS therapy contained acemannan from Aloe vera and curcumin from Curcuma longa, both in an oral gel formulation. For OM therapy, drugs contained curcumin from Curcuma longa; licorice from Glycyrrhiza glabra; Aloe vera and black mulberry from Morus nigra, in soft tablet, mouthwash solution or mucoadhesive film formulation. In conclusion, the most effective and safest plant-based therapy for RAS is Acemannan 0.5% in oral gel, whereas for OM is Licorice root extract 0.18 mg in mucoadhesive film.
34
Bell, Jill A., Farrah Anne Pompilus, Alissa Rams, Yanyan Zhu, Anna Ciesluk, Rafael Bejar, Robert J. Fram, Douglas V. Faller, and Patrick Marquis. "Patient-Centered Evaluation of Clinical Benefit in Acute Myeloid Leukemia: Importance of Early Engagement with Patients." Blood 134, Supplement_1 (November 13, 2019): 5898. http://dx.doi.org/10.1182/blood-2019-128517.
Full textAbstract:
INTRODUCTION Acute myeloid leukemia (AML), the most common form of acute leukemia among adults, is characterized by proliferation of immature myeloid cells in the peripheral blood, bone marrow, and/or other tissues, resulting in cytopenias. Clinical features such as anemia cause fatigue and dyspnea, which may negatively impact health-related quality of life, emphasizing the need for patient-centered outcomes to evaluate new therapies. Patients are uniquely positioned to inform the understanding of the therapeutic context for clinical development and provide additional information not captured by traditional clinical measures. Understanding the AML patient experience is essential for selecting relevant patient-reported outcome (PRO) measures. The purpose of this research was to incorporate the patient voice and generate an evidence base for selecting PRO endpoints for assessing clinical benefit. METHODS A cross-sectional, qualitative study was implemented among AML patients identified through clinical recruitment agencies and a patient advocacy organization. A targeted literature review (PubMed, Jan '00-Feb '19) and expert clinician consultation were conducted to explore the clinical perspective on treatment and observed patient experience. Following approval from an independent review board, qualitative concept-elicitation interviews were conducted with AML patients using a semi-structured interview guide. Patients completed the European Organisation for Research and Treatment of Cancer (EORTC) Quality of Life Questionnaire-Core 30 (QLQ-C30) and items from the EORTC item library; items were selected based on previous research in patients with myelodysplastic syndromes. All interviews were audio-recorded, transcribed, and analyzed thematically using inductive coding targeting manifestations of symptoms and impacts. To ensure enough patients were interviewed, saturation was assessed based on the number of new codes emerging in the data. RESULTS Patients were 63 (±6.3) years old; 65% female; 80% white; 75% retired; 95% married. Half were diagnosed within the last 6 months and 25% within 7-12 months of the interviews. Approximately 60% of patients were receiving treatment. Eastern Cooperative Oncology Group status (range: 0, fully active without restriction to 4, completely disabled and confined to bed or chair) was reported by patients (0=5%; 1=25%; 2=35%; 3=30%; 4=5%). A wide range of symptoms was reported by patients; among the most frequent were tiredness, general fatigue, lack of energy, shortness of breath on exertion, weakness, dizziness or lightheadedness, bruising, bleeds (nose/gums), body aches/pain, fever, night sweats, constipation, and diarrhea (Figure). The following themes emerged from the analysis of symptom-related codes: fatigue, shortness of breath, dizziness, bleeding, general malaise/pain, and gastrointestinal issues. Patients reported a wide range of impacts on their daily lives, which included having to stay in bed/chair/couch, difficulty walking, difficulty lifting heavy objects, moving slowly, needing to take breaks, napping/sleeping during the day, not getting restful sleep, needing to lie down, difficulty doing various activities (e.g., driving, shopping, preparing food, doing yardwork, laundry), spending less time with family/friends or caring for yourself/others, depressed mood, worry, and having to be careful/mindful of risk of infection. The following main themes emerged from the analysis of impact-related codes: daily life functioning, leisure activities, physical mobility, sleep, social limitations, and psychological impact. Other themes that were reported by patients included appearance, cognition, and work (Figure). Debriefing results indicated that all patients comprehended the EORTC items tested and confirmed their relevance. CONCLUSIONS Direct patient engagement via qualitative research and thematic analysis provided a valuable evidence base to inform the selection of conceptually relevant PRO measures. The themes suitable for inclusion in clinical programs should be further discussed. Based on this research, the EORTC QLQ-C30 is a reasonable instrument for use in patients with AML. Early involvement of patients allows for potential inclusion of supplemental symptom and impact items from the EORTC Item Library in clinical programs to improve conceptual coverage of the patient experience. Disclosures Bell: Takeda Pharmaceuticals: Employment, Equity Ownership. Pompilus:Takeda Pharmaceuticals: Research Funding; Modus Outcomes: Employment. Rams:Modus Outcomes: Employment; Takeda Pharmaceuticals: Research Funding. Zhu:Takeda Pharmaceuticals: Employment. Ciesluk:Modus Outcomes: Employment; Takeda Pharmaceuticals: Research Funding. Bejar:Celgene: Consultancy; Takeda Pharmaceuticals: Research Funding; AbbVie/Genentech: Consultancy, Honoraria; Astex/Otsuka: Consultancy; Modus Outcomes: Consultancy; Daiichi-Sankyo: Consultancy. Fram:BeyondSpring Pharmaceuticals, Inc.: Consultancy; Takeda Pharmaceuticals: Employment. Faller:Boston University: Employment; Phoenicia Biosciences: Equity Ownership; Viracta Pharmaceuticals: Equity Ownership; Millennium Pharmaceuticals, Inc., a wholly owned subsidiary of Takeda Pharmaceutical Company Limited: Employment; Briacell Pharmaceuticals: Equity Ownership. Marquis:Takeda Pharmaceuticals: Research Funding; Modus Outcomes: Employment, Equity Ownership, Membership on an entity's Board of Directors or advisory committees.
35
Wójtowicz, Ewa. "Mediateka Babel. YouTube jako temat, rama formalna i platforma sztuki." Artium Quaestiones 31, no. 1 (December 20, 2020): 171–89. http://dx.doi.org/10.14746/aq.2020.31.6.
Full textAbstract:
The text focuses on the specific features of the so-called 'cinematic turn' within the scope of visual culture emergent within the YouTube platform, particularly during its first, formative years. This turn takes place on the meta-level of the existing circulation of content enabled by YouTube, often being an autothematic reflection on this tool of cultural production. The vernacular aesthetics, a specific formal framework and a particular modus operandi of YouTube became the subject of artistic statements, sometimes in a form of subversive remix. Therefore I think of YouTube as a realm of art because of its meta-media practice that made the cinematic turn visible. It does not rely on straightforwardly understood production of (moving) images, but postproduction, as understood by Nicolas Bourriaud. Moreover, the cinematic turn taking place within YouTube is different from the one practised by the avant-garde of 20th century, due its being not “seeing” or “writing” (as Dziga Vertov understood montage) but rather “overwriting”, to use language more adequate to the described sphere of digital culture. Artists use YouTube as an open library, working with its resources, applying techniques such as postproduction, remix, re-contextualisation and appropriation. Therefore it becomes a multimedia library, a “Mediateca Babel” of a kind, to recall J. L. Borges' idea. The examples mentioned in the text are of a postproductional nature, such as to-camera-performance and subversive “overwriting” of contents enabled with the circulationism typical for social media. Equally important are the strategies of recognising the cultural framework of YouTube, in the context of 20th-century media art history, as well as the platform’s interface. Also, there is the issue of relations between vernacular creativity and the art system because of “capturing” the amateur-generated content and transferring it to mainstream artworld. These examples let me argue that the cinematic turn is a form of postproduction, which enables the hidden mechanisms behind the circulation of moving images in the overloaded global network. The cinematic turn in the context of YouTube does not mean that cinema and its language are at home within this platform. Also, the meta-artistic way of “making” platform art does not turn YouTube into “art platform” (as understood by Olga Goriunova). Nevertheless, platform art may happen in this context as a result of working with the cinematic turn in its vernacular aspect, which makes it possible to reveal its key features and move them to the meta-level.
36
HAJARTI, HAJARTI. "ANALISIS TINDAK TUTUR DIREKTIF DALAM NOVEL BELENGGU KARYA ARMIJN PANE (SUATU TINJAUAN PRAGMATIK)." KONFIKS : JURNAL BAHASA DAN SASTRA INDONESIA 1, no. 1 (December 15, 2016): 30. http://dx.doi.org/10.26618/jk.v1i1.159.
Full textAbstract:
Abstak :Penelitian ini bertujuan untuk memperoleh gambaran dan penjelasan tentang Analisis Tindak Tutur Direktif dalam Novel Belenggu Karya Armijn Pane (suatu Tinjauan Pragmatik). Jenis penelitian iniadalah penelitian pustaka yang bersifat deskriptif kualitatif yang menggunakan ancangan teoripragmatik. Sumber data dalam penelitian ini adalah novel yang berjudul Belenggu karya ArmijnPane. Hasil analisis data menunjukkan bahwa tindak tutur direktif yang ditemukan dalam novelBelenggu karya Armijn Pane, terdiri dari tiga bentuk, yaitu : (1) kalimat imperatif; (2) kalimatintrogatif; (3) kalimat deklaratif. Wujud tindak tutur direktif itu digunakan dalam tindak tuturmemesan, memerintah, memohon, menyarankan, meminta, mengajak, menentang, menasihati danmelarang. Tindak tutur direktif dalam novel Belenggu karya Armijn Pane diwujudkan denganmodus tuturan yang bervariasi dan dengan fungsi yang berbeda-beda. Hal itu digunakan untukmenjalin hubungan sosial sesuai dengan norma sosial budaya yang mereka miliki.Kata Kunci : Tindak Tutur Direktif, Novel, Tinjauan Pragmatik AbstractThis research object to finding the description and explanation about the descriptive expressionanalysis in the novel “Belenggu” by Armijn Pane (a pragmatic observation). The sort of thisresearch is the library research with the descriptive quantitative which used the pragmatic theoryplanning. The data source in this research is the novel from Armijn Pane “Belenggu”. The dataresult shows that the directive expression which found in novel “Belenggu” by Armijn Pane, dealswith three kinds, such as : (1) imperatife sentence; (2) introgative sentence; (3) declarativesentence. That directive expression appearance is used in the expression of order command,request, suggestion, asking, invication, resistance, advice and prohibition. The directive expressionin Belenggu novel by Armijn Pane is applied with the various expression modus and with the socialrelationship based on the socioculture norm that they have.Key Words : Directive expression, novel, pragmatic observation.
37
Abdul-Rahman, Aisyah, and A. M. Hafizi. "Ar-Rahnu (Pawn-broking) in Al-Qamari Bank Berhad." Emerald Emerging Markets Case Studies 5, no. 5 (October 14, 2015): 1–6. http://dx.doi.org/10.1108/eemcs-09-2014-0218.
Full textAbstract:
Subjectarea The case is suitable for use in the topics related to the functions and roles of Islamic pawn-broking and the Islamic risk management framework. Studylevel/applicability The case is designed for undergraduate and postgraduate students taking courses in Islamic Banking, Islamic Finance and Risk Management for Islamic Banking Institutions. Case overview This case is meant to explain the mechanics of pawn-broking (Ar-Rahnu) in Islam as well as to understand the risk management of Ar-Rahnu in the bank. Ar-Rahnu is discussed, in general, from the perspective of muamalat and then is related to the financing service offered through Ar-Rahnu scheme at Al-Qamari Bank Berhad (a disguised bank). Ar-Rahnu means making an asset as a security or collateral for a debt. The collateral will be used to settle the debt when the debtor is in default. It may also be known as borrowing with either collateral or pawn-broking. In Al-Qamari Bank Berhad, gold and jewellery are the subject of collateral for Ar-Rahnu. In return, customers will get the cash based on the margin of loan with regards to the current market value of gold/jewellery as determined by the bank. The operation of Ar-Rahnu is discussed in Exhibit 1, while the risk management of Ar-Rahnu is discussed in Exhibit 2. Expectedlearning outcomes The learning outcomes include: to identify a problem and issue related to Ar-Rahnu; to evaluate the modus operandi of Ar-Rahnu; to analyze the risk management practices of Ar-Rahnu; and to develop decision criteria on whether Ar-Rahnu in Al-Qamari bank is Shariah-compliant or not. Supplementarymaterials Teaching notes are available for educators only. Please contact your library to gain login details or email support@emeraldinsight.com to request teaching notes.
38
Muhajarah, Kurnia, and Farida Rachmawati. "Game Edukasi berbasis Android: Urgensi Penggunaan, Pengembangan dan Penguji Kelayakan." Justek : Jurnal Sains dan Teknologi 2, no. 2 (November 30, 2019): 29. http://dx.doi.org/10.31764/justek.v2i2.3733.
Full textAbstract:
Abstract: The development of information technology today has been able to package the conditions and realities of learning to be more attractive. Educational games are games or fun activities that contain educational content and their use, which is a necessity. This research is a library research. The data was extracted and analyzed in depth using the qualitative theory of Bogdan and Cresswell. The results showed that the ability to absorb each student in learning was strongly influenced by the learning experience, mode, modality and learning style.There are differences regarding this matter, it can be accommodated by the use of educational games as learning media. The use of educational games does not conflict with behaviorism and cognitivism theories. On the other hand, the use of android-based educational games serves to make it easier forstudents to operate and use them. However, because of its simplicity, the use of educational games must be tested first through strict instruments by experts to be able to meet the marketing standards, test content and maximize its use.Abstrak: Perkembangan teknologi informasi dewasa ini telah mampu mengemas kondisi dan realitas pembelajaran menjadi lebih menarik. Game edukasi merupakan permainan atau aktivitas menyenangkan yang memuat konten pendidikan dan penggunaanya, merupakan sebuah keniscayaan Penelitian ini merupakan penelitian kepustakaan. Data digali dan dianalisis secara mendalam menggunakanteori kualitatifnya Bogdan dan Cresswell. Hasil penelitian menunjukkan bahwa kemampuan daya serap masing-masing peserta didik dalam pembelajaran sangat dipengaruhi oleh pengalaman belajar, modus, modalitas dan gaya belajarnya.Adanya perbedaan mengenai akan hal ini, bisa diakomodir dengan penggunaan game edukasi sebagai media pembelajaran. Penggunaan game edukasi ini tidak bertentangan dengan teori behaviorime dan kogntivisme. Di lain sisi, penggunaan game edukasi berbasis android, berfungsi untuk memudahkan peserta didik dalam pengoperasian dan penggunaannya. Namun demikian, karena kemudahannya, penggunaan game edukasi harus diujilayakkan dahulu melalui instrumen yang ketat oleh para ahli untuk dapat memenuhi standar edar, uji konten dan memaksimalisasi pemanfaatannya.
39
Kimutai, Chesosi Bonface. "Oral Theology: An alternative Theological Model for African Theology." International Journal of Culture and Religious Studies 1, no. 1 (May 30, 2020): 1–7. http://dx.doi.org/10.47941/ijcrs.403.
Full textAbstract:
Purpose: The crux of this paper is to explore the rationale and basis of doing oral theology in the African context and situation. It debunks the myth that written theology is the only viable modus operandi of doing African theology.Methodology: The study using the desktop research methodology or library research establishes the vitality and significance of oral theology in the quest for authentic African theology which adheres to Biblical fidelity and cultural relevance.Results: The challenges of Oral Theology can be mitigated by importing written form of theology to capture the Oral Theology without minimizing or obfuscating its distinctiveness of Oral Theology. It can also be stored in for posterity so that it is not lost. We can also integrate Oral Theology with narrative theology to formulate, promulgate, define, defend and document an oral Theology that has the narrative at its trust. Oral Theology cannot be a standalone Theology. It needs to be buttressed with written Theology to preserve it for posterity. It also needs to be integrated to systematic Theology to make it intelligible relevant and appropriate to the African context and situation. Oral Theology needs to be formulated in a sense that it should supplement rates than supplant Bible hermeneutics story telling should not viewed as a surrogate to Biblical exposition of the text.Unique contribution to theory, practice and policy: The study recommends an integrated theological method that synergizes oral theology with written theology for African theology to have both biblical fidelity and cultural relevance. Oral theology ought to be included in the church teaching curriculum especially in its theological education by extension which is an informal theological education targeting church ministers. This will go a long way in enhancing the quality of church ministers and will lead eventually to exponential church growth
40
Ahusborde, Etienne, Brahim Amaziane, and Mustapha El Ossmani. "Improvement of numerical approximation of coupled multiphase multicomponent flow with reactive geochemical transport in porous media." Oil & Gas Science and Technology – Revue d’IFP Energies nouvelles 73 (2018): 73. http://dx.doi.org/10.2516/ogst/2018033.
Full textAbstract:
In this paper, we consider a parallel finite volume algorithm for modeling complex processes in porous media that include multiphase flow and geochemical interactions. Coupled flow and reactive transport phenomena often occur in a wide range of subsurface systems such as hydrocarbon reservoir production, groundwater management, carbon dioxide sequestration, nuclear waste repository or geothermal energy production. This work aims to develop and implement a parallel code coupling approach for non-isothermal multiphase multicomponent flow and reactive transport simulation in the framework of the parallel open-source platform DuMuX. Modeling such problems leads to a highly nonlinear coupled system of degenerate partial differential equations to algebraic or ordinary differential equations requiring special numerical treatment. We propose a sequential fully implicit scheme solving firstly a multiphase compositional flow problem and then a Direct Substitution Approach (DSA) is used to solve the reactive transport problem. Both subsystems are discretized by a fully implicit cell-centred finite volume scheme and then an efficient sequential coupling has been implemented in DuMuX. We focus on the stability and robustness of the coupling process and the numerical benefits of the DSA approach. Parallelization is carried out using the DUNE parallel library package based on MPI providing high parallel efficiency and allowing simulations with several tens of millions of degrees of freedom to be carried out, ideal for large-scale field applications involving multicomponent chemistry. As we deal with complex codes, we have tested and demonstrated the correctness of the implemented software by benchmarking, including the MoMaS reactive transport benchmark, and comparison to existing simulations in the literature. The accuracy and effectiveness of the approach is demonstrated through 2D and 3D numerical simulations. Parallel scalability is investigated for 3D simulations with different grid resolutions. Numerical results for long-term fate of injected CO2 for geological storage are presented. The numerical results have demonstrated that this approach yields physically realistic flow fields in highly heterogeneous media and showed that this approach performs significantly better than the Sequential Iterative Approach (SIA).
41
Michalon, Barthélémy. "Citizen Chen: a challenging test for bilateral diplomacy." Emerald Emerging Markets Case Studies 3, no. 5 (November 18, 2013): 1–9. http://dx.doi.org/10.1108/eemcs-10-2013-0193.
Full textAbstract:
Subject area Diplomatic and consular policies; legal aspects of international relations and Asia regional scenario. Study level/applicability Undergraduate. Case overview In April 2012, high-level officials from China and the USA were about to meet in Beijing in the framework of the bilateral Strategic and Economic Dialogue, organized on a yearly basis. The event was always delicate, due to the ambiguous relationship existing between the two countries, which were at the same time rivals and dependent on one another. That time, the tension previous to the meeting increased significantly: a Chinese human rights activist had just sought and obtained diplomatic protection in the US Embassy in Beijing, thus creating an embarrassing situation for both States' foreign departments […] How could they possibly solve this contentious issue without affecting their already sensitive relationship? Expected learning outcomes Analytical: to be aware of the political nature of the current Chinese Government; to realize the concrete and practical implications of an Embassy's special status; to balance two contradictory objectives, in a specific situation where none of them can be fully discarded; to contrast and try to combine long-term goals (in this case, to maintain a functioning relationship between two main world powers) with short-term objectives (in this case, how to deal with a Chinese activist that required protection against his own country's security forces); to find a modus vivendi (conciliation) between values and interests; to get convinced that certain kinds of negotiations cannot be conceived through a “win or lose” approach: in this case, the only way out must be respectful of the two parties' core interests; and to take into account that image preservation (“face-saving”) must be included within any country's objectives in any situation involving diplomatic means. Conceptual: the purpose is to familiarize the students with specific concepts, such as: best alternative to a negotiated agreement (BATNA), which is to be mentioned as part of the discussion (it is not included in the case study itself); interdependence; (purported) Group of Two; asylum and refuge; Immunity; and sending state/receiving state. Supplementary materials Teaching notes are available for educators only. Please contact your library to gain login details or email support@emeraldinsight.com to request teaching notes.
42
Bell, Jill A., Farrah A. Pompilus, Anna Christian, Flora Mazerolle, Fatima Scipione, Rafael Bejar, Aaron Galaznik, et al. "Assessing Patient-Reported Outcomes in People with Myelodysplastic Syndromes: Can a Customized Selection of Items from the EORTC Library Enhance the EORTC QLQ-C30?" Blood 132, Supplement 1 (November 29, 2018): 4856. http://dx.doi.org/10.1182/blood-2018-99-116977.
Full textAbstract:
Abstract INTRODUCTION Assessing patient-reported outcomes (PROs) is an essential part of understanding the ways in which a new drug might affect how a patient with cancer feels and functions within a clinical trial. Certain widely used PRO measures are now being supplemented with a selection of items from available item banks to ensure the measure is targeted to the specific context of use. Previous mixed methods research in higher risk myelodysplastic syndromes (HR MDS), chronic myelomonocytic leukemia (CMML), and low blast acute myeloid leukemia (LB AML) led to the development of a conceptual model of the symptoms and impacts for this population. It informed a PRO measurement strategy based on the European Organisation for Research and Treatment of Cancer (EORTC) Quality of Life Questionnaire Core 30 items (QLQ-C30) along with an additional, customized selection of 10 supplemental items from the EORTC library to cover unaddressed concepts. Clinical features such as anemia cause fatigue and dyspnea, which may negatively impact patient functioning, thus further emphasizing the importance of the patient voice when evaluating the value of a new therapy to patients. The purpose of this research was to incorporate the patient voice and generate information on this measurement strategy in a sample of people with HR MDS/ CMML and LB AML. METHODS This study was a one-time, cross-sectional patient-reported survey administered online. People living with HR MDS, non-proliferative CMML, and LB AML were recruited through the MDS Foundation, social media, and recruitment agencies. Patients completed the EORTC QLQ-C30 plus 10 supplemental items from the EORTC item library. In addition to PRO data, they were also asked to record demographics and disease-related information. Responses to the 40 PRO items were described and psychometric analyses based on Rasch measurement theory (RMT) were conducted on the original multi-item domains of the EORTC QLQ-C30. RMT analysis defines how a set of items should perform to generate reliable and valid measurements, which is important for the generalizability of the PRO instrument's psychometric evaluations to other contexts of use. RMT analyses were also performed on the following, enhanced domain measures which included original items and supplemental items: fatigue, dyspnea, physical functioning, and role functioning. RESULTS A total of 51 patients were recruited and participated in the online survey (HR MDS: 51%; CMML: 27%; LB AML: 10%). The mean age was 67.2 (SD: 11.8) and 49% of patients were female. The description of responses showed a possible floor effect for several EORTC QLQ-C30 items (i.e. a substantial percentage of responder reported the lowest value of the scale), whereas the responses to the supplemental items were well distributed across the response categories (Figure). This confirmed that the customized supplemental item selection was well targeted to the patient sample. Overall, the RMT psychometric examination of the original EORTC QLQ-C30 domain scores showed satisfactory ability to assess key outcomes for people with HR MDS/CMML and LB AML including fatigue and physical functioning. However, it highlighted some areas for possible improvement, due to gaps in the conceptual coverage of symptoms and impacts of HR MDS/CMML and LB AML. The enhanced fatigue, physical functioning and dyspnea measures that combined the original QLQ-C30 items with the supplemental items from the EORTC library showed improved measurement performances for these key domains for people with HR MDS/CMML and LB AML, typically in terms of conceptual coverage. CONCLUSIONS Our data shows how incorporating the patient voice early on in PRO measurement selection and a conceptually-driven approach to the development of customized item sets can lead to more fit-for-purpose PRO measures to be used in the context of clinical trials of patients with cancer. Specifically, while the QLQ-C30 may be a satisfactory PRO instrument for use in people with hematological stem cell disorders, it can be made more targeted and disease-specific by carefully utilizing mixed methods and selecting supplemental items from the EORTC item library. This patient-reported online survey provides early evidence, in a small sample of patients, on the appropriateness of both the original QLQ-C30 and enhanced item sets to assess PROs in HR MDS/CMML, and AML and should be further analyzed in future research. Disclosures Bell: Takeda Pharmaceuticals: Employment, Equity Ownership. Pompilus:Modus Outcomes: Employment; Takeda Pharmaceuticals: Research Funding. Christian:Modus Outcomes: Employment; Takeda Pharmaceuticals: Research Funding. Mazerolle:Modus Outcomes: Employment; Takeda Pharmaceuticals: Research Funding. Scipione:Takeda Pharmaceuticals: Employment. Bejar:Takeda: Research Funding; Celgene: Consultancy, Honoraria; Foundation Medicine: Consultancy; Modus Outcomes: Consultancy; Genoptix: Consultancy; AbbVie/Genentech: Consultancy, Honoraria; Astex/Otsuka: Consultancy, Honoraria. Galaznik:Takeda Pharmaceuticals International Co.: Employment. Fram:Takeda Pharmaceuticals: Consultancy; BeyondSpring Pharmaceuticals, Inc.: Consultancy. Faller:Takeda Pharmaceuticals: Employment, Equity Ownership. Cano:Modus Outcomes: Employment, Equity Ownership, Membership on an entity's Board of Directors or advisory committees; Takeda Pharmaceuticals: Research Funding. Regnault:Modus Outcomes: Employment, Membership on an entity's Board of Directors or advisory committees; Takeda Pharmaceuticals: Research Funding.
43
Prieto, Carlos, Christophe Faynel, Robert Robbins, and Axel Hausmann. "Congruence between morphology-based species and Barcode Index Numbers (BINs) in Neotropical Eumaeini (Lycaenidae)." PeerJ 9 (August 5, 2021): e11843. http://dx.doi.org/10.7717/peerj.11843.
Full textAbstract:
Background With about 1,000 species in the Neotropics, the Eumaeini (Theclinae) are one of the most diverse butterfly tribes. Correct morphology-based identifications are challenging in many genera due to relatively little interspecific differences in wing patterns. Geographic infraspecific variation is sometimes more substantial than variation between species. In this paper we present a large DNA barcode dataset of South American Lycaenidae. We analyze how well DNA barcode BINs match morphologically delimited species. Methods We compare morphology-based species identifications with the clustering of molecular operational taxonomic units (MOTUs) delimitated by the RESL algorithm in BOLD, which assigns Barcode Index Numbers (BINs). We examine intra- and interspecific divergences for genera represented by at least four morphospecies. We discuss the existence of local barcode gaps in a genus by genus analysis. We also note differences in the percentage of species with barcode gaps in groups of lowland and high mountain genera. Results We identified 2,213 specimens and obtained 1,839 sequences of 512 species in 90 genera. Overall, the mean intraspecific divergence value of CO1 sequences was 1.20%, while the mean interspecific divergence between nearest congeneric neighbors was 4.89%, demonstrating the presence of a barcode gap. However, the gap seemed to disappear from the entire set when comparing the maximum intraspecific distance (8.40%) with the minimum interspecific distance (0.40%). Clear barcode gaps are present in many genera but absent in others. From the set of specimens that yielded COI fragment lengths of at least 650 bp, 75% of the a priori morphology-based identifications were unambiguously assigned to a single Barcode Index Number (BIN). However, after a taxonomic a posteriori review, the percentage of matched identifications rose to 85%. BIN splitting was observed for 17% of the species and BIN sharing for 9%. We found that genera that contain primarily lowland species show higher percentages of local barcode gaps and congruence between BINs and morphology than genera that contain exclusively high montane species. The divergence values to the nearest neighbors were significantly lower in high Andean species while the intra-specific divergence values were significantly lower in the lowland species. These results raise questions regarding the causes of observed low inter and high intraspecific genetic variation. We discuss incomplete lineage sorting and hybridization as most likely causes of this phenomenon, as the montane species concerned are relatively young and hybridization is probable. The release of our data set represents an essential baseline for a reference library for biological assessment studies of butterflies in mega diverse countries using modern high-throughput technologies an highlights the necessity of taxonomic revisions for various genera combining both molecular and morphological data.
44
Muneeza, Aishath, Muhammad Fahmi Fauzi, Muhammad Faisal Bin Mat Nor, Mohamed Abideen, and Muhammed Maher Ajroudi. "House financing: contracts used by Islamic banks for finished properties in Malaysia." Journal of Islamic Accounting and Business Research 11, no. 1 (January 6, 2020): 168–78. http://dx.doi.org/10.1108/jiabr-04-2017-0057.
Full textAbstract:
Purpose The purpose of this paper is to find out the existing practices of the Islamic banks in providing financing to the customers who have a requirement to purchase a finished property and to examine the existing products used by the Islamic banks in this regard by providing an insight into the modus operandi of these products. In doing this, attempt is made to find out the most famous product offered by the Islamic banks in this regard and to find out whether in reality, Malaysian Islamic banking industry has moved away from Bai Bithaman Ajil (BBA) or not. Design/methodology/approach This is a qualitative research, largely library-based, and it will consist of secondary sources such as books, journals, articles and other sources related to the Islamic house financing in Malaysia for finished properties. Recent information of the practises of the banks in this regard is obtained from the official websites of the banks. Findings It is found from this study that majority of Islamic Banks in Malaysia prefer to use the Commodity Murabahah facility for finished property. This finding contradicts with the observations made by some scholars who state that in Malaysia, BBA was initially used, and nowadays, the use of Musharakah Mutanaqisah is more common. The reason why Commodity Murbahah has gained popularity is because of the fact that via the Bursa Suq Al Sila platform, it is easy, swift, reliable, profitable, cheaper, convenient and has zero risk to do this type of transaction at the comfort of the office. It is recommended in this paper to use Musharakah Mutanaqisah, as this contract is an innovative contract that is classified as an equity contract under shariah where risk is shared between the parties. There is need to conduct further research to implement Musharakah Mutanaqisah in Malaysia, specifically to reduce the risk that Islamic Banks will bear by practicing this contract. Originality/value The findings of this paper might create confusion among readers, as some may perceive that the finding of the paper is not new as BBA has been dominating Islamic house financing industry from the inception of Islamic banking in the country, and BBA and Murabahah are similar in nature, and as such, commodity Murabahah is also a Murabahah transaction. The reality that needs to be understood is that the way BBA was or is practised in Malaysia in relation to Islamic house financing is that in the name of BBA, the transaction actually followed the Bai’ ‘inah contract, which is a controversial contract among the shariah scholars. Likewise, commodity Murabahah is also a different contract than Murabahah, as it actually refers to tawarruq. As such, this research finding is important to the Islamic banking industry to understand that Malaysia has moved away from the Bai’ ‘inah contract practised in the name of BBA in Islamic house financing, and there are new products introduced by the Islamic banks in Malaysia to replace this practice which were criticised by Shariah scholars.
45
Flexor, Carina Ochi, Cleomar De Sousa Rocha, and Olira Saraiva Rodrigues. "Desenleio: Espaços e entremeios de acesso à leitura." PORTO ARTE: Revista de Artes Visuais 24, no. 40 (June 17, 2019). http://dx.doi.org/10.22456/2179-8001.93793.
Full textAbstract:
A proposta deste artigo é destrinçar questões que abordem configurações de bibliotecas contemporâneas, diante do contexto da cultura digital, com a compreensão de características multissensoriais e de fluxo e conexão, frente às inovações tecnológicas. Por meio de uma pesquisa bibliográfica em uma abordagem qualitativa, versar sob o modus operandi que conduz a biblioteca contemporânea à superação de sua própria delimitação espaço-temporal, diante do aspecto multissensorial das mídias nos processos comunicacionais, bem como os modos de acesso, compartilhamento e armazenamento ao objeto exposto à leitura.AbstractThe purpose of this article is to identify issues that approach contemporary library configurations, in the content of digital culture, with the understanding of multisensory characteristics and flow and connection, in the face of technological innovations. Through a bibliographical research in a qualitative approach, to study under the modus operandi that leads the contemporary library to overcoming its own space-temporal delimitation, in face of the multisensorial aspect of the media in the communicational processes, as well as the modes of access, sharing and storage to the object to read.
46
Bravo, Henrique, Christine L. Y. Cheng, Alessio Iannucci, Chiara Natali, Aline Quadros, Martin Rhodes, Matthew M. L. Yip, Stefano Cannicci, and Sara Fratini. "A DNA barcode library for mangrove gastropods and crabs of Hong Kong and the Greater Bay Area reveals an unexpected faunal diversity associated with the intertidal forests of Southern China." BMC Ecology and Evolution 21, no. 1 (September 23, 2021). http://dx.doi.org/10.1186/s12862-021-01914-6.
Full textAbstract:
Abstract Background Mangroves are tropical and subtropical intertidal forests colonising sheltered coasts across the world. They host a unique faunal community, dominated by brachyuran crabs and gastropods. These invertebrates strongly contribute to the functionality of the entire forest. The reliable assessment of mangrove faunal diversity is, thus, a crucial step for efficient management and conservation plans, but it is hindered by difficulties in species identification. Here we provide a verified DNA barcode library for brachyuran crabs and gastropods inhabiting the mangroves of the Greater Bay Area, Southern China. In particular, we collected and morphologically identified 1100 specimens of mangrove associated brachyuran crabs and gastropods. The partial sequences of the mtDNA cytochrome oxidase subunit I gene were obtained from 275 specimens. Barcode sequences were then used to delineate Molecular Operational Taxonomic Units (MOTUs), employing three different delimitation methods: the automatic barcode gap discovery (ABGD) method, the general mixed Yule coalescent (GMYC) model and a Bayesian implementation of the Poisson tree processes (bPTP) model. Results By integrating DNA barcodes with morphology, we identified 44 gastropod species and 58 brachyuran species associated with Hong Kong mangroves, with five and seven new records, for gastropods and crabs, respectively, for the Greater Bay Area. The delineation of MOTUs based on barcode sequences revealed a strong congruence between morphological and molecular identification for both taxa, showing the high reliability of the barcode library. Conclusions This study provides the first reference barcode library for mangrove-associated macrobenthic fauna in the Greater Bay Area and represents a reliable tool to management and conservation plans. Our molecular analyses resolved long lasting taxonomic misidentifications and inconsistencies and updated the knowledge on the geographical distribution of Asian mangrove associated fauna, ultimately highlighting a level of biodiversity higher than previously thought for Southern China.
47
"Mentors help new moms transition back to work at PricewaterhouseCoopers." Development and Learning in Organizations: An International Journal 23, no. 5 (August 21, 2009). http://dx.doi.org/10.1108/dlo.2009.08123ead.007.
Full text
48
Turner, Ian M. "The botanical legacy of Thomas Hardwicke’s journey to Srinagar in 1796." European Journal of Taxonomy, no. 108 (January 6, 2015). http://dx.doi.org/10.5852/ejt.2015.108.
Full textAbstract:
In 1796, Thomas Hardwicke travelled through northern India between what is now Fatehgarh in Uttar Pradesh and Srinagar in Uttarakhand. Hardwicke collected and described plants encountered and had many of the plants illustrated from life. He published an account of the journey in 1799 including a list of plant species. I review the names validated in the original paper, and also those published subsequently by Sir James Edward Smith and William Roxburgh based partly or wholly on the material or drawings acquired by Hardwicke on the journey to Srinagar. The large collection of Hardwicke plant drawings now held in the British Library, and a smaller set in the Botany Library of the Natural History Museum, are considered in relation to the application and typification of plant names related to Hardwicke’s botanical exploration in India. The names of seven plant species were validly published in the 1799 paper (Androsace rotundifolia Hardw., Ficus laminosa Hardw., Justicia thyrsiformis Roxb. ex Hardw., Linum trigynum Roxb. ex Hardw., Lonicera quinquelocularis Hardw., Salvia integrifolia Roxb. ex Hardw. and Volkameria bicolor Hardw.), plus one new combination (Echites antidysentericus (L.) Roxb. ex Hardw.). As concluded by Britten more than a century ago, Ficus laminosa is the correct name for the fig variously referred to F. saemocarpa Miq. or F. squamosa Roxb. Smith based Rhododendron arboreum Sm. and Bignonia undulata Sm. on Hardwicke plants. At least a dozen Roxburgh names, including Crataegus integrifolia Roxb., Gardenia tetrasperma Roxb. and Morus serrata Roxb., are based, at least partly, on Hardwicke’s collections. In total, 23 names are lectotypified here and one neotype is designated.
49
Xuan, Zhiyou, Jiaxi Xie, Haodong Yu, Song Zhang, Ruhui Li, and Mengji Cao. "Mulberry (Morus alba) is a new natural host of Citrus leaf blotch virus in China." Plant Disease, October 2, 2020. http://dx.doi.org/10.1094/pdis-07-20-1580-pdn.
Full textAbstract:
Mulberries (Morus spp., family Moraceae) are economically important deciduous woody plants. Their leaves are food for silkworms, and both the fruits and leaves have nutritional and medicinal values (Qin et al. 2012). The plants are widely distributed globally and have been cultivated in China for more than 5,000 years (Xie et al. 2014). In April 2019, virus-like symptoms of chlorotic leaf spots and, occasionally witches’ broom were observed in trees of white mulberry (M. alba) in Shapingba district of Chongqing province. To investigate if any potential viral agent is associated with the symptoms, total RNA was extracted from leaves of one symptomatic tree using an RNAprep Pure Plant Plus Kit (TianGen, China). Ribosomal RNAs were depleted using a TruSeq RNA Sample Prep Kit (Illumina, USA), and the depleted RNA was used for construction of a cDNA library for sequencing using an Illumina HiSeq X-ten platform with pair-ended reads length layout 150 bp. Adaptors, low-quality reads and mulberry genomes-derived reads (He et al. 2013) were removed from a total of 25,433,798 reads using the CLC Genomics Workbench 11 (Qiagen, USA) and the clean reads of 936,562 were subjected to de novo assembly that generated 4,278 contigs (200-3,862 bp). These sequences were annotated by Blastx searches to local Viruses_NR and viroid datasets downloaded from GenBank. Finally, except three contigs (3,862 nt, 1,950 nt, and 1,179 nt) with 81.4–90% nucleotide sequence identities to citrus leaf blotch virus (CLBV, genus Citrivirus, family Betaflexiviridae), no other contigs were identified as viral-related. Total clean reads of 113,185 were mapped to the viral contigs with average coverage depth of 1,915, suggesting the presence of CLBV in the symptomatic tree. To recover the complete genome of CLBV, overlapping fragments were amplified by RT-PCR using virus-specific primer pairs. The 5’ and 3’ termini were determined by rapid amplification of cDNA ends (RACE kit, Invitrogen, USA). Five clones per amplicon were sequenced in two directions (Cao et al. 2018). The complete genome of the mulberry strain of CLBV (CLBV-ML, GenBank accession no. MT767171) is 8,776 nucleotides (nt) in length, excluding the poly (A) tail. CLBV-ML is similar to extant CLBV isolates in genome structure. BLASTn analysis showed that CLBV-ML had highest nucleotide sequence identities of 79.65-81.56% with Actinidia isolates (Liu et al. 2019) of CLBV at the whole genome. Phylogenetic analysis also placed it with the Actinidia isolates, indicating they are closely related. Thus, CLBV-ML is a highly divergent strain of CLBV. To study the occurrence of CLBV-ML, a total of 62 mulberry samples (42 with similar symptoms and 20 without symptoms) were randomly collected from Shapingba and tested by conventional RT-PCR using an isolate-specific primer pair (CLBV-F7182: ACCAATGACAATGCCACA; CLBV-R7857: TTATGAAACTCTTCCCACTT) designed in the CP gene to amplify a 676 bp fragment. The virus was detected in 37 symptomatic trees (88%) and 2 (10%) asymptomatic trees, suggesting the association of CLBV-ML with the symptoms. To the best of our knowledge, this is the first report of CLBV infection in mulberry which expands the host range of CBLV.
50
Frail, Kim. "Welcome, Baby by B. Reid." Deakin Review of Children's Literature 3, no. 2 (October 11, 2013). http://dx.doi.org/10.20361/g2k31b.
Full textAbstract:
Reid, Barbara. Welcome, Baby. Toronto: Scholastic Canada, 2013. Print.As with Reid's other books, the focus of Welcome Baby is the author's superb hand-sculpted plasticine illustrations. They are all bright, colourful and contain small charming details such as: framed family photos, the stubble on a new father's unshaven face, and a baby's missing sock and tiny bare foot. The story is addressed to a new baby and presents the joys of welcoming the new arrival into the family. There are images of babies snuggling with Moms and Dads, interacting with grandparents, playing with siblings and friends and enjoying the great outdoors in all four seasons.The characters are racially diverse and household scenes are very realistic. A father and baby nap in the couch amidst a sea of toys and clothes strewn about the living room carpet. The narrative features a simple rhyme scheme that would appeal to young children. There are usually only 5-7 words per page and it alternates between text and image. The colour of the textual pages alternates between yellow and blue to create interest without overwhelming the images on the opposite side. The meaning of the text corresponds well to the images and conveys playful metaphors. For example, in one image we see rain and clouds through a large window. In the foreground a baby flashes a joyful smile while holding her father's finger. He is wearing a sports jersey. The text reads: "You will be our sunshine, We'll be your biggest fans." This book is ideal for the nursery or preschool library. It would make a fantastic gift for parents-to-be and could also be read to a sibling before the birth to allow them to share in the excitement and anticipation.Highly Recommended: 4 out of 4 starsReviewer: Kim FrailKim is a Public Services Librarian at the H.T. Coutts Education Library at the University of Alberta. Children’s literature is a big part of her world at work and at home. She also enjoys gardening, renovating and keeping up with her kids.