To see the other types of publications on this topic, follow the link: Ligand Structure Effects.
Dissertations / Theses on the topic 'Ligand Structure Effects'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 44 dissertations / theses for your research on the topic 'Ligand Structure Effects.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse dissertations / theses on a wide variety of disciplines and organise your bibliography correctly.
1
McFail-Isom, Lori. "Effects of ligand binding, coordinate error and ion binding on nucleic acid structure and conformation." Diss., Georgia Institute of Technology, 1998. http://hdl.handle.net/1853/30735.
Full text
2
Durivage, Jason Curtis. "Ligand Effects on Metal-Metal Bonding: Photoelectron Spectroscopy and Electronic Structure Calculations of Dimetal Paddlewheel Complexes." Diss., The University of Arizona, 2011. http://hdl.handle.net/10150/145427.
Full textAbstract:
Paddlewheel complexes are molecules in which two interacting metal atoms are bridged by four chelating ligands. This class of complexes has a large range of electronic variability while keeping a rigid geometric structure. This variability has led to their use as catalysts, strong reductants, anti-tumor agents, and electron transfer agents. This dissertation examines the effects of changing both the dimetal core and the surrounding ligands on the electronic structure properties of the paddlewheel complexes. Examination of Bi₂(O₂CCF₃)₄, a p-orbital dimetal paddlewheel complex, provided a way to probe the orbitals that are important in metal-ligand σ bonding. The b(1g) and b(2u) ligand orbitals of Bi₂(O₂CCF₃)₄ have no dimetal orbital counterpart, unlike the case of the more familiar d-orbital dimetal paddlewheel complexes such as Mo₂(O₂CCF₃)₄. This had the effect of destabilizing these ligand orbitals compared to d-orbital paddlewheel complexes. The ligand a1g orbital in Bi₂(O₂CCF₃)₄ was also destabilized due to nodal differences in the dimetal σ orbital. The unusual coincidence of Mo-Mo σ and π ionization bands is due to a greater amount of ligand character in the Mo-Mo σ orbital compared to its ditungsten analogue, which has separate ionization bands for the σ and π bonds. A series of p-substituted dimolybdenum tetrabenzoate complexes was synthesized and studied by photoelectron spectroscopy in order to further examine the delocalization of electron density from the metals to the ligands in these complexes. A 0.89 eV shift in the δ ionization band was observed from Mo₂(O₂CPh-p-OMe) ₄ and Mo₂(O₂CPh-p-CF₃)₄. Overlap effects are the major factor causing the shift in the δ bond ionization, as the calculated charges on the molybdenum and oxygen atoms did not vary significantly on change of substituent. Molybdenum and tungsten guanidinate paddlewheel complexes have promise as good reducing agents due to their extremely low ionization energies. The solubility of the complexes poses a problem for their widespread adoption for use as reducing agents. Alkyl substituents were added to the complexes to increase their solubility. W₂(TEhpp)₄ was observed to have the lowest ionization energy at 3.71 eV (vertical ionization) and 3.40 eV (onset ionization) of any molecule yet prepared.
3
Pollard, John Randolph 1969. "Ligand effects and periodic trends in metal-metal multiple bonds: Theoretical and experimental studies of electronic structure by gas-phase photoelectron spectroscopy." Diss., The University of Arizona, 1996. http://hdl.handle.net/10150/282196.
Full textAbstract:
Gas-phase photoelectron spectroscopy was utilized to study a series of metal-metal bonded complexes. Molecular mechanics, Fenske-Hall and ab-initio theoretical calculations were performed on many of the systems. The central focus of all the studies was to identify metal-metal ionizations, and observe how ligands effects influence metal-metal interactions. This information was then used to describe various physical and chemical properties of the species. The first group of compounds studied were molybdenum and tungsten D₃(h) triply-bonded hexa-alkoxides of the form M₂(OC(CH₃)n(CF₃)₃₋n)₆ (where M=Mo, W and n = 1, 2, 3). The metal-metal π and σ ionizations were identified. It is observed that sequential fluorination of the ligands shifts all the valence ionizations. Because the shifts are found to be dominated by charge effects, the virtual levels are assumed to be equally shifted. This information was used to describe the similarity of the UV absorption spectra of the compounds. The next group studied are electron-rich single-bonded Rh(II)-Rh(II) complexes. The previously assigned PES data for Mo₂(O₂CCF₃)₄ was used as a reference point when interpreting the data for Rh₂(O₂CCF₃)₄. The electron configuration orbital ordering for the Rh-Rh bond in Rh₂(O₂CCF₃)₄ is determined to be σ²π⁴δ²δ*²π*⁴, with the δ* and π* being nearly degenerate. It is observed that if the acetates are replaced with more electron-donating ligands, as with Rh₂(O₂CCF₃)₂(form)₂, Rh₂(form)₄ (form = N-N’-p-tolylformamidine, C₁₅H₁₅N₂) and Rh₂(dpf)₄ (dpf = diphenylformamidine, C₁₃H₁₁N₂), the δ* ionizations are destabilized relative to the other Rh-Rh ionizations. In addition, ligand-based ionizations overlap into metal-metal ionizations making it more difficult to interpret data. This information is then used to understand the data and electron structures of Rh₂(pfb)₄ (pfb = perfluorobutyrate, CF₃(CF₂)₂CO₂⁻), Rh₂(capy)₄ (capy = caprolactamate, ⁻OC(CH₂)₅N), Rh₂(OCCH₃NC₆H₅)₄ and Rh₂(OCCH₃NC₆F₅)₄. Rh₂(OCCH₃NC₆H₅)₄ and Rh₂(OCCH₃NC₆F₅)₄ provide examples where charge and overlap effects can be utilized to assign Rh-Rh ionizations. Rh₂(pfb)₄ and Rh₂(capy)₄ exhibit very high and different product selectivities when employed as catalysts in reactions involving carbenes derived from diazo-carbonyl complexes. A mechanism for this catalysis is derived which correlates with the observed selectivities.
4
Meyer, Marleen J. [Verfasser], Werner [Gutachter] Weitschies, Mladen V. [Gutachter] Tzvetkov, Jörg [Gutachter] König, and Joachim [Gutachter] Geyer. "Effects of ligand structure, amino acid substitutions, and species differences on the function of organic cation transporter OCT1: utilizing polyspecificity for understanding structure-function relationships / Marleen J. Meyer ; Gutachter: Werner Weitschies, Mladen V. Tzvetkov, Jörg König, Joachim Geyer." Greifswald : Universität Greifswald, 2020. http://d-nb.info/1224047362/34.
Full text
5
Green, Michael Roger. "Ligand and substituent effects on the electronic structures of mononuclear transition metal complexes /." The Ohio State University, 1987. http://rave.ohiolink.edu/etdc/view?acc_num=osu1487331541710079.
Full text
6
Xu, Rong. "The effects of structural modifications on sigma receptor binding." Diss., Columbia, Mo. : University of Missouri-Columbia, 2007. http://hdl.handle.net/10355/4742.
Full textAbstract:
Thesis (Ph. D.)--University of Missouri-Columbia, 2007.<br>The entire dissertation/thesis text is included in the research.pdf file; the official abstract appears in the short.pdf file (which also appears in the research.pdf); a non-technical general description, or public abstract, appears in the public.pdf file. Title from title screen of research.pdf file (viewed on December 18, 2007) Vita. Includes bibliographical references.
7
Patirana, Charles Gamini. "Ligand effects on the structures of Rh¦6(CO)¦1¦5L clusters, the novel coordination of a new bisthiophosphorus ligand to a triosmium carbonyl cluster." Thesis, National Library of Canada = Bibliothèque nationale du Canada, 2001. http://www.collectionscanada.ca/obj/s4/f2/dsk3/ftp05/MQ62944.pdf.
Full text
8
Herbert, Paul. "The heteromeric 5-HT3A/B receptor : the effect of 5-HT3B subunits on receptor structure and ligand recognition." Thesis, Aston University, 2008. http://publications.aston.ac.uk/11070/.
Full textAbstract:
The 5-HT3 receptors are members of the cys-loop family of ligand-gated ion channels. Two functional subtypes are known, the homomeric 5HT3A and the heteromeric 5HT3A/B receptors, which exhibit distinct biophysical characteristics but are difficult to differentiate pharmacologically. Atomic force microscopy has been used to determine the stoichiometry and architecture of the heteromeric 5HT3A/B receptor. Each subunit was engineered to express a unique C-terminal epitope tag, together with six sequential histidine residues to facilitate nickel affinity purification. The 5-HT3 receptors, ectopically expressed in HEK293 cells, were solubilised, purified and decorated with antibodies to the subunit specific epitope tags. Imaging of individual receptors by atomic force microscopy revealed a pentameric arrangement of subunits in the order BBABA, reading anti-clockwise when viewed from the extracellular face. Homology models for the heteromeric receptor were then constructed using both the electron microscopic structure of the nicotinic acetylcholine receptor, from Torpedo marmorata, and the X-ray crystallographic structure of the soluble acetylcholine binding protein, from Lymnaea stagnalis, as templates. These homology models were used, together with equivalent models constructed for the homomeric receptor, to interpret mutagenesis experiments designed to explore the minimal recognition differences of both the natural agonist, 5-HT, and the competitive antagonist, granisetron, for the two human receptor subtypes. The results of this work revealed that the 5-HT3B subunit residues within the ligand binding site, for both the agonist and antagonist, are accommodating to conservative mutations. They are consistent with the view that the 5-HT3A subunit provides the principal and the 5-HT38 subunit the complementary recognition interactions at the binding interface.
9
Huang, Shih-huang. "Synthetic, Mechanistic, and Structural Studies of Polynuclear Metal Clusters and Hydrazido-Substituted Tantalum(V) Compounds." Thesis, University of North Texas, 2010. https://digital.library.unt.edu/ark:/67531/metadc33166/.
Full textAbstract:
A combined experimental and computational study on the reversible ortho-metalation exhibited by the triosmium cluster Os3(CO)10(dppm) (dppm = 1,1-bis(diphenylphosphino)methane is reported. The conversion of nonacarbonyl cluster HOs3(CO)9[-PhP(C6H4)CH2PPh2] to Os3(CO)10(dppm) is independent of added CO and exhibits a significant inverse equilibrium isotope effect (EIE). Reductive coupling of the C-H bond in HOs3(CO)9[-PhP(C6H4)CH2PPh2] leads to the formation of agostic C-H and two distinct aryl-π species prior to the rate-limiting formation of the unsaturated cluster Os3(CO)9(dppm). Heating the unsaturated dimer H2Re2(CO)8 with Cp*Rh(CO)2 (Cp* = 1,2,3,4,5-pentamethylcyclopentadiene) at elevated temperature affords the new trimetallic clusters H2RhRe2Cp*(CO)9 and HRh2ReCp*2(CO)6, and the spiked-triangular cluster HRhRe3Cp*(CO)14. H2Re2(CO)8 reacts with Cp*2Rh2(CO)2 under identical conditions to furnish H2RhRe2Cp*(CO)9 and HRh2ReCp*2(CO)6 as the principal products, in addition to the tetrahedral cluster H2Rh2Re2Cp*2(CO)8. H2RhRe2Cp*(CO)9 undergoes facile fragmentation in the presence of halogenated solvents and the thiols RSH (where R = H, C6H4Me-p) to afford the structurally characterized products Cp*Rh(-Cl)3Re(CO)3, S2Rh3Cp*(CO)4, Cp*Rh(-Cl)(-SC6H4Me-p)2Re(CO)3, and Cp*Rh(-SC6H4Me-p)3Re(CO)3. The new hydrazido-substituted compounds TaCl(NMe2)3[N(TMS)NMe2] (TMS = tetramethylsilyl) and Ta(NMe2)4[N(TMS)NMe2] have been synthesized and their structures established by X-ray crystallography. The latter product represents the first structurally characterized octahedral tantalum(V) complex containing a single hydrazido(I) ligand in an all-nitrogen coordinated environment about the metal center. The fluxional properties of the amido and hydrazido ligands in these new compounds have been established by VT 1H NMR spectroscopy (VT = variable temperature). Preliminary data using Ta(NMe2)4[N(TMS)NMe2] as an ALD (ALD = atomic layer deposition) precursor for the preparation of tantalum nitride and tantalum oxide thin films are presented.
10
Parkes, Roberta Leigh. "Part A. Intrazeolite organometallic kinetics, Part B. Ligand effects on the structures of Rh¦6(CO)¦1¦4LL clusters." Thesis, National Library of Canada = Bibliothèque nationale du Canada, 2001. http://www.collectionscanada.ca/obj/s4/f2/dsk3/ftp05/MQ62943.pdf.
Full text
11
Durr, Christopher Blair. "The Effect of Metal Containing Ligands on The Metal-Metal Quadruple Bond: Structure, Synthesis, And Photophysics." The Ohio State University, 2015. http://rave.ohiolink.edu/etdc/view?acc_num=osu1429542171.
Full text
12
Hinch, Garry Dale. "Effect of ligand addition and substitution on metal-metal multiple bonds: Direct electronic structure comparisons via gas phase photoelectron spectroscopy." Diss., The University of Arizona, 1990. http://hdl.handle.net/10150/185132.
Full textAbstract:
Several series of complexes containing metal-metal and metal-heteroatom multiple bonds have been examined via gas-phase photoelectron spectroscopy to study the electronic structure effects resulting from simple ligand addition or substitution. Two types of complexes containing metal-metal multiple bonds form the basis of this study: complexes containing the M₂X₄P₄ core (where M = Mo, Re; X = halogen, Me; and P₄ = (PMe₃)₄ or [R₂P(CH₂)ₓPR₂]₂) and the dinuclear cyclopentadienyl metal carbonyl complexes [CpM(CO)ₓ]₂ (where M = Cr, Mo, W and x = 2,3). In the M₂X₄P₄ dimers two basic substitutions were examined. One involved changing the degree of rotation between the metal centers by varying the chelating phosphine ligand bridging the two centers. The other substitution involved varying the X ligand among Cl, Br, I, and Me on Mo₂ and Re₂ complexes with a monodentate phosphine, PMe₃. The synthesis and characterization of Re₂I₄ (PMe₃)₄, a previously unreported member of this series, is also described. For both of these substitutions, only very small changes were seen in the energy of the ionizations from orbitals involved in the metal-metal multiple bond. In the chelating phosphine complexes, changes in bandshape of the metal-based ionizations can be explained through the reduction in symmetry caused by placing the metals in a "staggered" configuration. For the monodentate phosphine complexes, the direction of the energy shifts which do occur indicate that changes in π-donor capability of the X ligand affect the metal-metal bonding to a greater extent than the changes in σ-donor capability. The effects of ligand addition to a metal-metal multiple bond (as in (CpM(CO)₂)₂) were examined, first by addition of one CO/metal, and then by insertion of a heteroatom into the multiple bond. In both cases, substantial energy shifts occur in related metal-based ionizations upon ligand addition. With CO addition, the M-M σ ionization is destabilized by ca. 1-2 eV, correlating with the longer M-M distances and increased reactivity in the (CpM(CO)₃)₂ systems. With the insertion of a chalcogen (S,Se) atom into the M-M triple bond of (CpCr(CO)₂)₂, the π-donor capability of the chalcogen results in M-heteroatom multiple bond character, though the PE spectra suggest that a full triple bond is not present.
13
Mao, Zhong. "Effects of copper-ligand and copper-copper interactions on excited state properties of luminescent copper (I) complexes : structural and photophysical studies /." View the Table of Contents & Abstract, 2003. http://sunzi.lib.hku.hk/hkuto/record/B26450859.
Full text
14
Mao, Zhong, and 毛中. "Effects of copper-ligand and copper-copper interactions on excited state properties of luminescent copper (I) complexes: structural and photophysical studies." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2003. http://hub.hku.hk/bib/B45015582.
Full text
15
Millán, Elías Cinthia Raquel. "Structural and functional studies of AT-Rich DNA ligands and their effect on trypanosoma brucei." Doctoral thesis, Universitat Politècnica de Catalunya, 2017. http://hdl.handle.net/10803/461498.
Full textAbstract:
AT-rich sequences confer unique properties to DNA, such as high polymorphism and flexibility. The abundance of AT-rich DNA in several pathogens' genomes and the ability of specific molecules to selectively target AT base pairs have prompted studies on ligands that interact with the minor groove of high AT content DNA. Of special interest are kinetoplastid parasites, such as Trypanosoma brucei, the causative agent of sleeping sickness, which are distinguished by the presence of a very AT-rich mitochondrial DNA structure called kinetoplast.
Minor groove binding ligands have offered critical information on DNA molecular recognition, providing clinically useful strategies against diseases. Thus, the binding affinity and structural characteristics of AT-rich oligonucleotides in complex with different ligands, specifically with HMG proteins and bisimidazolinium compounds, has been chosen as the object of study.
The `High Mobility Group¿ (HMG) is a family of architectural proteins that bind to DNA and influence a myriad of essential cellular processes. This research work has focused in two HMG subfamilies: HMGA and HMGB. They bind to the minor groove of the DNA by means of AT-hook (HMGA) or HMG-box (HMGB) domains. HMGA1a(50-91), HMGB1 box B and HMGB1 box AB have been expressed and purified. High similar binding affinity to an AT-rich DNA sequence containing [AATAAT_ATTATT] has been found by SPR¿biosensor experiments for both proteins. A d[CCAATAATCGCGATTATTGG]2-HMGB1 box B complex was crystallized. The diffraction patterns of the crystal at 2.68 Å resolution presented well-defined spots revealing two diffraction orientations.
A series of derivatives of FR60 [4-((4,5-dihydro-1H-imidazol-2-yl)amino)-N-(4-((4,5-dihydro-1Himidazol-2-yl)amino)phenyl)benzamide] have been proved to be high affinity DNA binders with a preference for AT over GC-rich DNA, showing slight selectivity towards sequences containing [AATT] versus [(AT)4] or [AATAAT_ATTATT]. Furthermore, competition assays have demonstrated that JNI18 competes with HMGA1a and HMGB1 for binding to DNA and it is able to displace the proteins from their DNA binding sites. This last interaction is of prime importance, as related proteins have been found to be essential in kinetoplastid parasites.
The structure of the bis(2-aminoimidazoline) compound CDIV32 with the oligonucleotide d[AAATTT]2 partially solved at 3.10 Å resolution, displays DNA columns of stacked oligonucleotides forming apseudo-continuous helix packed in a crossed column configuration of DNA helices that are at ~90° to each other. The presence of the drug CDIV32 modulates the organization of duplexes.
The crystal structure of the complex of the oligonucleotide d[AAATTT]2 with the lead compound FR60, solved at atomic resolution of 1.25 Å (PDB-ID: 5LIT) by X-ray crystallography, is constituted of stacked oligonucleotides organized as infinite continuous parallel columns, packed in a pseudo-tetragonal configuration. The structure revealed that the drug interacts with the central [AATT] region, covers the minor groove of DNA, displaces bound water and interacts with neighboring DNA molecules as a crosslinking agent.
Finally, a functional analysis has been performed on the effect of different bis(2-aminoimidazolines) on T.brucei (>70% AT kDNA) to assess whether parasite DNA was a target for these compounds. By a combination of flow cytometry and imaging techniques such as fluorescence microscopy and TEM, it was demonstrated that these compounds have a clear effect on the S-phase of T. brucei cell cycle by inflicting specific damage on the kinetoplast. It can be concluded that the studied DNA binding compounds FR60 and JNI18 are powerful trypanocides that act directly on the kinetoplast DNA. As the compounds show 100% curative activity in a mouse model of T. b. rhodesiense infection, they are potentially an effective chemotherapeutic agent for the treatment of sleeping sickness.<br>Las secuencias ricas en AT le confieren al ADN propiedades únicas como un alto polimorfismo y flexibilidad. Su abundancia en el genoma de varios patógenos y la selectividad de unión a secuencias AT que presentan ciertas moléculas, han llevado al estudio de ligandos que interactúan con el surco estrecho de DNA con alto contenido en AT. De especial interés son los parásitos kinetoplástidos, como el Trypanosoma brucei, agente causante de la enfermedad del sueño, los cuales se distinguen por la presencia de una estructura de ADN mitocondrial muy rica en AT llamada kinetoplasto. Los ligandos de unión al surco estrecho han ofrecido información primordial sobre el reconocimiento molecular del ADN, proporcionando estrategias terapéuticas útiles. Por ello, se ha elegido como objeto de estudio complejos de ADN ricos en AT con diferentes ligandos, específicamente con proteínas HMG y compuestos bisimidazolinio. Las HMG son una familia de proteínas arquitectónicas que se unen al ADN e influyen en numerosos procesos celulares esenciales. En este trabajo se han estudiado dos subfamilias de las HMG: HMGA y HMGB. Ambas se unen al surco estrecho del ADN mediante diferentes motivos de unión: AT-hook (HMGA) y HMG-box (HMGB). Se han expresado y purificado las formas HMGA1a(50-91), HMGB1 box B y HMGB1 box AB. Mediante SPR, ambas proteínas presentaron una afinidad de unión alta y similar hacia un ADN conteniendo la secuencia [AATAAT_ATTATT]. Se cristalizó el complejo d[CCAATAATCGCGATTATTGG]2- HMGB1 box B. La difracción a una resolución de 2.68 Å presentó reflexiones bien definidas que indicaban dos orientaciones preferenciales. Una serie de derivados del compuesto FR60 [4-((4,5-dihidro-1H-imidazol-2-il)amino)-N-(4-((4,5-dihidro-1H-imidazol-2-il)amino)fenil)benzamida] han demostrado ser ligandos de alta afinidad por secuencias AT con respecto a GC, mostrando cierta preferencia hacia secuencias con [AATT] comparado con [(AT)4] o [AATAAT_ATTATT]. Además, se ha demostrado que el JNI18 compite con la HMGA1a y la HMGB1 en su unión al ADN y es capaz de desplazar a dichas proteínas de sus sitios de unión al ADN. Este hecho es de especial relevancia, ya que se han encontrado proteínas relacionadas que son esenciales en parásitos kinetoplástidos. La estructura del compuesto de bis(2-aminoimidazolinio) CDIV32 con el oligonucleótido d[AAATTT]2 ha sido parcialmente resuelta a una resolución de 3.10 Å. Se encontraron columnas de oligonucleótidos apilados formando una hélice pseudo-continua, empaquetada en una configuración de columnas cruzadas perpendicularmente. La presencia del fármaco CDIV32 modula la organización de las hélices de ADN. Se ha resuelto la estructura cristalográfica del complejo d[AAATTT]2-FR60 a resolución atómica de 1.25 Å (PDB-ID: 5LIT). Se encontraron los oligonucleótidos apilados organizados en columnas infinitas y paralelas en una configuración pseudo-tetragonal. El fármaco interacciona con la región central [AATT], ocupa el surco estrecho del ADN, desplaza las moléculas de agua presentes e interactúa con moléculas de ADN vecinas como un agente entrecruzador. Finalmente, se ha realizado un análisis funcional del efecto de diferentes compuestos bis(2-aminoimidazolinio) en T. brucei (con >70% de AT en su kDNA) para evaluar si el ADN del parásito es una diana para estos compuestos. Se ha estudiado su efecto in vitro mediante una combinación decitometría de flujo y técnicas como microscopía de fluorescencia y TEM. Los resultados permitieron demostrar que estos compuestos tienen un efecto claro sobre la fase S del ciclo celular de T. brucei al dañar específicamente el kinetoplasto. Se ha podido concluir que los compuestos FR60 y JNI18 son potentes tripanocidas que actúan directamente sobre el ADN del kinetoplasto. Ya que los compuestos muestran una actividad curativa del 100% en un modelo de ratón infectado por T. b. rhodesiense, representan un agente quimioterapéutico potencialmente eficaz para el tratamiento de la enfermedad del sueño.
16
Abbas, Haider. "Expression of sigma receptors in human cancer cell lines and effects of novel sigma-2 ligands on their proliferation." Thesis, University of Wolverhampton, 2018. http://hdl.handle.net/2436/621768.
Full textAbstract:
Sigma receptors originally thought to be an opioid receptor is now categorized as a distinct class of receptor. There are two main subtypes, the sigma-1 receptor and an uncharacterised binding site, named the sigma-2 binding site. The presence of the sigma-2 binding site shows high correlation with proliferation of cells and is associated with cancer. I have categorized sigma-1 and sigma-2 binding sites in 11 human tumour cell lines. I have demonstrated that tumour cell lines from a range of tissues express both sigma-1 and sigma-2 binding sites. One exception is the MCF7 breast cancer cell line, which lacks sigma-1 receptors. I show that the quantitation of sigma-2 binding sites using the "masking" protocols are flawed, significantly overestimating levels of sigma-2 binding sites. I propose novel protocols to determine levels of sigma-1 receptors and sigma-2 binding sites in cell lines and tissue. Using radioligand binding assays in MCF7 cells, I have characterised novel sigma-2 ligands. These ligands are simple ammonium salts containing a single nitrogen atom. They are simpler than the previously recognised pharmacophore for the sigma-2 site. I have shown that these simple ammonium salts show graded affinity for the sigma-2 binding site. The highest affinity ligands were dihexylammonium (pKi 7.58) and dioctylammonium (pKi 7.9). I have used these ammonium salts and previously characterised ligands to determine sigma-2 binding site biology. I have shown that the biological activity of these drugs is related neither to their hydrophobicity nor their ability to effect calcium signalling in cells. I propose that the Hill slope of binding is inversely related to the efficacy of a ligand to inhibit metabolic activity of cancer cells. Furthermore, I offer an explanation as to why concentrations of sigma-2 ligands far higher than their determined binding affinities are required to inhibit metabolic activity.
17
Trabelsi, Mohamed. "Synthèse d'une nouvelle série de spiroarsoranes à ligands catécholamide. Activités antifilarienne et trypanocide." Toulouse 3, 1992. http://www.theses.fr/1992TOU30113.
Full textAbstract:
Les travaux qui font l'objet de cette these sont consacres a la mise au point d'une nouvelle serie de spiroarsoranes a ligands catecholamide, inclus ou non dans des structures macrocycliques. La presence d'une fonction amide et d'une molecule d'eau dans ces structures leur confere des caracteristiques physicochimiques particulieres. Une etude en resonance magnetique nucleaire dynamique de ces composes pentacoordines a permis la mise en evidence d'une labilite structurale qui se traduit par la mise en jeu de plusieurs formes en equilibre. Ceci est lie a l'intervention de plusieurs phenomenes dont la stereomutation, propre aux structures pentacoordines, l'isomerie cis/trans, imposee par la substitution du noyau phenyle des ligands, et le caractere de double liaison de la fonction carbone-azote amide. Du point de vue biologique, les spiroarsoranes ont deja montre de bonnes activites antiparasitaire, antifongique et antitoxoplasmique. Cette nouvelle serie, dont le but est d'ameliorer leurs performances, a permis de reveler une activite antifilarienne, in vitro, tres interessante, meilleure que celle des spiroarsoranes de premiere generation et celle du mel w pris comme reference lors des tests biologiques. Les tests de cytotoxicite, in vitro, realises sur des cellules buccale et hepatique, montrent que les produits les plus actifs restent peu toxiques comparativement au meme produit de reference
18
Cantalupo, Stefanie A. "Structural and electronic effects of mono- and bidentate perfluorinated alkoxide ligands in late first-row transition metal complexes." Thesis, Boston University, 2013. https://hdl.handle.net/2144/12725.
Full textAbstract:
Thesis (Ph.D.)--Boston University
PLEASE NOTE: Boston University Libraries did not receive an Authorization To Manage form for this thesis or dissertation. It is therefore not openly accessible, though it may be available by request. If you are the author or principal advisor of this work and would like to request open access for it, please contact us at open-help@bu.edu. Thank you.<br>Seven homoleptic first-row transition metal complexes were prepared with the perfluoro-t-butoxide ligand with three- and four-coordinate geometry. The compounds were prepared via metathesis reactions with the form [M(OC4F9)3]-, M = Mn (1), Fe (2), Co (5), and Zn (7); [M(OC4F9)4]n-, M = Fe (4), Co (6); and the THF adducts [M(THF)(OC4F9)3]- M = Co (5-TBF), and Zn (7-THF). The complexes were synthesized and structurally characterized. Spectroscopic characterization with UV-vis, NMR, and IR will be discussed. Cyclic voltammetry studies of 5 and 6 in conjunction with UV-vis data show the presence of an equilibrium between the three- and four-coordinate complexes with ligand association and dissociation.
Using the bidentate perfluorinated pinacolate ligand, ddfp, three complexes were prepared as [M(ddfp)2]2-, in which M =Fe (8), Co (9), and Zn (10). Complexes 8 and 9 have square-planar geometry and are high-spin. The magnetism was studied both in solution and the solid state. The combination of geometry and spin-state is rare for {M04} complexes and 9 is the first example of {C0O4} with this combination, and 8 is the second example of this combination in an {FeO4} system. A five-coordinate Co complex was also structurally characterized (9-OH2).
A family of heteroleptic complexes of the form [Fe(X)(OC4F9)3]- in which X = Cl (11), Br (12), or pyridine (13), and [M(py)(ddfp)2]2- for M= Co (14), and Fe (15), were prepared and some were structurally characterized. Analytical data suggests the formation of an iron-amide complex, [Fe(HN(C6H5)(ddfp)2]3-, (16), capable of further reactivity. The synthesis, characterization, and preliminary reactivity studies will be discussed.
Two iron aryloxide complexes were synthesized with the pentafluorophenolate ligand, [Fe(OArF)4]2-, (17) and [(OArF)3Fe(μ2-OArF)2Fe(OArF)3]2-, (18). The FeIII complex was formed as a result of presumed ligand oxidation and dissociation, highlighting the vulnerability of aryloxide ligands.
A series of isotopically labeled compounds containing a short, strong hydrogen bond were prepared and characterized for neutron diffraction experiments. The compounds, [Cp2Co][D(OAr5)], (19) and d10-[Cp2Co][H(OAr')], (20), were prepared with the partially fluorinated OAr' ligand, bis-(3,5-trifluoromethyl)phenoxide. The synthesis and characterization of these compounds will be discussed.
19
Thirumaran, Sangeetha-Laura. "Polypharmacologie des récepteurs mélatoninergiques et sérotoninergiques à visée thérapeutique Structure-activity relationships of serotonin 5-HT 7 receptors ligands: A review." Thesis, Normandie, 2020. http://www.theses.fr/2020NORMC406.
Full textAbstract:
Un des enjeux actuels de santé publique est de proposer de nouvelles stratégies pour le traitement de pathologies neurodégénératives et neuropsychiatriques qui, de part leurs origines multifactorielles, restent difficiles à traiter. Ces dernières décennies ont vu l’émergence d’une nouvelle alternative thérapeutique prometteuse, en vue d’obtenir non seulement une action préventive mais aussi curative : la polypharmacologie. Des effets neuroprotecteurs et pro-cognitifs ont ainsi été mis en évidence in vivo par la modulation simultanée de différentes cibles biologiques impliquées dans la physiopathologie de ces maladies, tels que les récepteurs MT1, MT2 et 5-HT2C. Ce projet s’est d’abord focalisé sur la détermination des relations structure-activité d’une chimiothèque interne, composée de MTDLs ciblant les récepteurs MT1, MT2 et 5-HT2C, avec parfois une activité complémentaire envers les récepteurs 5-HT7, à visée anti-dépressive. Le recours à diverses approches de chémoinformatique et de modélisation moléculaire a permis, dans un second temps, de concevoir et synthétiser, via une démarche pharmacochimique, des ligands originaux, affins et sélectifs, d’une part des récepteurs MT2 et 5-HT2C, à visée promnésiante et anti-dépressive, et d’autre part des récepteurs 5-HT7. Parmi les molécules synthétisées, certains composés se sont révélés particulièrement d’intérêt pour la modulation de ces cibles<br>One of the current public health challenges is to propose new strategies for the treatment of neurodegenerative and neuropsychiatric diseases which, due to their multifactorial causes, remain difficult to treat. Over the last decades, a new and promising therapeutic alternative has been developed, with the aim to obtain not only a preventive action but also a curative action: the polypharmacological approach. Several in vivo assays have demonstrated the neuroprotective and pro-cognitive effects caused by the simultaneous modulation of different biological targets involved in the pathophysiology of these disorders, such as MT1, MT2 and 5-HT2C receptors. This project firstly focused on the determination of the structure-activity relationships of an in-house chemical library, constituted of MT1, MT2 and 5-HT2C receptors MTDLs, with additional activity towards 5-HT7 receptors for some derivatives, and with anti-depressive properties. The use of various chemoinformatics and molecular modeling approaches allow then to design and synthesize, by pharmacomodulation, original, potent and selective ligands, on the one hand of MT2 and 5-HT2C receptors, with potential pro-cognitive and antidepressive actions, and on the other hand of 5-HT7 receptors. Among the synthesized molecules, some compounds are of particular interest for the modulation of these targets
20
El, hellani Ahmad. "Evaluation of The Electronic Properties of Carbon(0)-Based Compounds Through Gold Catalysis and X-Ray Structure Analysis." Thesis, Paris 11, 2012. http://www.theses.fr/2012PA112252.
Full textAbstract:
La plupart des composés organiques ont un atome de carbone tétravalent, où tous les électrons de valence sont utilisés pour former des liaisons covalentes. En parallèle, la chimie des composés divalents ayant un carbone(II) s’est développée après l’isolement de carbènes stables par Bertrand en 1985. Auparavant, en 1961, Ramirez a rapporté l’isolement de l’hexaphénylcarbodiphosphorane, que l’on peut considérer comme un composé présentant un carbone(0) avec ses deux doublets libres, lui permettant de coordiner jusqu’à deux acides de Lewis. A partir de 2006, les propriétés électroniques de ces ligands ont été étudiées au travers d’études théoriques par Frenking ; ce qui a permis à Bertrand et Fürstner d’isoler et d’ajouter des nouveaux membres à cette famille. Cette classe de ligand est aujourd’hui connue sous le nom de “carbônes”, avec comme formule générale CL2 (L = PR3 ou carbène).Cette famille n’a jamais été utilisée dans le domaine de la catalyse. C’est pourquoi nous avons, décidé d’etudier les propriétés électroniques de ce ces composés au travers de la catalyse à l’or, afin de les comparer aux NHC, phosphines, et phosphites. Récemment, nous avons utilisé ces composés pour générer des complexes donneur accepteur avec du GaCl3, et de corréler leurs différentes caractéristiques géometriques à leurs propriétés électroniques en utilisant les règles de Gutmann sur des adduits acide/base de Lewis. De plus, nous avons isolé des “dimères” ioniques dont la formation peut être expliquée par les propriétés intrinsèques des ligands. Nous avons ainsi démontré par ces deux approches que les “carbônes” sont de meilleurs donneurs que les NHC<br>Most organic compounds which are stable in the condensed phase contain tetravalent carbon atoms, where all four valence electrons are being engaged in chemical bonds. On the other hand, the chemistry of divalent carbon(II) was only recognized after the isolation of a stable persistent carbene by Bertrand and co-workers in 1985. Such products display one s-type lone pair orbital and are thus good ligands. Earlier on, concern was also paid to a new family of compounds, first reported in 1961 by Ramirez and co-workers. They can be considered as divalent carbon(0) derivatives with two lone pairs at the central carbon, with a possibility of double coordination of two Lewis acids to this carbon. This feature was proposed by Kaska in 1973, and verified later by the isolation of di-metalated adducts. From 2006, these compounds were the centre of extensive theoretical investigations by Frenking, which led to the isolation of new members of this family by Fürstner and Bertrand. This family is now referred to as “carbones”, of general formula CL2 (L =PR3 or carbene).“Carbones” are still virtually unused in catalysis. Thus, we have decided to study these derivatives, especially in the field of gold catalysis, and to compare them with well-known ligands such as NHCs, phosphines and phosphites. Recently, we were able to synthesize their corresponding GaCl3 complexes and to rationalize their electronic properties through Gutmann’s rules for Lewis acid/Lewis base adducts. In addition, we obtained some ionic “dimers” and we explained their formation on the basis of ligand’s electronic properties. We have shown through these two approaches that carbones are far better donors than NHCs
21
Zhao, Simin. "The effects of organic ligands on biotic oxidation of structural Fe(II) in reduced nontronite by Pseudogulbenkianiasp. strain 2002." Miami University / OhioLINK, 2019. http://rave.ohiolink.edu/etdc/view?acc_num=miami1556873530093781.
Full text
22
Delacroix-Beaurain, Nathalie. "Conception et synthèse de dérivés benzothiopéniques impliquant les mécanismes mélatoninergiques." Lille 2, 2001. http://www.theses.fr/2001LIL2P004.
Full text
23
Benghalia, Abdelmadjid. "Contribution à la modélisation bidimensionnelle de lignes micro-coplanaires sur substrat semiconducteur : application au transistor à effet de champ." Toulouse, INPT, 1989. http://www.theses.fr/1989INPT040H.
Full textAbstract:
Cet ouvrage concerne l'etude et la modelisation des structures a ondes lentes en lignes micro-coplanaires deposees en contact schottky sur substrat semiconducteur, ainsi que l'etude en statique et en dynamique des transistors a effet de champ utilises en microondes. L'originalite de l'approche theorique reside dans l'obtention d'une fonction de green par la technique de transformation conforme qui tient compte de la forme exacte de la structure physique. Cette fonction est utilisee pour inverser l'operateur laplacien conduisant a la resolution de l'equation de poisson et l'equation integrale resultante est traitee numeriquement par la methode des moments. La resolution de systemes d'equations permet de calculer avec precision et dans une approche bidimensionnelle, le profil de la zone depeuplee et la distribution de charges sur le conducteur. Ceci permet d'etablir le schema equivalent d'une unite de longueur de la structure et de caracteriser la propagation des ondes lentes en mode quasi tem le long de la ligne coplanaire. Son application aux transistors a effet de champ en microondes a permis de caracteriser ces dispositifs en statique et en dynamique en tenant compte de la propagation d'une onde lente le long de la grille du transistor
24
López, Muñoz Laura. "Homology modeling and structural analysis of the antipsychotic drugs receptorome." Doctoral thesis, Universitat Pompeu Fabra, 2010. http://hdl.handle.net/10803/7228.
Full textAbstract:
Classically it was assumed that the compounds with therapeutic effect exert their action interacting with a single receptor. Nowadays it is widely recognized that the pharmacological effect of most drugs is more complex and involves a set of receptors, some associated to their positive effects and some others to the side effects and toxicity. Antipsychotic drugs are an example of effective compounds characterized by a complex pharmacological profile binding to several receptors (mainly G protein-coupled-receptors, GPCR). In this work we will present a detailed study of known antipsychotic drugs and the receptors potentially involved in their binding profile, in order to understand the molecular mechanisms of the antipsychotic pharmacologic effects.<br/><br/>The study started with obtaining homology models for all the receptors putatively involved in the antipsychotic drugs receptorome, suitable for building consistent drug-receptor complexes. These complexes were structurally analyzed and compared using multivariate statistical methods, which in turn allowed the identification of the relationship between the pharmacological properties of the antipsychotic drugs and the structural differences in the receptor targets. The results can be exploited for the design of safer and more effective antipsychotic drugs with an optimum binding profile.<br>Tradicionalmente se asumía que los fármacos terapéuticamente efectivos actuaban interaccionando con un único receptor. Actualmente está ampliamente reconocido que el efecto farmacológico de la mayoría de los fármacos es más complejo y abarca a un conjunto de receptores, algunos asociados a los efectos terapéuticos y otros a los secundarios y toxicidad. Los fármacos antipsicóticos son un ejemplo de compuestos eficaces que se caracterizan por unirse a varios receptores simultáneamente (principalmente a receptores unidos a proteína G, GPCR). El trabajo de la presente tesis se ha centrado en el estudio de los mecanismos moleculares que determinan el perfil de afinidad de unión por múltiples receptores de los fármacos antipsicóticos.<br/><br/>En primer lugar se construyeron modelos de homología para todos los receptores potencialmente implicados en la actividad farmacológica de dichos fármacos, usando una metodología adecuada para construir complejos fármaco-receptor consistentes. La estructura de estos complejos fue analizada y se llevó a cabo una comparación mediante métodos estadísticos multivariantes, que permitió la identificación de asociaciones entre la actividad farmacológica de los fármacos antipsicóticos y diferencias estructurales de los receptores diana. Los resultados obtenidos tienen interés para ser explotados en el diseño de fármacos antipsicóticos con un perfil farmacológico óptimo, más seguros y eficaces.
25
Yahya, Raïda. "Etudes thermodynamiques de la protonation et de la complexation de cryptands et d'amino-3 pyridazines." Université Louis Pasteur (Strasbourg) (1971-2008), 1986. http://www.theses.fr/1986STR13069.
Full text
26
Klenowski, Paul Mark. "Molecular and structural requirements of the ß1L-adrenoceptor." Thesis, Queensland University of Technology, 2012.
Find full textAbstract:
Noradrenaline which occurs naturally in the body binds to beta-adrenoceptors on the heart, causing the heart to beat faster and with greater force in response to increased demand. This enables the heart to provide oxygenated blood to vital organs. Prolonged overstimulation by noradrenaline can be harmful to the heart and lead to the progression of heart disease. In these circumstances beta-adrenoceptors are blocked with drugs called beta-blockers. Beta-blockers block the effects of noradrenaline by binding to the same site on the beta-adrenoceptor. Some beta-blockers such as CGP12177 can also cause increases in heart rate. Therefore it was proposed that CGP12177 could bind in a different place to noradrenaline. The aim of this study was to determine where CGP12177 binds to on the beta-adrenoceptor. The results have revealed a separate binding site named beta-1-low. These results may lead to the development of improved -blockers for the management of heart conditions.
27
Oberoi, Chauhan Moni. "Analogies silicium-phosphore. Etude de composés hexacoordonnés du phosphore. Stabilisation d'espèces très réactives du silicium et du phosphore." Montpellier 2, 1996. http://www.theses.fr/1996MON20112.
Full textAbstract:
Une etude de l'extension de coordination au niveau des atomes de phosphore et de silicium a ete realisee grace au ligand monochelatant le 8-dimethylaminonaphtyle et au ligand potentiellement bis-chelatant le 2,6-bis (dimethylamino)methylphenyle. Une etude detaillee en rmn du #1h a temperature variable a permis de mettre en evidence un phenomene d'isomerisation permutationnelle non-dissociatif sur certains de ces composes. Les ions silylium et phosphenium qui sont des especes tres instables ont ete prepares et leur nature exacte a ete determine par rmn (#3#1p ou #2#9si, #1#3c) et spectroscopie de masse
28
Pérollier, Céline. "Synthèse de nouvelles métalloporhyrines chirales à substituants cyclopropaniques : applications en catalyse d'époxydation asymétrique et en reconnaissance moléculaire d'enantiomères." Université Joseph Fourier (Grenoble ; 1971-2015), 1998. http://www.theses.fr/1998GRE10191.
Full textAbstract:
Le biocartol ou acide (1r)-cis-hemicaronaldehydique, un compose cyclopropanique enantiopur provenant de la synthese industrielle d'insecticides pyrethroides, est utilise comme synthon pour la preparation de nouvelles porphyrines chirales. Nous decrivons la synthese d'amides du biocartol, puis la synthese des porphyrines correspondantes par condensation avec le pyrrole. Celles-ci sont obtenues exclusivement sous la forme de l'atropoisomere , avec un rendement variant de 7 a 60%. Une serie de complexes de manganese (iii) de ces chiroporphyrines, derivees d'amides et d'esters du biocartol, ont ete prepares. Ces complexes sont de bons catalyseurs pour l'epoxydation asymetrique d'olefines prochirales. Les substrats a structure rigide cyclique sont epoxydes avec la plus grande selectivite. Ainsi, des exces enantiometriques allant jusqu'a 86% ont ete obtenus pour l'epoxydation du 1,2-dihydronaphtalene en (1s, 2r)-epoxy-1,2,3,4-tetrahydronaphtalene. L'influence de differents facteurs (nature des substituants, solvant, ligand axial, metal) sur la reactivite et l'enantioselectivite ont ete etudies. Des etudes structurales par resonance magnetique nucleaire et par diffraction des rayons x ont permis d'etablir une correlation entre structure et induction asymetrique dans cette serie. Nous avons mis en evidence que l'encombrement sterique au niveau du centre metallique lors de l'epoxydation est le determinant principal de l'enantioselectivite. Ces resultats sont interpretes par un modele geometrique de l'approche de l'olefine vers le centre metallique. La complexation d'amines derivees d'olefines prochirales par les chiroporphyrines de cobalt (iii) a egalement ete etudiee.
29
Diantouba, Bertin Aimé. "Effets structuraux des acyl-4-pyrazolones-5 dans l'extraction liquide-liquide des cations metalliques divalents." Université Louis Pasteur (Strasbourg) (1971-2008), 1988. http://www.theses.fr/1988STR13093.
Full textAbstract:
Etude de l'effet de l'acidite de la lipophilie et effets structuraux des acyl-4 pyrazolones-5 dans l'extraction de cu, co, zu et pb divalents. Extraction de 3 types de complexes metalliques : mononucleaires de type m(l-n-lh)::(2) ou m(l-n-l) et polynucleaires (m(l-n-l))::(j). Meilleures possibilites des bis-acyl-4 pyrazolones-5
30
Safsaf, Abdelaziz. "Etude structurale par diffraction des rayons x d'un phosphonate et de quelques hydroxydiphosphonates." Paris 13, 1989. http://www.theses.fr/1989PA132001.
Full textAbstract:
Pour les acides phosphoniques, diphosphoniques et diphosphonates organiques acides, la corrélation entre la longueur p-oh et la distance oh. . . O est linéaire. Les molécules d'éthanédiphosphonate-1,1 (hydroxy-1 "0,0,0',o'"-tetramethyl) et les molécules dérivées, possedent une relative flexibilité (corrélation linéaire entre l'angle p-c-p et le décalage des deux groupes acides phosphoniques)
31
Samson, Samantha. "Profilage in silico de la protéine multifonctionnelle Mfd, une cible thérapeutique innovante dans la lutte contre l'antibiorésistance bactérienne." Electronic Thesis or Diss., université Paris-Saclay, 2024. http://www.theses.fr/2024UPASL125.
Full textAbstract:
Face à la montée préoccupante de la résistance aux antibiotiques, la recherche de nouveaux antimicrobiens constitue un enjeu de santé urgent. Nous avons identifié la protéine bactérienne Mutation Frequency Decline (Mfd) comme étant une cible thérapeutique innovante pour le développement de nouveaux médicaments. Un criblage in silico à haut débit a été réalisé, dans un premier temps, afin de sélectionner des molécules pouvant se lier spécifiquement au site actif de la protéine et inhiber son activité, empêchant donc la résistance bactérienne face au stress immunitaire de l'hôte. Les molécules identifiées se sont révélées efficaces in vitro et efficaces et non toxiques in vivo, dans un modèle d'infection chez l'insecte, sur au moins deux pathogènes bactériens. Ces données préliminaires ont constitué une preuve de concept du potentiel innovant de ces molécules et ont également servi de base aux travaux présentés dans cette thèse.L'objectif principal de ce travail était l'identification des interactions moléculaires critiques entre ces molécules inhibitrices et le site actif de Mfd chez E. coli, ainsi que l'élargissement de cette analyse aux pathogènes prioritaires du groupe ESKAPE. En conséquence de quoi, un modèle optimal d'inhibiteur a été déterminé et ses dérivés sont actuellement testés in vitro et in vivo en tant que potentiels agents antimicrobiens. En parallèle, l'analyse de la séquence et de la structure de Mfd, provenant de souches environnementales et cliniques, met en évidence les caractéristiques d'une corrélation moléculaire entre la séquence de Mfd et le phénotype de virulence du pathogène. La confirmation in vitro est actuellement en cours d'évaluation. Enfin, mon objectif final est de repositionner la fonction motrice de Mfd dans un cadre plus large de remodelage conformationnel et fonctionnel afin de mieux comprendre cette cible et son rôle dans la réparation par excision de nucléotides. En produisant plusieurs simulations de dynamique moléculaire sur des « linkers » clés qui relient les principaux modules fonctionnels de Mfd, l'investigation de leur flexibilité intrinsèque et de leur conservation vise à récapituler le remodelage extensif des conformations de Mfd au cours de son cycle fonctionnel, tel qu'il a été décrit précédemment par cryo-EM. Cela a pour but de documenter dans quelle mesure ces linkers, qui relient cette protéine multi-modulaire, sont plus que de simples "connecteurs" et portent, dans leur séquence et leur longueur, des propriétés internes leur permettant d'adopter des états discrets garantissant la transition boucle-hélice nécessaire au bon fonctionnement de Mfd<br>In an alarming context of antibiotic resistance, the search for new antimicrobials is an urgent health issue. We had identified the bacterial protein Mutation Frequency Decline (Mfd) as an innovative target for the development of new drugs. A high throughput in silico screening was initially performed in order to select molecules specifically binding to the active site of the target and inhibiting its activity, thereby preventing bacterial resistance to host immune stress. The identified hits were shown to be efficient in vitro and efficient and non-toxic in vivo, in an insect model of infection on at least two bacterial pathogens. These preliminary data have constituted a proof of concept of the innovative potential of these hits and were also the basis of this thesis.The main objective of this work was the identification of the critical molecular interaction found between those hits and the active site of Mfd in E. coli and also enlarged to the priority pathogens of the ESKAPE group. As a result, an optimal inhibitor scaffold was determined and its derivatives are currently tested in vitro and in vivo as potential antimicrobial agents. In parallel, the sequence and structure analysis of Mfd, from environmental and clinical strains, showcase the basic features of a molecular correlation between Mfd sequence and virulence phenotype. The in vitro confirmation is currently being evaluated. Finally, my goal reposition this motor function of Mfd into a larger conformational and functional remodeling of Mfd in order to get a better understanding of this target and its role in the Nucleotide Excision Repair. Using molecular dynamics simulation on distinguished linkers that connect the main functional modules of Mfd, the investigation of their intrinsic flexibility and resilience to recapitulate the extensive remodeling of Mfd conformations within its functional cycle that has been previously described by cryo-EM. This aims to document to which extent the linkers that connect this multi-module protein are more than "linkers" and harbor, in their sequence and length, internal properties to adopt discrete states that guarantee disorder-to-coil transition to assure the functional machinery of Mfd
32
AKAABOUNE, NOR-EDDINE. "Diagramme de phase (H,T) du supraconducteur organique (TMTSF)2ClO4 faiblement désordonné." Phd thesis, Université Paris Sud - Paris XI, 2002. http://tel.archives-ouvertes.fr/tel-00002215.
Full textAbstract:
Nous avons procédé dans cette thèse, à l'étude de la phase supraconductrice du composé organique quasi unidimensionnel, (TMTSF)2ClO4, dans son état relaxé et dans son état faiblement désordonné en se servant de la vitesse de refroidissement comme paramètre modifiable au passage de la température de transition de la mise en ordre des anions à TAO=24K comme c'est montré par les mesures de rayons X. Des mesures de transport électronique linéaire (mesure de résistivité) et non linéaire (V-I) ont été effectuées en injectant un courant le long de l'axe c de plus faible conduction et sous champ magnétique appliqué perpendiculairement (H//c) et parallèlement (H//b) aux plans supraconducteurs. Dans l'état relaxé, nous avons déterminé, pour la première fois, le diagramme de phase de vortex à partir des mesures de résistivité interplans et sous champ H//c, en établissant les différentes lignes caractéristiques de ce diagramme de phase (ligne du champ critique, ligne de fusion, ). L'analyse des courants critiques et des fluctuations supraconductrice nous révèlent bien clairement l'existence de fluctuations dont le caractère est de nature tridimensionnelle (3D). L'extrapolation de Hc2(T) à T=0K nous donne Hc2(0)=0.19T. Dans l'état liquide de vortex, au dessus de la température de fusion, l'analyse des courbes de résistivité électrique nous révèle un comportement thermiquement activé dans le modèle de TAFF (thermally activated flux flow) décrit par la loi d'Arrhenius. Nous avons fini l'étude de l'état liquide de vortex par une analyse de l'énergie d'activation. Nous avons trouvé une dépendance en 1/H de l'énergie d'activation indiquant une caractéristique liée à la déformation plastique des lignes de flux tridimensionnelles à cause vraisemblablement des joints de grains apparaissant lors du refroidissement. Cette dépendance est en faveur de l'anisotropie modérée dans notre composé. Les mesures de résistivité en champ magnétique appliqué le long de l'axe b de conduction modérée(H//b) montre une survie de la supraconductivité à très fort champ magnétique Cette possible survie de la supraconductivité, peut être expliquée par le changement de la dimensionnalité effective du système 3D vers 2D, résultant de la réduction de la longueur de cohérence supraconductrice à très fort champ magnétique. Le changement de la dimensionnalité 3D vers 2D à partir d'un champ de découplage évalué à H*=1T, s'accompagne d'une transition métal- isolant. A ce champ correspond une température de découplage des plans qui est de 0.65K. L'augmentation du désordre introduit par la vitesse de refroidissement montre une augmentation du champ critique supérieur, une ligne de fusion qui se décale vers les plus basses températures et une diminution de la longueur de corrélation des lignes de flux selon la direction la plus faiblement conductrice.
33
Sanders, Rachel Sarah. "Aminocyclodextrin ion channels : development of a model for ligand gating and investigations of the effects of channel structure on transport properties and ion selectivity /." 2006. http://gateway.proquest.com/openurl?url_ver=Z39.88-2004&rft_val_fmt=info:ofi/fmt:kev:mtx:dissertation&res_dat=xri:pqdiss&rft_dat=xri:pqdiss:3223711.
Full textAbstract:
Thesis (Ph. D.)--University of Illinois at Urbana-Champaign, 2006.<br>Source: Dissertation Abstracts International, Volume: 67-07, Section: B, page: 3809. Adviser: Mary S. Gin. Includes bibliographical references. Available on microfilm from Pro Quest Information and Learning.
34
Chang, Miao-Ning, and 張妙寧. "Synthesis, Structures and Properties of Divalent Coordination Polymers Containing Bis-pyridyl-bis-amide and Polycarboxylate Ligands: Metal and Ligand Effect." Thesis, 2017. http://ndltd.ncl.edu.tw/handle/249x5s.
Full textAbstract:
碩士<br>中原大學<br>化學研究所<br>105<br>Ten divalent coordination polymers constructed from polycarboxylic acids and flexible bis-pyridyl-bis-amide ligands with different lengths and donor atom positions, {[Ni(L1)(3,5-PDA)(H2O)3]·2H2O}n (L1 = N,N’-di(3-pyridyl)suberoamide, 3,5-H2PDA = 3,5-pyridinedicarboxylic acid), 1, {[Ni2(L1)2(1,3,5-HBTC)2(H2O)4]·H2O}n (1,3,5-H3BTC = 1,3,5-benzenetricarboxylic acid), 2, {[Ni(L2)(5-tert-IPA)(H2O)2]·2H2O}n (L2 = N,N’-di(3-pyridyl)adipoamide, 5-tert-H2IPA = 5-tert-butylisophthalic acid), 3, [Ni(L3)1.5(5-tert-IPA)]n (L3 = N,N’-di(4-pyridyl)adipoamide), 4, [Co(L1)(1,3,5-HBTC)(H2O)]n, 5, {[Co3(L1)3(1,3,5-BTC)2(H2O)2]·6H2O}n, 6, [Cu(L4)(AIPA)]n (L4 = N,N’-bis(3-pyridinyl)terephthalamide, H2AIPA = 5-acetamido isophthalic acid), 7, {[Cu(L2)0.5(AIPA)]·MeOH}n, 8, {[Zn(L4)(AIPA)]·2H2O}n, 9, {[Zn(L2)(AIPA)]·2H2O}n, 10, were synthesized by hydrothermal reactions. These complexes were structurally characterized by using single-crystal X-ray diffraction and their properties investigated by using powder X-ray diffraction and thermal gravimetric analysis.
Complex 1 forms a 1D chain, while complex 2 is a 2D layer with the sql topology. The bis-pyridyl-bis-amide ligands in 3 and 4 show different donor atom positions, resulting in a 2D layer with the 63 topology and a 3D network with the (42·67·8) topology, respectively. Different amounts of polycarboxylic acids in the preparations for complexes 5 and 6 were used, affording a 2D layer with the sql topology and a 2D network with the (4·85)2(4)2(83)2(8) topology, which can be further simplified to a 63 topology. Complexes 7 - 10 were prepared by the use of neutral ligands with different flexibility. While complex 7 is a 2D layer with the sql topology and complex 8 is a 2-fold interpenetrated 3D framework with the pcu topology, complexes 9 and 10 are 3D frameworks with the 8T2 and the (44·610·8) topologies, respectively. The emission properties and catalytic effect on the photodegradation of dye of some of the complexes are also discussed.
35
Panay, Escobar Aram Joel. "Mechanistic and Structural Studies of Phenylalanine Hydroxylase from Chromobacterium violaceum." Thesis, 2010. http://hdl.handle.net/1969.1/ETD-TAMU-2010-08-8584.
Full textAbstract:
The phenylalanine hydroxylase from Chromobacterium violaceum (CvPheH) is a
non-heme iron monooxygenase that catalyzes the hydroxylation of phenylalanine. This
study presents the use of kinetic isotope effects (KIE) as mechanistic probes to compare
the reactivity of CvPheH and that of the eukaryotic aromatic amino acid hydroxylases.
This study also describes the use of different spectroscopic and kinetic techniques to
identify the hydroxylating intermediate for this enzyme and the assignment of the NMR
backbone resonances of CvPheH.
Kinetic isotope effects on aromatic and benzylic hydroxylation were used to
establish that bacterial and eukaryotic phenylalanine hydroxylases have similar
reactivity. The observed KIE on aromatic hydroxylation of 1.4 was shown to be a
combination of an inverse isotope effect on the hydroxylation of the amino acid and a
normal isotope effect on a subsequent step in the reaction. An isotope effect on benzylic
hydroxylation of 10 was found for CvPheH. This result establishes the similar reactivity
for CvPheH and the eukaryotic aromatic amino acid hydroxylases and suggests the
involvement of a common hydroxylating intermediate.
Kinetic isotope effects were used to study the hydroxylation of the aliphatic
substrate cyclohexylalanine. The Dkcat value with [1,2,2,3,3,4,4,5,5,6,6-2H11]-
cyclohexylalanine is unity with wild-type CvPheH, suggesting that chemistry is not ratelimiting
with this substrate. The intramolecular isotope effect calculated using
[1,2,3,4,5,6-2H6]-cyclohexylalanine yields a value of 14. This result is evidence for the
involvement of a reactive iron species capable of abstracting a hydrogen atom from the
aliphatic carbon in cyclohexylalanine.
Analysis of the CvPheH reaction using freeze-quench Mössbauer spectroscopy
allowed the detection of an Fe(IV) species in the first turnover of the enzyme. Chemical
quench and stopped-flow spectrophotometric methods were used to establish the kinetic
competency of the Fe(IV) intermediate as the hydroxylating species.
The NMR amide backbone resonances in the HSQC spectrum of CvPheH were
assigned to the corresponding amino acid residues using a suite of TROSY-based threedimensional
triple resonance experiments. We were able to assign 224 residues out of
the 278 assignable residues in CvPheH, this constitutes 81 percent of the assignable protein
sequence.
36
Chien-ChihChang and 張健智. "Effect of ligand length on the structure of block copolymer/nanoparticle composite thin film." Thesis, 2010. http://ndltd.ncl.edu.tw/handle/51886857214816765122.
Full textAbstract:
碩士<br>國立成功大學<br>化學工程學系碩博士班<br>98<br>Thin films of nanocomposites composed of polystyrene-b-poly(2 vinylpyridine) (PS-b-P2VP) and different molecular weights of thiol-terminated polystyrene (PSSH) tethered Au nanoparticles were investigated. It was obtained that the particle size increases with increasing molecular weight of PSSH. The Tg of PS-b-P2VP/ PSSH-Au nanocomposites shows a strong function of particle concentration and particle size and the addition of Au particles increases the Tg of block copolymer. However when PS-b-P2VP was mixed with large particles at high loading, macrophase separation of particles from the preferred domains of PS-b-P2VP occurs, causing the nearly identical Tg of composite to the neat copolymer.
We further investigated the effect of particles on the morphology of composite thin films during neutral solvent annealing. At low particle loading with short annealing time, a well ordered structure was obtained regardless of the size of particles. For large particles, composite thin film developed to a lamellar structure perpendicular to the substrate. In contrast, composite thin film with the addition of small particles formed a parallel cylinder structure. During annealing, particles tend to move the air/ polymer interface to increase the conformational entropy of the system. At high particle loading, composite thin film with large particles formed macrophase separation. The PS-b-P2VP/particle composite thins not only affect the surface morphology but also change the wetting ability of thin films. Results showed the use of the high particle loading and the high molecular weight of PSSH significantly improves the wetting of the thin films. This behavior is due to the Au particles diffusion to the interface between poymer and substrate.
The surface morphology of PS-b-P2VP/PSSH-Au/hPS composite thin films during chloroform vapor annealing was also studied. The incorporate of hPS into the nanocomposite enhances the diffusion of the system. The composite thin film with small Au particles and low concentration exhibit a perpendicularly cylindrical structure. This structure is due to the sequestering of hPS in the PS domains, that casuses an increase in the effective volume fraction of the PS domains, resulting in the order to order transition. In addition, the addition of Au particles and hPS reduces the degree of segregation. This behavior and the chloroform vapor treatment reduce the energy difference between the polymer and subrate that induced the change in orientation of the ordered domains. The perpendicularly cylindrical structure disappeared with slightly increasing Au particle and hPS concerntration. This is attributed to the significantly decreasing the degree of segregation. OM results revealed that the wetting ability was enhances with the addition of hPS. This phenomenon is consistent with the composite manipulated with Au nanoparticles.
37
Chen, Mei Yu, and 陳美妤. "Effect of Ligand Structure on Copper(I) Quantum Yields of Copper(II)/Amino-Acid Complexes." Thesis, 2016. http://ndltd.ncl.edu.tw/handle/45605990241721716774.
Full textAbstract:
碩士<br>國立清華大學<br>生醫工程與環境科學系<br>104<br>Cu(I) quantum yields were measured at 313 nm for copper(II)-amino acid complexes with eight amino acids in aqueous solutions. Photochemical formation of copper(I) has been systematically studied for copper(II) complexes in different conditions (changing pH and ligand concentration). Bathocuproine method was used to determine copper(I) concentration. For the 1:1 Cu(II) complexes (CuL), the Cu(I) quantum yields at 313 nm (ΦCu(I),CuL) are in the sequence (25 0C, ionic strength = 0.10 M): 2-AIBA > β-ala > ala, 2-ABA, nor > val > 4-ABA > gly, ranging from 0.279 to 0.06 (mol einstein-1). Experimental data show that the photoreactivity of Cu(II)/amino-acid complexes can be predicted by Cu(II) speciation in a wide range of the solution conditions, varying in pH and the total concentration of ligand. The stability of the carbon-center radical plays an important role on the Cu(I) quantum yield. The six-membered chelate ring of Cu(II)/amino-acid complexes has larger Cu(I) quantum yields than five-membered chelate ring, probably owing to the increasing of the intra-molecular electron-transfer rate.
38
Chao, Chia-Wei, and 趙家緯. "The Effect of Bonding Characteristic of Axial Ligand on the Electronic Structure of Iron(Ⅲ) Porphyrins." Thesis, 2006. http://ndltd.ncl.edu.tw/handle/68733395661926837934.
Full textAbstract:
碩士<br>國立中興大學<br>化學系<br>94<br>Abstract
Recent researches demonstrate that porphyrin distortion is mainly divided into two kinds: saddle and ruffle. The saddle distortion in OETPP increases basicity. The phenomenon promotes dx2-y2 orbital energy and decreases dz2 orbital energy relatively in metalloporphyrin. Porphyrin’s a1u orbital has the same symmetry as dxy orbital in saddle distortions. Iron (III) porphyrin is advantageous to intermediate-spin under crystal field intensity change. The ruffle distortion in TiPP decreases porphyrin core and creates dxy orbital bonding interaction with porphyrin’s a2u orbital. Iron (III) porphyrin becomes the unusual (dxz, dyz)4(dxy)1 electronic state.
Beside this substituents effect, we are focusing on axial ligand in this report. It is generally believed that a strong field ligand is a good σ- donor and is also a good π-acceptor. Through the bonding analysis, it has been found that CN- is a good σ- donor but the π-acceptor of neutral HNC is better than CN- which make large difference in their electronic properties in metalloporphyrin . The electronic state of planar [Fe(TPP)(HNC)2]+ is (dxz, dyz)4(dxy)1 and exhibits Jahn-Teller distortion. In case of [Fe(OETPP)(HNC)2]+ the unpair electron is unusually present on the porphyrin’s a2u orbital and make [FeII(OETPP)+•(HNC)2]+.
The electronic state of [Fe(TPP)(Im)2]+ is (dxy)2(dxz, dyz)3 in many evidential demonstrations where Im is mainly good σ- donor. But [Fe(TPP)(Py)2]+ is more complex where Py is also good σ- donor as well as π-acceptor. However, the π-acceptor properties of Py is not better than HNC but it still has a little ruffle distortion because two pys are peripendicular to meso porphyrin which lead the electronic state to (dxz, dyz)4(dxy)1.
At last, we tried to explain, by using of Ramsey equations and 59Co chemical shift, why the weak field axial ligand low-spin Co(II) porphyrin oxidizes on the porphyrin ring which become π cation radical. But we found another way to determine the crystal field energy by accident.
39
Hsieh, Ching-Lin, and 謝慶霖. "Effects of protein glycosylation on structural variation, thermal stability and ligand specificities of two Tachypleus plasma lectins." Thesis, 2009. http://ndltd.ncl.edu.tw/handle/79183124054894990065.
Full textAbstract:
碩士<br>國立臺灣大學<br>生化科學研究所<br>97<br>Two lectins, Tachypleus plasma lectin-1 (TPL-1) and Tachypleus plasma lectin-2 (TPL-2), derived from hemolymph of Tachypleus tridentatus (horseshoe crab) recognize peptidoglycan (PGN) in Gram-positive bacteria and lipopolysaccharide (LPS) in Gram-negative bacteria, respectively (1, 2). They serve as pattern recognition receptors (PRRs) and exert important roles in innate immunity of host. Previously, we utilized yeast Pichia pastoris to express glycosylated TPL-1 and TPL-2 (yTPL-1 and yTPL-2) with PGN-binding and LPS-trapping activity, but expression yields of both proteins were low (3). In this study, I tried to overexpress non-glycosylated TPL-1 and TPL2 (EcTPL-1 and EcTPL-2) using prokaryotic system and compared their ligand specificities with glycosylated equivalents. Non-glycosylated EcTPL-1 lost the PGN-binding activity, and its affinity to N-acetylmonosaccharide was weaker compared to that of yTPL-1. EcTPL-2 specifically interacted with L-rhamnose (L-Rha) and LPS from P. aeruginosa, but other O-antigen-containing LPS from E. coli, effective ligands for yTPL-2, could not bind to EcTPL-2. Both EcTPL-1 and yTPL-1 were dominated by β–sheet structure, whereas EcTPL-1 contained more random coil. The secondary structure of EcTPL-2 was also predominant in a β–sheet conformation differing from more unordered yTPL-2. As evidenced by analytic ultracentrifugation (AUC), EcTPL-1 formed a dimer and yTPL-1 were mixtures of monomer and dimer. Both EcTPL-2 and yTPL-2 migrated as a dimer under non-reducing SDS-PAGE analysis, and dimeric EcTPL-2 further associated to become an octamer. In the thermal unfolding profiles of differential scanning calorimetry (DSC), both non-glycosylated TPLs have Tm values a little higher than glycosylated counterparts, suggesting that in the present case glycosylation modification of protein could not contribute to its thermal stability.
Ligand-induced conformational change and variation of association status of proteins were further examined by circular dichroism (CD), AUC. The addition of N-acetylmuramic acid (MurNAc), a common ligand for both EcTPL-1 and yTPL-1, rendered EcTPL-1 a tetramer and induced monomerization of yTPL-1. Moreover, monomerization of yTPL-1 upon addition of muramyl-dipeptide correlated to more random coil structure. P. aeruginosa LPS-treated EcTPL-2 remained as an octamer and gained more compact β–sheet conformation. By contrast, E. coli LPS-bound yTPL-2 exhibited significant oligomerization and minor conformational change. Finally, we utilized isothermal titration calorimetry (ITC) and dynamic light scattering (DLS) to investigate the physical property of LPS-TPL-2 complex and corresponding thermodynamic scenario. TPL-2 possessed disaggregating effect to disrupt the hydrophobic force among LPS micelle, and the expense of energy might be compensated by entropy-driven protein-ligand interaction and further stabilized by the multivalency of oligomeric TPL-2. Overall, these studies demonstrate that glycosylation modification of TPLs does influence its ligand specificities and causes structural variations even though it does not change thermostability.
40
Hackermüller, Jörg, Nicole-Claudia Meisner, Manfred Auer, Markus Jaritz, and Peter F. Stadler. "The Effect of RNA Secondary Structures on RNA-Ligand Binding and the Modifier RNA Mechanism: A Quantitative Model." 2005. https://ul.qucosa.de/id/qucosa%3A32908.
Full textAbstract:
RNA-ligand binding often depends crucially on the local RNA secondary structure at the binding site. We develop here a model that quantitatively predicts the effect of RNA secondary structure on effective RNA-ligand binding activities based on equilibrium thermodynamics and the explicit computations of partition functions for the RNA structures. A statistical test for the impact of a particular structural feature on the binding affinities follows directly from this approach. The formalism is extended to describing the effects of hybridizing small \modifier RNAs' to a target RNA molecule outside its ligand binding site. We illustrate the applicability of our approach by quantitatively describing the interaction of the mRNA stabilizing protein HuR with AU-rich elements [Meisner et al. (2004), Chem. Biochem. in press]. We discuss our model and recent experimental findings demonstrating the ffectivity of modifier RNAs in vitro in the context of the current research activities in the field of non-coding RNAs. We speculate that modifier RNAs might also exist in nature; if so, they present an additional regulatory layer for fine-tuning gene expression that could evolve rapidly, leaving no obvious traces in the genomic DNA sequences.
41
Lu, I.-Yin, and 盧怡尹. "The effect of axial ligands on the mixed-valence pentanickel metal string complexes:Synthesis, Structure and Magnetic Property." Thesis, 2009. http://ndltd.ncl.edu.tw/handle/75028580836437446551.
Full text
42
Han, Hui-An, and 韓蕙安. "Development of Pyridyl-Imine Ligand Used in Atom Transfer Radical Polymerization and The Structural Effect to Fluorescent Intensity of Dye-labeled Polymers." Thesis, 2014. http://ndltd.ncl.edu.tw/handle/65786136283784015495.
Full textAbstract:
碩士<br>國立清華大學<br>化學系<br>102<br>Pyridyl-imine copper complex, CuII(paenMe2)Br2, was used to mediate the normal and AGET (Activators generated by electron transfer) ATRP of methyl methacrylate. The different initiators, ratios of ligand and the lengths of copper wires were tuned. The polymeric products showed a low polydispersity (Mw/Mn = 1.14 ~ 1.18) and the molecular weight matched the theoretical values.
Besides, the pyrene-labeled polymers with structure of linear, star and network were synthesized by AGET ATRP. Observing the fluorescent intensity changes of polymers by PL, we found the fluorescent intensity of star polymer decreased at the beginning and increased afterwards. For linear and network polymers, the fluorescent intensity increased with conversion increasing.
The block copolymers of pyrene-PMMA-b-PSt, naphthalene-PMMA-b-PSt, pyrene-PSt-b-PMMA and naphthalene-PSt-b-PMMA were synthesized to observe their self-assembly effect. However, using SAXS (Small angle x-ray scattering) and TEM (Transmission electron microscopy) to observe the structure of block copolymers, the ordered arrangement and microphase separation were not found.
43
Reese, Marcel. "Sensitivity Enhancement of Liquid-State NMR and Improvement of the INPHARMA Method." Thesis, 2010. http://hdl.handle.net/11858/00-1735-0000-0006-B4EB-9.
Full text
44
Cibian, Mihaela. "Des complexes métalliques avec des ligands hydroxyamidines/ amidines oxydes (AMOXs) : synthèse, caractérisation et investigation de leurs applications." Thèse, 2015. http://hdl.handle.net/1866/18431.
Full textAbstract:
The English translation of the chapters written in French is available in Appendix.<br>La motivation initiale de ce travail provient de l'importance que les composés de coordination ont dans notre vie quotidienne. Leurs propriétés les rendent attrayants pour un large éventail d'applications, dans des domaines allant de la catalyse et de la conversion et stockage de l'énergie solaire jusqu’au domaine des matériaux et des sciences de la vie. Poussée par l'évolution et le progrès général de notre société, la recherche en chimie de coordination moderne évolue vers la complexité au niveau moléculaire, où la Nature représente une source majeure d'inspiration, comme dans le cas de la photosynthèse artificielle et de la chimie métallo-supramoléculaire. Dans le même temps, l'étude des complexes de coordination nourrit la curiosité scientifique et les approches pluridisciplinaires ouvrent de nouveaux mondes fascinants, tout en repoussant les frontières de la connaissance à des niveaux sans précédent.
En continuité avec l'étude et le développement de composés de coordination pour des applications spécifiques, le thème central de cette thèse est l'interaction Métal - Ligand et les moyens de la moduler par le design du ligand, afin de générer les propriétés nécessaires pour les applications ciblées. Le design de complexes de coordination est considéré comme un «ensemble de composants modulables» – le ligand: les groupes fonctionnels des atomes donneurs, les substituants et leurs effets électroniques et stériques, le type et la dimension du cycle chélate; l’ion métallique; l'environnement.
Les ligands étudiés ici sont les oxydes d’amidines N,N’-disubstitués (AMOXs) (aussi appelés α-aminonitrones ou hydroxyamidines). L'influence du motif de substitution du ligand sur les propriétés des composés est étudiée pour des complexes bis(AMOX) de cobalt(II) et de zinc(II). Les bis(chélates) de cobalt(II) sont plan carré (bas spin) à l'état solide, mais présentent une isomérisation de la structure plan carré (bas spin) vers une structure tétraédrique (haut spin) en solution dans des solvants non-coordinants. L'équilibre d'isomérisation est fortement influencé par le motif de substitution sur le ligand, du fait d’une combinaison de facteurs stériques et électroniques.
Une approche théorique (DFT/ TD-DFT) et expérimentale combinée a montré que, dans la famille des chélates bis(AMOX) de zinc(II), le gap optique peut être finement modulé pour de potentielles applications dans des dispositifs optoélectroniques par la modification spécifique des ligands.
Un cas spécial de solvatomorphisme a été identifié: des modifications de la géométrie et de l’état de spin sont induites par la présence ou l’absence de liaisons hydrogènes dans un même composé de cobalt(II). L’influence de l'environnement est ainsi illustrée. Les interactions faibles sont les principaux facteurs responsables pour la stabilisation du système vers une combinaison spécifique géométrie - état de spin à l'état fondamental, de façon similaire au contrôle allostérique et aux interactions hôte-invité dans les systèmes biologiques.
Des études préliminaires vers des systèmes supramoléculaires à base des ligands AMOX ont été effectuées (assemblées multimétalliques vers des matériaux fonctionnels et des systèmes photocatalytiques pour conversion d'énergie solaire, en particulier la photocatalyse pour la production de H2).
J’espère que les résultats et les perspectives présentées dans cette thèse incitent à la poursuite de la chimie de coordination des AMOXs.<br>The underlying motivation for this work stems from the importance that coordination compounds play in our daily lives. Their properties make them suitable and attractive for a wide range of applications in fields going from catalysis and solar energy conversion/ storage to materials and life sciences. Driven by the general progress of our society, research in modern coordination chemistry evolves toward complexity at the molecular level, with Nature representing a major source of inspiration as shown by artificial photosynthesis and metallosupramolecular chemistry. At the same time, the study of coordination complexes nurtures scientific curiosity, and multidisciplinary approaches are opening fascinating new worlds, while pushing the frontiers of knowledge to unprecedented depths.
In line with the study and the development of coordination compounds for specific applications, the central theme of this thesis is the Metal-Ligand interaction and how it can be modulated through ligand design to generate the properties targeted for particular applications. The design of coordination complexes is seen as a ‘collection of adjustable components’ (e.g. the ligand: the donor atoms and their functional groups, the type and the size of the chelating ring, the ring substituents and their electronic and steric effects; the metal-ion; the environment).
The ligands under study are the N,N’-disubstituted amidine oxides (AMOXs) (also known as α-aminonitrones/ hydroxyamidines). The influence of the ligand substitution pattern on the properties of the compounds is investigated in series of cobalt(II) and zinc(II) bis(AMOX) complexes. The cobalt(II) bis(chelates) are square-planar (low spin) in the solid state, but show square-planar (low spin) to tetrahedral (high spin) isomerization in solution of non-coordinating solvents. The isomerization equilibrium is highly sensitive to the substitution pattern on the ligand due to a combination of steric and electronic influences. A combined experimental and theoretical approach [DFT and time dependent (TD-DFT)] has shown that in the family of zinc(II) bis(AMOX) chelates, by specific modification of the ligands, the optical band gap can be fine-tuned for potential applications in optoelectronic devices. A special case of hydrogen-bonding-induced geometry and spin change at a cobalt(II) centre within a same cobalt(II) bis(chelate) has been identified. It highlights the influence of the environment on the properties of the complex. Weak interactions are the main factors responsible for biasing the system toward a specific geometry – spin state combination in the ground state, in a similar fashion to allosteric control and host-guest interactions in biological systems.
Preliminary studies were conducted toward AMOX-based supramolecular systems: multimetallic assemblies toward functional materials and photocatalytic systems for solar energy-conversion (in particular photocatalysis for H2 production).
It is my hope that the above results and the perspectives presented in this work motivate further developments in AMOX coordination chemistry.