Log in

Relevant bibliographies by topics / Multinuclear complexes

Contents

Journal articles
Dissertations / Theses
Books
Book chapters
Conference papers

Academic literature on the topic 'Multinuclear complexes'

Author: Grafiati

Published: 5 June 2025

Last updated: 15 July 2025

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Multinuclear complexes.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Journal articles on the topic "Multinuclear complexes"

1

Schreiber, A., H. Rauter, M. Krumm, S. Menzer, E. C. Hillgeris, and B. Lippert. "Multinuclear Metal Nucleobase Complexes." Metal-Based Drugs 1, no. 2-3 (1994): 241–46. http://dx.doi.org/10.1155/mbd.1994.241.

Full text

Abstract:

Of all properties of metal nucleobase complexes, formation of multinuclear species appears to be an outstanding feature. After a brief introduction into well known polymeric metal nucleobase complexes, three aspects recently Studied in our laboratory will be dealt with in more detail: (i) Heteronuclear complexes derived from trans-[(amine)2Pt(1-MeC)2]2+ (1-MeC=1-methylcytosine). They form, e. g. with Pd(II) or Hg(II), upon single deprotonation of the exocyclic amino group of each 1-MeC ligand, compounds of type trans-[(amine)2Pt(1-MeC-)2MY]n+, displaying Pt-M bond formation. (ii) Cyclic nucleobase complexes derived from cis-a2Pt(II). A cyclic compound of composition {[(en)Pt(UH-N1,N3)]4}4+ (UH=monoanion of unsubstituted uracil) is presented and the analogy with organic calix-[4]-arenes is pointed out. (iii) Cyclic nucleobase complexes from trans-a2Pt(II). Possible ways for the preparation of macrocyclic nucleobase complexes containing trans-a2Pt(II) linkages are outlined and precursors and intermediates are presented.

APA, Harvard, Vancouver, ISO, and other styles

2

B., Chakravarty. "Substitution reactions of ligand bridged multinuclear complexes of platinum group metal ions." Journal of Indian Chemical Society Vol. 80, Apr 2003 (2003): 227–31. https://doi.org/10.5281/zenodo.5839342.

Full text

Abstract:

Department of Chemistry, University of Kalyani, Kalyani-741 235, India <em>E-mail:</em> bnc@klyuniv.ernet.in <em>Manuscript received 11 September 2002</em> This review discusses the kinetic aspects of the substitutions in various ligand bridge multinuclear complexes of platinum group metal ions. The reactions have been categorized with various bridging bonds and metal ions acting as nuclei. Polymerization of complex compounds involves formation of multinuclear complexes. Kinetics and mechanistic features associated with all such reactions have been highlighted and discussed critically.

APA, Harvard, Vancouver, ISO, and other styles

3

Kostova, Irena. "Homo- and Hetero-Multinuclear Iridium(III) Complexes with Cytotoxic Activity." Inorganics 13, no. 5 (2025): 156. https://doi.org/10.3390/inorganics13050156.

Full text

Abstract:

Towards the efforts to expand the bioactivity and to reduce toxic and adverse properties of known metal-based drugs, various multinuclear complexes have recently been studied. They have shown enhancement of target specificity and selectivity. Different from small organic compounds and traditional metal-based complexes with anticancer activity, iridium(III) multinuclear or heteronuclear metallodrugs have confirmed potential advantages due to their unique biological and chemical diversities, better activity and different anticancer mechanisms. Ir(III) coordination compounds, similar to most Pt group compounds, are of excessive interest because of their potential cytotoxic activity, effective cellular uptake and tolerance by healthy cells. Although mononuclear Ir(III) complex compounds have been extensively studied as promising candidates for antitumor application, the research on the antineoplastic potential of homo- or hetero-multinuclear iridium(III) complexes is not as abundant; nevertheless, intensive investigations have been conducted in the recent years towards developing complexes that are anticipated to have improved therapeutic potential and biotarget selectivity. Multimetallic iridium(III) frameworks have offered interesting possibilities for designing new antitumor agents by exploiting the action of different metal cations at the same time. This method was very successful in the design of homo- and hetero-multinuclear cyclometalated and half-sandwich organometallic Ir(III) compounds. In the described background, many homonuclear and heteronuclear Ir(III) complexes have been estimated and have exposed promising advantages in cancer therapy. This review intends to summarize newly reported innovative and promising multinuclear Ir(III)-based complexes and to afford a wide-ranging overview of current development and perspectives for the practical impact of these complexes in the tumor therapy field. It is anticipated that this analysis will provide significant direction for the further progress of active homonuclear and heteronuclear iridium-based anticancer agents.

APA, Harvard, Vancouver, ISO, and other styles

4

Yamazaki, Yasuomi, Tatsuki Morimoto, and Osamu Ishitani. "Synthesis of novel photofunctional multinuclear complexes using a coupling reaction." Dalton Transactions 44, no. 25 (2015): 11626–35. http://dx.doi.org/10.1039/c5dt01717c.

Full text

APA, Harvard, Vancouver, ISO, and other styles

5

Willcocks, Alexander M., Thomas P. Robinson, Christopher Roche, et al. "Multinuclear Copper(I) Guanidinate Complexes." Inorganic Chemistry 51, no. 1 (2011): 246–57. http://dx.doi.org/10.1021/ic201602m.

Full text

APA, Harvard, Vancouver, ISO, and other styles

6

Yuan, Guozan, Qi Zhang, Zhiping Wang, et al. "Assembly of four 8-quinolinate-based multinuclear complexes: the effect of substituents on core structures and photoluminescence properties." Inorganic Chemistry Frontiers 4, no. 5 (2017): 764–72. http://dx.doi.org/10.1039/c7qi00082k.

Full text

Abstract:

Four multinuclear complexes with different core structures are synthesized. The core structures and photoluminescence properties of M(ii)–quinolinate complexes are controlled by the different substituent groups of ligands.

APA, Harvard, Vancouver, ISO, and other styles

7

Nath, Bikash Dev, Kazuto Takaishi, and Tadashi Ema. "Macrocyclic multinuclear metal complexes acting as catalysts for organic synthesis." Catalysis Science & Technology 10, no. 1 (2020): 12–34. http://dx.doi.org/10.1039/c9cy01894h.

Full text

APA, Harvard, Vancouver, ISO, and other styles

8

Pal Chaudhuri, Urmila, Laura R. Whiteaker, Lei Yang, and Robert P. Houser. "Multinuclear copper complexes of pyridylmethylamide ligands." Dalton Transactions, no. 15 (2006): 1902. http://dx.doi.org/10.1039/b513763b.

Full text

APA, Harvard, Vancouver, ISO, and other styles

9

Fedorov, Yu V., N. E. Shepel, O. Yu Kolosova, et al. "Multinuclear complexes of crown-containing monostyrylphenantrolines." Russian Chemical Bulletin 63, no. 10 (2014): 2271–80. http://dx.doi.org/10.1007/s11172-014-0734-0.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

Lange, Peter, Annette Schier, and Hubert Schmidbaur. "Dendrimer-Based Multinuclear Gold(I) Complexes." Inorganic Chemistry 35, no. 3 (1996): 637–42. http://dx.doi.org/10.1021/ic950644l.

Full text

APA, Harvard, Vancouver, ISO, and other styles

More sources

Dissertations / Theses on the topic "Multinuclear complexes"

1

Grieves, R. A. "Multinuclear NMR spectroscopy of transition metal complexes." Thesis, University of Bradford, 1985. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.372167.

Full text

APA, Harvard, Vancouver, ISO, and other styles

2

Hill, Angela M. "Synthesis and studies on transition metal complexes of antimony ligands." Thesis, University of Southampton, 1997. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.241988.

Full text

APA, Harvard, Vancouver, ISO, and other styles

3

Davis, A. L. "Multinuclear NMR studies of dirhodium and platinum-rhodium complexes." Thesis, University of Bristol, 1989. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.235315.

Full text

APA, Harvard, Vancouver, ISO, and other styles

4

Sampanthar, J. T. "Multinuclear NMR studies on rhodium compounds containing N-heterocyclic ligands." Thesis, University of Liverpool, 1996. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.295834.

Full text

APA, Harvard, Vancouver, ISO, and other styles

5

Thomas, Donald S. "Molecular modelling and NMR studies of multinuclear platinum anticancer complexes." University of Western Australia. School of Biomedical, Biomolecular and Chemical Sciences, 2006. http://theses.library.uwa.edu.au/adt-WU2007.0009.

Full text

Abstract:

[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t,t,t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H,&sup15N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(μ- NH2(CH2)6NH2)]2+ (1,1/t,t) and [{cis-PtCl(NH3)2}2(μ-NH2(CH2)6NH2)]2+ (1,1/c,c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis.... The work described in Chapter 6 employed three duplexes; 5'-d(TCTCCTATTCGCTTATCTCTC)-3'·5'- d(GAGAGATAAGCGAATAGGAGA)-3' (VB12), 5'-d(TCTCCTTCTTGTTCTTCCTCC)- 3'·5'-d(GGATTAAGAACAAGAAGGAGA)-3' (VB14) and 5'- d(CTCTCTCTATTGTTATCTCTTCT)-3'·5'-d(AGAAGAGATAACTATAGAGAGAG)-3' (VB16). Two minor groove preassociated forms of 1,0,1/t,t,t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3'→3' and 5'→5' directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t,t,t. Here it was found that the monofunctionally anchored 1,0,1/t,t,t adopted a position along the phosphate backbone of the duplex in the 5'→5' direction.

APA, Harvard, Vancouver, ISO, and other styles

6

Stringer, Tameryn. "Multinuclear PGM complexes of thiosemicarbazones : synthesis, characterisation and biological activity." Master's thesis, University of Cape Town, 2010. http://hdl.handle.net/11427/11409.

Full text

Abstract:

Includes abstract.<br>Includes bibliographical references.<br>A series of mono- and dithiosemicarbazone ligands were prepared by simple Schiff-base condensation reactions between thiosemicarbazides and various substituted salicylaldehydes.

APA, Harvard, Vancouver, ISO, and other styles

7

Swarts, Andrew John. "Mononuclear and multinuclear palladacycles as catalysts." Thesis, Stellenbosch : University of Stellenbosch, 2011. http://hdl.handle.net/10019.1/6626.

Full text

APA, Harvard, Vancouver, ISO, and other styles

8

Jesudas, Jecob Jegathesh [Verfasser]. "Multinuclear complexes with 2,6-dipicolinoylbis(N,N-dialkylthioureas) / Jecob J. Jesudas." Berlin : Freie Universität Berlin, 2013. http://d-nb.info/103795484X/34.

Full text

APA, Harvard, Vancouver, ISO, and other styles

9

Harrison, A. T. "A multinuclear magnetic resonance study of vanadium (V) complexes and equilibria." Thesis, University of Warwick, 1986. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.373196.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

Pütz, Ulf [Verfasser], Philipp [Akademischer Betreuer] Kurz, and Ingo [Akademischer Betreuer] Krossing. "CO releasing manganese complexes, reaction pathways and synthesis of multinuclear Mn-compounds." Freiburg : Universität, 2017. http://d-nb.info/1136567305/34.

Full text

APA, Harvard, Vancouver, ISO, and other styles

More sources

Books on the topic "Multinuclear complexes"

1

Yamazaki, Yasuomi. Development of Synthetic Methods for Novel Photofunctional Multinuclear Complexes. Springer Singapore, 2022. http://dx.doi.org/10.1007/978-981-16-7148-7.

Full text

APA, Harvard, Vancouver, ISO, and other styles

2

Harrison, Aidan Timothy. A multinuclear magnetic resonance study of vanadium (V) complexes and equilibria. typescript, 1986.

Find full text

APA, Harvard, Vancouver, ISO, and other styles

3

Yamazaki, Yasuomi. Development of Synthetic Methods for Novel Photofunctional Multinuclear Complexes: Simple Synthetic Methods for Multinuclear Complexes Using Various C-C Coupling Reactions. Springer Singapore Pte. Limited, 2021.

Find full text

APA, Harvard, Vancouver, ISO, and other styles

4

Yamazaki, Yasuomi. Development of Synthetic Methods for Novel Photofunctional Multinuclear Complexes: Simple Synthetic Methods for Multinuclear Complexes Using Various C-C Coupling Reactions. Springer, 2022.

Find full text

APA, Harvard, Vancouver, ISO, and other styles

Book chapters on the topic "Multinuclear complexes"

1

Williams, J. A. Gareth. "Multinuclear Iridium Complexes." In Iridium(III) in Optoelectronic and Photonics Applications. John Wiley & Sons, Ltd, 2017. http://dx.doi.org/10.1002/9781119007166.ch2.

Full text

APA, Harvard, Vancouver, ISO, and other styles

2

Mankad, Neal P. "Catalysis with Multinuclear Complexes." In Non-Noble Metal Catalysis. Wiley-VCH Verlag GmbH & Co. KGaA, 2018. http://dx.doi.org/10.1002/9783527699087.ch3.

Full text

APA, Harvard, Vancouver, ISO, and other styles

3

Fackler, John P. "Multinuclear d8-d10Metal Ion Complexes with Sulfur-Containing Ligands." In Progress in Inorganic Chemistry. John Wiley & Sons, Inc., 2007. http://dx.doi.org/10.1002/9780470166222.ch3.

Full text

APA, Harvard, Vancouver, ISO, and other styles

4

Nastasi, F., Giuseppina La Ganga, Maria Letizia Di Pietro, S. Serroni, Sebastiano Campagna, and F. Puntoriero. "Multinuclear Metal Complexes: Coordination Dendrimers, Polymers, and Coordination Cages." In Springer Handbook of Inorganic Photochemistry. Springer International Publishing, 2022. http://dx.doi.org/10.1007/978-3-030-63713-2_24.

Full text

APA, Harvard, Vancouver, ISO, and other styles

5

Yamazaki, Yasuomi. "Synthesis of Multinuclear Complexes Using the Mizoroki–Heck Reaction." In Development of Synthetic Methods for Novel Photofunctional Multinuclear Complexes. Springer Singapore, 2021. http://dx.doi.org/10.1007/978-981-16-7148-7_2.

Full text

APA, Harvard, Vancouver, ISO, and other styles

6

Yamazaki, Yasuomi. "Synthesis of Novel Multinuclear Complexes for Light-Harvesting Systems Using the Coupling Reactions with Ring-Shaped Multinuclear Re(I) Complexes as Building Blocks." In Development of Synthetic Methods for Novel Photofunctional Multinuclear Complexes. Springer Singapore, 2021. http://dx.doi.org/10.1007/978-981-16-7148-7_5.

Full text

APA, Harvard, Vancouver, ISO, and other styles

7

Yamazaki, Yasuomi. "Photochemical and Electrochemical Hydrogenation of π-Conjugated Bridging Ligands on Photofunctional Multinuclear Complexes." In Development of Synthetic Methods for Novel Photofunctional Multinuclear Complexes. Springer Singapore, 2021. http://dx.doi.org/10.1007/978-981-16-7148-7_4.

Full text

APA, Harvard, Vancouver, ISO, and other styles

8

Skordilis, C. S., and P. J. Pomonis. "Transport of Biomimetic Multinuclear Complexes of Manganese into Environmental Abudant Clays." In Cytotoxic, Mutagenic and Carcinogenic Potential of Heavy Metals Related to Human Environment. Springer Netherlands, 1997. http://dx.doi.org/10.1007/978-94-011-5780-3_38.

Full text

APA, Harvard, Vancouver, ISO, and other styles

9

Yamazaki, Yasuomi. "Conclusions." In Development of Synthetic Methods for Novel Photofunctional Multinuclear Complexes. Springer Singapore, 2021. http://dx.doi.org/10.1007/978-981-16-7148-7_6.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

Yamazaki, Yasuomi. "General Introduction." In Development of Synthetic Methods for Novel Photofunctional Multinuclear Complexes. Springer Singapore, 2021. http://dx.doi.org/10.1007/978-981-16-7148-7_1.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Conference papers on the topic "Multinuclear complexes"

1

ALTAMURA, P., I. FRATODDI, M. V. RUSSO, L. PALUMMO, and A. BEARZOTTI. "PT (II) MULTINUCLEAR COMPLEX WITH POLY(ETHYNYLTHIOPHENE) BRIDGE AS SENSITIVE MEMBRANE FOR THE DETECTION OF CHEMICAL VAPOURS." In Proceedings of the 8th Italian Conference. WORLD SCIENTIFIC, 2004. http://dx.doi.org/10.1142/9789812702944_0024.

Full text

APA, Harvard, Vancouver, ISO, and other styles

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!