To see the other types of publications on this topic, follow the link: Multinuclear complexes.
Dissertations / Theses on the topic 'Multinuclear complexes'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 dissertations / theses for your research on the topic 'Multinuclear complexes.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse dissertations / theses on a wide variety of disciplines and organise your bibliography correctly.
1
Grieves, R. A. "Multinuclear NMR spectroscopy of transition metal complexes." Thesis, University of Bradford, 1985. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.372167.
Full text
2
Hill, Angela M. "Synthesis and studies on transition metal complexes of antimony ligands." Thesis, University of Southampton, 1997. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.241988.
Full text
3
Davis, A. L. "Multinuclear NMR studies of dirhodium and platinum-rhodium complexes." Thesis, University of Bristol, 1989. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.235315.
Full text
4
Sampanthar, J. T. "Multinuclear NMR studies on rhodium compounds containing N-heterocyclic ligands." Thesis, University of Liverpool, 1996. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.295834.
Full text
5
Thomas, Donald S. "Molecular modelling and NMR studies of multinuclear platinum anticancer complexes." University of Western Australia. School of Biomedical, Biomolecular and Chemical Sciences, 2006. http://theses.library.uwa.edu.au/adt-WU2007.0009.
Full textAbstract:
[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t,t,t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H,¹5N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(μ- NH2(CH2)6NH2)]2+ (1,1/t,t) and [{cis-PtCl(NH3)2}2(μ-NH2(CH2)6NH2)]2+ (1,1/c,c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis.... The work described in Chapter 6 employed three duplexes; 5'-d(TCTCCTATTCGCTTATCTCTC)-3'·5'- d(GAGAGATAAGCGAATAGGAGA)-3' (VB12), 5'-d(TCTCCTTCTTGTTCTTCCTCC)- 3'·5'-d(GGATTAAGAACAAGAAGGAGA)-3' (VB14) and 5'- d(CTCTCTCTATTGTTATCTCTTCT)-3'·5'-d(AGAAGAGATAACTATAGAGAGAG)-3' (VB16). Two minor groove preassociated forms of 1,0,1/t,t,t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3'→3' and 5'→5' directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t,t,t. Here it was found that the monofunctionally anchored 1,0,1/t,t,t adopted a position along the phosphate backbone of the duplex in the 5'→5' direction.
6
Stringer, Tameryn. "Multinuclear PGM complexes of thiosemicarbazones : synthesis, characterisation and biological activity." Master's thesis, University of Cape Town, 2010. http://hdl.handle.net/11427/11409.
Full textAbstract:
Includes abstract.<br>Includes bibliographical references.<br>A series of mono- and dithiosemicarbazone ligands were prepared by simple Schiff-base condensation reactions between thiosemicarbazides and various substituted salicylaldehydes.
7
Swarts, Andrew John. "Mononuclear and multinuclear palladacycles as catalysts." Thesis, Stellenbosch : University of Stellenbosch, 2011. http://hdl.handle.net/10019.1/6626.
Full text
8
Jesudas, Jecob Jegathesh [Verfasser]. "Multinuclear complexes with 2,6-dipicolinoylbis(N,N-dialkylthioureas) / Jecob J. Jesudas." Berlin : Freie Universität Berlin, 2013. http://d-nb.info/103795484X/34.
Full text
9
Harrison, A. T. "A multinuclear magnetic resonance study of vanadium (V) complexes and equilibria." Thesis, University of Warwick, 1986. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.373196.
Full text
10
Pütz, Ulf [Verfasser], Philipp [Akademischer Betreuer] Kurz, and Ingo [Akademischer Betreuer] Krossing. "CO releasing manganese complexes, reaction pathways and synthesis of multinuclear Mn-compounds." Freiburg : Universität, 2017. http://d-nb.info/1136567305/34.
Full text
11
Kemmitt, T. "Synthesis, properties and multinuclear NMR studies of chelating telluride ligands and complexes." Thesis, University of Southampton, 1988. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.233840.
Full text
12
Adams, Muneebah. "Mono- and multinuclear PGM complexes containing thiosemicarbazones synthesis, characterization and antiplasmodial evaluation." Master's thesis, University of Cape Town, 2012. http://hdl.handle.net/11427/10907.
Full textAbstract:
Four aryl- and ferrocenyl-derived thiosemicarbazone ligands have been synthesized and characterized using NMR, infrared (IR) spectroscopy and mass spectrometry. These ligands were used towards the synthesis of three series of mono- and multinuclear complexes, in which the thiosemicarbazone ligands chelate in either a bidentate (N,S) or tridentate (C,N,S) mode.
13
Masaoka, Shigeyuki. "Studies on Crystal Design and Crystal Growth Control of Multinuclear Metal Complexes." 京都大学 (Kyoto University), 2004. http://hdl.handle.net/2433/147663.
Full text
14
Tilford, Claire. "Experimental investigations of the electronic interactions within multinuclear first row transition metal complexes." Thesis, University of East Anglia, 1999. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.302144.
Full text
15
October, Jacquin. "Novel multinuclear complexes of Rh and Ru and their application in alkene hydroformylation." Thesis, Stellenbosch : Stellenbosch University, 2015. http://hdl.handle.net/10019.1/97866.
Full textAbstract:
Thesis (MSc)--Stellenbosch University, 2015.<br>ENGLISH ABSTRACT: This project entailed the synthesis and characterization of mono- and multi-nuclear rhodium
and ruthenium iminopyridyl complexes and their application in the hydroformylation of 1-
octene. The multi-nuclear complexes were synthesized in order to investigate whether it
could produce catalysts with higher activity than their mononuclear analogues.
Four novel iminopyridyl ligands, ranging from mono- to tetra-functional compounds, were
synthesized. The synthesis was a two-step process initially involving a Schiff base
condensation reaction between 2-pyridinecarboxaldehyde and 4-aminophenol to produce a
hydroxy functionalized pyridine-imine. The latter was then subjected to a nucleophilic
substitution reaction with an appropriate benzyl bromide derivative to yield the target ligands.
All these ligands were isolated in moderate to good yields and characterized using a range of
analytical techniques. These ligands, together with the hydroxy functionalized pyridine imine, were then complexed
to both Rh(I) and Ru(II) metal precursors, yielding ten novel metal complexes. The
characterization of some of the complexes, especially the multi-nuclear complexes, were
slightly more difficult due to their low solubility. However, all these complexes could be
isolated in good to high yields as stable green-brown (in the case of Rh(I)) and yellow-orange
(in the case of Ru(II)) solids. Finally, these complexes were applied as catalyst precursors in the hydroformylation of 1-
octene. In the case of the Rh(I) complexes, relatively high activities were observed, with
conversions ranging between 50 – 90 % in all cases, when tested at 30 bar, 75 °C and a 0.05
mol% catalyst loading. The activity was found to increase when going from the mono- to the
bi-nuclear catalyst. However, solubility in the reaction medium was a major issue for the trinuclear
catalyst, as it contributed to the lower activity observed. High chemoselectivity
towards aldehydes was observed for all catalysts, which increased with reaction times.
During shorter reaction time, linear regioselectivity was also relatively high. This however,
decreased with increasing reaction time as the internal octenes formed initially, were
converted to branched aldehydes. When the Ru(II) complexes were tested under the same
conditions as the Rh(I) complexes, very low activity was observed. Under more stringent
conditions (45 bar, 120 °C, 0.5 mol%) the ruthenium catalysts performed relatively well,
compared to other complexes in the literature. The same trend in terms of the chemo- and regioselectivity for the Ru(II) complexes were observed. The Rh(I) complexes were far more
active than the Ru(II) complexes.<br>AFRIKAANSE OPSOMMING: Hierdie projek behels die sintese en karakterisering van mono- en multi-kernige rhodium en
ruthenium iminopiridiel komplekse en hul toepassing in the hidroformulering van 1-okteen.
Die multi-kernige komplekse is gesintetiseer met die doel om vas te stel of hulle katalisatore
wat meer aktief is as hul monokernige eweknieë, kan produseer.
Vier nuwe iminopiridiel ligande, wat strek vanaf mono- tot tetra-funksionele verbindings, is
gesintetiseer. Die sintese was ‘n twee-stap proses wat aanvanklik ‘n Schiff basis kondensasie
reaksie tussen 2-piridienaldehied en 4-aminofenol behels, om ‘n fenol gefunksioneerde
piridien-imien te vorm. Die laasgenoemde was gevolglik aan ‘n nukleofiliese substitusie
reaksie met ‘n gepaste bensiel bromied derivaat onderhewig. Al hierdie ligande is geisoleer in
matige tot goeie opbrengste en gekarakteriseer met ‘n reeks analitiese tegnieke. Hierdie ligande, tesame met die fenol gefunksioneerde piridien imien, is dan met Rh(I) en
Ru(II) metaal uitgangstowwe gekomplekseer, wat tien nuwe metaal komplekse tot gevolg
gehad het. Die karakterisering van sommige van die kompekse, spesifiek die multi-kernige
komplekse, was effens moeiliker as gevolg van hul swak oplosbaarheid. Al hierdie
komplekse kon egter in goeie tot hoë opbrengste as stabiele groen-bruin (in die geval van
Rh(I)) en geel-oranje (in die geval van Ru(II)) vastestowwe geisoleer word. Laastens is die komplekse as katalisator-voorlopers in die hidroformulering van 1-okteen
gebruik. In die geval van die Rh(I) komplekse is redelike hoë aktiwiteite waargeneem, met
omsettings tussen 50 – 90 % in alle gevalle, wanneer hulle by 30 bar, 75 °C en ‘n katalisator
lading van 0.05 mol% getoets is. Die aktiwiteit neem toe vanaf die mono- na die bi-kernige
katalisator. Oplosbaarheid in die reaksie medium was egter ‘n probleem vir die tri-kernige
katalisator, wat ‘n laer aktiwiteit tot gevolg gehad het. Hoë chemoselektiwiteit na aldehiede is
waargeneem vir al die katalisatore en dit neem toe met reaksietyd. Gedurende korter
reaksietye was die liniêre regioselektiwiteit ook redelik hoog, maar neem af met toenemende
reaksietyd soos die interne okteen wat aanvanklik vorm na vertakte aldehiede omgeskakel
word. Toe die Ru(II) komplekse onder dieselfde toestande as die Rh(I) komplekse getoets is,
was baie lae aktiwiteite waargeneem. Onder hoër temperatuur en druk (45 bar, 120 °C, 0.5
mol%) toon die ruthenium katalisatore redelik goeie aktiwiteite in vergelyking met ander
komplekse wat in die literatuur gerapporteer is. Dieselfde tendense in terme van die chemoen
regioselektiwiteit is vir die Ru(II) komplekse waargeneem. Die Rh(I) kompleks was baie
meer aktief as die Ru(II) komplekse.
16
Paraginski, Vanessa Teixeira Kunz. "Síntese e caracterização de complexos organometálicos de Cu(I), Cu(II) e Ni(II) com ferroceno-triazenos e triazenido de Hg(II) com interação Metal-Areno-Pi." Universidade Federal de Santa Maria, 2016. http://repositorio.ufsm.br/handle/1/12416.
Full textAbstract:
This Thesis aimed the synthesis of new metal complexes with triazenido ligands and triazenes chains directly linked to ferrocene fragment by a new synthesis methodology. The complex bis-[1,3-bis(2-biphenyl)triazenido-κN1]mercury(II) was synthesized, melting point 222–224 °C and yield 82 %, characterized by IR, UV-Vis, 1H e 13C RMN, elemental analysis, mass spectrometry by ESI(+)TOF, single crystal x-ray diffraction. The triazenes 1,1’-bis[1-phenyl-3(H)triazene]ferrocene (Compound 1) and 1,1’-bis(benzo-1,2,3-triazol-1-phenyltriazene)ferrocene (Compound 6) were synthesized by ferrocene metalation with BuLi and substitution by correspondent azide, with yields higher than 70 %, melting points 151 and 160 °C, respectively, were characterized by UV-Vis (Compound 1), 1H and 13C NMR, elemental analysis, IE-MS (Compound 1) ESI(+)TOF (Compound 6), single crystal x-ray diffraction (Compoound 1), powder x-ray diffraction, scanning electron microscopy (SEM) and thermogravimetric analysis. Starting from Compound 1 the following heterobimetallic complexes were sinthesized: {[Fe(C5H4NNNH5C6)]2Ni2} (Compound 2), {[Fe(C5H4NNN(H)H5C6)]2Cl2Cu2} (Compound 3 with protonated triazene), {[Fe(C5H4NNNH5C6)]2[Cu(PPh3)2]2} (Compound 4), {[Fe(C5H4NNN(H)H5C6)]2Cu4} (Compound 5). Compounds 6 and 7 didn’t yields suitable single crystals for X-ray diffraction, but based on the MS-ESI(+)TOF and 1H NMR analysis the respective structures based on 1,1’-bis[1-phenyl-3(H)triazene]ferrocene could be predicted. The new triazenes synthesis by methodology under study showed good yields and can be done in two steps. The compounds purification is simple by only extraction with organic solvent and water precipitation followed by filtration enabling the development of further new triazenes including other metallocenes and other azides.<br>O objetivo desta tese foi a síntese de novos complexos metálicos envolvendo ligantes triazenidos e triazenos diretamente ligados ao ferroceno. Foi sintetizado o complexo bis-[1,3-bis(2-bifenil)triazenido-κN1]mercúrio(II) com ponto de fusão 222–224 °C e rendimento de 82 %, caracterizado por infravermelho, UV-Vis, 1H e 13C RMN, análise elementar, espectroscopia de massas por ESI(+)TOF, difração de raios X em monocristal. Os triazenos 1,1’-bis[1-fenil-3(H)triazeno]ferroceno (Composto 1) e 1,1’-bis(benzo-1,2,3-triazol-1-feniltriazeno)ferroceno (Composto 6) foram sintetizados por metalação via BuLi, seguida da substituição pela azida correspondente com rendimentos superiores a 70 %, com pontos de fusão de 151 e 160 °C, respectivamente, foram caracterizados por UV-Vis (Composto 1), 1H e 13C RMN, análise elementar, espectroscopia de massas por IE (Composto 1) ESI(+)TOF (Composto 6), difração de raios X em monocristal (Composto 1), difração de raio X de pó, microscopia eletrônica de varredura e análise termogravimétrica. A partir do Composto 1 foram sintetizados os complexos multinucleares: {[Fe(C5H4NNNH5C6)]2Ni2} (Composto 2), {[Fe(C5H4NNN(H)H5C6)]2Cl2Cu2} (Composto 3 com triazeno protonado), {[Fe(C5H4NNNH5C6)]2[Cu(PPh3)2]2} (Composto 4), {[Fe(C5H4NNN(H)H5C6)]2Cu4} (Composto 5). O Composto 6 e o Composto 7 não resultaram em cristais adequados para medida, com as análises por EM-ESI(+)TOF e 1H RMN pode-se fazer uma predição da estrutura baseada nas estruturas com o 1,1’-bis[1-fenil-3(H)triazeno]ferroceno. A síntese de novos triazenos pela metodologia estudada possui bom rendimento e é realizada em apenas duas etapas, a purificação dos triazenos é simples, envolvendo apenas a extração com solvente orgânico e a precipitação em água seguida de filtração possibilitando o desenvolvimento de novos triazenos com outros metalocenos e outras azidas.
17
Zhao, Yunjie Physical Environmental & Mathematical Sciences Australian Defence Force Academy UNSW. "Cucurbit[n]uril - a delivery host for anti-cancer drugs." Publisher:University of New South Wales - Australian Defence Force Academy. Physical, Environmental & Mathematical Sciences, 2009. http://handle.unsw.edu.au/1959.4/44380.
Full text
18
Al-Anber, Mohammed. "Organic and/or InOrganic Pi-Conjugated Units in the Synthesis of Multinuclear Transition Metal Complexes." Doctoral thesis, Universitätsbibliothek Chemnitz, 2003. http://nbn-resolving.de/urn:nbn:de:swb:ch1-200301585.
Full textAbstract:
Die heterobimetallischen Pi-Pinzetten können erfolgreich als Grundbaustein für die Darstellung von mehrkernigen Übergangsmetallkomplexen, in denen die Metallzentren M(I) (M = Cu, Ag) über unterschiedliche stickstoffhaltige organische sigma-Donor-Liganden verbrückt sind, verwendet werden. In Abhängigkeit von der Natur der korrespondierenden organometallischen Pi-Pinzetten und der organischen Brückeneinheiten konnten verschiedene mehrkernige Übergangsmetallkomplexe synthetisiert werden. Diese Komplexe wurden mittels IR, 1H- und 13C-NMR-Spektroskopie sowie MS charakterisiert. Die Festkörperstrukturen ausgewählter Komplexe konnten durch Einkristall-Röntgenstrukturanalyse erhalten werden. Die Wechselwirkungen der Kupfer(I)- sowie Silber(I)-Ionen, über die koordinativ gebundenen stickstoffhaltigen. Stichworte: Organometallischen À-Pinzetten; Bis(alkinyl)titanocene; Titanium; À- Konjugierte; Mehrkernigen; Kupfer(I), Silber(I).
19
Chavan, S. A. "Structure and catalytic properties of model multinuclear transition metal complexes encapsulated in porous inorganic solids." Thesis(Ph.D.), CSIR-National Chemical Laboratory, Pune, 2002. http://dspace.ncl.res.in:8080/xmlui/handle/20.500.12252/2344.
Full text
20
Chen, Zhigang. "A multinuclear magnetic resonance study of the structures and dynamics of lanthanum(III) complexes in solution." Thesis, University of Ottawa (Canada), 1993. http://hdl.handle.net/10393/6807.
Full textAbstract:
The structural and dynamic behaviours of La(III) complexes in solution have been investigated by multinuclear magnetic resonance spectroscopy. In an acetonitrile solution of La(NO$\sb3)\sb3$ 6 H$\sb2$O, a combined $\sp{139}$La and $\sp $O NMR study revealed the existence of the following equilibrium: $\rm \{La(NO\sb3)\sb3(AN)\sb{x}\} + H\sb2O\rightleftharpoons\{La(NO\sb3)\sb3\ H\sb2O(AN)\sb{y}\}$. The NMR results have been quantitatively interpreted through this model. The detailed analysis of $\sp $O NMR spectra of H$\sb2$O allowed the indirect coupling constant between the $\sp $O of the coordinated water and $\sp{139}$La to be estimated. The main focus of the present work was given to the thermodynamic, structural, and dynamic studies of La(III) complexes with crown ethers in non-aqueous solutions. Stable 1:1 cation:crown ether complexes were formed between La(III) and 18C6, B15C5, and 15C5. During the course of the complexation, the crown ethers entered to the first coordination shell of La(III) by replacing the coordinated water and most probably the solvent (AN) molecules. In all the cases, the La(III) cations were coordinated by the oxygen atoms from three bidentate nitrate anions and from the crown ethers. Both cation and ligand exchanges are slow in the system $\rm La(NO\sb3)\sb3$ 6 H$\sb2$O - 18C6 - AN. The rate constant for the exchange is k = 0.15 s$\sp{-1}$ at 333 K. A dissociative exchange mechanism is one of the contributions to the La(III) exchange. This two-site exchange occurs only through a dissociative pathway, which is determined by the structures of the complexes. Since the ligand can not make contact with La(III) from both sides of the complexes, the dissociative mechanism must be the major contribution to the crown ether chemical exchange. An exchange process involving coordinated B15C5 and/or 15C5 was detected by $\sp1$H NMR spectra of the ligands. Detailed $\sp1$H NMR observations were made on the system involving 15C5. A model involving "inner" and "outer" proton exchange was postulated to account for the $\sp1$H NMR experimental data. The structures of La(III) complexes with crown ethers in solution and in the solid state were compared. It might be concluded that the structures of these complexes in solution are very similar to that in the solid state. (Abstract shortened by UMI.)
21
Govender, Preshendren. "Synthesis, characterization and anticancer studies of multinuclear ruthenium(II) arene complexes based on a dendritic scaffold." Master's thesis, University of Cape Town, 2010. http://hdl.handle.net/11427/10568.
Full textAbstract:
Includes bibliographical references.<br>A series of monodentate (N-) and chelating bidentate (N,N-, N,O-), monomeric and dendritic ligands based on a poly(propyleneimine) dendrimer scaffold were synthesized via Schiff base condensation reactions of the relevant amine and appropriate aldehydes. These reactions yielded air- and moisture-stable oils or solids. These ligands contained pyridyl-imine moieties and salicylaldimine moieties. These compounds were isolated in good yields and characterized using standard spectroscopic and spectrometric, analytical techniques.
22
Anber, Mohammed al. "Organic and, or inorganic p-conjugated [pi-conjugated] units in the synthesis of multinuclear transition metal complexes." [S.l. : s.n.], 2003. http://deposit.ddb.de/cgi-bin/dokserv?idn=97031387X.
Full text
23
Smith, Helen Patricia Graves. "A multinuclear magnetic resonance study of the kinetics and mechanisms of dissociation of cation complexes with ionophores." Thesis, University of Ottawa (Canada), 1991. http://hdl.handle.net/10393/7701.
Full textAbstract:
The behaviour of the cation - ionophore complexes in solution has been studied by $\sp{23}$Na, $\sp{43}$Ca and $\sp $C NMR. $\sp{23}$Na NMR is an ideal tool for investigating the decomplexation of such complexes. The (Na-DB24C8)$\sp+$ and (Na-18C6)$\sp+$ complexes form quantitatively (K$\sb{\rm f} > 10\sp5$) and may decomplex by either the dissociative or the metal associative interchange "M$\sb{\rm ai}$" mechanisms. The (Na-DB24C8)$\sp+$ system follows the M$\sb{\rm ai}$ mechanism when either BPh$\sb4\sp-$ or PF$\sb6\sp-$ is the counter anion. The concentration of the counter anion does not influence the mechanism, but at higher concentrations the rate is slightly accelerated. The (Na-18C6)$\sp+$ has been examined in AC (acetone), AN (acetonitrile), NM (nitromethane), PC (propylene carbonate), and PY (pyridine), with BPh$\sb4\sp-$ as the counter anion. The dissociative mechanism is the only one operative in AC. The two mechanisms compete in AN, PC and PY. The kinetic parameters for the dissociative process have been calculated in these four solvents, while in PC the kinetic parameters of the M$\sb{\rm ai}$ mechanism were also accessible. An entropy-enthalpy effect was observed. In NM a kinetic study is precluded by the small difference in chemical shifts between free and complexed species. The influence of the counter anion was studied by examining the changes which result when SCN$\sp-$ replaces BPh$\sb4\sp-$ for the (Na-18C6)$\sp+$ system in AC. With BPh$\sb4\sp-$, only the dissociative mechanism is operative, so if the presence of SCN$\sp-$ were to change the mechanism this would be easily identifiable. Ion-pairing must be considered. All of the species were characterized, and the ion-pairing rate constants for the cation and complex were determined. The contributions to the observed rate constant could then be separated. The ion-paired complex, though 2.3 $\pm$ 0.4 kJ.mol$\sp{-1}$ less stable, has a lower activation barrier (47.2 $\pm$ 0.2 kJ.mol$\sp{-1}$ as compared to 49.5 $\pm$ 0.2 kJ.mol$\sp{-1})$ and the faster rate of dissociation. $((4.2 \pm 0.3) \times 10\sp4\rm{s}\sp{-1}$ as compared to $(1.6 \pm 0.2) \times 10\sp4\rm{s}\sp{-1})$ The presence of SCN$\sp-$ accelerates the rate of the dissociative mechanism, rather than introducing another. The $\sp{23}$Na quadrupolar coupling constant is not accessible by $\sp{23}$Na NMR. With the aid of $\sp $C NMR, and based on the assumption that the $\tau\sb{\rm eff}$ measured for 18C6 is equivalent to the $\tau\sb{\rm c}$ of the $\sp{23}\rm{Na}\sp+$ it is complexing, a measure of the symmetry about the $\sp{23}\rm{NA}\sp+$ is obtained. In AC, AN, and PC this environment is quite symmetrical ($\chi\sim$ 1.0-1.2 MHz). In PY the highly donating solvent competes with crown ether oxygens and in NM the high internal pressure of the solvent both lead to distortions of the complex from high symmetry and higher $\chi$ values result. Lasalocid, a naturally-occurring ionophore, complexes with Na$\sp+$ cations. This compound can serve as both ligand and counter anion so the approach used for the (Na-18C6)$\sp+$ system gives some information, but does not describe it completely. The dissociative mechanism is operative in PY but other interactions are present. The tetra-carboxylic acid substituted 18crown6 (18C6A$\sb4$) was also studied in PY. Interactions between the Na$\sp+$ and 18C6A$\sb4$ were observed by $\sp{23}$Na NMR but were not quantified. The $\sp{43}$Ca nucleus is not as well-suited for NMR studies as $\sp{23}$Na, since it is of low abundance and resonates at low frequencies. Despite these potential drawbacks an exploratory study in 50:50 AC:H$\sb2$O was made. The titration of $\sp{43}$Ca$\sp{++}$ by 18C6 could be followed, and the formation constant (K$\sb{\rm f}$) was found to be 10 $\pm$ 3.
24
Chan, Ka-man Carmen. "Design and synthesis of luminescent branched multinuclear platinum(II) alkynyl complexes and the study of their two-photon absorption properties." Click to view the E-thesis via HKUTO, 2010. http://sunzi.lib.hku.hk/hkuto/record/B43703653.
Full text
25
Chan, Ka-man Carmen, and 陳嘉敏. "Design and synthesis of luminescent branched multinuclear platinum(II)alkynyl complexes and the study of their two-photon absorptionproperties." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2010. http://hub.hku.hk/bib/B43703653.
Full text
26
Lam, Chan-fung, and 林親鳳. "Synthesis, optical and luminescence studies of rhenium(I) diimine alkynyl complexes and their utilization as building blocks for theassembly of multinuclear and mixed-metal complexes." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2005. http://hub.hku.hk/bib/B32010564.
Full text
27
Ma, Guibin. "On Thallium (III) and binuclear platinum-thallium complexes with N-donor ligands in solution and in solid." Doctoral thesis, Stockholm, 2001. http://urn.kb.se/resolve?urn=urn:nbn:se:kth:diva-3129.
Full text
28
McDougald, Roy N. Jr. "Photochemical and Photophysical Properties of Mononuclear and Multinuclear Closed Shell D10 Coinage Metal Complexes and Their Metallo-organometallic Adducts." Thesis, University of North Texas, 2013. https://digital.library.unt.edu/ark:/67531/metadc407759/.
Full textAbstract:
This dissertation covers the studies of two major topics: the photochemistry of mononuclear and multinuclear gold(I) complexes and synthetic approaches to tailor photophysical properties of cyclic trinuclear d10 complexes. First a detailed photochemical examination into the photoreactivity of neutral mononuclear and multinuclear gold(I) complexes is discussed, with the aim of gold nanoparticle size and shape control for biomedical and catalysis applications. Next is a comprehensive systematic synthetic approach to tailor the photophysical properties of cyclic trinuclear d10 complexes. This synthetic approach includes an investigation of structure-luminescence relationships between cyclic trinuclear complexes, an examination into their π-acid/π-base reactivity with heavy metal cations and an exploration into the photophysical properties of new heterobimetallic cyclic trinuclear complexes. These photophysical properties inspections are used to screen materials for their employment in molecular electronic devices such as organic light-emitting diodes (OLEDs) and thin film transistors (OTFTs).
29
Gau, Michael. "Self-assembled, labile, multinuclear metal complexes inspired by nature's oxygen-evolving complex of photosystem II and iron-molybdenum cofactor." Diss., Temple University Libraries, 2017. http://cdm16002.contentdm.oclc.org/cdm/ref/collection/p245801coll10/id/430413.
Full textAbstract:
Chemistry<br>Ph.D.<br>The aim of this work is to synthesize and study novel multinuclear manganese systems to model the structure and function of the oxygen-evolving complex (OEC). With the synthesis and study of these model complexes, a greater understanding of nature’s OEC mechanism and processes will come to fruition as well as a viable homogenous water-oxidation catalyst. In addition, small molecule activation was investigated using an FeI precursor. A tetramanganese “pinned-butterfly” cluster with the chemical formula Mn4(µ3-N2Ph2)2(µ-N2Ph2)(µ-NHPh)2(L)4, was synthesized via self-assembly with the addition of N, N’-diphenylhydrazine to Mn(N(SiMe3)2)2). The reaction proceeds over the course of a few hours with a visible color change pale yellow to yellow, black and finally red. The self-assembly mechanism was elucidated with methods such as ligand labeling, kinetic isotope effect, IR spectroscopy, X-ray diffractometry (single crystal and powder), UV/vis kinetic studies and absorbance studies, hydrogen-atom transfer (HAT) competition studies, NMR studies, GC studies and freezing point depression studies. The “twisted basket” cluster is a two-hydrogen-atom reduced analogue of the aforementioned “pinned-butterfly” cluster with a chemical formula of Mn4(µ-NHPh)4(µ-PhNNPh-2N,N’)2(py)4. Conversion between the clusters was investigated and achieved with the addition of an equivalent of N,N’-diphenylhydrazine and heat to a solution of the “pinned-butterfly” complex. This conversion between the clusters displays similarities to the OEC in the sense that it is undergoing proton-coupled electron transfer (PCET), cluster rearrangement and N-N bond formation. While these novel tetramanganese clusters provide us unique, reactive, and flexible clusters, they are far too sensitive to air and water to perform any useful catalysis. Due to the ligands’ lack of stabilization, alternate ligand platforms were investigated that would be able to form more rigid complexes, but retain lability. Bi- and tridentate ligands were investigated that resulted in the synthesis of several novel multinuclear homo- and hetero- metallic complexes. The ligands include polyoligimeric silsesquioxanes and substituted pyridines. These multinuclear Mn clusters show similarities to the OEC in their composition and structures. Upon exposure to air, a color change is observed without the precipitation of a manganese oxide insoluble species. This observation supports the increased stability, yet retained reactivity of the chelated clusters. Lastly, an FeI precursor was reacted with CS2 in attempts to isolate an Fe-S carbide complex and model the iron-molybdenum cofactor (FeMoco). Instead, a CS2 bridging dimer was formed and isolated. The activation of CS2 led us to attempt the reaction of the FeI precursor with other analogues such as CO2, diisopropylcarbodiimide, methylisothiocyanate, and phenylacetylene. CO2 and acetylene have been shown to be reactive substrates to the native FeMoco. These small molecule activated Fe complexes were characterized using X-ray diffraction technqiues, UV/visible spectroscopy, electron paramagnetic resonance spectroscopy and infrared spectroscopy.<br>Temple University--Theses
30
Lam, Chan-fung. "Synthesis, optical and luminescence studies of rhenium(I) diimine alkynyl complexes and their utilization as building blocks for the assembly of multinuclear and mixed-metal complexes." Click to view the E-thesis via HKUTO, 2005. http://sunzi.lib.hku.hk/hkuto/record/B32010564.
Full text
31
Tao, Chi-hang, and 陶志恆. "Synthesis and luminescence studies of branched carbonrich platinum(II)and palladium(II) alkynyl complexes: versatile building blocks for multinuclear assemblies." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2004. http://hub.hku.hk/bib/B31246011.
Full text
32
Vladimir, Shuster. "Phenazine: A Building Block for Multinuclear and Heterometallic Complexes, Where the Ligand Acts as an Electron Acceptor and Radical Abstractor." Thèse, Université d'Ottawa / University of Ottawa, 2013. http://hdl.handle.net/10393/24234.
Full textAbstract:
Over the past decade, intensive academic and commercial interests have been paid on compounds possessing photochemical properties, namely for their preparation, chemical properties, high efficiency and potential low-cost.
Compounds having intense photochemical properties gained great interest due to wide range of potential applications. The sensitizers are one of the key components for high power-conversion efficiency in the dye sensitized solar cells (DSSCs). They are the core components in the organic light-emitting devices (OLEDs) due to their ability to emit light with the wavelengths largely red- shifted from their absorption wavelength. Ruthenium based sensitizers have been tagged “molecular light switches” because, although the fluorescence of these complexes in aqueous solutions is negligible, it increases of greater than 10000 fold in the presence of DNA. Many polypyridyl and dipyrido phenazine ruthenium complexes have achieved high power conversion efficiencies and therefore are of practical interest. Several research groups stated that the dipyrido phenazine ligand may be thought of as comprising two components: a bipyridyl unit and a phenazine unit. These two subunits behave essentially separately, with many molecular orbitals being localised over only one subunit and a redox properties of central phenazine moiety in the dipyrido phenazine ligand are important for the photochemical applications.
Therefore a phenazine ligand was selected as a model for the present investigation. The chemistry of phenazine ligand is mostly limited to the late transition metal and f - element complexes. Our laboratory has a rich backgroung in the aluminum and early transition metal chemistry. The aluminum chemistry and early transition metal chemistry are of great interest since aluminum and early transition metal complexes are environmentally friendlier and cheaper than the late transition metal compounds. Another drawback of the ruthenium-based sensitizers is the lack of absorption in the red region of the visible spectrum, and also low molar extinction coefficients. An essential requirement for efficient conversion of solar energy is the good spectral match of the sensitizer absorption to the emission spectrum of solar radiation. In this regard, the ruthenium sensitizers’ spectral response in the lower energy regions is not sufficient.
The current project has three parts. In the first part we collected and reviewed known literature regarding the certain classes of non-innocent ligands containing the six-membered carbon- nitrogen heterocycles and regarding the ligands potentially important for the photochemical applications. We also reviewed all available to the data information about the complexes supported by the phenazine ligand.
In the second part we have investigated interaction of alkylaluminum compounds and phenazine and observed reduction of phenazine accompanied by formation of dialuminum cage type compounds containing two formally mononegative phenazine ligand. The derivatization of phenazine has been also observed. It resulted in formation of compounds having a stable organic radical.
In a third part of our project we have explored interaction of phenazine or thiophenazine with the alkylaluminum compounds and chromium dichloride. The reaction in the three component system resulted in reduction of phenazine ligand and lead to the heterometallic Cr(II) - aluminum complexes containing a formally dinegative phenazine or thiophenazine ligands. When a large excess of triethylaluminum was taken, reduction of phenazine and chromium has been observed leading to the heterometallic multinuclear Cr(I) - aluminum complex containing a formally dinegative phenazine ligands and two chromium atoms in one complex in the rare oxidation state one.
33
Bischof, Caroline [Verfasser], Michael [Gutachter] Seitz, and Martin [Gutachter] Feigel. "Building blocks for multinuclear near-IR luminescent lanthanide complexes / Caroline Bischof ; Gutachter: Michael Seitz, Martin Feigel ; Fakultät für Chemie und Biochemie." Bochum : Ruhr-Universität Bochum, 2013. http://d-nb.info/1201553318/34.
Full text
34
Mtongana, Sibusiso. "A multinuclear magnetic resonance spectroscopy study of E/Z configurational isomers of unsymmetrical N-alkyl-N-alkyl(aryl)-N'-acylthioureas of platinum(II) complexes." Thesis, Stellenbosch : Stellenbosch University, 2006. http://hdl.handle.net/10019.1/21893.
Full textAbstract:
Dissertation (PhD)--University of Stellenbosch, 2006.<br>ENGLISH ABSTRACT: The partial double bond character of the carbon-nitrogen bond of the (S)C-NRR’ moiety results in unsymmetrical
dialkyl-substituted N-alkyl-N-alkyl(aryl)-N’-acylthioureas, R”C(O)NHC(S)NRR’ (HL) displaying E,Z
configurational isomerism in solution. The isomerism manifests itself by the duplication of resonances of the N-alkyl
groups in the 1H and 13C NMR spectra. In one class of these ligands where R and R’ groups are non-equivalent alkyl
groups the isomerism is easily observable at 298 K in chloroform. In the other class where R’ is still an alkyl group
and R is a para-substituted phenyl group the isomerism is only observable at much lower temperatures due to a lower
barrier to rotation around the (S)C-N(alkyl)(para-X-Ph) bond (X = O-CH3, H and NO2). The electron-withdrawing
nature of the nitro group in N-methyl-N-(4-nitro-phenyl)-N’-2,2-dimethylpropanoylthiourea, HL3A and N-pentyl-N-
(4-nitro-phenyl)-N’-2,2-dimethylpropanoylthiourea, HL3D result in the E,Z isomerism of these ligands not observable
even at 198 K in dichloromethane. The distribution of E and Z isomers of the unbound ligands vary depending on
these R and R’ groups. Several E isomers of these ligands have been isolated and structurally characterised and the
(S)C-NRR’ bond falls in the range [1.343(3) – 1.329(3) Å] which shorter than the average C-N single bond of
1.472(5) Å.
The E,Z configurational isomerism in the unbound ligands is passed on to the Pt(II) chelates derived from these
ligands. The presence of cis-[Pt(ZZ-L-S,O)2], cis-[Pt(EZ-L-S,O)2] and cis-[Pt(EE-L-S,O)2] is readily observable by
means of 195Pt NMR spectroscopy which shows three well resolved resonances, and this can be confirmed by 1H and
13C NMR spectra of these complexes. The 195Pt nuclei are spatially linked to the 13C nuclei, four bonds away
resulting in 4J(195Pt-13C) couplings with N-CH2- or N-CH3 carbons in a W pathway. The 195Pt NMR spectra are also
linked to N-CH2- or N-CH3 proton resonances by means of the ZZ, EZ and EE isomer distributions. Assignment of
these configurational isomers was then achieved by means of a combination of low magnetic field 13C NMR spectra
and high-resolution gHSQC (1H/13C) NMR experiments.
1H NMR rotational dynamics study showed that the barrier to rotation, ΔG≠, around the (S)C-N(Me)(para-X-Ph)
bond in cis-bis(N-methyl-N-(4-methoxy-phenyl)-N’-2,2-dimethylpropanoylthioureato)platinum(II), cis-[Pt(L1AS,
O)2]; cis-bis(N-methyl-N-phenyl-N’-2,2-dimethylpropanoylthioureato)platinum(II), cis-[Pt(L2A-S,O)2] and cisbis(
N-methyl-N-(4-nitro-phenyl)-N’-2,2-dimethylpropanoylthioureato)platinum(II), cis-[Pt(L3A-S,O)2] complexes
was observed to follow the order: (electron-withdrawing group) NO2 < H < (electron-donating group) O-CH3. The
ZZ isomer was observed to be favoured over the EZ and EE isomers in this order of the para-substituent on the Nphenyl
group. The 1H dynamic NMR trends about the barrier to rotation, ΔG≠, around the (S)C-N(Me)(para-X-Ph)
bond were also complemented by DFT linear transit calculations. The isomer distributions were also influenced by
solvent polarity and the temperature at which the distributions are determined apart from the electronic influence of
the para-substituent of the N-phenyl group.
The ZZ, EZ and EE isomers of complexes derived from N-alkyl-N-(para-X-Ph)-N’-acylthioureas with varying Nalkyl
substituent (methyl, isopropyl, cyclohexyl and n-pentyl) were determined from the 195Pt NMR spectra which were measured under identical conditions. The ZZ isomer was observed to be favoured over the EZ and EE isomers
upon methyl group substitution with a bulkier alkyl group in the order: methyl < isopropyl < cyclohexyl < n-pentyl.
Qualitatively it has been shown that a bulkier N-pentyl group increases the barrier to rotation around the (S)CN(
alkyl)(para-X-Ph) bond over the N-methyl group and this leads to higher concentrations of the ZZ isomer over the
EZ and EE isomers. The combined effects of the electron-donating substituent (X = O-CH3) on the N-(para-X-Ph)
group and the bulkier N-alkyl group (n-pentyl) result in highest ZZ concentration (76 %) over EZ and EE isomers in
the complex cis-bis(N-pentyl-N-(4-methoxy-phenyl)-N’-2,2-dimethylpropanoylthioureato)platinum(II), cis-[Pt(L1DS,
O)2]. The lowest concentration ZZ (27 %) is obtained in the complex cis-bis(N-methyl-N-(4-nitro-phenyl)-N’-2,2-
dimethylpropanoylthioureato)platinum(II), cis-[Pt(L3A-S,O)2] when the coordinated ligand has both N-methyl group
and N-(4-nitro-Ph) group which both lower the barrier to rotation around the (S)C-N(alkyl)(para-X-Ph) bond.
A crystal of the complex cis-bis(N-pentyl-N-(4-methoxy-phenyl)-N’-2,2-dimethylpropanoylthioureato)platinum(II),
cis-[Pt(L1D-S,O)2] has been isolated and structurally characterised and was shown to be in the ZZ configuration,
which is the major component (76 %) in chloroform. This is the first example of Pt(II) chelates with asymmetrically
disubstituted ligands to be reported.<br>AFRIKAANSE OPSOMMING: Die gedeeltelike dubbelbinding karakter van die koolstof-stikstof-binding van die (S)C-NRR’-moieteit lei tot
onsimmetriese dialkiel-gesubstitueerde N,N-dialkiel-N’-asieltioureums, R”C(O)NHC(S)NRR’ (HL) wat E,Zkonfigurasionele
isomerie in oplossing besit. Die isomerie is sigbaar in die verdubbelling van die seine van die Nalkielgroepe
in die 1H- en 13C-KMR spektra. In een so klas ligande waar R- en R’-groepe nie-ekwivalente
alkielgroepe is, is isomerie duidelik sigbaar by 298 K in chloroform. In die ander klas waar R’ steeds ’n alkielgroep
is, en R ’n para-gesubstitueerde feniel groep, is die isomerie alleenlik sigbaar by baie laer temperature as gevolg van
’n laer rotasieversperring om die (S)C-N(alkiel)(para-X-Ph)-binding (X = O-CH3, H and NO2). Die
elektrononttrekkende aard van die nitrogroep in N-metiel-N-(4-nitrofeniel)-N’-(2,2-dimetielpropanoïel)tioüreum,
HL3A en N-(4-nitrofenyl)-N-pentiel-N’-(2,2-dimetielpropanoïel)tioüreum, HL3D lei daartoe dat die E,Z-isomerie van
die ligande nie eers by 198 K in dichlorometaan waargeneem word nie. Die verspreiding van die E en Z isomere
verskil na gelang van die R en R’ groepe. Verskeie E-isomere van hierdie ligande is geïsoleer en struktureel
gekarakteriseer en die (S)C-NRR’-bindingslengte is in ‘n gebied [1.343(3) – 1.329(3) Å] wat korter is as die
gemiddelde C-N-enkelbindingslengte van 1.472(5) Å.
Die Pt(II) chelate wat afgelei is van die ligande is blootgestel aan die E,Z-konfigurasie isomere van die ongebinde
ligande. Die teenwoordigheid van cis-[Pt(ZZ-L-S,O)2], cis-[Pt(EZ-L-S,O)2] en cis-[Pt(EE-L-S,O)2] is maklik
waarneembaar deur middel van 195Pt-KMR-spektroskopy wat drie goed geresolueerde seine toon, en dit kan bevestig
word met 1H- en 13C-KMR spectra van hierdie komplekse. Die 195Pt kerne is ruimtelik geskakel met die 13C kerne
deur vier bindings wat aanleiding gee tot 4J(195Pt-13C)-koppelings met N-CH2- of N-CH3-koolstofatome in ‘n Wkonformasie.
Die 195Pt KMR spektra word geskakel met die N-CH2- of N-CH3-protonresonansies in al drie die
moontlike ZZ, EZ en EE kompleksisomere. Toekenning van die konfigurasionele isomere is dan bewerkstellig deur
middel van ‘n kombinasie van lae magneetveld 13C-KMR spectra en hoë resolusie gHSQC (1H/13C) KMR
experimente.
1H-KMR-rotasiedinamiek studie toon dat die rotasiegrens, ΔG≠, om die (S)C-N(Me)(para-X-Ph)-binding in cisbis(
N-metiel-N-(4-metoksifeniel)-N’-2,2-dimetielpropanoïeltioureato)platinum(II), cis-[Pt(L1A-S,O)2]; cis-bis(Nfeniel-
N-metiel-N’-2,2-dimetielpropanoïeltioureato)platinum(II), cis-[Pt(L2A-S,O)2] en cis-bis(N-metiel-N-(4-
nitrofeniel)-N’-2,2-dimetielpropanoïeltioureato)platinum(II), cis-[Pt(L3A-S,O)2] komplekse was met die volgende
orde bepaal: (elektron-ontrekkende groep) NO2 < H < (elektron-skenkende groep) O-CH3. Die ZZ-isomeer blyk by
voorkeur te vorm bo die EZ- en EE-isomere in dieselfde orde as hierbo wat betref para-substituent aan die Nfenielgroep.
Die 1H dinamiese KMR tendencies ten opsigte van die rotasiegrens, ΔG≠, om die (S)C-N(Me)(para-XPh)-
binding is gekomplimenteer met DFT-linêre organgs berekeninge. Die isomer verspreidings blyk ook beïnvloed
te word deur die oplosmiddel polariteit en die temperatuur waarby die verspreidings bepaal is, buiten die elektroniese
invloed van die para-substituent aan die N-fenielgroep. Die ZZ, EZ en EE isomeer verspreiding van komplekse wat afgelei is van N-alkiel-N-(para-X-Ph)-N’-asieltioureums
met veranderlike N-alkiel substituente (metiel, isopropyl, sikloheksiel, en n-pentiel) is vasgestel deur middel van die
195Pt KMR wat opgeneem is onder identiese kondisies. Die ZZ-isomeer blyk die verkose isomeer te wees bo die EZen
EE-isomere waar die metiel substituent vervang word met ‘n groter alkiel groep in die orde van: metiel <
isopropiel < sikloheksiel < n-pentiel. Dit is kwalitatief getoon dat die groter N-pentielgroep die rotasiegrens verhoog
vir rotasie om die (S)C-N(alkiel)(para-X-Ph)-binding bo dié van die N-metielgroep wat aanleiding gee tot hoër
konsentrasies van die ZZ-isomeer relatief tot die EZ- en EE-isomere. Die gekombineerde uitwerking van die
electron-skenkende substituent (O-CH3) op die N-(para-X-Ph)-groep en die groter N-alkiel groep (n-pentiel) gee
aanleiding tot die hoogste ZZ-konsentrasie (76%) bo EZ- en EE-isomere in die kompleks cis-bis(N-pentiel-N-(4-
metoksifeniel)-N’-2,2-dimetielpropanoïeltioureato)platinum(II), cis-[Pt(L1D-S,O)2]. Die laagste konsentrasie ZZ
(27%) is verkry in die kompleks cis-bis(N-metiel-N-(4-nitrofeniel)-N’-2,2-dimetielpropanoïel)tioureato)platinum(II),
cis-[Pt(L3A-S,O)2] waar die gekoördineerde ligand beide die N-metiel- sowel as die N-(4-nitro-Ph)-groep, wat albei
die rotasiegrens van die (S)C-N(alkiel)(para-X-Ph)-binding verlaag.
‘n Kristalstruktuur van die kompleks cis-bis(N-pentiel-N-(4-metoksifeniel)-N’-2,2-dimetielpropanoïeltioureato)
platinum(II), cis-[Pt(L1D-S,O)2] wat geïsoleer is, is struktureel gekarakteriseer en is in die ZZ-konfigurasie,
wat die hoofkomponent (76%) is in chloroform. Hierdie is die eerste voorbeeld van Pt(II) chelate met asimmetriese
digesubstitueerde ligande om geraporteer te word.
35
Christendat, Dharamdat. "Synthesis, structural and solid-state, multinuclear magnetic resonance studies of some manganese and nickel complexes containing silicon, tin, lead and phosporus ligands." Thesis, National Library of Canada = Bibliothèque nationale du Canada, 1998. http://www.collectionscanada.ca/obj/s4/f2/dsk1/tape10/PQDD_0007/NQ44384.pdf.
Full text
36
Christendat, Dharamdat. "Synthesis, structural and solid-state, multinuclear magnetic resonance studies of some manganese and nickel complexes containing silicon, tin, lead and phosphorus ligands." Thesis, McGill University, 1998. http://digitool.Library.McGill.CA:80/R/?func=dbin-jump-full&object_id=34928.
Full textAbstract:
A number of organometallic complexes involving manganese, bonded to silicon, tin, lead and phosphorus ligands, and nickel, bonded to various trialkylphosphine ligands, has been synthesized and their crystal structures, vibrational, and multinuclear magnetic resonance spectra have been obtained. The FT-IR and FT-Raman spectra of the manganese carbonyl compounds in the carbonyl region (2200--1850 cm--1) have been assigned. Solid-state, CP-MAS, 13C, 29Si, 31P, 117Sn, 119Sn and 207Pb NMR spectra of substituted pentacarbonylmanganese(I) and tetracarbonylmanganese(I) complexes feature asymmetric sextets, whereas those containing a group 14 (IVA) element bridging two pentacarbonylmanganese(I) moieties show asymmetric sextets. The uneven splitting arises from spin-spin coupling and second-order quadrupole-dipole effects, which are not eliminated by magic angle spinning. The solid-state NMR spectra of the manganese complexes have been analyzed to give the isotropic chemical shifts, the chemical shift tensors, one-bond spin-spin coupling constants, 55Mn nuclear quadrupole coupling constants, effective dipolar coupling constants and the anisotropies; in the spin-spin coupling for each complex. The results provide new insights into the relationship between spin-spin coupling and quadrupolar coupling in bimetallic complexes involving a quadrupole transition-metal and a spin-1/2 nucleus.<br>For the para-substituted triaryltin complexes, the 13C, 55Mn and 119Sn chemical shifts and one-bond spin-spin constants in solution show excellent correlations with pairs of substituent constants (sigmaI, sigmaR). However, there is no correlation of the chemical shifts or spin-spin coupling with either Hammett (sigmaP) or Taft (sigmaP o) constants or the Mn-Sn bond lengths, rMn-Sn. The results obtained from dual substituent parameter (DSP) analysis indicate that both resonance effects (sigmaR) and inductive effects (sigma I) are important in determining the NMR parameters.<br>Crystal structures and high-resolution solution and solid-state 31P NMR spectra were obtained for several dihalobis(trialkylphosphine)nickel(II) complexes. The crystal structures and NMR results indicate that these complexes are trans square-planar in the solid-state. The chemical shifts and shift tensors were obtained and found to vary with the electronic properties of the halogens. The 31P isotropic chemical shifts in the solution spectra of dibromo- and diiodiobis(tribenzylphosphine)nickel(II) are very different from those found for the solid-state, and chemical exchange effects were observed in all spectra. The mechanism of exchange appears to involve the formation of dimers with bridging halides.
37
Lo, Hiu-suet, and 盧曉雪. "Design and syntheses of luminescent alkynyl complexes containing multinuclear platinum (II) and coinage metal centres: from photophysics to host-guest chemistry andsupramolecular architectures." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2009. http://hub.hku.hk/bib/B41633714.
Full text
38
Lo, Hiu-suet. "Design and syntheses of luminescent alkynyl complexes containing multinuclear platinum (II) and coinage metal centres from photophysics to host-guest chemistry and supramolecular architectures /." Click to view the E-thesis via HKUTO, 2009. http://sunzi.lib.hku.hk/hkuto/record/B41633714.
Full text
39
Ruhayel, Rasha A. "Multinuclear platinum anticancer therapeutics : insights into their solution chemistry and DNA binding interactions from NMR spectroscopy and molecular modelling." University of Western Australia. School of Biomedical, Biomolecular and Chemical Sciences, 2010. http://theses.library.uwa.edu.au/adt-WU2010.0021.
Full textAbstract:
In the 1980's, Nicholas Farrell developed a range of structurally distinct multinuclear Pt complexes that form long-range interstrand crosslinks (IXLs) in DNA. The dinuclear complex [{trans-PtCl2(NH3)}2-µ-(H2N(CH2)6NH2)]2+ (1,1/t,t) was the first of this series to show promising results, however, it was the trinuclear complex [{trans-PtCl2(NH3)}2-µ-trans-Pt(NH3)2(H2N(CH2)6NH2)2]4+ (1,0,1/t,t,t or BBR3464) that was chosen for clinical trials based on significantly increased cytotoxicity compared to 1,1/t,t and cisplatin. Molecular biology experiments have shown that 1,1/t,t exclusively forms IXLs in DNA in the 5'¿ 5' direction, whilst 1,0,1/t,t,t can form IXLs in both the 5'¿5' and 3'¿3' directions. Previously, 2D [1H,15N] HSQC NMR has been used to study the formation of 5'5' 1,4GG IXLs. The formation of 3'3' 1,4GG IXLs have been studied as part of this thesis. More recently, Pt complexes such as [{transPtCl2(NH3)}2{H2N(CH2)6(NH2(CH2)2NH2)(CH2)6NH2}]4+ (1,1/t,t6,2,6) and [{transPtCl2(NH3)}2{H2N(CH2)6(NH2)(CH2)6NH2}]3+ (1,1/t,t6,6), where the charged central Pt moiety of 1,0,1/t,t,t is replaced by a polyamine linker, have been developed in the Farrell group and show increased potency compared to 1,0,1/t,t,t. The complex 1,1/t,t 6,2,6 is a lead candidate currently undergoing Phase I clinical trials. Prior to the work presented in this thesis, little was known about the aquation chemistry or kinetics of DNA binding of these novel complexes. Reported in Chapter 3 is the study of the formation of 3'3' 1,4GG IXLs by both 1,0,1/t,t,t and 1,1/t,t in the duplex 5' {d(TATACATGTATA)2} (3314XL) (pH 5.4, 298K). A combination of 1D 1H and 2D [1H, 15N] HSQC NMR experiments was used to directly compare the results with the stepwise formation of the 5'5' 1,4GG IXL with the previously studied duplex, 5' {d(ATATGTACATAT)2} (5514XL), under the same conditions. Preassociation as well as aquation were similar, however, differences were observed at the monofunctional binding step with evidence for numerous monofunctional adducts. Both reactions did not yield a single 3'3' 1,4GG IXL, rather several adducts that could not be characterised. Molecular dynamics simulations of the 3'3' 1,4GG IXLs showed highly distorted lesions that may have implication in cellular repair processes.
40
Mtongana, Sibusiso. "A multinuclear (1H, 13C, 31P and 195Pt) magnetic resonance spectroscopy study of mixed ligand platinum(II) complexes with new N,N-dialkyl-N'-acyl(aroyl)thioureas as ligands." Thesis, Stellenbosch : Stellenbosch University, 2002. http://hdl.handle.net/10019.1/52649.
Full text
41
Kruppa, Sebastian [Verfasser], and Christoph [Akademischer Betreuer] Riehn. "Photochemistry and Ultrafast Dynamics of Mass-selected Multinuclear Coinage Metal Complexes Studied by Electronic Photodissociation Ion Spectroscopy in an Ion Trap / Sebastian Kruppa ; Betreuer: Christoph Riehn." Kaiserslautern : Technische Universität Kaiserslautern, 2021. http://d-nb.info/1227925654/34.
Full text
42
Jahnke, Ann Christin. "Liganden mit N/S-Donorsets in der Münzmetallchemie: Modellkomplexe für Methanobactin und multinukleare, lumineszierende Pyrazolat-Komplexe." Doctoral thesis, Niedersächsische Staats- und Universitätsbibliothek Göttingen, 2012. http://hdl.handle.net/11858/00-1735-0000-000E-0CEF-3.
Full text
43
Lum, June S. "1. Dioxygen reactivity of multinuclear fluorinated copper(I) alkoxides facilitated by secondary ligand interactions 2. synthesis and characterization of monomeric O-donor complexes of divalent copper and zinc." Thesis, Boston University, 2013. https://hdl.handle.net/2144/12811.
Full textAbstract:
Thesis (Ph.D.)--Boston University
PLEASE NOTE: Boston University Libraries did not receive an Authorization To Manage form for this thesis or dissertation. It is therefore not openly accessible, though it may be available by request. If you are the author or principal advisor of this work and would like to request open access for it, please contact us at open-help@bu.edu. Thank you.<br>Copper(I) complexes with fluorinated alkoxide ligands with the form K[Cu(OCRMe^F2)2], in which R = Me^F (4), Ph (5), or Me (6), were synthesized and characterized. The dioxygen (O2) reactivity of the series of complexes was investigated at -78°C and two stoichiometries of {CunO2} species were observed. Manometric O2 uptake studies showed dinuclear {Cu2O2} and triuclear {Cu3O2} species and their chromophores were measured with UV-vis spectroscopy. Warming these species to room temperature resulted in irreversible spectroscopic changes, and ligand hydroxylation was observed for complexes 5 and 6. ESI-MS study of reactions with 18O2 confirmed O2 as the source of the ligand hydroxyl O atom. A tetrameric Cu(II) carbonate complex, {{K2(DME)1.5}[Cu(OCMeMe^F2)2C03]}4 (14), was obtained from CO2 addition to the {Cu2O3} moiety derived from 6.
Irreversible reduction of O2 required secondary potassium-ligand (K···F and K-O) interactions which bridge multiple [Cu(OCRMe^F2)2]- anions in solid-state structures of 4, 5, and 6, and were quantified by K+ cation bond valence analysis. Solution conductivity studies confirmed that neutral aggregates of K[Cu(OCRMe^F2)2] complexes are retained in solution. Ionic copper(I) complexes of the form {K(18C6)}[Cu(OCRMe^F2)2] in which R = Me^F (7), Ph (8), or Me (9) and (Ph4P)[Cu(OCRMe^F2)2], with R = Me^F (10) were prepared, none of which react with O2 at -78°C.
The Cu(II) alkoxide compounds {K(18C6)}[Cu(OCRMe^F2)3], in which R= Me^F (15) and Me (16) were prepared and spectroscopically and magnetically characterized. Compound 16 was demonstrated to be trigonal-planar by X-ray crystallography and all other data for 15 are consistent with trigonal-planar coordination. Two four-coordinate Cu(II) compounds with dodecafluoropinacolate (ddfp) ligands were also synthesized and characterized spectroscopically. The structurally characterized square-planar ddfp compounds have the form {K(solvent)2}2[Cu(ddfp)2], in which solvent= H2O (17) or DME (18). Diamagnetic Zn(II) derivatives with aryloxide ligands of the form {K(18C6)}2[Zn(OAr)4], m which Ar = A^F (19) or Ar' (20) and {K(18C6)}[Zn(OCRMe^F2)3], with R = Ph (21) were also prepared and characterized by X-ray crystallography and multinuclear NMR.
44
Hung, Ling-ling. "Novel luminescent cyclometalated gold (III) alkynyls design, synthesis, photophysics and their multinuclear assemblies /." Click to view the E-thesis via HKUTO, 2007. http://sunzi.lib.hku.hk/hkuto/record/B3963453X.
Full text
45
Malgas, Rehana. "The application of novel multinuclear catalysts derived from dendrimeric ligands in the polymerization and oligomerization of unsaturated hydrocarbons." Thesis, University of the Western Cape, 2007. http://etd.uwc.ac.za/index.php?module=etd&action=viewtitle&id=gen8Srv25Nme4_7858_1183727432.
Full textAbstract:
<p>G1 and G2 dendrimeric salicylaldimine ligands containing both substituted and unsubstituted aryl rings were synthesized via a Schiff base condensation of the appropriate salicylaldehyde and the peripheral amino groups of the corresponding G1 and G2 polypropyleneimine dendrimers. The new ligands were characterized using FTIR, 1H NMR and 13C NMR spectroscopy, elemental analysis and ESI mass spectrometry. The dendrimeric ligands were converted to multinuclear nickel complexes by reaction with nickelacetate. The metal complexes were characterized by FTIR spectroscopy, elemental analysis and ESI mass spectrometry.</p>
<p>Some of the dendritic complexes were evaluated as catalyst precursors in the oligomerization of &alpha<br>-olefins such as ethylene and 1-pentene, using aluminium alkyls such as EtAlCl2 and modified methylaluminoxane (MMAO) as activators. All the dendrimeric catalysts evaluated are active in the oligomerization reactions. From the oligomerization results it was observed that there is a clear dendritic effect, in that both catalyst activity as well as selectivity are impacted by the dendrimer generation. In most cases it was observed that the second generation complexes show higher activity than the corresponding first generation complexes.</p>
<p>The dendrimeric complexes were also evaluated as catalyst precursors in the vinyl polymerization of norbornene. In this case methylaluminoxane (MAO) were employed as an activator. Once again it was noted that a dendritic effect is operative, with second generation metallodendrimers having a higher activity than the first generation complexes.</p>
46
Iwamoto, Takahiro. "Studies on Synthesis and Host-Guest Chemistry of Cycloparaphenylenes." 京都大学 (Kyoto University), 2014. http://hdl.handle.net/2433/188613.
Full text
47
Brodie, Craig R., University of Western Sydney, College of Health and Science, and School of Biomedical and Health Sciences. "Multinuclear DNA binding ruthenium complexes." 2006. http://handle.uws.edu.au:8081/1959.7/16203.
Full textAbstract:
This thesis reports the synthesis, characterisation and DNA binding of a number of novel ruthenium(II) complexes. Four mononuclear complexes were synthesised. These complexes were resolved using a large scale extraction procedure employing the chiral TRISPHAT anion. The racemic mononuclear complexes containing halogenated ligands were used in the synthesis of the racemic dinuclear complexes. Resolved mononuclear complexes were also used to stereo-selectively synthesise enantiomers of their respective dinuclear complexes. All metal complexes were characterised using fluorescence spectroscopy. Resolved metal complexes were further characterised using CD spectroscopy to determine their molar rotation coefficients and optical purity. Preliminary DNA binding studies were conducted using the racemic dinuclear complexes and their mononuclear equivalent. Titration experiments with calf thymus-DNA were used to determine the DNA binding constant and binding site size. Samples containing a higher NaCl concentration (100 mM) slightly improved the oligonucleotide spectrum resolution, but not to an extent where a complex binding model could be determined. Attempts to determine DNA binding preferences of the dinuclear complexes with oligonucleotides which contain two-adenine bulge sites using a 96-well a fluorescence plate reader were attempted, but were unsuccessful. Samples containing a higher NaCl concentration (100 mM) slightly improved the oligonucleotide spectrum resolution, but not to an extent where a complex binding model could be determined. Attempts to determine DNA binding preferences of the dinuclear complexes with oligonucleotides which contain two-adenine bulge sites using a 96-well a fluorescence plate reader were attempted, but were unsuccessful.<br>Doctor of Philosophy (PhD)
48
Brodie, Craig R. "Multinuclear DNA binding ruthenium complexes." Thesis, 2006. http://handle.uws.edu.au:8081/1959.7/16203.
Full textAbstract:
This thesis reports the synthesis, characterisation and DNA binding of a number of novel ruthenium(II) complexes. Four mononuclear complexes were synthesised. These complexes were resolved using a large scale extraction procedure employing the chiral TRISPHAT anion. The racemic mononuclear complexes containing halogenated ligands were used in the synthesis of the racemic dinuclear complexes. Resolved mononuclear complexes were also used to stereo-selectively synthesise enantiomers of their respective dinuclear complexes. All metal complexes were characterised using fluorescence spectroscopy. Resolved metal complexes were further characterised using CD spectroscopy to determine their molar rotation coefficients and optical purity. Preliminary DNA binding studies were conducted using the racemic dinuclear complexes and their mononuclear equivalent. Titration experiments with calf thymus-DNA were used to determine the DNA binding constant and binding site size. Samples containing a higher NaCl concentration (100 mM) slightly improved the oligonucleotide spectrum resolution, but not to an extent where a complex binding model could be determined. Attempts to determine DNA binding preferences of the dinuclear complexes with oligonucleotides which contain two-adenine bulge sites using a 96-well a fluorescence plate reader were attempted, but were unsuccessful. Samples containing a higher NaCl concentration (100 mM) slightly improved the oligonucleotide spectrum resolution, but not to an extent where a complex binding model could be determined. Attempts to determine DNA binding preferences of the dinuclear complexes with oligonucleotides which contain two-adenine bulge sites using a 96-well a fluorescence plate reader were attempted, but were unsuccessful.
49
Chung-Wei, Liu. "Preparation of multinuclear Ruthenium Vinylidene Complexes and Their Deprotonation Reactions." 2006. http://www.cetd.com.tw/ec/thesisdetail.aspx?etdun=U0001-2806200612411500.
Full text
50
Liu, Chung-Wei, and 劉中偉. "Preparation of multinuclear Ruthenium Vinylidene Complexes and Their Deprotonation Reactions." Thesis, 2006. http://ndltd.ncl.edu.tw/handle/17152775044433618155.
Full textAbstract:
碩士<br>國立臺灣大學<br>化學研究所<br>94<br>Treatment of [Ru]-Cl, [Ru] = CpRu(PEt3)2, with phenylacetylene in the presence of KPF6 in methanol affords [Ru]=C=C(H)Ph+ (2) and then deprotonation of 2 by MeONa yields complex [Ru]-C≡C-Ph (3) isolated as yellow solid in high yield. Reactions of 3 with various organic halides in the presence of KPF6 yield corresponding air stable cationic vinylidene complexes [Ru]=C=C(Ph)CH2R+ (4a, R = CH=CH2; 4b, R = CN; 4c, R = C≡CH; 4d, R = CO2Me; 4e, C≡C(SiMe3); 4f, R = Ph; 4g, R = COOEt), respectively, all in high yield. Deprotonation of mononuclear cationic vinylidene complexes of ruthenium [Ru]=C=C(Ph)CH2R (4a, R = CH=CH2, 4b, R = CN, 4f, R = Ph) yields corresponding cyclopropenyl complexes [Ru]-C=C(Ph)CHR (5a, R = CH=CH2, 5b, R = CN, 5f, R = Ph) in high yield. The neutral ruthenium furyl complexes [Ru]-C=C(Ph)CH=C(O)OR, (6d, R = Me; 6g, R = Et) are also prepared by deprotonation of corresponding ruthenium vinylidene complexes containing an ester group at Cγ.
Reaction of the terminal alkynyl group of 4c with [Ru’]-Cl in the presence of KPF6 affords the bisvinylidene complexes [Ru]=C=C(Ph)CH2C(H)=C=[Ru’], (7w, [Ru’] = CpR (PEt3)2; 7x, [Ru’] = CpRu(PPh3)2) which deprotonated to give the alkynyl,vinylidene complexes [Ru]=C=C(Ph)CH2C≡C-[Ru’], (8w, [Ru’] = CpRu(PEt3)2; 8x, [Ru’] =
CpRu(PPh3)2 in the presence of base. Alkylation of complex 8w with various primary alkyl halide affords the corresponding cationic ruthenium bisvinylidene complexes[Ru]=C=C(Ph)CH2C(CH2R)=C=[Ru’], ([Ru’] = CpRu(PEt3)2; 9w, R = CH=CH2; 10w, R = CN; 11w, R = C≡CH; 12w, R = CO2Me; 13w, R = COOEt; 14w, R = Ph; 15w, R = C≡C(SiMe3)). Complexes 9x, 10x, 11x, 12x, 13x, 15x are also successfully obtained by the same synthetic strategy. Deprotonation of the dinuclear dicationic vinylidene complex {[Ru]=C=C(Ph)CH2C(CH2CN)=C=[Ru’]}2+ (10w) by n-Bu4NOH is also followed by a cyclization process, however, yielding the distinctive stable complex 16w containing a five-membered carbocyclic ring ligand which is fully characterized by 2D-NMR analysis and single crystal X-ray diffraction analysis. Deprotonation of {[Ru]=C=C(Ph)CH2C(CH2COOEt)=C=[Ru’]}2+ (13w) similarly gave the stable product 17w containing a bridging ligand also with the same five-membered carbocyclic ring. Interestingly, analogous dinuclear complex 16x with bistriphenylphosphine ligand on one metal, which is prepared in a similar manner
from {[Ru]=C=C(Ph)CH2C(CH2CN)=C=[Ru’]}2+ (10x), however, is unstable undergoing isomerization to give the dinuclear complex 18x containing cyclopropenyl ligand.
The reaction of 11w with [Ru”]-Cl, [Ru”] = CpRu(PEt3 2, gives the trinuclear trisvinylidene complex 21 which undergoes deprotonation to give the trinuclear bisvinylidene acetylide complex 22 characterized by spectroscopic method. Treatment of complex 1 with 1,1 diphenyl-2-propyn-1-ol yields the cationic ruthenium allenylidene complex [Ru]=C=C=C(Ph)2+, (30, [Ru] = CpRu(PEt3)2), in high yield which reacts with Grignard reagent RCH2MgBr in THF affords the neutral ruthenium acetylide complexes [Ru]-C≡C-C(Ph)2CH2R, (31a, R = CH=CH2; 31b, R =
C≡CH). Complexes 30 undergo protonation reactions giving the corresponding vunylidene complexes [Ru]=C=C(H)-C(Ph)2CH2R+, (32a, R = CH=CH2; 32b, R = C≡CH). Unfortunately, no transformation of complexes 32 in solution is observed
indicating the reactivity of complexes 32a and 32b is different from that reported previously.
A number of cationic ruthenium isocyanide complexes [Ru]-CNCH2R+, ([Ru] = CpRu(PEt3)2; 41a, R = Ph; 41b, R = C≡CH) are prepared by alkylation of Ru cyano complex 40 with corresponding alkyl halide. Treatment of complex 41a with base in acetone cause the formation of ruthenium oxazolinyl complex Cp(PEt3)2RuCNCH(Ph)C(Me)2O (43). Complex 41a also reacts with benzaldehyde in CH2Cl2 to afford another ruthenium oxazolinyl complex Cp(PEt3)2RuCNCH(Ph)C(Ph)HO (44).