To see the other types of publications on this topic, follow the link: Mutation h63d.
Journal articles on the topic 'Mutation h63d'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Mutation h63d.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Nanah, Rama, Mrinal Patnaik, Naseema Gangat, Darci Zblewski, Rong He, Phuong L. Nguyen, Michelle A. Elliott, William J. Hogan, Mark Robert Litzow, and Aref Al-Kali. "Clinical significance of HFE gene mutations in patients with refractory anemia with ring sideroblasts (RARS)." Journal of Clinical Oncology 35, no. 15_suppl (May 20, 2017): e18556-e18556. http://dx.doi.org/10.1200/jco.2017.35.15_suppl.e18556.
Full textAbstract:
e18556 Background: RARS is a subtype of myelodysplastic syndromes (MDS) defined by < 5% blasts and ≥15% ring sideroblasts (WHO 2008). Hereditary hemochromatosis is a disorder characterized by dysregulations in iron absorption, largely associated with C282Y and H63D mutations of the HFE gene. Iron levels are elevated in both disorders and pathophysiologic correlations were suggested. HFE gene mutations were previously found higher in MDS compared to controls (50% vs 36%) ( Nearman et al, Am J Hematol 2007). Methods: A total of 168 RARS patients’ data from 1994 to 2015 at Mayo Clinic were reviewed after appropriate IRB approval was obtained. All cases had their bone marrow slides reviewed at our center. We searched patients’ records retrospectively to Identify those tested for HFE gene (C282Y, H62D, S65C) mutations, done inside or outside our institution. Survival estimates were calculated using Kaplan-Meier curves. Results: Out of the 168 RARS patients, only 17 (10%) were tested for HFE gene mutations. Out of the 17 tested, 11 (65%) were found to have mutations; 2 of which (18%) had homozygous H63D mutation, 1 patient (9%) had double heterozygous H63D and C282Y mutations, 5 (45%) had only one H36D heterozygous mutation vs 3 patients (27%) with only one C282Y heterozygous mutation. Only one patient was tested for the additional S65C mutation and it was not detected. H63D mutation was present in a total of 8 patients (73%) vs C282Y mutation which was present in 4 patients (36%). Bone marrow iron stores were increased in all 17 tested patients, except one who had decreased stores, this patient had one heterozygous C282Y mutation. Median overall survival (mOS) was 117 months in the HFE mutated patients vs 75 months in the non-mutated (p = 0.6). Conclusions: Our study found the HFE gene, when tested, to be mutated in higher frequencies among patients with RARS compared to that reported in the general population (65% vs 36%), with H63D mutation in almost three quarters of all mutated patients. Although it did not reach statistical significance, the longer survival observed among HFE mutated patients compared to the wild-type raises the question whether testing for HFE gene mutations among patients with MDS-RARS should be further explored.
2
Ali, Nadir, Bashir Ahmed, Humaira Akram, Junaid Akhtar, Ross Williams, and Ron Dixon. "HFE GENE MUTATIONS." Professional Medical Journal 25, no. 01 (January 10, 2018): 129–34. http://dx.doi.org/10.29309/tpmj/2018.25.01.551.
Full textAbstract:
Objectives: To determine the frequency of two common HFE Gene Mutations(C282Y & H63D) in an immigrant population (British Pakistanis) in UK. Study Design: Crosssectional study. Setting: University of Lincoln UK. Duration: Duration of study was 12 monthsfrom 01/09/2012 to 31/08/2013. Material and Methods: Two hundred immigrant Pakistani (BP)chromosomes (100 samples; 50 male and 50 female) from major cities of UK and 200 ancestralorigin Pakistani chromosomes (100 samples; 50 male and 50 female) were analysed by PCRRFLPfor the presence of the H63D and C282Y mutations. Results: Eight individuals were foundto be heterozygous for the H63D mutation and one individual was found to be homozygousfor the H63D mutation, therefore, the H63D mutation was observed to have a frequency of 8%in immigrant Pakistani (BP) population sample and similar results were observed in ancestralorigin population from Pakistan. The C282Y mutation was not detected at all. Conclusion: Wefound that our results are close to Saudi-Arabian and Indian population (8.5% & 9.1% H63Dmutation, respectively) and in accordance with the global spread of the H63D mutation.
3
Tursinawati, Yanuarita, Nyoman Suci Widyastiti, and Moedrik Tamam. "IDENTIFIKASI MUTASI H63D GEN HFE PADA KELAINAN HBE." INDONESIAN JOURNAL OF CLINICAL PATHOLOGY AND MEDICAL LABORATORY 22, no. 2 (March 27, 2018): 176. http://dx.doi.org/10.24293/ijcpml.v22i2.1123.
Full textAbstract:
The H63D HFE mutation has been reported to be responsible for primary haemochromatosis. The allele frequency in Indonesianpopulation is about 2.8%. Co inheritance between H63D mutation and hemoglobin disorders such as Thalassemia may increase theseverity of iron overload. Nevertheless, the coinheritance of this mutation with HbE disorder is the most common hemoglobin disorderin Indonesia and the gene frequency have not been reported especially in Javanese ethnic. To identify the presence and the frequency ofH63D HFE mutation in HbE disorder among Javanese ethnic. A cross sectional study involved 24 Javanese individuals who consist of21 HbE heterozygotes (HbAE) and 3 HbE homozygotes (HbEE) subjects. The subjects were screened for H63D mutation by digestion ofPCR products with MbO I restriction endonuclease. The genotype frequency for wt/wt was 95.24% in HbAE, 100% in HbEE and for wt/H63D was 4.76% in HbAE. The allele frequency for H63D HFE mutation was 2.08% in total sample of HbE. The allele frequencies inHbAE and HbEE individual were 2.38% and 0%, respectively. H63D HFE mutation is found in 24 Javanese ethnic individual with HbEdisorder. However, the allele frequency of H63D HFE mutation is low and almost similar to the allele frequency of H63D HFE mutationin Indonesian population.
4
Bradley, L. A., D. D. Johnson, G. E. Palomaki, J. E. Haddow, N. H. Robertson, and R. M. Ferrie. "Hereditary haemochromatosis mutation frequencies in the general population." Journal of Medical Screening 5, no. 1 (March 1, 1998): 34–36. http://dx.doi.org/10.1136/jms.5.1.34.
Full textAbstract:
Objectives This study aims to expand our knowledge of the general population frequency of two mutations, C282Y and H63D, identified in the candidate gene for hereditary haemochromatosis, and to determine whether the testing can be performed using routinely obtained cheek-brush (buccal) samples. Setting Banked buccal lysate samples, randomised and coded for anonymity, from a cohort of couples who underwent prenatal cystic fibrosis screening in Maine. Methods A multiplex ARMS test was performed on buccal cell lysates to identify the two mutations. Results Genotype frequencies found among the 1001 subjects studied (502 women, 499 men) were: seven C282Y homozygotes, 22 C282Y/H63D compound heterozygotes, 97 C282Y heterozygotes, 17 H63D homozygotes, 246 H63D heterozygotes, and 612 individuals with no detectable mutation. The allele frequencies for C282Y and H63D were 0.066 and 0.151, respectively. Conclusions Observed genotype frequencies in Maine are consistent with expectations and with consensus data from five smaller studies. Combined mutational analysis data indicate that homozygosity for C282Y (the genotype found in about 85% of subjects with diagnosed hereditary haemochromatosis) occurs in 51 per 10 000 white subjects of northern European heritage; the corresponding total hereditary haemochromatosis prevalence of about 60 per 10 000 is consistent with previous estimates. The study also confirms that H63D would not be useful in general population screening for hereditary haemochromatosis.
5
El-Beshlawy, Amal, Manal Michel Wilson, Elwakeel Hanan, Mona Elghmarwy, Fadwa Said, and Mary Assaad. "Study of the Effect of HFE Gene Mutations on Iron Overload in Egyptian Thalassemia Patients." Blood 124, no. 21 (December 6, 2014): 1359. http://dx.doi.org/10.1182/blood.v124.21.1359.1359.
Full textAbstract:
Abstract Introduction: β-thalassemia is a common genetic disorder affecting the β-globin gene, characterized by ineffective erythropoiesis and iron overload. It is the most common hereditary hemolytic anemia in Egypt(85.1%)with a carrier rate of 5.3to 9% and annual birth of 1000/1.5million live births born with the disease. Mutations in the HFE gene have been shown to be responsible for hereditary hemochromatosis, an autosomal recessive disease of iron overloading. The effect of these mutations on iron load in β- thalassemia patients and carriers remains controversial. Interaction between β- thalassemia and hemochromatosis may increase the likelihood of developing iron overload in thalassemic patients and thus may require early iron chelation. Objectives:In this cross-sectional case-control study, we aimed to determine the prevalence of HFE gene mutations (C282Y and H63D) in β- thalassemia patients and carriers and to investigate the effect of these mutations on their serum ferritin levels. Patients and Methods: A total of100 β-thalassemia subjects; 75 β- thalassemia patients (homozygous or compound heterozygous) and 25 carriers were screened for HFE gene mutations (H63D and C282Y) by polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP). Serum ferritin was measured for all subjects by enzyme-linked immunosorbant assay (ELISA) and β-globin gene mutations were determined by reverse hybridization technique. All β- thalassemia patients (45 males and 30 females with mean age 3.2 + 2.7 years) were diagnosed and followed at at our Pediatric Hematology Clinic. Their baseline serum ferritin at diagnosis was evaluated in relation to the HFE mutations. Twenty-five heterozygotes for β- thalassemia attending for genetic screening or parents or sibs of our patients were enrolled as carriers. All subjects and/or guardians gave informed consent before enrollment. Results: Twenty- eight of 75 β- thalassemia patients (37.3%) were heterozygotes for the H63D mutation (H/D), 8 (10.7%) were D/D homozygotes and 39 (52%) were negative for the mutation( H/H homozygotes). Among carriers, 4 (16%) were D/D homozygotes and 21 (84%) were H/H homozygotes(Fig1) . The C282Y mutant allele was not detected in any of patients or carriers. The median serum ferritin level was significantly higher in β- thalassemia patients compared to carriers (386 vs. 216 ng/ml; p=0.03). Serum ferritin levels were compared according to H63D genotypes in β- thalassemia patients and carriers (Table 1). There were significantly high levels of serum ferritin in β-thalassemia patients who were heterozygotes or homozygotes for the H63D mutation compared to those without the mutation (p=0.000).B-Thalassemia carriers homozygotes for the H63D mutation showed significantly higher serum ferritin levels compared to those without the mutation (P<0.001). The most prevalent underlying genetic mutation of β globin gene in our β-thalassemia patients was IVS 1.110 mutation followed by IVS 1.6. This study showed no correlation between these mutations and the H63D genotype. Conclusion:Homozygosity for the H63D mutation tend to be associated with higher ferritin levels in beta-thalassemia patients and carriers compared to the H/H genotype, suggesting that the H63D mutation may have a modulating effect on iron load. Screening of H63D mutation in β-thalassemia patients may predict patients with more tendency to develop early iron overload. Proper timely management of these patients prevents the hazard of iron overload. Figure (1): H63D polymorphism of the HFE gene in β-thalassemia patients and carriers Figure (1):. H63D polymorphism of the HFE gene in β-thalassemia patients and carriers Abstract 1359. Table 1: Serum ferritin levels in β-thalassemia patients and carriers according to their H63D genotype H63D Genotype β-thalassemia patients (n=75) β-thalassemia carriers (n=25) No. of subjects (%) Ferritin (ng/ml) Mean + SD P value No. of subjects (%) Ferritin (ng/ml) Mean + SD P value H/H H/D D/D 39(52%) 28 (37.3) 8(10.7%) 297.2 + 175.8 565.3 + 358 920.4 + 508.2 <0.001* 21(84%) - 4(16%) 221.9 + 142.9 - 969.8 + 290.3 <0.001* p-values: H/H vs. H/D; H/D vs. D/D;H/H vs. D/D < 0.001* Disclosures No relevant conflicts of interest to declare.
6
Alvarez, S., M. S. Mesa, F. Bandrés, and E. Arroyo. "C282Y and H63D Mutation Frequencies in a Population from Central Spain." Disease Markers 17, no. 2 (2001): 111–14. http://dx.doi.org/10.1155/2001/350460.
Full textAbstract:
Objectives:To determine the frequency of hereditary hemochromatosis gene mutations, C282Y and H63D, from 125 autochthonous blood donors originating from a Central region of Spain, to provide epidemiological data about HFE gene in the Iberian Peninsula.Methods:DNA extracted from blood samples was analyzed by PCR-RFLP. Restriction enzimes were Snab I and Bcl I for C282Y and H63D, respectively. Results were visualized with Ethidium Bromide staining after gel electrophoresis.Results and discussion:C282Y frequency was 0.02 and that of H63D was 0.16. Result for C282Y mutation falls within the range of variation of the Mediterranean populations. H63D frequency agrees with those reported for other European populations. In both cases frequencies obtained are the lowest of compared Spanish data.Conclusions:This study is useful to compare expected versus presented C282Y and H63D frequencies in Spanish populations and to contribute to the knowledge of Spanish variability, rarely analyzed until now for HFE gene mutations.
7
Gabriková, Dana, Iveta Boroňová, Ivan Bernasovský, Regina Behulová, Soňa Mačeková, Alexandra Bôžiková, Adriana Sovičová, et al. "Hemochromatosis gene mutations in the general population of Slovakia." Open Medicine 6, no. 2 (April 1, 2011): 148–51. http://dx.doi.org/10.2478/s11536-010-0067-9.
Full textAbstract:
AbstractThis is an epidemiologic study of the Slovak population with the aim of determining the frequencies of three hemochromatosis gene (HFE) variants C282Y, H63D and S65C known to be associated with manifestation of hereditary hemochromatosis and to assess deviations of these frequencies from those reported elsewhere. Mutations were detected in 359 ethnic Slovaks by real-time PCR assay based on TaqMan technology. The allelic frequencies were 4.03% for C282Y, 12.67% for H63D and 1.25% for S65C mutation. We observed 0.28% of C282Y/C282Y homozygotes, 3.34% H63D/H63D homozygotes, 0.84% of C282Y/H63D compound heterozygotes and 0.56% of H63D/S65C compound heterozygotes. This is the first time the frequencies of H63D and S65C mutations have been reported in the general population in Slovakia. The observed allelic frequencies are consistent with the previous studies of Slavic and Central European populations.
8
Enein, Azza Aboul, Nermine A. El Dessouky, Khalda S. Mohamed, Shahira K. A. Botros, Mona F. Abd El Gawad, Mona Hamdy, and Nehal Dyaa. "Frequency of Hereditary Hemochromatosis (HFE) Gene Mutations in Egyptian Beta Thalassemia Patients and its Relation to Iron Overload." Open Access Macedonian Journal of Medical Sciences 4, no. 2 (June 1, 2016): 226–31. http://dx.doi.org/10.3889/oamjms.2016.055.
Full textAbstract:
AIM: This study aimed to detect the most common HFE gene mutations (C282Y, H63D, and S56C) in Egyptian beta thalassemia major patients and its relation to their iron status. SUBJECTS AND METHODS: The study included 50 beta thalassemia major patients and 30 age and sex matched healthy persons as a control group. Serum ferritin, serum iron and TIBC level were measured. Detection of the three HFE gene mutations (C282Y, H63D and S65C) was done by PCR-RFLP analysis. Confirmation of positive cases for the mutations was done by sequencing.RESULTS: Neither homozygote nor carrier status for the C282Y or S65C alleles was found. The H63D heterozygous state was detected in 5/50 (10%) thalassemic patients and in 1/30 (3.3%) controls with no statistically significant difference between patients and control groups (p = 0.22). Significantly higher levels of the serum ferritin and serum iron in patients with this mutation (p = 001).CONCLUSION: Our results suggest that there is an association between H63D mutation and the severity of iron overload in thalassemic patients.
9
Nie, Ling, Lin Yang, Qinghua Li, Jianxiang Wang, and Zhijian Xiao. "Incidence of HFE Gene Mutations in Chinese Patients with Myelodysplastic Syndrome and Aplastic Anemia." Blood 112, no. 11 (November 16, 2008): 5085. http://dx.doi.org/10.1182/blood.v112.11.5085.5085.
Full textAbstract:
Abstract The C282Y and H63D mutations of HFE gene responsible for hereditary hemochromatosis lead to absorption of excess dietary iron, tissue iron deposition and occurrence of clinical complications such as congestive heart failure, arrhythmia, hepatocellular cirrhosis, insulin resistance and diabetes. Iron overload is one important clinical feature in patients with myelodysplastic syndrome (MDS) and aplastic anemia(AA). However, the conflict has been existing about influence of HFE gene mutations on iron overload in MDS patients. In the present study, we analyzed the incidence of the C282Y and H63D mutations of HFE gene in 271 MDS patients, 402 AA patients and 1615 healthy controls by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). No C282Y mutations and compound heterozygote were observed in the entire cohort. The genotype distribution of H63D heterozygous and homozygous did not differ significantly in AA cases from those in controls(9.7%vs. 10.2%, 0.25%vs. 0.24% respectively, Pearson Chi-square p both >0.05). While the frequency of the H63D heterozygous in MDS patients was significantly lower than controls (4.1%vs. 10.7%, Pearson Chi-square p=0.002). H63D homozygous was not found in MDS patients. The incidence of C282Y and H63D mutations of HFE gene in Chinese MDS cases is lower than those reported in the literature. Comparing the pretransfusion serum ferritin(SF), serum iron concentration(SI) and transferrin saturation values(TS) between HFE-mutation and HFE-wild MDS groups, we did not find a significant difference (all P>0.05); However, Only SI values were significantly higher in the HFE-mutation AA cases than those in HFE-wild ones[42.6(24.6–60.4)umol/Lvs. 32.0(8.4–63.3)umol/L, P=0.011]. We further estimated the function of important organs in MDS and AA patients. There is no significantly difference in Alanine amino transferase (ALT), Aspartate amino transferase (AST), fasting blood sugar, and electrocardiogram(ECG) between HFE-mutation and HFE-wild MDS and AA groups irrespective of the red blood cell transfusion history. The results suggest that the distribution of C282Y and H63D mutations has ethnic and genetic differences, and is very rare in Chinese population. The mutations of HFE gene are not main factors of iron overload in Chinese patients with myelodysplastic syndrome and aplastic anemia.
10
Mura, Catherine, Odile Raguenes, and Claude Férec. "HFE Mutations Analysis in 711 Hemochromatosis Probands: Evidence for S65C Implication in Mild Form of Hemochromatosis." Blood 93, no. 8 (April 15, 1999): 2502–5. http://dx.doi.org/10.1182/blood.v93.8.2502.
Full textAbstract:
Abstract Hereditary hemochromatosis (HH) is a common autosomal recessive genetic disorder of iron metabolism. The HFE candidate gene encoding an HLA class I-like protein involved in HH was identified in 1996. Two missense mutations have been described: C282Y, accounting for 80% to 90% of HH chromosomes, and H63D, which is associated with a milder form of the disease representing 40% to 70% of non-C282Y HH chromosomes. We report here on the analysis of C282Y, H63D, and the 193A→T substitution leading to the S65C missense substitution in a large series of probands and controls. The results confirm that the C282Y substitution was the main mutation involved in hemochromatosis, accounting for 85% of carrier chromosomes, whereas the H63D substitution represented 39% of the HH chromosomes that did not carry the C282Y mutation. In addition, our screening showed that the S65C substitution was significantly enriched in probands with at least one chromosome without an assigned mutation. This substitution accounted for 7.8% of HH chromosomes that were neither C282Y nor H63D. This enrichment of S65C among HH chromosomes suggests that the S65C substitution is associated with the mild form of hemochromatosis.
11
Mura, Catherine, Odile Raguenes, and Claude Férec. "HFE Mutations Analysis in 711 Hemochromatosis Probands: Evidence for S65C Implication in Mild Form of Hemochromatosis." Blood 93, no. 8 (April 15, 1999): 2502–5. http://dx.doi.org/10.1182/blood.v93.8.2502.408k27_2502_2505.
Full textAbstract:
Hereditary hemochromatosis (HH) is a common autosomal recessive genetic disorder of iron metabolism. The HFE candidate gene encoding an HLA class I-like protein involved in HH was identified in 1996. Two missense mutations have been described: C282Y, accounting for 80% to 90% of HH chromosomes, and H63D, which is associated with a milder form of the disease representing 40% to 70% of non-C282Y HH chromosomes. We report here on the analysis of C282Y, H63D, and the 193A→T substitution leading to the S65C missense substitution in a large series of probands and controls. The results confirm that the C282Y substitution was the main mutation involved in hemochromatosis, accounting for 85% of carrier chromosomes, whereas the H63D substitution represented 39% of the HH chromosomes that did not carry the C282Y mutation. In addition, our screening showed that the S65C substitution was significantly enriched in probands with at least one chromosome without an assigned mutation. This substitution accounted for 7.8% of HH chromosomes that were neither C282Y nor H63D. This enrichment of S65C among HH chromosomes suggests that the S65C substitution is associated with the mild form of hemochromatosis.
12
Cançado, Rodolfo Delfini, Aline Cristiane de Oliveira Guglielmi, Carmen Silvia Vieitas Vergueiro, Ernani Geraldo Rolim, Maria Stella Figueiredo, and Carlos Sérgio Chiattone. "Analysis of HFE gene mutations and HLA-A alleles in Brazilian patients with iron overload." Sao Paulo Medical Journal 124, no. 2 (2006): 55–60. http://dx.doi.org/10.1590/s1516-31802006000200002.
Full textAbstract:
CONTEXT AND OBJECTIVE: Hemochromatosis is a common inherited disorder of iron metabolism and one of the most important causes of iron overload. The objective was to analyze the presence of C282Y, H63D and S65C mutations in the HFE gene and HLA-A alleles for a group of Brazilian patients with iron overload, and to correlate genotype with clinical and laboratory variables. DESIGN AND SETTING: Prospective study, in Discipline of Hematology and Oncology, Faculdade de Ciências Médicas da Santa Casa de Misericórdia de São Paulo. METHODS: We studied 35 patients with iron overload seen at our outpatient unit between January 2001 and December 2003. Fasting levels of serum iron and ferritin, and total iron-binding capacity, were assayed using standard techniques. Determinations of C282Y, H63D and S65C mutations in the HFE gene and of HLA-A alleles were performed by polymerase chain reaction (PCR). RESULTS: Twenty-six out of 35 patients (74%) presented at least one of the HFE gene mutations analyzed. Among these, five (14%) were C282Y/C282Y, four (11%) C282Y/H63D, one (3%) H63D/H63D, six (17%) C282Y/WT and ten (29%) H63D/WT. No patients had the S65C mutation and nine (25%) did not present any of the three HFE mutations. Four out of five patients with C282Y/C282Y genotype (80%) and three out of four patients with C282Y/H63D genotype (75%) were HLA A*03. CONCLUSION: Analysis of HFE gene mutations constitutes an important procedure in identifying patients with hereditary hemochromatosis, particularly for patients with iron overload.
13
Killeen, Anthony A., John W. Breneman, Arlene R. Carillo, Jason Liu, and Craig S. Hixson. "Linked Linear Amplification for Simultaneous Analysis of the Two Most Common Hemochromatosis Mutations." Clinical Chemistry 49, no. 7 (July 1, 2003): 1050–57. http://dx.doi.org/10.1373/49.7.1050.
Full textAbstract:
Abstract Background: Two mutations in HFE, G845A (amino acid substitution C282Y) and C187G (H63D), are associated with hereditary hemochromatosis. We developed and validated a novel method, linked linear amplification (LLA), for detection of these two mutations. Methods: Two segments of HFE were amplified by a multiplex LLA reaction that generated biotinylated LLA products. Aliquots of the multiplex LLA reaction were captured in microwells by hybridization to immobilized allele-specific oligonucleotides (ASOs). One wild-type and one mutant ASO represented the DNA sequence at each of the two mutation sites. Hybridization was detected by a streptavidin–horseradish peroxidase-based colorimetric method. Genotypes obtained by LLA and PCR-restriction fragment length polymorphism (PCR-RFLP) methods for 320 individuals were compared. Results: The amplified samples included the following genotypes as determined by PCR-RFLP: wild-type 282 and 63 codons (n = 105), C282Y homozygous mutant (n = 54), C282Y heterozygous (n = 52), H63D homozygous mutant (n = 17), H63D heterozygous (n = 59), and compound H63D and C282Y heterozygous mutant (n = 33). There was complete concordance between the results obtained by LLA and those obtained by PCR-RFLP analysis. The presence of another HFE mutation, A193T (encoding S65C), did not interfere with genotyping at codon 63. Conclusions: LLA provides a reliable method to detect the common mutations in HFE that cause hereditary hemochromatosis.
14
Kelley, Melissa, Nikhil Joshi, Yagang Xie, and Mark Borgaonkar. "Iron Overload Is Rare in Patients Homozygous for the H63D Mutation." Canadian Journal of Gastroenterology and Hepatology 28, no. 4 (2014): 198–202. http://dx.doi.org/10.1155/2014/468521.
Full textAbstract:
BACKGROUND: Previous research has suggested that the H63DHFEmutation is associated with elevated iron indexes. However, the true penetrance of this mutation remains unclear.OBJECTIVE: To assess the proportion of H63D homozygotes with laboratory abnormalities consistent with iron overload.METHODS: The present study was a retrospective analysis of all individuals referred forHFEgenotyping in Newfoundland and Labrador between 1999 and 2009, who were found to be homozygous for the H63D mutation. Using electronic health records, results of ferritin, transferrin saturation, aspartate aminotransferase and alanine aminotransferase testing performed closest to the time of genetic testing were recorded for each patient. Iron overload was classified using previously published definitions from the HealthIron study. SPSS version 17.0 (IBM Corporation, USA) was used for descriptive statistics and to compare means using one-way ANOVA.RESULTS: Between 1999 and 2009, 170 individuals tested positive for H63D/H63D. At the time of genotyping, 28.8% had an elevated mean (± SD) ferritin level of 501±829 μg/L and 15.9% had an elevated transferrin saturation of 0.45±0.18. At genotyping, 94 individuals had sufficient data available to classify iron overload status. Only three (3.2%) had documented iron overload while the majority (85.1%) had no evidence of iron overload. Sixty individuals had follow-up data available and, of these, only four (6.7%) had documented iron overload, while 45 (75.0%) had no evidence of iron overload. Only one individual had evidence of iron overload-related disease at genotyping and at follow-up.CONCLUSIONS: H63D homozygosity was associated with an elevated mean ferritin level, but only 6.7% had documented iron overload at follow-up. The penetrance of the H63D mutation appeared to be low.
15
Bhattad, Pradnya Brijmohan, Amandeep Goyal, Ashley N. Hamati, Akshat Madhok, Shobi Venkatachalam, Divya Sree Madhuramthakam, and Vinay Jain. "Hemochromatosis Arthropathy in Heterozygous HFE H63D Mutation Without Iron Overload- An Entity Less Commonly Touched." Journal of Medical Research 7, no. 1 (February 19, 2021): 27–29. http://dx.doi.org/10.31254/jmr.2021.7108.
Full textAbstract:
Human homeostatic iron regulator protein gene (HFE gene) H63D mutations even when homozygous are rarely associated with iron overload. These mutations, independent of iron status, are associated with calcium pyrophosphate dihydrate crystal deposition disease (CPPD) leading to arthropathy even for heterozygotes. The arthropathy does not respond to iron depletion. We report a case of a 62-year-old male with chronic generalized arthralgias with no evidence of iron overload or elevated inflammatory markers with characteristic radiographic hook-like osteophytes suggestive of hemochromatosis arthropathy. Further, he was found to be a carrier of HFE H63D mutation. Recognition of the association can help guide goal directed management.
16
Coelho-Borges, Silvia, Hugo Cheinquer, Fernando Herz Wolff, Nelson Cheinquer, Luciano Krug, and Patricia Ashton-Prolla. "Effect of HFE gene polymorphism on sustained virological response in patients with chronic hepatitis C and elevated serum ferritin." Arquivos de Gastroenterologia 49, no. 1 (March 2012): 9–13. http://dx.doi.org/10.1590/s0004-28032012000100003.
Full textAbstract:
CONTEXT: Abnormal serum ferritin levels are found in approximately 20%-30% of the patients with chronic hepatitis C and are associated with a lower response rate to interferon therapy. OBJECTIVE: To determine if the presence of HFE gene mutations had any effect on the sustained virological response rate to interferon based therapy in chronic hepatitis C patients with elevated serum ferritin. METHODS: A total of 44 treatment naÏve patients with histologically demonstrated chronic hepatitis C, all infected with hepatitis C virus genotype non-1 (38 genotype 3; 6 genotype 2) and serum ferritin above 500 ng/mL were treated with interferon (3 MU, 3 times a week) and ribavirin (1.000 mg, daily) for 24 weeks. RESULTS: Sustained virological response was defined as negative qualitative HCV-RNA more than 24 weeks after the end of treatment. Serum HCV-RNA was measured by qualitative in house polymerase chain reaction with a limit of detection of 200 IU/mL. HFE gene mutation was detected using restriction-enzyme digestion with RsaI (C282Y mutation analysis) and BclI (H63D mutation analysis) in 16 (37%) patients, all heterozygous (11 H63D, 2 C282Y and 3 both). Sustained virological response was achieved in 0 of 16 patients with HFE gene mutations and 11 (41%) of 27 patients without HFE gene mutations (P = 0.002; exact Fisher test). CONCLUSION: Heterozigozity for H63D and/or C282Y HFE gene mutation predicts absence of sustained virological response to combination treatment with interferon and ribavirin in patients with chronic hepatitis C, non-1 genotype and serum ferritin levels above 500 ng/mL.
17
de Assis, Reijane Alves, Fernando Uliana Kay, Paulo Vidal Campregher, Gilberto Szarf, Fabiana Mendes Conti, Michelli da Silva Diniz, Roberta Sitnik, et al. "Role of Magnetic Ressonance Imaging – T2* in Hereditary Hemochromatosis." Blood 120, no. 21 (November 16, 2012): 2096. http://dx.doi.org/10.1182/blood.v120.21.2096.2096.
Full textAbstract:
Abstract Abstract 2096 Introduction: Hereditary hemochromatosis (HH) is an autossomic recessive disorder characterized by increased iron absorption. Magnetic resonance imaging – T2* (MRI-T2*) has become a reliable and robust methodology to directly assess the iron burden, with better results in transfusional hemosiderosis compared to indirect methods, such as serum ferritin and transferrin saturation (TS). However, little is known about its role in HH. Objectives: Describe the demographic profile of HH type 1 patients as to the type of the HFE mutation and correlate laboratory parameters to MRI-T2*results. Methods: We collected data from patients with a positive HFE gene mutation who performed abdominal and/or cardiac MRI-T2* in our institution from 2004 to 2011. Images retrieved from the digital archive were analyzed by two blinded independent radiologists using the Thalassemia-Tools software (Cardiovascular Imaging Solutions, London, UK). Laboratory data available within 6 months before or after the MRI study were analyzed using the t-Student test, Exact Fisher's test analysis and multivariate analyses. Results: We analyzed 81 patients, 76 (93%) males and 5 (6.2%) females, with a median age of 48 years (21–80). Liver, pancreatic and splenic MRI-T2*values and LIC calculation were performed in 80 patients, and cardiac T2* assessment in 57 patients. The inter-observer T2* variation coefficient was 5%. Serum ferritin was abnormal in 70 patients (90.9%), while TS was abnormal in 34% of the tests. In our study sample, the H63D mutation was present in 70 patients (86.4%): 11 (13.6%) were homozygous, 59 (72.8%) heterozygous and 7 (8.6%) double heterozygous for C282Y/H63D. Only three patients (3.7%) were homozygous and 6 (7.4%) were heterozygous only for the C282Y mutation. The S65C mutation was detected in heterozygous state in 2 (2.5%) of cases. Two out 57 cases had a positive T2* result and were classified as light cardiac overload (T2*:18.98 e 19.14 ms). Both had the H63D mutation (1 homozygous and 1 heterozygous). Thirty seven out of 80 patients (46.3%) had liver overload in abdominal MRI (T2*: 3.8–11.4ms), being 33 (41.3%) light overload and four (5%) moderate overload (T2*:1.8–3.8ms). We found that 77.8% of patients with liver overload were C282Y carriers, of which 57.2% had double mutation and 40.3% had H63D mutation in hetero or homozigosity. Pancreatic overload was found in 20 patients (25.1%), while 30 patients (37.5%) had splenic overload. There was a slight correlation (r: 0.365) between liver T2* and splenic T2* (p=0.001). The presence of C282Y and H63D mutations was statistically associated with a higher frequency of abnormal liver T2* (p=0.017 and p=0.042, respectively). The H63D mutation was associated with iron accumulation in the liver (p=0,037) and homozygous carriers showed higher levels of liver overload (p=0,038). Conclusion: In our study, serum ferritin was a better surrogate marker for iron overload than ST. In addition, up to 40.3% of patients with H63D mutation had evidence of hepatic iron overload by MRI. These findings differ from the currente literature. The higher RMI positivity might be due to a higher sensitivity to detect lower levels of organic iron. Despite the lack of a control group and laboratory tests or MRI in all the cases studied, our results suggest that RMI-T2* is a promising methodology to guide the therapeutic management of HH patients. The clinical impact of this finding must be investigated in further studies. Disclosures: No relevant conflicts of interest to declare.
18
Lakshmanan, Seetha, and Alan Epstein. "S3530 Homozygous H63D Mutation in Hereditary Hemochromatosis." American Journal of Gastroenterology 115, no. 1 (October 2020): S13. http://dx.doi.org/10.14309/01.ajg.0000716168.30066.9e.
Full text
19
Grove, J., A. K. Daly, A. D. Burt, M. Guzail, O. F. W. James, M. F. Bassendine, and C. P. Day. "Heterozygotes for HFE mutations have no increased risk of advanced alcoholic liver disease." Gut 43, no. 2 (August 1, 1998): 262–66. http://dx.doi.org/10.1136/gut.43.2.262.
Full textAbstract:
Background—Iron overload is common in the livers of alcoholics and may play a role in disease pathogenesis. An MHC like gene, HFE,has recently been identified that is mutated in most patients with hereditary haemochromatosis (C282Y in 90% and H63D in 45% of the remainder).Aim—To examine the hypothesis that these mutations determine hepatic iron status in alcoholics and play a role in predisposition to advanced alcoholic liver disease.Methods—TheHFE gene was genotyped in 257 patients with alcoholic liver disease and 117 locally matched healthy volunteers. In addition, iron staining was scored (0–4) on biopsy specimens from fibrotic/cirrhotic patients with and withoutHFE mutations matched for age and sex.Results—Some 15.7% of fibrotic/cirrhotic patients were C282Y heterozygotes compared with 13.7% of controls (p = 0.77). One control and three patients were C282Y homozygotes. Of chromosomes without the C282Y mutation, 68/442 (15.4%) of patients’ chromosomes carried the H63D mutation compared with 36/216 (16.6%) of control chromosomes (p = 0.91). Significant (>grade 1) hepatocyte iron staining was seen in 6/23 C282Y heterozygotes and 4/26 H63D heterozygotes compared with 4/23 controls.Conclusions—Possession of a single copy of either of the two HFEmutations influences neither liver iron content nor the risk of fibrotic disease in alcoholics.
20
Inoyatova, F. I., Kh M. Kadyrkhodzhayeva, G. Z. Inogamova, N. A. Ikramova, F. G. Abdullayeva, N. K. Valiyeva, and A. Kh Akhmedova. "Chronic hepatitis B in children carried out of the hemochromatosis gene HFE." Journal Infectology 13, no. 2 (July 14, 2021): 108–14. http://dx.doi.org/10.22625/2072-6732-2021-13-2-108-114.
Full textAbstract:
Purpose: to establish the frequency and clinical significance of mutant variations of the HFE gene polymorphism in chronic hepatitis B (CHB) in children with iron overload syndrome (IOS).Materials and methods: 60 children with chronic hepatitis B with iron overload syndrome (IOS) were examined. When distributing children into groups, we took into account the criteria we developed for assessing the degree of life expectancy in children with CHB: CST>0.5 – mild degree of life expectancy (43,3% of children), CST˃0.5 – mild degree of life expectancy (43,3% of children), CST˂0,5 – moderate severity of life expectancy (31,7% of children) and CST˂0,2 – severe degree of SPL (25,0%). Virological verification of HBV was performed by ELISA and PCR. Using PCR Real Time and molecular genetic analysis, HFE gene C282Y, H63D, S65C mutations were detected from amplified DNA using the PRONTO Hemochromatosis reagent kit (Israel). The transferrin saturation coefficient (CST) was calculated using the formula CST = sTfR / log10.Ft. Results:Results: The study of the hemochromatosis gene HFE showed that the overwhelming majority (84,0%) of children with CHB with IOS were carriers of heterozygous, phenotypically different, mutant types. And only 16,0% of sick children were homozites of the wild (normal) HFE gene. Analysis of the phenotypic polymorphism of the hemochromatosis gene HFE revealed the presence of three point heterozygous mutations: H63D, S65C and combined variations in H63D / S65C, the latter of which is associated with severe forms of CHB and severe IOS.Conclusion. Children with CHB with IOS are characterized by a high incidence of heterozygous mutations in the HFE gene, the phenotypic manifestations of which were S65C, H63D, H63D / S65C. The comparability of the heterozygous combined mutation H63D / S65C with severe forms of CHB and a severe degree of IOS gives grounds to consider this phenotype of the HFE gene as a factor in the progression of the disease.
21
Salvador, Maria, Fernando A. Gonzalez, Paloma Ropero, Briceño Olga, Anguita Eduardo, and Villegas Ana. "16189 Mitocondrial Variant and Iron Overload." Blood 106, no. 11 (November 16, 2005): 3705. http://dx.doi.org/10.1182/blood.v106.11.3705.3705.
Full textAbstract:
Abstract Hereditary haemochromatosis(HH) is one of the most common autosomal recessive diseases in Europe, this is characterized by iron overload. There are two predominant mutations associated with the disease in the HFE gene: C282Y and H63D. The majority of haemochromatosis patients are homozygous for C282Y mutation and a small proportion are compound heterozygous C282Y/H63D. Not all C282Y homozygotes and compound heterozygous will show signs of iron loading. Several studies have shown the incomplete penetrance of haemochromatosis and suggest that iron overload is influenced by both enviromental and genetic factors wich may modify the phenotipic expression of the disease. Iron loading is associated with impaired mitochondrial function. It has been reported that the T16189C variant of mitochondrial DNA may act as a modifier increasing iron loading in HH. 16189 variant lies in the first hypervariable region (HV1), close to the sequences controlling replication and transcription. Aim: to determine the frequency of the 16189 variant in normal population and in a group of HH pacients with mutations in HFE gene or iron loading due to Mayor or Intermediate b-Thalassemia. Materials and methods: We stablished the frequence of 16189 variant in normal population by studying it in a group of 102 blood donors which did not have any mutation in HFE gene. We determined the variant in 27 C282Y homozygous, 32 compound heterozygous C282Y/H63D and 31 H63D homozygous and 16 β-thalassemics aswell. DNA was extracted from peripheral blood, HV1 region was amplified by PCR using primers: F(15800–15819)CAAGTAGCATCCGT ACTATA; R(16344–16325)GTAATGTGCTATGTACGGTA The product of amlification was digested with MnlI acording to manufacturer’s specifications. In wild type there is a restriction site at position 16189 which is absent in mutant allele. All samples lacking MnlI site were directly sequenced in a ABI PRISM 310 Genetic Analyzer. Statistical analysis was performed using the SPSS package. Results: shown in table 1 Conclusions: Our results do not show significant differences between the groups analyzed, but no significant increased frequency of the variant in the group of compound heterozygous. With this study we cannot conclude that mitochondrial function influences iron overload. This is could be dued to the short number of samples analyzed. In β-Thalassemia iron loading is modifed by an increased absorption(TM y TI) and transfusions(TM). At the present we are studying other factors that could play an important role in iron homeostasis: Transferrin receptor, Hepcidine and Hemojuveline. Table 1. Results Controls C282Y/C282Y C282Y/H63D H63D/H63D β-Thalassemia 16189C 12% 11.1% 18.7% 6.4% 12.5%
22
Burt, M. J., P. M. George, J. D. Upton, J. A. Collett, C. M. A. Frampton, T. M. Chapman, T. A. Walmsley, and B. A. Chapman. "The significance of haemochromatosis gene mutations in the general population: implications for screening." Gut 43, no. 6 (December 1, 1998): 830–36. http://dx.doi.org/10.1136/gut.43.6.830.
Full textAbstract:
Background—Haemochromatosis is associated with mutations in the HFE gene but the significance of these mutations in the general population is unknown.Aims—To determine the frequency ofHFE gene mutations in the general population, their effect on serum iron indexes, and their role in screening for haemochromatosis.Methods—Deoxyribonucleic acid (DNA) from 1064 randomly selected subjects was analysed for the C282Y and H63D mutations in the HFE gene. Serum iron, transferrin saturation, and ferritin were measured and individuals with increased iron indexes were investigated to confirm or exclude a clinical diagnosis of haemochromatosis.Results—Mutations were identified in 409 individuals (38.4%) with heterozygote (carrier) frequencies of 13.2% and 24.3% for the C282Y and H63D mutations respectively. Heterozygosity for either mutation significantly increased serum iron and transferrin saturation but despite a similar trend for ferritin, this was only significant for C282Y homozygotes. Five individuals (0.47%) were homozygous for the C282Y mutation, three of whom had haemochromatosis confirmed by liver biopsy (0.28%). The other two C282Y homozygotes would not have been detected by phenotypic screening alone.Conclusions—HFE mutations are present in 38.4% of the population, affect serum iron indexes, and are important determinants of iron status. The population frequency of genetically defined haemochromatosis (C282Y homozygosity) is approximately one in 200 and is higher than the prevalence of clinically apparent haemochromatosis.
23
Nearman, Zachary P., Bianca Serio, Hadrian Szpurka, Ilka Warshawsky, Alan Lichtin, Mikkael A. Sekeres, and Jaroslaw P. Maciejewski. "Hemochromatois-Associated Gene Mutations in Patients with Myelodysplastic Syndromes with Refractory Anemia and Ringed Sideroblasts." Blood 108, no. 11 (November 16, 2006): 1541. http://dx.doi.org/10.1182/blood.v108.11.1541.1541.
Full textAbstract:
Abstract Complex interaction between a multitude of genetic variants may be responsible for differential susceptibility to specific diseases, and be responsible for phenotypic variability and heterogeneity of clinical presentations. Such a variability in clinical features confounded for many years investigations into the pathogenesis of myelodysplastic syndromes (MDS). We made a curious observation of increased ferritin levels in some newly diagnosed patients with MDS RARS (refractory anemia with ringed sideroblasts) in whom transfusional iron-overload was unlikely due to very low transfusion burden. Hence, we hypothesized that RARS patients may harbor hemochromatosis-related mutations, which could contribute to the pathophysiology of this particular subset of MDS. We studied a cohort of 109 MDS patients; 42 with RARS, and 67 with other forms of MDS (18 RA, 12 RAEB, 7 RAEB-T, 1 CMML, and 29 MDS/MPD overlap). All patients were genotyped using restriction fragment length polymorphism (RFLP) method, designed to detect presence of C282Y and H63D mutations of the HFE gene. We found significantly higher frequency of heterozygozity for the C282Y mutation in 21% of RARS patients (vs 9% in control population, n=2016, p= 0.017) while H63D genotype was not increased. The possible pathogenic role of this finding in RARS was supported by the normal distribution of mutant HFE alleles in patients with other forms of MDS (5% vs. 9%, p =0.35). Interestingly, 3/7 patients with RA not fulfilling the RARS criteria, but having increased numbers of ringed sideroblasts (<15%) also showed heterozygozity for either C282Y or H63D allele. To correlate the presence of C282Y allele with clinical features of RARS patients, we have performed a subset analysis. Within this group we have included patients with a rather nebulous and rare form of MDS, provisionally subclassified by WHO as RARS with thrombocytosis (RARSt); 7 of these patients (n=10) were found to have either C282Y or H63D allele resulting in a frequency of 30% and 40% of C282Y or H63D allele, respectively. The combined prevalence of either of these alleles in the control population is 33% (vs. 70% in RARSt, p=.01). Previously, we have demonstrated that RARSt patients are characterized by a high prevalence of the V617F JAK2 mutation (Szpurka et al, Blood 2006) suggestive of the pathophysiologic derivation of this syndrome from MPD rather than MDS. Consequently, we have tested the frequency of HFE gene variants associated with hemochromatosis in patients with MPD and Jak2 mutations. Of note is that patients with RARS harbored more C282Y alleles than those with other forms of MDS or MPD with Jak2 mutation (except for those with RARSt; (21% vs 5% and 3%, p =0.036 and .012, respectively). We conclude that hemochromatosis associated mutations may contribute to the pathogenesis of RARS. In patients with MPD and Jak2 mutation, concomitant presence of hemachromatosis-predisposing HFE variants may result in the unusual presentation associated with ringed sideroblasts.
24
Biasiotto, Giorgio, Silvana Belloli, Giuseppina Ruggeri, Isabella Zanella, Gianmario Gerardi, Marcella Corrado, Elena Gobbi, Alberto Albertini, and Paolo Arosio. "Identification of New Mutations of the HFE, Hepcidin, and Transferrin Receptor 2 Genes by Denaturing HPLC Analysis of Individuals with Biochemical Indications of Iron Overload." Clinical Chemistry 49, no. 12 (December 1, 2003): 1981–88. http://dx.doi.org/10.1373/clinchem.2003.023440.
Full textAbstract:
Abstract Background: Hereditary hemochromatosis is a recessive disorder characterized by iron accumulation in parenchymal cells, followed by organ damage and failure. The disorder is mainly attributable to the C282Y and H63D mutations in the HFE gene, but additional mutations in the HFE, transferrin receptor 2 (TfR2), and hepcidin genes have been reported. The copresence of mutations in different genes may explain the phenotypic heterogeneity of the disorder and its variable penetrance. Methods: We used denaturing HPLC (DHPLC) for rapid DNA scanning of the HFE (exons 2, 3, and 4), hepcidin, and TfR2 (exons 2, 4 and 6) genes in a cohort of 657 individuals with altered indicators of iron status. Results: DHPLC identification of C282Y and H63D HFE alleles was in perfect agreement with the restriction endonuclease assay. Fourteen DNA samples were heterozygous for the HFE S65C mutation. In addition, we found novel mutations: two in HFE (R66C in exon 2 and R224G in exon 4), one in the hepcidin gene (G71D), and one in TfR2 (V22I), plus several intronic or silent substitutions. Six of the seven individuals with hepcidin or TfR2 coding mutations carried also HFE C282Y or S65C mutations. Conclusion: DHPLC is an efficient method for mutational screening for the genes involved in hereditary hemochromatosis and for the study of their copresence.
25
Gurnari, Carmelo, Annamaria Lombardi, Elisabetta Cosi, Giacomo Biagetti, Francesco Buccisano, Luca Franceschini, Manuela Rizzo, et al. "Unravelling Genetic Mechanisms of Erythrocytosis: A Real-Life Experience from a Single Center." Blood 132, Supplement 1 (November 29, 2018): 3617. http://dx.doi.org/10.1182/blood-2018-99-115103.
Full textAbstract:
Abstract Introduction Erythrocytosis is characterized by persistently raised hemoglobin (HB) and hematocrit (Ht) levels. Differential diagnosis includes Polycythemia Vera (PV), secondary, hereditary (HE) and idiopathic erythrocytosis (IE). Recently, Randi et al. (Br J Haematol, 2018) demonstrated the recurrence of HFE single nucleotide variants (SNVs) in patients with IE, postulating a possible link between Hemochromatosis genes and erythrocytosis. The most frequent HFE SNVs are C282Y and H63D, reported at allele frequencies of about 13% and 4% in Caucasian countries. HE has also been associated with mutations in genes members of the complex pathway of "oxygen sensing" (EPOR, VHL, HIF-2a and PHD2). To date, 30 mutations have been described in the PHD2 gene, all localized in the catalytic domain, which impair binding to HIF-2a. The PHD2p.C127S variant is frequently observed in Tibetans with D4E in cis (overall prevalence of this haplotype is 88.6% at altitudes above 3000m), in linkage disequilibrium with other missense mutations (in particular HIF-2a/EPAS1). Surprisingly, the combination of PHD2/HIF-2a variants result in a gain-of-function effect that blunts the hypoxic response, providing a molecular mechanism for the observed protection of Tibetans from erythrocytosis at high altitude. In normoxic conditions and in low-landers, the PHD2p.C127S variant may lead to increased erythropoiesis as reported in the literature. Patients and Methods Twenty-three patients with erythrocytosis (21 males and 2 females with a median age of 56 years, range 18-76, Table 1) negative for JAK2 mutations (both V617F and exon 12 variants), and with a bone marrow histology not suggestive of a myeloproliferative syndrome were studied for secondary causes of erythrocytosis using an appropriate algorithm (EPO levels, chest and abdomen imaging, spirometry, venous p50 of HB, arterial blood gas analysis). Since all tests were negative, HE genes mutation analysis was carried out, using Sanger sequencing of EPOR exon 8, the VHL coding region, PHD2 exon 1-3 and HIF-2a exon 12. HFE SNVs were studied using allele-specific real-time PCR. Results Sequencing of HE genes identified 4 carriers of PHD2 variants in 23 patients (17%). One patient had a novel missense heterozygous mutation (PHD2p.I269N). The study of his kindred showed that his sister and one daughter have HE and both carried the same heterozygous mutation of the propositus. Furthermore, his father had died with a diagnosis of PV in the pre-JAK2 era. In contrast, the patient's brother and the other daughter, both with normal Hb and Hct, had wild-type PHD2. Of note, the propositus and his two daughters were heterozygous for H63D in the HFE gene. The patient's pedigree is illustrated in Figure 1. Interestingly, three further patients tested positive for the PHD2 missense heterozygous variant (PHD2p.C127S) previously reported in the Tibetan population, and whose role in patients with erythrocytosis is still unclear. HFE SNVs real-time PCR revealed 7 carriers of the H63D, 1 of C282Y and 1 of S65C SNV in the HFE gene (about 40% of our cohort). Interestingly, two H63D heterozygous patients were a father and his son. They were all males with a median age of 48 years (range 18-64). The prevalence of HFE SNVs in our cohort of patients with erythrocytosis is higher than expected for H63D and S65C for Caucasians (30% vs 13% for H63D and 4.35 vs 1.5% for S65C), while the allele frequency of C282Y was similar to that of the general population. Finally, the patient with the S65C SNV also had the "Tibetan" PHD2 polymorphism. Conclusions In addition to previously known PHD2 gene alterations, we report here the occurrence in HE patients of a novel PHD2 mutation with an autosomal-dominant inheritance likely involved in disease pathogenesis. The milder phenotypic features of this patient's daughter and sister in terms of erythocytosis, may be explained by the childbearing age and the absence of H63D SNV, respectively. The increased prevalence of HFE SNVs in patients with IE may indicate an effect of impaired iron metabolism on erythropoiesis. Our data show that the inclusion of HFE SNVs and oxygen pathway mutational analysis in the diagnostic algorithm of erythrocytosis may help to better define the genetic basis of erythrocytosis. Further studies -including the analysis of molecules involved in iron storage pathway- in larger IE patient cohorts are warranted in order to clarify the link between HFE gene and IE. Disclosures Voso: Celgene: Research Funding, Speakers Bureau.
26
Perruccio, Katia, Francesco Arcioni, Carla Cerri, Roberta La Starza, Donatella Romanelli, Ilaria Capolsini, and Maurizio Caniglia. "The Hereditary Hyperferritinemia-Cataract Syndrome in 2 Italian Families." Case Reports in Pediatrics 2013 (2013): 1–4. http://dx.doi.org/10.1155/2013/806034.
Full textAbstract:
Two 8- and 9-year-old brothers were referred to the Pediatric Oncology Unit, Perugia General Hospital, because of hyperferritinemia. Both had a history of bilateral cataract and epilepsy. Genetic investigation revealed two distinct mutations in iron haemostasis genes; homozygosity for the HFE gene H63D mutation in the younger and heterozygosity in the elder. Both displayed heterozygosity for C33T mutation in the ferritin light chain iron response element. A 7-year-old boy from another family was referred to our unit because of hyperferritinemia. Genetic analyses did not reveal HFE gene mutations. Family history showed that his mother was also affected by hyperferritinemia without HFE gene mutations. Magnetic resonance imaging in the mother was positive for iron overload in the spleen. Cataract was diagnosed in mother and child. Further genetic investigation revealed the C29G mutation of the ferritin light chain iron response element. C33T and C29G mutations in the ferritin light chain iron response element underlie the Hereditary Hyperferritinemia-Cataract Syndrome (HHCS). The HFE gene H63D mutation underlies Hereditary Haemochromatosis (HH), which needs treatment to prevent organ damages by iron overload. HHCS was definitively diagnosed in all three children. HHCS is an autosomal dominant disease characterized by increased L-ferritin production. L-Ferritin aggregates accumulate preferentially in the lens, provoking bilateral cataract since childhood, as unique known organ damage. Epilepsy in one case and the spleen iron overload in another could suggest the misleading diagnosis of HH. Consequently, the differential diagnosis between alterations of iron storage system was essential, particularly in children, and required further genetic investigation.
27
Le Gac, Gerald, Catherine Mura, and Claude Férec. "Complete Scanning of the Hereditary Hemochromatosis Gene (HFE) by Use of Denaturing HPLC." Clinical Chemistry 47, no. 9 (September 1, 2001): 1633–40. http://dx.doi.org/10.1093/clinchem/47.9.1633.
Full textAbstract:
Abstract Background: Between 4% and 35% of hereditary hemochromatosis (HC) probands are C282Y or H63D heterozygotes or lack both of these two common HFE mutations, and 15 novel HFE mutations have been described recently. We evaluated denaturing HPLC (DHPLC) for screening of the whole HFE coding region and further defined whether HC probands with an incomplete HFE genotype carry uncommon mutations. Methods: Analytical conditions for each coding exon were determined by a combination of computer melting profile predictions and experimental melting curves. To test accuracy for scanning the complete HFE coding region and optimize DHPLC running conditions, each melting domain was investigated with at least one mutation or one polymorphism as reference. We tested 100 DNA samples harboring the C282Y, H63D, or S65C mutations and 17 artificially created positive controls that carried either 1 of the 14 other known HFE mutations or 3 selected polymorphisms. Results: Investigations on each of the coding exons 1, 2, 4, 5, and 6 could be performed at one analysis temperature. Coding exon 3 displayed a more complex melting profile and required two analysis temperatures. DHPLC detected all known HFE mutations as well as the three selected polymorphisms. Conclusions: DHPLC can be used to scan the HFE gene in HC probands in whom at least one chromosome lacks an assigned mutation.
28
BEUTLER, ERNEST, and AVERY AUGUST. "The Significance of the 187G (H63D) Mutation in Hemochromatosis." American Journal of Human Genetics 61, no. 3 (September 1997): 762–64. http://dx.doi.org/10.1016/s0002-9297(07)64339-0.
Full text
29
Beutler, Ernest. "The Significance of the 187G (H63D) Mutation in Hemochromatosis." American Journal of Human Genetics 61, no. 3 (September 1997): 762–65. http://dx.doi.org/10.1086/524858.
Full text
30
Delbini, Paola, Lorena Duca, Isabella Nava, Anna Meo, Marina La Rosa, and Maria D. Cappellini. "Identification of a New Mutation in the 5′-UTR of Hepcidin Gene in beta-Thalassemia Major (TM) Patients." Blood 108, no. 11 (November 16, 2006): 3811. http://dx.doi.org/10.1182/blood.v108.11.3811.3811.
Full textAbstract:
Abstract Hepcidin is a peptide hormone produced in the liver that acts as negative regulator of iron absorption from the enterocytes and of iron release from macrophages. Iron overload and inflammation up-regulate hepcidin synthesis, while anaemia and hypoxia suppress hepcidin expression. Thalassaemia Major (TM) is a hereditary haemolytic anaemia requiring long-life blood transfusions treatment with consequent iron overload. In β-thalassemias is a disorder in which hepcidin is regulated by opposing influences of ineffective erythropoiesis and concomitant iron overload. In order to get further insights on iron regulation in thalassemias, we screened hepcidin and HFE genes in fourty-three TM regularly transfused patients and sixty control subjects. Blood from TM was taken at least 48 hours after chelation therapy and just before blood transfusion. DNA was prepared from peripheral blood, according to standard protocols. Hepcidin and HFE sequences were amplified with PCR using specific primers and PCR products were sequenced, after purification, in a automatic sequencer. Moreover in all patients serum pro-hepcidin was evaluated by ELISA competitive binding assay (DRG,Germany); iron status was evaluated by serum ferritin (SF), percentage of transferrin saturation (TS) by standard procedures and non transferrin bound iron (NTBI) in serum by HPLC after nitrilotriacetic acid (NTA) chelation. Serum IL-6 as inflammation marker was measured by lateral flow immunoassay (Milenia QuickLine, Germany). Molecular analysis detected an undescribed G→T mutation at position +23 of the 5′-untranslated region in two unrelated TM patients; no mutations were found in control subjects. The probands have been regularly transfused since the age of 1 year, receiving 2–3 units of packed red cells and treated with Deferoxamine 40 mg/Kg/day 6 days/week. The first patient, wild type for HFE mutation, was a 29-years-old compound heterozygous IVS II-745/IVS I-110 man. The SF was 1052 ng/ml, TS 94% and NTBI 1.77 μM. Serum pro-hepcidin value was in normal range (213 ng/ml). The proband’s father was heterozygous for the same hepcidin mutation and showed signs of mild iron overload (SF 491 ng/ml and NTBI 0.50 μM). The second patient was a 26-years-old homozygous β039 man with high levels of SF (4346 ng/ml), TS (169%) and NTBI (2.10 μM), while serum pro-hepcidin was 269 ng/ml. HFE analysis revealed a homozygous genotype for H63D mutation. The patient’s mother was heterozygous for hepcidin and H63D mutation and showed mild iron overload (SF 500 ng/ml; NTBI 0.22 μM) whereas the father, heterozygous only for H63D, had normal iron status. According to recent findings (Bridle et al, 2003) our results indicate that hepcidin mutation in association with H63D synergizes the effect on iron homeostasis and it could be responsible for the development of marked iron overload poorly responsive to chelation therapy in β-thalassemia patients.
31
Alkhateeb, Asem, Amal Uzrail, and Khaldon Bodoor. "Frequency of the Hemochromatosis Gene (HFE) Variants in a Jordanian Arab Population and in Diabetics from the Same Region." Disease Markers 27, no. 1 (2009): 17–22. http://dx.doi.org/10.1155/2009/329603.
Full textAbstract:
Hereditary HFE-linked hemochromatosis is a frequent recessive disorder among individuals of northern European ancestry. The clinical characteristic of this disease is the gradual accumulation of iron in internal organs, which ultimately may lead to organ damage and death. Three allelic variants of HFE gene have been correlated with hereditary hemochromatosis: C282Y is significantly associated with hereditary hemochromatosis in populations of Celtic origin, H63D and S65C are associated with milder form of iron overload. In this study we performed mutation analysis to identify allele frequency of the three variants of HFE gene in Jordanian Arab population, to assess deviations of these frequencies from those detected elsewhere, and to determine if there is an increased frequency of these variants in a diabetic population (Type 2 diabetes) from the same area. DNA was extracted from blood samples of 440 individuals attending King Abdullah University Hospital for ambulatory services. We used polymerase chain reaction (PCR) to amplify exons 2 and 4 of the HFE gene then restriction fragment length polymorphism (RFLP) method to detect the variants. There were neither homozygous nor heterozygous for C282Y variant. For the H63D variant, 0.68% were homozygous and 21.1% were heterozygous. For the S65C variant, there were no homozygous and 0.23% were heterozygous. Allelic frequencies were, 0%, 11.25%, and 0.11% for C282Y, H63D, and S65C, respectively. Our samples were subdivided into two categories of type 2 diabetic (89 cases) and controls (blood donors, 204 cases) and compared with regard to the H63D variant. Both groups did not have homozygous H63D variant. H63D heterozygous in diabetics were 23.60% and in blood donor controls 22.55%. Allelic frequency of the mutant H63D allele was 11.80% in diabetics and 11.27% for the blood donor controls. This is the first study to show the frequency of the three hemochromatosis gene variants in Jordan with the interesting finding of no C282Y allele detected in 440 samples. Additionally, no significant difference was observed in H63D variant frequency in type 2 diabetics as compared to controls.
32
Abdelkrim, Zazour, Wafaa Khannoussi, Amine El Mekkaoui, Ghizlane Kharrasse, and Zahi Ismaili. "Compound Heterozygous C282Y/H63D Mutation in Hemochromatosis: A Case Report." Open Journal of Clinical Diagnostics 06, no. 03 (2016): 30–35. http://dx.doi.org/10.4236/ojcd.2016.63006.
Full text
33
Acton, Ronald T., Beverly M. Snively, James C. Barton, Paul C. Adams, John H. Eckfeldt, Emily L. Harris, Fitzroy W. Dawkins, et al. "Geographic and Racial/Ethnic Differences in HFE Mutation Frequencies and Iron Phenotypes in the Hemochromatosis and Iron Overload Screening (HEIRS) Study." Blood 104, no. 11 (November 16, 2004): 3211. http://dx.doi.org/10.1182/blood.v104.11.3211.3211.
Full textAbstract:
Abstract Designing an optimal screening approach for hemochromatosis and iron overload requires knowledge of racial/ethnic subpopulations and frequencies of HFE mutations and phenotypes in geographic areas. In the HEIRS Study, HFE C282Y and H63D genotypes and prevalences of participants who met biochemical criteria for further evaluation (transferrin saturation >50% and ferritin >300 ng/mL, men; >45% and >200 ng/mL, women) were compared in a primary care-based sample of ~100,000 adults ≥25 years from 5 Field Centers. There were different respective HFE C282Y and H63D genotype frequencies in Whites, Blacks, Asians, and Hispanics across geographic areas (all p<0.0001), but not in Native Americans or Pacific Islanders. In Whites, the C282Y/C282Y proportion was significantly higher in AL than in CA or OR/HI. AL also had a significantly higher proportion of C282Y/wt than CA or OR/HI. In Blacks, D.C. had a significantly higher proportion of C282Y and H63D genotypes than AL. ONT had a significantly higher H63D genotype proportion than AL. In Asians, CA had a significantly higher proportion of H63D genotypes than OR/HI or ONT. In Hispanics, there were significant differences between: AL and CA; AL and D.C.; CA and D.C.; CA and OR/HI; D.C. and OR/HI; and D.C. and ONT. We also observed: Prevalences of Participants Who Met Biochemical Criteria for Further Evaluation Race/Ethnicity Geographic Area Prevalence (%) 95% CI Asians California 5.54 4.98, 6.16 Oregon/Hawaii 5.06 4.29, 5.95 Ontario 4.25 3.69, 4.88 Alabama 1.41 0.25, 7.56 D.C. 0.96 0.26, 3.42 Pacific Islanders California 3.66 1.25, 10.21 Oregon/Hawaii 3.47 2.23, 5.36 Native Americans Alabama 2.65 0.91, 7.52 Oregon/Hawaii 2.50 0.69, 8.66 D.C. 0.99 0.17, 5.40 Ontario 0.75 0.21, 2.71 Whites Ontario 2.31 2.08, 2.56 California 1.93 1.56, 2.37 Oregon/Hawaii 1.52 1.34, 1.73 Alabama 1.48 1.26, 1.74 D.C. 1.40 0.80, 2.43 Hispanics Ontario 1.92 0.82, 4.41 California 1.52 1.28, 1.79 Oregon/Hawaii 1.34 0.73, 2.4 Alabama 0.84 0.23, 3.01 D.C. 0.74 0.48, 1.16 Blacks D.C. 1.75 1.56, 1.96 Ontario 1.55 0.52, 4.45 Alabama 1.09 0.90, 1.32 Oregon/Hawaii 0.92 0.31, 2.66 California 0.86 0.29, 2.51 The percentage of men who met biochemical criteria for further evaluation was greater than that of women. We conclude that 1) C282Y and H63D genotype frequencies vary significantly within a single racial/ethnic group across geographic regions; and 2) the percentage of participants who met biochemical criteria for further evaluation varies by racial/ethnic group.
34
Skrlec, Ivana, Robert Steiner, Jasenka Wagner, and Mirela Florijancic. "Hereditary hemochromatosis gene mutations in patients with myocardial infarction." Molecular and experimental biology in medicine 2, no. 1 (April 4, 2019): 24–28. http://dx.doi.org/10.33602/mebm.2.1.4.
Full textAbstract:
Hereditary hemochromatosis (HH) is a disorder of iron accumulation in tissues, which is related to coronary heart diseases. Free radicals and reactive oxygen species, created because of iron deposition, promote oxidation of LDL cholesterol and could lead to the development of atherosclerosis. Studies have shown that HFE gene mutation carriers might be at higher risk of developing cardiovascular diseases compared with non-carriers. This study aimed to determine the frequency of HFE gene mutations in patients with myocardial infarction compared to a healthy group in eastern Slavonia. A retrospective case-control study was carried out on a population of 400 participants. In the first group there were 200 patients (114 males and 86 females) with myocardial infarction. The second group consisted of 200 controls (103 males and 97 females) without a history of cardiovascular diseases. All patients were genotyped for the three most common mutations of the HH in the HFE gene: C282Y, H63D, and S65C, by real-time PCR. The difference in the frequency of carriers of these mutations between the patients and the controls was not significant (C282Y: 4.5 vs. 8.1%; H63D: 19 vs. 24.5%; S65C: 3.5 versus 4%), and neither was the frequency and distribution of possible HFE gene genotypes and compound heterozygotes. There were no statistically significant associations of cardiovascular risk factors and HFE gene mutations in patients with myocardial infarction. In this study, no association was found between the HFE gene mutation for HH and myocardial infarction in the population of eastern Slavonia.
35
COSTA-MATOS, Luís, Paulo BATISTA, Nuno MONTEIRO, Pedro HENRIQUES, Fernando GIRÃO, and Armando CARVALHO. "HFE MUTATIONS AND IRON OVERLOAD IN PATIENTS WITH ALCOHOLIC LIVER DISEASE." Arquivos de Gastroenterologia 50, no. 1 (March 2013): 35–41. http://dx.doi.org/10.1590/s0004-28032013000100008.
Full textAbstract:
ContextAlcoholic liver disease (ALD) is generally associated with iron overload, which may contribute to its pathogenesis, through increased oxidative stress and cellular damage. There are conflicting reports in literature about hemochromatosis (HFE) gene mutations and the severity of liver disease in alcoholic patients.ObjectivesTo compare the prevalence of mutations in the hemochromatosis (HFE) gene between patients with ALD and healthy controls; to assess the relation of HFE mutations with liver iron stores and liver disease severity.MethodsLiver biopsy specimens were obtained from 63 ALD patients (during routine treatment) and 52 healthy controls (during elective cholecystectomy). All individuals underwent routine liver function tests and HFE genotyping (to detect wild-type sequences and C282Y, H63D, S65C, E168Q, E168X, V59M, H63H, P160delC, Q127H, Q283P, V53M and W164X mutations). Associations between HFE mutations and risk of excessive liver iron stores, abnormal serum ferritin, liver fibrosis, or necroinflammatory activity were assessed by multivariate logistic regression analysis.ResultsALD patients had significantly higher serum ferritin and transferrin saturation than controls (both P<0.05), but the distribution of HFE mutations was similar between the two groups. For ALD patients, the odds ratio for having at least one HFE mutation and excessive liver iron stores was 17.23 (95% confidence interval (CI): 2.09-142.34, P = 0.008). However, the presence of at least one HFE mutation was not associated with an increased risk of liver fibrosis or necroinflammatory activity. Active alcohol ingestion showed the strongest association to increased serum ferritin (OR = 8.87, 95% CI: 2.11-34.78, P = 0.003).ConclusionsALD patients do not present with a differential profile of HFE mutations from healthy controls. In ALD patients, however, the presence of at least one HFE mutation increases the risk of having excessive liver iron stores but has no detectable effects on liver disease activity or severity.
36
Gunn, I. R., F. K. Maxwell, D. Gaffney, A. D. McMahon, and C. J. Packard. "Haemochromatosis gene mutations and risk of coronary heart disease: a west of Scotland coronary prevention study (WOSCOPS) substudy." Heart 90, no. 3 (February 13, 2004): 304–6. http://dx.doi.org/10.1136/hrt.2003.015149.
Full textAbstract:
Objectives: To measure the frequency of genotypes of the HFE (haemochromatosis) gene in patients recruited to the west of Scotland coronary prevention study (WOSCOPS), and relate them to the subsequent occurrence of coronary clinical events.Design: Nested case–control study, drawing samples of DNA from the biological bank of a cohort study.Patients: Men aged 45–64 years in 1989, with moderate hypercholesterolaemia and no evidence of coronary heart disease at baseline.Interventions: Follow up for a mean period of 4.9 years. Typing for C282Y and H63D mutations of the HFE gene in 482 subjects with a subsequent coronary event and 1104 without an event.Results: The C282Y mutation was present in 81 of 482 cases (16.8%) and 182 of 1104 controls (16.5%). Comparing the prevalence of gene mutations in the cases and controls, there were no significant differences. The hazard ratio for C282Y heterozygotes was 1.03 (95% confidence interval (CI) 0.77 to 1.36) and for C282Y/H63D compound heterozygotes 1.04 (95% CI 0.50 to 2.14). Prespecified subgroup analyses of the pravastatin, placebo, smoking, and non-smoking groups showed no significant differences between cases and controls. Repeating the analyses after adjusting for possible confounding factors produced no change in the results.Conclusions: In a population of moderately hypercholesterolaemic middle aged Scottish men who did not have any evidence of coronary heart disease at baseline, the presence of a C282Y mutation in the HFE gene did not predict the occurrence of coronary events over a mean follow up of 4.9 years.
37
Chen, Chien-Juan, Ting-Yi Lin, Chao-Ling Wang, Chi-Kung Ho, Hung-Yi Chuang, and Hsin-Su Yu. "Interactive Effects between Chronic Lead Exposure and the Homeostatic Iron Regulator Transport HFE Polymorphism on the Human Red Blood Cell Mean Corpuscular Volume (MCV)." International Journal of Environmental Research and Public Health 16, no. 3 (January 27, 2019): 354. http://dx.doi.org/10.3390/ijerph16030354.
Full textAbstract:
Research has shown that long-term exposure to lead harms the hematological system. The homeostatic iron regulator HFE (hemochromatosis) mutation, which has been shown to affect iron absorption and iron overload, is hypothesized to be related to lead intoxication in vulnerable individuals. The aim of our study was to investigate whether the HFE genotype modifies the blood lead levels that affect the distributions of serum iron and other red blood cell indices. Overall, 121 lead workers and 117 unexposed age-matched subjects were recruited for the study. The collected data included the blood lead levels, complete blood count, serum iron, total iron binding capacity, transferrin, and ferritin, which were measured during regular physical examinations. All subjects filled out questionnaires that included demographic information, medical history, and alcohol and tobacco consumption. HFE genotyping for C282Y and H63D was determined using polymerase chain reaction and restriction fragment length polymorphism (PCR/RFLP). The mean blood lead level in lead workers was 19.75 µg/dL and was 2.86 µg/dL in unexposed subjects. Of 238 subjects, 221 (92.9%) subjects were wild-type (CCHH) for HFE C282Y and H63D, and 17 (7.1%) subjects were heterozygous for a H63D mutation (CCHD). Multiple linear regression analysis showed that blood lead was significantly negatively associated with hemoglobin (Hb), mean corpuscular hemoglobin concentration (MCHC), and mean corpuscular volume (MCV), whereas the HFE variant was associated negatively with MCV and positively with ferritin. An interactive influence on MCV was identified between blood lead and HFE variants. Our research found a significant modifying effect of the HFE variant, which possibly affected MCV. The HFE H63D heterozygous (CCHD) variant seemed to provide a protective factor against lead toxicity. Future studies should focus on competing binding proteins between iron and lead influenced by gene variation.
38
WANG, Jian, Guohua CHEN, and Kostas PANTOPOULOS. "The haemochromatosis protein HFE induces an apparent iron-deficient phenotype in H1299 cells that is not corrected by co-expression of beta2-microglobulin." Biochemical Journal 370, no. 3 (March 15, 2003): 891–99. http://dx.doi.org/10.1042/bj20021607.
Full textAbstract:
HFE, an atypical MHC class I type molecule, has a critical, yet still elusive function in the regulation of systemic iron metabolism. HFE mutations are linked to hereditary haemochromatosis type 1, a common autosomal recessive disorder of iron overload. Most patients are homozygous for a C282Y point mutation that abrogates the interaction of HFE with β2-microglobulin (β2M) and, thus, impairs its proper processing and expression on the cell surface. An H63D substitution is also associated with disease. To investigate the function of HFE we have generated clones of human H1299 lung cancer cells that express wild-type, C282Y or H63D HFE under the control of a tetracycline-inducible promoter. Consistent with earlier observations in other cell lines, the expression of wild-type or H63D, but not C282Y, HFE induces an apparent iron-deficient phenotype, manifested in the activation of iron-regulatory protein and concomitant increase in transferrin receptor levels and decrease in ferritin content. This phenotype persists in cells expressing wild-type HFE after transfection with a β2M cDNA. Whereas endogenous β2M is sufficient for the presentation of at least a fraction of chimeric HFE on the cell surface, this effect is stimulated by approx. 2.8-fold in β2M transfectants. The co-expression of exogenous β2M does not significantly affect the half-life of HFE. These results suggest that the apparent iron-deficient phenotype elicited by HFE is not linked to β2M insufficiency.
39
Ali-Rahmani, Fatima, Patricia S. Grigson, Sang Lee, Elizabeth Neely, James R. Connor, and Cara-Lynne Schengrund. "H63D mutation in hemochromatosis alters cholesterol metabolism and induces memory impairment." Neurobiology of Aging 35, no. 6 (June 2014): 1511.e1–1511.e12. http://dx.doi.org/10.1016/j.neurobiolaging.2013.12.014.
Full text
40
Tomatsu, S., K. O. Orii, R. E. Fleming, C. C. Holden, A. Waheed, R. S. Britton, M. A. Gutierrez, S. Velez-Castrillon, B. R. Bacon, and W. S. Sly. "Contribution of the H63D mutation in HFE to murine hereditary hemochromatosis." Proceedings of the National Academy of Sciences 100, no. 26 (December 12, 2003): 15788–93. http://dx.doi.org/10.1073/pnas.2237037100.
Full text
41
Castiella, Agustin, and Eva Zapata. "Proven: The causative role of homozygous H63D mutation in hereditary haemochromatosis." Gastroenterología y Hepatología (English Edition) 39, no. 7 (August 2016): 494–95. http://dx.doi.org/10.1016/j.gastre.2016.06.016.
Full text
42
Castiella, Agustin, and Eva Zapata. "Proven: The causative role of homozygous H63D mutation in hereditary haemochromatosis." Gastroenterología y Hepatología 39, no. 7 (August 2016): 494–95. http://dx.doi.org/10.1016/j.gastrohep.2015.12.004.
Full text
43
Samarasena, Jason, Wendy Winsor, Richard Lush, Peter Duggan, Yagang Xie, and Mark Borgaonkar. "Individuals Homozygous for the H63D Mutation Have Significantly Elevated Iron Indexes." Digestive Diseases and Sciences 51, no. 4 (April 2006): 803–7. http://dx.doi.org/10.1007/s10620-006-3210-3.
Full text
44
Pascoe, A., P. Kerlin, C. Steadman, A. Clouston, D. Jones, L. Powell, E. Jazwinska, S. Lynch, and R. Strong. "Spur cell anaemia and hepatic iron stores in patients with alcoholic liver disease undergoing orthotopic liver transplantation." Gut 45, no. 2 (August 1, 1999): 301–5. http://dx.doi.org/10.1136/gut.45.2.301.
Full textAbstract:
BACKGROUNDFollowing orthotopic liver transplantation (OLT) histological examination of explant livers from patients with alcoholic liver disease (ALD) sometimes shows extensive iron deposits in a distribution suggestive of homozygous haemochromatosis.AIMSTo use haemochromatosis gene (HFE) assays to distinguish between ALD with notable siderosis and hereditary haemochromatosis. To evaluate the possible influence of spur cell haemolytic anaemia on hepatic iron loading.PATIENTSThirty seven patients with ALD were abstinent for at least six months prior to OLT. Twenty three patients had transferrin saturations greater than 55%, 16 also had increased serum ferritin (>350 μg/l). Eight of 37 (22%) explant livers had grade 3 or 4 hepatic iron deposition, predominantly in hepatocytes. Of these, four had a hepatic iron index greater than 1.9 and most seemed to have spur cell haemolytic anaemia.METHODSMutation analysis for C282Y and H63D mutations was performed on DNA extracts from peripheral blood or explant liver. Spur cell haemolytic anaemia was diagnosed when the haemoglobin was 105 g/l in the presence of notable acanthocytosis.RESULTSNone of the eight patients with grade 3 or 4 hepatic iron had evidence of the C282Y mutation. Two of the eight were heterozygous for H63D. None of the remaining 28 patients tested showed homozygous HFE mutations. Spur cell anaemia was present in six of the eight patients with heavy iron deposition and only one of the remaining patients.CONCLUSIONSThe HFE mutation was not present in these patients with advanced ALD and heavy iron loading. Spur cell haemolytic anaemia provides an alternative potential mechanism for the heavy iron loading.
45
Singh, Prabhsimranjot, Sudhamshi Toom, Makardhwaj S. Shrivastava, and William B. Solomon. "A Rare Combination of Genetic Mutations in an Elderly Female: A Diagnostic Dilemma!" Blood 128, no. 22 (December 2, 2016): 5487. http://dx.doi.org/10.1182/blood.v128.22.5487.5487.
Full textAbstract:
Introduction: JAK2 is located on chromosome 9p24 and includes 25 exons encoding a protein of about 1132 amino acids. JAK2 is one of the four Janus family non-receptor protein tyrosine kinases. JAK2V617F is by far the most prevalent mutation in BCR-ABL1-negative Myeloproliferative neoplasms (occurs in ∼95% of patients with polycythemia vera, in ∼55% with essential thrombocythemia and in ∼65% with primary myelofibrosis) 1, 2. More than 80% of hemochromatosis patients are homozygous for a C282Y mutation in HFE gene, and a smaller proportion are compound heterozygous for both the C282Y mutation and an H63D mutation3. Here we present the first case of an elderly female with concomitant diagnosis of Polycythemia Vera (PV) and hemochromatosis. To our knowledge, there is no literature about the co-existence or associations of these diseases. Case Reports: 75 year old female, former smoker with PMH of hemochromatosis and COPD with recent exacerbation, presented to the oncology clinic after hospital discharge for continuing care of her hemochromatosis requiring phlebotomy. She reports to have had multiple phlebotomies in the past fifteen years. Patient denied any history of liver disease, diabetes, arthralgia, skin pigmentation or sleep problems. Vital signs and examination were within normal limits. Her initial work up reported significantly elevated hemoglobin of 17.4gm/dl, hematocrit of 56.1%, RBC count of 6.98M/UL with MCV 80.4 fl, MCH 24.9 pg and platelet count of 673 K/UL. Peripheral smear showed normal red cell morphology and few giant platelets. Subsequently, further lab testing revealed ferritin of 25.7ng/ml. Her elevated hematocrit was further evaluated and erythropoietin was surprisingly <1mIU/ml. Genetic testing for HFE gene mutation screen was positive for homozygous C282Y mutation. Due to high suspicion for Polycythemia Vera, JAK2 mutation was also tested, which to our surprise, came back positive for JAK2 V617F point mutation. Patient is diagnosed with Polycythemia Vera and Hereditary Hemochromatosis and is recommended to start Aspirin, continue phlebotomy to maintain Hematocrit below 45% and take hydroxyurea for thrombocytosis. Discussion: It is interesting to note the co-existence of two un-related diseases. Franchini M et al analyzed 52 patients with PV for 12 HH gene mutations and found no significant association between the two conditions4. Hannuksela J et al studied C282Y and H63D mutations in 232 patients with hematological malignancies and reported no significant association5. Beaton and Adams in their review article about the myths and realities of hemochromatosis reports an elevated hemoglobin, in hemochromatosis's patient as a myth, based on their review of 634 C282Y homozygous patients at London health Science center, with mean hemoglobin of 145±13 g/L6. Our case re-iterates the importance of clinical suspicion of polycythemia Vera in a hemochromatosis patient with elevated hematocrit and undetectable erythropoietin. The coincidence is, phlebotomy is the treatment for both conditions as long as patient is fairly asymptomatic. References: 1. Ayalew Tefferi; Molecular drug targets in myeloproliferative neoplasms: mutant ABL1, JAK2, MPL, KIT, PDGFRA, PDGFRB and FGFR1; J Cell Mol Med. 2009 Feb; 13(2): 215-237. 2. Cross NC (2011); Genetic and epigenetic complexity in myeloproliferative neoplasms. Hematology Am Soc Hematol Educ Program 2011:208-214. 3. Feder JN, Gnirke A, Thomas W, et al. A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis. Nat Genet1996; 13:399-408. 4. Analysis of hemochromatosis gene mutations in 52 consecutive patients with polycythemia vera. Franchini M1, de Matteis G, Federici F, Solero P, Veneri D. Hematology. 2004 Oct-Dec;9(5-6):413-4. 5. Prevalence of HFE genotypes, C282Y and H63D, in patients with hematologic disorders. Hannuksela J, Savolainen ER, Koistinen P, Parkkila S. Haematologica. 2002 Feb;87(2):131-5. 6. The myths and realities of hemochromatosis Melanie D Beaton, Paul C Adams Can J Gastroenterol. 2007 February; 21(2): 101-104. PMCID: PMC2657669 Disclosures No relevant conflicts of interest to declare.
46
Zamin Jr, Idilio, Angelo Alves de Mattos, Ângelo Zambam de Mattos, Eduardo Migon, Claudia Bica, and Cláudio Osmar Pereira Alexandre. "Prevalence of the hemochromatosis gene mutation in patients with nonalcoholic steatohepatitis and correlation with degree of liver fibrosis." Arquivos de Gastroenterologia 43, no. 3 (September 2006): 224–28. http://dx.doi.org/10.1590/s0004-28032006000300013.
Full textAbstract:
BACKGROUND: Nonalcoholic steatohepatitis is a chronic liver disease with a high prevalence in the general population and a potential to evolve into cirrhosis. It is speculated that iron overload could be associated with liver injury and unfavorable progress in affected patients. AIMS: To evaluate the prevalence of mutation of the hemochromatosis gene (HFE) in patients with nonalcoholic steatohepatitis and to correlate it with histological findings in liver specimens. PATIENTS AND METHODS: Twenty-nine patients with nonalcoholic steatohepatitis were evaluated. The presence of mutation in the hemochromatosis gene (C282Y and H63D) was tested in all patients and its result was evaluated in relation to hepatic inflammatory activity, presence of fibrosis, and iron overload in the liver. The control group was composed of 20 patients with normal liver function tests and 20 patients infected with the hepatitis C virus, with elevated serum levels of aminotransferases and with chronic hepatitis as shown by biopsy. RESULTS: Mutation of the hemochromatosis gene (C282Y and/or H63D) was diagnosed in 16 (55.2%) patients with nonalcoholic steatohepatitis, in 12 (60%) patients with hepatitis C and in 8 (40%) patients with no liver disease. No association was found between the presence of mutation and inflammatory activity, nor with the presence of fibrosis in patients with nonalcoholic steatohepatitis. An association was found between the presence of mutation and the occurrence of iron overload in liver, but there was no association between liver iron and the occurrence of fibrosis. CONCLUSIONS: The findings suggest that iron does not play a major role in the pathogenesis and progression of nonalcoholic steatohepatitis, and routine tests of the hemochromatosis gene mutation in these patients should not be recommended.
47
Luszczyk, Marcin, Barbara Kaczorowska-Hac, Ewa Milosz, Elzbieta Adamkiewicz-Drozynska, Ewa Ziemann, Radoslaw Laskowski, Damian Flis, Magdalena Rokicka-Hebel, and Jedrzej Antosiewicz. "Reduction of Skeletal Muscle Power in Adolescent Males Carrying H63D Mutation in theHFEGene." BioMed Research International 2017 (2017): 1–7. http://dx.doi.org/10.1155/2017/5313914.
Full textAbstract:
Iron overload resulting from the mutation of genes involved in iron metabolism or excess dietary intake has been reported to negatively influence human physical performance. The aim of this study was to test the hypothesis that adolescents bearing a hemochromatosis gene(HFE)mutation in contrast to adults with the same mutation will not experience iron accumulation and their aerobic capacity will be similar to that of age-matched controls. Thirteen boys participated in the study. Seven of them are carriers of H63D mutation in theHFEgene and six were wild type. Fitness levels were assessed using the cardiopulmonary exercise test. In addition, iron status and inflammatory markers were determined. We observed that cardiovascular fitness was significantly lower in the group bearing theHFEmutation compared to the control group. Moreover, theHFEmutation group achieved lower maximal power output compared to the control group. There were no differences in blood ferritin concentrations between the two groups which indicates similar amounts of stored iron. Obtained data do not confirm our hypothesis. On the contrary, it was demonstrated thatHFEmutation is associated with a lower level of aerobic capacity, even in the absence of iron accumulation.
48
Turner, Mark S., Sarah Penning, Angela Sharp, Valentine J. Hyland, Ray Harris, C. Phillip Morris, and Angela van Daal. "Solid-Phase Amplification for Detection of C282Y and H63D Hemochromatosis (HFE) Gene Mutations." Clinical Chemistry 47, no. 8 (August 1, 2001): 1384–89. http://dx.doi.org/10.1093/clinchem/47.8.1384.
Full textAbstract:
Abstract Background: There is a need for simple, rapid, and inexpensive methods for the detection of single-nucleotide polymorphisms. Our aim was to develop a single-tube ELISA-like PCR assay and evaluate it by detecting the common C282Y and H63D mutations found in the hemochromatosis gene (HFE) by use of clinical samples. Methods: The method, termed solid-phase amplification (SPA), involves dual liquid- and solid-phase amplification of a target sequence by the use of two PCR primers, one of which is in two forms: the first is covalently immobilized to the wall of a microwell, and the second is free in solution. During allele-specific amplification, both the free and solid-phase amplicons are labeled by incorporation of digoxigenin (DIG)-dUTP. The amount of surface-bound amplicon is determined colorimetrically by the use of an alkaline phosphatase-anti-DIG-Fab conjugate and p-nitrophenyl phosphate. Results: Two different amplicon-labeling methods were evaluated. Analysis of 173 clinical samples for the C282Y and H63D HFE point mutations with SPA revealed that only one sample was incorrectly diagnosed, apparently because of operator error, when compared with conventional restriction fragment length polymorphism assay results. Conclusions: The SPA assay has potential for medium-scale mutation detection, having the advantage of being manipulatively simple and immediately adaptable for use in clinical laboratories with existing ELISA instrumentation.
49
De Haas, E. C., C. Meijer, N. Zwart, G. Van der Steege, H. M. Boezen, S. Sleijfer, F. E. Van Leeuwen, A. J. Smit, D. T. Sleijfer, and J. A. Gietema. "Hemochromatosis gene (HFE) mutations and chemotherapy-related cardiovascular risk profile in testicular cancer survivors (TCS)." Journal of Clinical Oncology 24, no. 18_suppl (June 20, 2006): 14589. http://dx.doi.org/10.1200/jco.2006.24.18_suppl.14589.
Full textAbstract:
14589 Background: TCS show an increased incidence of treatment-related cardiovascular disease. Standard chemotherapy (CT) may cause tissue damage by inducing free oxygen radicals through release of redox-active iron from body iron stores. HFE mutations associated with altered body iron load may therefore contribute to an increase in CT-induced free oxygen radicals and tissue damage. We investigated whether two HFE mutations (C282Y and H63D) are associated with cardiovascular risk profile in TCS. Methods: From a group of 90 TCS with a known cardiovascular status (JCO 2005; 23: 3718–25), genomic DNA for genotyping was available for 63 TCS (median (range) age at follow-up 35 y (24–54) and median follow-up duration 7 y (3–13)). Two HFE genotype groups were composed: HFE mutation (mut) (n = 19; any mutation C282Y and/or H63D) and HFE wild type (wt) (n = 44). Both groups were compared for cardiovascular risk profile, using Mann-Whitney U Test or Fisher’s Exact Test. Results: Groups had received comparable CT regimens. Body iron stores as reflected by plasma ferritin and transferrin saturation were not different for the HFE mut vs HFE wt group, respectively 104 μg/l (21–413) vs. 90 μg/l (22–569); p = 0.53 and 31% (20–49) vs. 30% (11–59); p = 0.15. Signs of vascular damage estimated by urinary albumin excretion and Von Willebrand factor levels were not significantly different: respectively 8.3 mg/24 h (4–165) vs. 7.7 mg/24 h (3–647); p = 0.90 and 90% (52–296) vs. 102% (28–235); p = 0.25. The prevalence of cardiovascular risk factors obesity (BMI > 27.8 kg/m2), metabolic syndrome (NCEP ATP III-criteria) and hypertension (mean 24-h blood pressure >135/85 mmHg) are shown in the table. Conclusion: TCS with a mutation in the HFE gene do not show more signs of cardiovascular damage after CT compared to TCS with wt HFE. However, the data suggest that TCS with a HFE mutation may have more frequently cardiovascular risk factors. Further study in a larger group of TCS is needed to explore this observation. [Table: see text] No significant financial relationships to disclose.
50
Andrikovics, Hajnalka, Nora Meggyesi, Aniko Szilvasi, Julia Tamaska, Gabriella Halm, Sandor Lueff, Sarolta Nahajevszky, et al. "HFE C282Y Mutation as a Genetic Modifier Influencing Disease Susceptibility for JAK2 V617F Positive Chronic Myeloproliferative Disease." Blood 108, no. 11 (November 16, 2006): 4904. http://dx.doi.org/10.1182/blood.v108.11.4904.4904.
Full textAbstract:
Abstract Common HFE gene point mutations (C282Y, H63D and S65C) are responsible for hemochromatosis type 1 in homozygous or compound heterozygous states. Although HFE-related hemochromatosis is inherited in a recessive manner, heterozygous carriers were shown to have higher iron parameters (serum iron and ferritin levels, transferrin saturation) without progressive iron overload. Heterozygous HFE carriership has been implicated as a genetic modifier of several diseases, where iron homeostasis play an important role in disease susceptibility or disease progression (porphyria cutanea tarda, myelodyslasia). We investigated 336 unrelated patients with chronic myeloproliferative disease (CMPD) [176 patients with polycythemia vera (PV), 131 patients with essential thrombocythemia (ET) and 29 patients with chronic idiopathic myelofibrosis (CIMF)] and 171 first time blood donors as controls for allele frequencies (AFs) of HFE mutations by Light Cycler allele discrimination method. The presence of the acquired JAK2 V617F mutation in CMPD was investigated by allele specific PCR. Laboratory (hemoglobin, white blood cell and platelet count) and clinical features (sex, age at diagnosis, splenomegaly, presence of thrombotic, myelofibrotic or leukemic transformation) were recorded in the patient group. Compared to controls (4.7 +/− 2.3%), decreased HFE C282Y AF was found in patient group (1.8 +/− 1.0%; p=0.02; OR=0.38 [0.17–0.85]). Decreased HFE C282Y AFs were detected in all patient subgroups according to diagnosis (PV, ET, CIMF) and according to JAK2 V617F mutational status, but the difference remained significant only in the patient group with PV or with JAK2 V617F positive CMPD (PV:1.7 +/− 1.4%; p=0.04; JAK2 V617F positive patients: 1.6+/− 1.1%). H63D and S65C mutational status did not differ significantly between control (12.0+/−3.5% and 1.3+/−1.8%) and patient groups (13.1+/−2.6% and 0.5+/−0.5%). JAK2 V617F frequency was 86.9% (153/176) in PV, 60.3% (79/131) in ET, and 72.4% (21/29) in CIMF. We found significantly elevated hemoglobin levels and WBC values (measured at the time of diagnosis) in the V617F-positive PV (and ET patient groups compared to V617F-negative patients. The incidence of vascular complications (arterial and venous thrombosis or bleeding) was higher in JAK2 V617F CMPD. The age of CMPD onset and the rate of different complications were not altered by HFE mutational status. Our data confirm earlier observations that JAK2 V617F-positive ET shares clinical features (elevated hemoglobin) with PV. We found that HFE C282Y mutation may be associated with a protective role against CMPD (also CMPD associated with JAK2 positivity). Chronic iron deficiency or latent anemia may trigger disease susceptibility for CMPD, and HFE C282Y positivity can play a protective role against chronic iron deficiency.