To see the other types of publications on this topic, follow the link: Nutrition surveys – Dominican Republic.
Journal articles on the topic 'Nutrition surveys – Dominican Republic'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Nutrition surveys – Dominican Republic.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Prince, Martin, Daisy Acosta, Alan D. Dangour, Ricardo Uauy, Mariella Guerra, Yueqin Huang, K. S. Jacob, et al. "Leg length, skull circumference, and the prevalence of dementia in low and middle income countries: a 10/66 population-based cross sectional survey." International Psychogeriatrics 23, no. 2 (August 12, 2010): 202–13. http://dx.doi.org/10.1017/s1041610210001274.
Full textAbstract:
ABSTRACTBackground: Adult leg length is influenced by nutrition in the first few years of life. Adult head circumference is an indicator of brain growth. There is a limited literature linking short legs and small skulls to an increased risk for cognitive impairment and dementia in late life.Methods: One phase cross-sectional surveys were carried out of all residents aged over 65 years in 11 catchment areas in China, India, Cuba, Dominican Republic, Venezuela, Mexico and Peru (n = 14,960). The cross-culturally validated 10/66 dementia diagnosis, and a sociodemographic and risk factor questionnaire were administered to all participants, and anthropometric measures taken. Poisson regression was used to calculate prevalence ratios for the effect of leg length and skull circumference upon 10/66 dementia, controlling for age, gender, education and family history of dementia.Results: The pooled meta-analyzed fixed effect for leg length (highest vs. lowest quarter) was 0.82 (95% CI, 0.68–0.98) and for skull circumference 0.75 (95% CI, 0.63–0.89). While point estimates varied between sites, the proportion of the variability attributable to heterogeneity between studies as opposed to sampling error (I2) was 0% for leg length and 22% for skull circumference. The effects were independent and not mediated by family history of dementia. The effect of skull circumference was not modified by educational level or gender, and the effect of leg length was not modified by gender.Conclusions: Since leg length and skull circumference are said to remain stable throughout adulthood into old age, reverse causality is an unlikely explanation for the findings. Early life nutritional programming, as well as neurodevelopment may protect against neurodegeneration.
2
Giambrone, Ashley E., Linda M. Gerber, Jesica S. Rodriguez-Lopez, Chau Trinh-Shervin, Nadia Islam, and Lorna E. Thorpe. "Hypertension Prevalence in New York City Adults: Unmasking Undetected Racial/Ethnic Variation, NYC HANES 2004." Ethnicity & Disease 26, no. 3 (July 20, 2016): 339. http://dx.doi.org/10.18865/ed.26.3.339.
Full textAbstract:
<p><strong>Objective: </strong>Using 2004 New York City Health and Nutrition Examination Survey (NYC HANES) data, we sought to examine variation in hypertension (HTN) prevalence across eight Asian and Hispanic subgroups. <strong></strong></p><p><strong>Design: </strong>Cross-sectional <strong></strong></p><p><strong>Setting: </strong>New York City, 2004 <strong></strong></p><p><strong>Main Outcome Measures: </strong>Logistic regression was performed to identify differences in HTN prevalence between ethnic subgroups controlling for age, sex, education and BMI. <strong></strong></p><p><strong>Results: </strong>Overall HTN prevalence among NYC adults was 25.5% (95% CI: 23.4-27.8), with 21.1% (95% CI: 18.2-24.3) among Whites, 32.8% (95% CI: 28.7-37.2) Black, 26.4% (95% CI: 22.3-31.0) Hispanics, and 24.7% (95% CI: 19.9-30.3) Asians. Among Hispanic subgroups, Dominicans had the highest HTN prevalence (32.2%), followed by Puerto Ricans (27.7%), while Mexicans had the lowest prevalence (8.1%). Among Asian subgroups, HTN prevalence was slightly higher among South Asians (29.9%) than among Chinese (21.3%). Adjusting for age, Dominican adults were nearly twice as likely to have HTN as non-Hispanic (NH) Whites (OR=1.96, 95% CI: 1.24-3.12), but this was attenuated after adjusting for sex and education (OR=1.27, 95% CI: .76 – 2.12). When comparing South Asians with NH Whites, results were also non-significant after adjustment (OR=2.00, 95% CI: .90-4.43). <strong></strong></p><p><strong>Conclusion: </strong>When analyzing racial/ethnic subgroups, NH Black and Hispanic adults from Dominican Republic had the highest HTN prevalence followed by South Asian and Puerto Rican adults. Mexican adults had the lowest prevalence of all groups. These findings highlight that ethnic subgroup differences go undetected when stratified by broader racial/ ethnic categories. To our knowledge, this is the first population-based study using objective measures to highlight these differences. <em>Ethn Dis. </em>2016;26(3):339-344; doi:10.18865/ed.26.3.339 </p>
3
de Onis, Mercedes, Adelheid W. Onyango, Elaine Borghi, Cutberto Garza, and Hong Yang. "Comparison of the World Health Organization (WHO) Child Growth Standards and the National Center for Health Statistics/WHO international growth reference: implications for child health programmes." Public Health Nutrition 9, no. 7 (October 2006): 942–47. http://dx.doi.org/10.1017/phn20062005.
Full textAbstract:
AbstractObjectivesTo compare growth patterns and estimates of malnutrition based on the World Health Organization (WHO) Child Growth Standards (‘the WHO standards’) and the National Center for Health Statistics (NCHS)/WHO international growth reference (‘the NCHS reference’), and discuss implications for child health programmes.DesignSecondary analysis of longitudinal data to compare growth patterns (birth to 12 months) and data from two cross-sectional surveys to compare estimates of malnutrition among under-fives.SettingsBangladesh, Dominican Republic and a pooled sample of infants from North America and Northern Europe.SubjectsRespectively 4787, 10 381 and 226 infants and children.ResultsHealthy breast-fed infants tracked along the WHO standard's weight-for-age mean Z-score while appearing to falter on the NCHS reference from 2 months onwards. Underweight rates increased during the first six months and thereafter decreased when based on the WHO standards. For all age groups stunting rates were higher according to the WHO standards. Wasting and severe wasting were substantially higher during the first half of infancy. Thereafter, the prevalence of severe wasting continued to be 1.5 to 2.5 times that of the NCHS reference. The increase in overweight rates based on the WHO standards varied by age group, with an overall relative increase of 34%.ConclusionsThe WHO standards provide a better tool to monitor the rapid and changing rate of growth in early infancy. Their adoption will have important implications for child health with respect to the assessment of lactation performance and the adequacy of infant feeding. Population estimates of malnutrition will vary by age, growth indicator and the nutritional status of index populations.
4
de Koning, Wim, David Dean, Frank Vriesekoop, Luis Kluwe Aguiar, Martin Anderson, Philippe Mongondry, Mark Oppong-Gyamfi, et al. "Drivers and Inhibitors in the Acceptance of Meat Alternatives: The Case of Plant and Insect-Based Proteins." Foods 9, no. 9 (September 14, 2020): 1292. http://dx.doi.org/10.3390/foods9091292.
Full textAbstract:
Insects as an alternative protein source has gained traction for its advantageous environmental impact. Despite being part of many traditional food cultures, insects remain a novelty in Western cultures and a challenging concept for many. Even though plant-based protein alternatives are not facing the same barriers, product unfamiliarity and limited exposure hinder adoption, which could be detrimental to growth within the food sector. This study is aimed at evaluating plant- and insect-based proteins as alternative dietary proteins. A model indicating the drivers of consumer attitudes towards meat-alternative proteins and consumer willingness to try, buy, and pay a premium was tested. Further, 3091 responses were collected using surveys in nine countries: China, USA, France, UK, New Zealand, Netherlands, Brazil, Spain, and the Dominican Republic. Structural Equation Modelling was used to analyze the data. We found that consumer’s behavioral intentions towards both plant-based and insect-based alternatives are inhibited by food neophobia but to an extent, are amplified by the perceived suitability and benefits of the protein, which in turn are driven by nutritional importance, environmental impact, healthiness, and sensory attributes for both alternatives. The expectation of the nutritional value of meat is the strongest (negative) influence on perceived suitability/benefits of plant-based protein and willingness to try, buy, and pay more for plant-based proteins, but it only has a relatively small impact on the suitability/benefits of insect-based protein and no impact on willingness to try, buy, and pay more for insect-based proteins. Overall, we conclude that consumer adoption towards meat alternatives is complex and is strengthened by the perceived suitability/benefits of the protein and general importance of perceived food healthiness and sustainability. Conversely, adoption is hindered by dietary factors and the experiential importance of meat and food neophobia.
5
Luft, Heidi, Weiming Ke, Lara Trifol, Mina Halpern, and Elaine Larson. "Sexual Relationship Power and Safe Sex Communication Among Partnered Women in the Dominican Republic." Journal of Transcultural Nursing 31, no. 1 (April 4, 2019): 28–37. http://dx.doi.org/10.1177/1043659619840413.
Full textAbstract:
Introduction: Research is needed to identify influences on safe sex communication among specific culture groups. This study aimed to (1) describe sexual behaviors and indicators of sexual power among partnered Dominican women and (2) identify which of these indicators are significantly associated with safe sex communication. Methodology: Cross-sectional surveys, grounded in the theory of gender and power, were conducted with 100 partnered women at a clinic in southeastern Dominican Republic. Linear regression modeling was used to identify significant associations. Results: Self-efficacy (β = 0.48), total personal monthly income (β = 0.21), and history of sexually transmitted infection (β = 0.19) were significantly associated with higher level of partner safe sex communication. Discussion: Nurse clinicians, educators, and researchers should consider self-efficacy, personal income, and history of sexually transmitted infection when addressing communication in HIV prevention efforts among Dominican women.
6
Duffy, Lauren N., Garrett Stone, H. Charles Chancellor, and Carol S. Kline. "Tourism development in the Dominican Republic: An examination of the economic impact to coastal households." Tourism and Hospitality Research 16, no. 1 (October 27, 2015): 35–49. http://dx.doi.org/10.1177/1467358415613118.
Full textAbstract:
Coastal tourism projects are promoted in the Dominican Republic as national-level economic development initiatives that will create jobs for local residents, subsequently benefiting the households in these communities. However, the economic benefits of tourism can be severely weakened as a result of the neoliberal economic policies that guide such projects. Like other economically developing countries—particularly small island nations—the Dominican Republic embraced neoliberal policies that have ultimately reshaped the country’s economic, political, cultural, and physical landscape. As a result, transnational companies, foreign investors, and large-scale enclave tourism projects are the dominant form of tourism development in the Dominican Republic. Though companies’ revenue and profit data are not available for analysis of economic leakage, households can be investigated to understand the level of economic benefits obtained by residents of the local communities. Toward this end, 360 household surveys were collected to examine household income and material assets across 12 coastal communities in three regions of the Dominican Republic. Because of the noted differences in previous development literature, gender of the head of households and whether the household was dependent on income from tourism employment were compared across these measures after adjusting for regional differences. Results indicate that the gender of the head of the household and tourism dependency positively predicted household income, while only gender of the head of the household predicted material assets.
7
Peña, Farah, Raquel Pimentel, Shaveta Khosla, Supriya Mehta, and Maximo Brito. "Zika Virus Epidemic in the Dominican Republic, 2016." Open Forum Infectious Diseases 4, suppl_1 (2017): S301. http://dx.doi.org/10.1093/ofid/ofx163.694.
Full textAbstract:
Abstract Background The first cases of Zika (ZIKV) in the Americas were reported in Easter Island, Chile in 2014. The epidemic spread to Brazil and Central America in 2015. We describe the extent and distribution of the countrywide ZIKV epidemic in the Dominican Republic. Methods The DR Ministry of Health (MoH) instituted active surveillance, monitoring and mandatory reporting of suspected cases of ZIKV in 2015 through the National System of Epidemiologic Surveillance (SINAVE). In the pre-epidemic period, the MoH conducted active search and blood testing of suspected cases in communities rumored to have cases of the disease. During the epidemic, the MoH conducted weekly monitoring of all cases of febrile exanthems, flaccid paralysis and meningitis, and also conducted rapid surveys in highly populated areas to identify local outbreaks. Data from SINAVE was exported and analyzed using SAS. Results A total of 5226 cases ZIKV were reported to the MoH from January 2016 to December 2016 (figure). Cases were 74% female, of whom 1275 (33%) were pregnant. Most of the cases (51%) were diagnosed in the age group of 20 to 39, and did not differ by gender. The majority (58%) of cases were reported from a metropolitan area. Almost all cases (82%) were treated in the outpatient setting, while 17% were hospitalized. Only 3 patients died and 95% had an uncomplicated course. There were 285 cases of Guillain BarrŽ Syndrome (GBS; Figure), with the epidemic curve showing a peak 2–4 weeks following the peak of the epidemic. Compared with patients with suspected ZIKV (n = 1054), those with GBS were more likely to be male (47% vs. 19%, P < 0.001), aged ≥40 years (53% vs. 19%, P < 0.001),, more likely to have complications (18% vs. 6%, P < 0.001) and comorbidity (2% vs. 0.2%, P = 0.04) Seventeen (6%) of confirmed GBS cases resulted in death. Conclusion The DR reported one of the largest ZIKV outbreaks in the Americas. The epidemic started early in 2016 and had all but subsided by May 2017. Although most cases had an uncomplicated course, incidence of GBS was high. Disclosures All authors: No reported disclosures.
8
Salati, Raquel, Medhat K. Nahkla, Maria R. Rojas, Pablo Guzman, Jose Jaquez, Douglas P. Maxwell, and Robert L. Gilbertson. "Tomato yellow leaf curl virus in the Dominican Republic: Characterization of an Infectious Clone, Virus Monitoring in Whiteflies, and Identification of Reservoir Hosts." Phytopathology® 92, no. 5 (May 2002): 487–96. http://dx.doi.org/10.1094/phyto.2002.92.5.487.
Full textAbstract:
Epidemics of tomato yellow leaf curl disease (TYLCD) in the Dominican Republic in the early to mid-1990s resulted in catastrophic losses to processing tomato production. As part of an integrated management approach to TYLCD, the complete nucleotide sequence of a full-length infectious clone of an isolate of Tomato yellow leaf curl virus (TYLCV) from the Dominican Republic (TYLCV-[DO]) was determined. The TYLCV-[DO] genome was nearly identical in sequence (>97%) and genome organization to TYLCV isolates from Israel and Cuba. This established that TYLCV-[DO] is a bonafide TYLCV isolate (rather than a recombinant virus, such as isolates from Israel [Mild], Portugal, Japan, and Iran), and provided further evidence for the introduction of the virus from the eastern Mediterranean. A reduction in the incidence of TYLCV in the northern and southern processing tomato production areas of the Dominican Republic has been associated with the implementation of a mandatory 3-month whitefly host-free period (including tomato, common bean, cucurbits, eggplant, and pepper). Monitoring TYLCV levels in whiteflies, by polymerase chain reaction with TYLCV-specific primers, established that the incidence of TYLCV decreased markedly during the host-free period, and then gradually increased during the tomato-growing season. In contrast, TYLCV persisted in whiteflies and tomato plants in an area in which the host-free period was not implemented. Surveys for TYLCV reservoir hosts, conducted to identify where TYLCV persists during the host-free period, revealed symptomless infections in a number of weed species. The implications of these findings for TYLCV management in the Dominican Republic are discussed.
9
Siu, Carolina. "Can Central America and the Dominican Republic Overcome Malnutrition in All Its Forms?" Food and Nutrition Bulletin 41, no. 1_suppl (June 2020): S86—S88. http://dx.doi.org/10.1177/0379572120906639.
Full textAbstract:
Malnutrition impairs many forms of human development. In order to tackle nutritional deficiencies and excesses, the science of evidence-based nutrition needs rapid transformations to scale up pro-poor and sustainable actions. The aims of this article are to briefly outline the nutritional challenges faced in Central America and the Dominican Republic, highlight new evidence produced by the Institute of Nutrition of Central America and Panama during the last decade, and foster the implementation of feasible solutions in limited-resourced settings.
10
Revuelta, Ohiana, Yolanda M. León, Pablo Feliz, Brendan J. Godley, Juan A. Raga, and Jesús Tomás. "Protected areas host important remnants of marine turtle nesting stocks in the Dominican Republic." Oryx 46, no. 3 (July 2012): 348–58. http://dx.doi.org/10.1017/s0030605311001529.
Full textAbstract:
AbstractNesting by marine turtles in the Caribbean has declined considerably, mainly because of human exploitation, but there has previously been no monitoring in the Dominican Republic. We present the first detailed assessment of the status of marine turtle nesting in the country, based on surveys during 2006–2010. Nesting populations of hawksbill Eretmochelys imbricata and leatherback turtle Dermochelys coriacea are of regional importance and the green turtle Chelonia mydas is still present, although nesting in low numbers. The two main nesting sites are within protected areas: the Jaragua National Park in the south-west, important for leatherback turtles (mean of 126 nests per season), and Del Este National Park on Saona Island in the south-east, principally for hawksbill turtles (mean of 100 nests per season). Comparison with historical data suggests all rookeries are profoundly reduced in size. Although the main nesting beaches are within protected areas, illegal egg-take and meat consumption continues there, and also elsewhere in the country.
11
WELSH, MICHAEL J., ELIZARDO PUELLO, MELINDA MEADE, SAM KOME, and TARA NUTLEY. "EVIDENCE OF DIFFUSION FROM A TARGETED HIV/AIDS INTERVENTION IN THE DOMINICAN REPUBLIC." Journal of Biosocial Science 33, no. 1 (January 2001): 107–19. http://dx.doi.org/10.1017/s0021932001001079.
Full textAbstract:
The diffusion potential of a targeted HIV/AIDS intervention that enlisted peer educators to disseminate ‘safer sex’ messages and condoms among female commercial sex workers and their clients was evaluated in the Dominican Republic. Levels of interurban interaction potential were ascertained that linked the targeted city of La Romana with the proximate cities of San Pedro de Macoris and Guaymate. Weekly service statistics generated over an 8-month period were analysed to establish activity areas for the peer educators. Data were entered and analysed using a geographic information system and interurban linkages were established. Project outcomes were examined via a series of three cross-sectional Knowledge, Attitudes and Practices (KAP) surveys conducted among convenience samples of commercial sex workers at the start of the intervention and at 4 and 8 months. The results attest to a high degree of interconnectivity between the targeted and proximate cities, and a pattern of interurban mobility that links commercial sex workers, clients and establishments in all three cities. The examination of project outcomes revealed statistically significant changes in condom use in the targeted city of La Romana among commercial sex workers, as well as among their counterparts interviewed in the proximate cities of San Pedro de Macoris and Guaymate. These data suggest a diffusion effect. It is concluded that a targeted intervention may influence proximate cities within a relatively compressed period of time. The findings suggest the importance of considering geographic diffusion principles, such as urban hierarchies, regional nodes and transportation linkages, when designing HIV/AIDS prevention efforts. It also has important implications in the selection of control sites when conducting experimental studies of HIV/AIDS interventions.
12
Mattila, David K., Phillip J. Clapham, Oswaldo Vásquez, and Robert S. Bowman. "Occurrence, population composition, and habitat use of humpback whales in Samana Bay, Dominican Republic." Canadian Journal of Zoology 72, no. 11 (November 1, 1994): 1898–907. http://dx.doi.org/10.1139/z94-258.
Full textAbstract:
A study of humpback whales (Megaptera novaeangliae) was conducted between 1988 and 1991 in Samana Bay, Dominican Republic. Humpbacks were observed as early as the earliest survey (3 January) and as late as the latest (16 March). Local abundance varied from 0 whales per hour to a maximum of 3.2 whales per hour (mean = 1.70, SD = 0.79), and densities calculated from track surveys ranged from 0.09 to 0.82 whales per square nautical mile (mean = 0.31). Abundance generally peaked in February, but variation was observed both within a season and between years. Almost all whales were observed in the eastern part of the bay, towards or at its mouth. In all, 397 individuals were photographically identified during the study period. Of these, 18 were observed in more than 1 year (17 in 2 years, 1 in 3 years). A total of 15.8% of identified individuals were observed on more than 1 day in a year (maximum 5 days), with mothers representing 33.3% of all resightings. Observed occupancies of resighted animals ranged from 1 to 33 days (mean = 6.3 days, SD = 7.14). The mean group size was 1.95 (range = 1–15, SD = 1.30, n = 652 groups). Ninety-nine groups contained a calf, and all groups larger than three (n = 45) were competitive in nature. Comparisons of fluke photographs with the North Atlantic Humpback Whale Catalogue revealed 141 matches of 118 individuals to other areas. Of these, 76 were to high-latitude feeding grounds (including the Gulf of Maine, Newfoundland, Labrador, the Gulf of St. Lawrence, and west Greenland), while the remaining 65 were to other areas of the West Indies (Silver Bank, Navidad Bank, Puerto Rico, Virgin Bank, or Anguilla Bank) or to Bermuda. We suggest that Samana Bay is one of the most important winter habitats in the West Indies for humpback whales from all over the western North Atlantic, although whaling records suggest that the abundance of whales in this area may be a relatively recent phenomenon. Sightings of other marine mammal species in Samana Bay are summarized.
13
Lim, Burton K. "Review of genetic diversification of bats in the Caribbean and biogeographic relationships to Neotropical species based on DNA barcodes." Genome 60, no. 1 (January 2017): 65–73. http://dx.doi.org/10.1139/gen-2015-0204.
Full textAbstract:
DNA barcoding is helping in discovering high levels of cryptic species and an underestimation of biodiversity in many groups of organisms. Although mammals are arguably the most studied and one of the least speciose taxonomic classes, the rate of species discovery is increasing and biased for small mammals on islands. An earlier study found bats in the Caribbean as a taxonomic and geographic deficiency in the International Barcode of Life initiative to establish a genetic reference database to enable specimen identification to species. Recent surveys in Dominican Republic, Jamaica, and Martinique have documented and barcoded half of the 58 bat species known from the Caribbean. I analyze all available barcode data of Caribbean bats to investigate biogeography and cryptic species in the Neotropical region. Analysis of the mitochondrial DNA gene cytochrome c oxidase subunit 1 results in a phylogenetic tree with all but one species as well-supported and reciprocally monophyletic. With a broader sampling across the Neotropics, there are also divergent lineages that exhibit biogeographic structuring: (i) a phylogenetic split between northern and southern Dominican Republic in three species, (ii) two taxa with cryptic species associated with higher degree of island endemism, (iii) populations of two widely distributed species with deep divergence between the Caribbean and North and Central America, and (iv) one species in the Caribbean with affinities to taxa in South America.
14
Hawkes, Corinna, and Anne Marie Thow. "Implications of the Central America-Dominican Republic-Free Trade Agreement for the nutrition transition in Central America." Revista Panamericana de Salud Pública 24, no. 5 (November 2008): 345–60. http://dx.doi.org/10.1590/s1020-49892008001100007.
Full text
15
Maliszewski, Genevieve, Maithe Enriquez, An-Lin Cheng, Pamela Logan, and Jennifer Watts. "Development and feasibility of a community-partnered nutrition intervention targeting rural migrant communities in the Dominican Republic." Public Health Nursing 34, no. 4 (March 21, 2017): 343–47. http://dx.doi.org/10.1111/phn.12322.
Full text
16
Bouilly, Roberta, Giovanna Gatica-Domínguez, Marilia Mesenburg, Francisco I. Cáceres Ureña, Daniel G. P. Leventhal, Aluísio J. D. Barros, Cesar G. Victora, and Fernando C. Wehrmeister. "Maternal and child health inequalities among migrants: the case of Haiti and the Dominican Republic." Revista Panamericana de Salud Pública 44 (November 20, 2020): 1. http://dx.doi.org/10.26633/rpsp.2020.144.
Full textAbstract:
Objective. To assess coverage and inequalities in maternal and child health interventions among Haitians, Haitian migrants in the Dominican Republic and Dominicans. Methods. Cross-sectional study using data from nationally representative surveys carried out in Haiti in 2012 and in the Dominican Republic in 2014. Nine indicators were compared: demand for family planning satisfied with modern methods, antenatal care, delivery care (skilled birth attendance), child vaccination (BCG, measles and DPT3), child case management (oral rehydration salts for diarrhea and careseeking for suspected pneumonia), and the composite coverage index. Wealth was measured through an asset-based index, divided into tertiles, and place of residence (urban or rural) was established according to the country definition. Results. Haitians showed the lowest coverage for demand for family planning satisfied with modern methods (44.2%), antenatal care (65.3%), skilled birth attendance (39.5%) and careseeking for suspected pneumonia (37.9%), and the highest for oral rehydration salts for diarrhea (52.9%), whereas Haitian migrants had the lowest coverage in DPT3 (44.1%) and oral rehydration salts for diarrhea (38%) and the highest in careseeking for suspected pneumonia (80.7%). Dominicans presented the highest coverage for most indicators, except oral rehydration salts for diarrhea and careseeking for suspected pneumonia. The composite coverage index was 79.2% for Dominicans, 69.0% for Haitian migrants, and 52.6% for Haitians. Socioeconomic inequalities generally had pro-rich and pro-urban pattern in all analyzed groups. Conclusion. Haitian migrants presented higher coverage than Haitians, but lower than Dominicans. Both countries should plan actions and policies to increase coverage and address inequalities of maternal health interventions.
17
Pedreira, Cristina, Elizabeth Thrush, Gloria Rey-Benito, Ana Elena Chévez, and Barbara Jauregui. "The path towards polio eradication over 40 years of the Expanded Program on Immunization in the Americas." Revista Panamericana de Salud Pública 41 (December 20, 2017): 1. http://dx.doi.org/10.26633/rpsp.2017.154.
Full textAbstract:
This article synthesizes the important lessons learned from polio eradication in the Region of the Americas, including initial and more recent challenges and best practices, as well as particular factors surrounding attainment of this ambitious goal. Using documents, interviews, and country surveys, the authors describe and analyze the strategies and lessons learned during the 40 years of the Expanded Program on Immunization (1977 – 2017). Some major milestones and chxallenges specifically covered are: the Vaccine-derived Poliovirus (VDPV) outbreak in the Dominican Republic; the regional “mop-up operation;” poliovirus containment in essential facilities; the unprecedented introduction of inactivated polio vaccine (IPV); the synchronized switch from trivalent to bivalent OPV; and the countries’ unfailing commitment to the cause.
18
Zingman, Michael A., Amarilis Then Paulino, and Matilde Peguero Payano. "Clinical manifestations of chikungunya among university professors and staff in Santo Domingo, the Dominican Republic." Revista Panamericana de Salud Pública 41 (July 7, 2017): 1. http://dx.doi.org/10.26633/rpsp.2017.64.
Full textAbstract:
Objective. To further characterize chikungunya virus infection and its associated clinical manifestations, using a sample of university professors and staff in Santo Domingo, the Dominican Republic. Methods. A cross-sectional study with quota sampling by department was performed to obtain a convenience sample of professors (n = 736) and staff (n = 499) at the Universidad Autónoma de Santo Domingo. Surveys were used to collect demographic and infection data during the fall term of 2014. Univariate and bivariate analyses were carried out to quantify infection and clinical manifestation prevalence and to assess relationships of these outcomes with age, sex, and acute phase duration. Results. Of 1 236 participants, 49% reported infection (professors = 41%; staff = 61%). Of these, 53% also reported the presence of chronic effects, largely arthralgia (48%). Significant relationships were observed between reported infection and sex (P = 0.023), age (P < 0.001), and occupation (P < 0.001). More headache (P = 0.008) and edema (P < 0.001) in females, more headache (P = 0.005) in younger subjects, and more myalgia (P = 0.006) in those with longer acute symptoms were found. Additionally, more chronic arthralgia (P < 0.001; P = 0.003) and chronic edema (P < 0.001; P = 0.001) in females and older subjects, and more chronic myalgia (P = 0.041) and chronic edema (P = 0.037) in those with longer acute symptoms were observed. Conclusions. To the authors knowledge, this is the first population-based chikungunya prevalence study in the Dominican Republic, and the first to explore clinical manifestations in a university setting. The findings reflect results from studies following the 2005 – 2006 Reunion Island outbreak: prevalence of infection and chronic arthralgia, as well as associations with sex, age, and acute intensity. Longitudinal research can provide further insight into these effects.
19
Agha, Sohail, Mai Do, and Françoise Armand. "When Donor Support Ends: The Fate of Social Marketing Products and the Markets They Help Create." Social Marketing Quarterly 12, no. 2 (June 2006): 28–42. http://dx.doi.org/10.1080/15245000600678489.
Full textAbstract:
This article assesses the performance of social marketing interventions for oral contraceptives in Morocco and the Dominican Republic. These interventions were implemented under a model that has the potential to achieve sustainability; a donor-funded project partners with a manufacturer or distributor willing to market a contraceptive at a price lower than the prices of other commercial brands; the partnership makes it profitable for the commercial partner to continue the distribution and marketing of the contraceptive after donor support ceases. Multiple rounds of data from nationally representative surveys were analyzed to determine changes in the commercial sector share of oral contraceptives prior to and following the withdrawal of donor support. Particular attention was paid to changes in lower and middle income groups. In Morocco, the commercial sector share of oral contraceptives started increasing prior to the intervention and continued to do so after the withdrawal of donor support. These increases occurred for all women as well as for lower and middle income women. In the Dominican Republic, the commercial sector share of oral contraceptives increased among lower and middle income women during the period that social marketing activities were conducted and fluctuated in the period following withdrawal of donor support. The study suggests that if certain conditions are met, contraceptive social marketing interventions implemented under the manufacturer's model can contribute to a higher commercial sector share of a method among lower and middle income women and that these changes are sustainable after donor support has been withdrawn.
20
Batuman, O., M. R. Rojas, A. Almanzar, and R. L. Gilbertson. "First Report of Tomato chlorotic spot virus in Processing Tomatoes in the Dominican Republic." Plant Disease 98, no. 2 (February 2014): 286. http://dx.doi.org/10.1094/pdis-07-13-0685-pdn.
Full textAbstract:
Processing tomatoes (Solanum lycopersicum) are an important industry in the Dominican Republic. In November 2012, symptoms typical of tospovirus infection (bronzing, chlorosis, and necrosis of leaves) appeared in numerous processing tomato fields in the North (>50% incidence in some fields) and a few fields in the South (<1% incidence). Plants in affected fields had large populations of thrips on leaves and in flowers. Symptomatic leaves from four fields in the North (Guayubin, Juan Gomez, Hatillo Palma, and Navarrete) and one field in the South (Azua) were positive for infection by Tomato spotted wilt virus (TSWV) when tested with AgDia immunostrips. However, RT-PCR tests of these samples with a TSWV N gene primer pair (1) were negative, whereas the expected size 590 and 777 bp fragments were amplified with N gene primers for Groundnut ringspot virus (GRSV, 2) and Tomato chlorotic spot virus (TCSV; NF5′ATGTCTAAGGTCAAGCTCACC3′ and NR5′TTATGCAACACCTGAAATTTTGGC3′), respectively. These fragments were sequenced (KF420087 and KF420088) and comparisons revealed 99, 83, and 80% identities with N gene sequences of TCSV, GRSV, and TSWV, respectively. Portions of the L, M, and S RNAs were amplified from symptomatic leaves by RT-PCR with degenerate L (TOSPO L For: CWGARGATRTDATWATAAATAAYAATGC and TOSPO L Rev: GCATCNACAGAWATYTTCCA), M (TOSPO M For: AGAGCAATCAGTGCATC and TOSPO M Rev: CTTRCAGGCTTCAATRAAKGC), and S (3) primers. The expected L, M, and S RNA fragments of 450, 849, and 871 bp, respectively, were amplified and sequenced (KF420089, KF420090, and KF420091). Sequence comparisons revealed 98, 83, and 78%; 99, 94, and 82%; and 99, 83, and 77% identities with TCSV-, GRSV-, and TSWV-L, M, and S RNA sequences, respectively. Weed surveys around tomato fields revealed tospovirus symptoms (chlorosis, mosaic/mottle, and necrosis) in leaves of two common species, Boerhavia erecta and Cleome viscosa. Symptomatic leaves were positive with TSWV immunostrips, whereas RT-PCR and sequence analyses of these leaves from C. viscosa (one each from the North and South) and B. erecta (one from the South) revealed infection with TCSV (99% identities for L, M, and S RNA fragments). In contrast, leaves from pepper plants with tospovirus symptoms (chlorosis, ringspots, and necrosis) in a commercial greenhouse in the North (Villa Gonzales) were positive for TSWV based on immunostrips and RT-PCR and sequence analyses. Dot blot hybridization tests with the cloned TCSV L RNA fragment confirmed TCSV infection in PCR-positive tomato plants and weeds, whereas no hybridization signal was detected for TSWV-infected peppers or uninfected tomatoes. Identification of thrips collected from symptomatic tomato plants at Navarrete and Hatillo Palma revealed that tomato thrips (Frankliniella schultzei) was predominant (90%) along with Western flower thrips (F. occidentalis) (10%), whereas only F. schultzei was identified from weeds in the South. Thus, TCSV is causing the tospovirus disease of processing tomato, and this is the first report of this virus in the Dominican Republic. This is also consistent with F. schultzei being an efficient vector of TCSV. An IPM program for TCSV based on planting thrips- and virus-free transplants and resistant varieties, roguing symptomatic plants, thrips monitoring and management, and area-wide sanitation is being implemented. References: (1) H. R. Pappu et al. Tobacco Sci. 40:74, 1996. (2) C. G. Webster et al. Virol. 413:216, 2011. (3) R. J. Weeks et al. Acta Hort. 431:159, 1996.
21
Derose, Kathryn P., María Altagracia Fulcar, Ramón Acevedo, Gabriela Armenta, Gipsy Jiménez-Paulino, Claudio Lugo Bernard, Luis Eduardo Peña del Rosario, and Amarilis Then-Paulino. "An Integrated Urban Gardens and Peer Nutritional Counseling Intervention to Address Food Insecurity Among People With HIV in the Dominican Republic." AIDS Education and Prevention 33, no. 3 (June 2021): 187–201. http://dx.doi.org/10.1521/aeap.2021.33.3.187.
Full textAbstract:
Food insecurity negatively affects HIV prevention and care, and sustainable interventions are needed. Here we describe the development of an integrated urban gardens and peer nutritional counseling intervention to address food insecurity and nutrition among people with HIV, which included: (1) peer nutritional counseling, (2) gardening training, and (3) garden-based nutrition and cooking workshops. The intervention was developed using community-based participatory research over multiple years and stages of data gathering and implementation and evaluation. Lessons learned include the importance of cross-sectoral partnerships to achieve multifaceted, integrated, and sustainable interventions and a shared commitment among partners to an ongoing cycle of action-oriented research, and the need for home-based and community-based gardens to enhance food security and social support. The development process successfully combined an evidence-based framework and community engagement to yield a multicomponent yet integrated food security and nutrition intervention appropriate for people with HIV and potentially adaptable for other chronic conditions.
22
Kelleher, Cecily C., Juzer Lotya, Mary-Clare O'Hara, and Celine Murrin. "Session 1: Public health nutrition Nutrition and social disadvantage in Ireland." Proceedings of the Nutrition Society 67, no. 4 (October 10, 2008): 363–70. http://dx.doi.org/10.1017/s0029665108008677.
Full textAbstract:
There is now considerable evidence from several data sources, including the National Surveys of Lifestyles, Attitudes and Nutrition, that dietary patterns vary according to social position in the Republic of Ireland and those individuals in situations of social disadvantage experience barriers to consuming a healthy diet according to recommended guidelines. Obesity is a major impending public health problem related in part to social position that requires concerted inter-sectoral policy action. The Life-ways Cross-generation Cohort Study of >1000 Irish families has been followed prospectively since antenatal recruitment in 2001. Published findings to date indicate considerable social variability in food consumption and BMI patterns during pregnancy in the case of the maternal cohort. The present paper reports nutrient intake across the four family cohorts related to a key variable of interest, means-tested General Medical Services eligibility.
23
Anderson, J. E., H. E. Ali, A. H. Dakroury, A. K. Said, M. A. Hussein, M. I. El-Ghorab, D. C. Miller, and E. W. Brink. "Use of Nutrition Surveys for Family Planning Programme Evaluation: The Case of the Arab Republic of Egypt Nutrition Status." Journal of Tropical Pediatrics 33, no. 2 (April 1, 1987): 85–92. http://dx.doi.org/10.1093/tropej/33.2.85.
Full text
24
Hallum-Montes, Rachel, Rohan D’Souza, Maria Isabel Tavarez, Russell Manzanero, Grace E. Dann, Helen M. Chun, and Michael P. Anastario. "Condom Use During Last Sexual Contact and Last 30 Days in Two Samples of Caribbean Military Personnel." American Journal of Men's Health 6, no. 2 (November 21, 2011): 132–35. http://dx.doi.org/10.1177/1557988311418218.
Full textAbstract:
Condom use during last sexual contact is a survey measure that may be used to inform monitoring and evaluation indicators of recent condom use in populations at risk for HIV infection and other sexually transmitted infections, such as the uniformed services. The authors tested for differences in condom use measures that were fielded within separate Biological and Behavioral Surveillance Surveys conducted in the armed forces of two separate nations: the Dominican Republic and Belize. Both surveys included measures of condom use during last sexual contact with specified partners and both surveys included the Risk Behavior Assessment (RBA), which measures specific sexual acts and condom use frequency during a specified time period. In both samples, more than 40% of respondents who reported condom use during last sexual contact with a regular partner also reported engaging in unprotected sex when screened with the RBA. Furthermore, more than 60% of respondents who reported condom use during last sexual encounter with a commercial sex worker also reported engaging in unprotected sex when screened with the RBA. The results carry implications for monitoring and evaluation indicators of large-scale HIV prevention programs. The authors recommend that, when feasible, more in-depth instruments such as the RBA be considered to measure recent condom use in populations of uniformed services personnel.
25
Gómez-Luciano, Cristino Alberto, Luis Kluwe de Aguiar, Frank Vriesekoop, and Beatriz Urbano. "Consumers’ willingness to purchase three alternatives to meat proteins in the United Kingdom, Spain, Brazil and the Dominican Republic." Food Quality and Preference 78 (December 2019): 103732. http://dx.doi.org/10.1016/j.foodqual.2019.103732.
Full text
26
Toktorbaeva, Nargiza, Timothy Williams, Nazgul Abazbekova, Jennifer Yourkavitch, and Silvia Alayon. "Methodological Lessons Learned From Conducting a Population-Based Phone Survey on Nutrition Practices in the Kyrgyz Republic." Current Developments in Nutrition 5, Supplement_2 (June 2021): 885. http://dx.doi.org/10.1093/cdn/nzab048_020.
Full textAbstract:
Abstract Objectives To share lessons from a survey on nutrition practices, where the methodology shifted from in-person to phone interviews due to the COVID-19 pandemic. Methods The USAID Advancing Nutrition Project is conducting an impact evaluation in Kyrgyz Republic to determine the effect of project interventions on nutrition behaviors. Municipalities in Batken and Jalalabad regions were randomly assigned to intervention or comparison areas.The stepped wedge design includes baseline, midpoint, and endline surveys, carried out at 12-month intervals. The baseline survey was completed in late 2020. Difference in differences analysis and analysis of project exposure variables will be used to determine impact. Due to COVID-19, all interviews were carried out using computer assisted telephone interviewing (CATI). Results We interviewed 2,091 women with children under two years of age, with phone numbers obtained from health facilities in survey areas. The response rate (11.6% completed interviews) was similar or higher than typical phone surveys. Interviews included complex questions related to 11 nutrition practices, including women's and children's dietary recall. Average interview length was 31 minutes. 4% of respondents dropped before completing the call. Advantages of phone interviews included reduced travel costs, improved quality control, and real-time data review. Disadvantages included high non-response, inability to observe items such as handwashing stations, and potential biases related to phone ownership. Conclusions Our experience suggests that it is possible to carry out a complex, population-based nutrition survey using CATI. Response rates may be improved by building rapport at the start of the call. Interview length can be reduced using block randomization. Baseline levels of most indicators were similar to previous in-person surveys in Kyrgyzstan, suggesting CATI survey results can potentially provide accurate estimates of nutrition behaviors. Funding Sources United States Agency for International Development.
27
Martínez, R. T., S. Poojari, S. A. Tolin, X. Cayetano, and R. A. Naidu. "First Report of Tomato spotted wilt virus in Peppers and Tomato in the Dominican Republic." Plant Disease 98, no. 1 (January 2014): 163. http://dx.doi.org/10.1094/pdis-06-13-0617-pdn.
Full textAbstract:
In the Dominican Republic, green bell pepper (Capsicum annuum L.) and tomato (Solanum lycopersicum L.) are widely cultivated under protected greenhouse conditions as high value commercial crops for export. For the past 2 to 3 years, pepper and tomato have been observed in protected crop facilities in Jarabacoa and Constanza in the North Region with chlorotic and necrotic spots and rings on leaves, petioles, and stems, leaf bronzing, and tip necrosis. Fruits on symptomatic pepper and tomato plants showed concentric rings, irregular chlorotic blotches and deformation, and uneven maturation and development. Incidence on pepper and tomato was 20 to 100% and 5 to 20%, respectively. In initial tests, leaves and fruits from each of 20 symptomatic tomato and pepper plants from several greenhouse facilities were reactive in Tomato spotted wilt virus (TSWV; genus Tospovirus, family Bunyaviridae) immunostrip assays (Agdia, Inc., Elkhart, IN). Since these immunostrips are known to react with other tospoviruses, such as Tomato chlorotic spot virus (TCSV) and Groundnut ring spot virus, additional molecular diagnostic assays were conducted. Leaf and fruit samples from symptomatic plants were imprinted on nitrocellulose membrane (NCM) (2), air-dried, and sent to Washington State University for confirmatory tests. Viral nucleic acids were eluted from NCM discs (1) and subjected to reverse transcription (RT)-PCR using primers gL3637 (CCTTTAACAGTDGAAACAT) and gL4435 (CATDGCRCAAGARTGRTARACAGA) designed to amplify a portion of the L RNA segment of several tospoviruses (3). A single DNA product of ~800 bp was amplified from all samples. Amplicons from two tomato (leaf and fruit) and one pepper fruit samples were cloned separately into pCR2.1 (Invitrogen Corp., Carlsbad, CA). Two independent clones per amplicon were sequenced in both orientations. Sequence analyses of these clones (GenBank Accession Nos. KF 219673 to 75) showed 100% nucleotide sequence identity among themselves and 97% identity with corresponding L RNA sequences of pepper isolates of TSWV from Taiwan (HM180088) and South Korea (HM581940), 94 to 95% with tomato isolates of TSWV from South Korea (HM581934) and Hawaii (AY070218), and 89% with a tomato isolate from Indonesia (FJ177301). These results further confirm the presence of TSWV in symptomatic tomato and pepper plants. A comparison of TSWV sequences from the Dominican Republic with TSWV isolates from the United States and other countries in the Caribbean region could not be made due to the absence of corresponding sequences of the L-RNA of the virus from these countries in GenBank. TSWV-positive samples were negative for TCSV in RT-PCR, indicating the absence of this tospovirus that has been reported in the Caribbean region (data not shown). To our knowledge, this is the first confirmed report of TSWV in tomatoes and peppers in the Dominican Republic. The presence of vector thrips, Frankliniella occidentalis, on symptomatic plants was also confirmed, suggesting a role in the spread of TSWV under greenhouse conditions. Recent surveys identified some greenhouses with 100% symptomatic peppers. The presence of TSWV in tomato and pepper has important implications for the domestic and export vegetable industry in the Dominican Republic because of the broad host range of the virus (4). It is critical for commercial producers to monitor TSWV and deploy appropriate management strategies to limit virus spread. References: (1) O. J. Alabi et al. J. Virol. Methods 154:111, 2008. (2) P.-G. S. Chang et al. J. Virol. Methods 171:345, 2011. (3) F. H. Chu et al. Phytopathology 91:361, 2001. (4) G. Parrella et al. J. Plant Pathol. 85:227, 2003.
28
BECKER, STAN, and SANTOSH C. SUTRADHAR. "FERTILITY INTENTIONS: ARE THE UNDECIDED MORE LIKE THOSE WHO WANT MORE OR WANT NO MORE CHILDREN?" Journal of Biosocial Science 39, no. 1 (March 28, 2006): 137–45. http://dx.doi.org/10.1017/s0021932006001283.
Full textAbstract:
In fertility surveys often women (and sometimes men) are asked their fertility desires, i.e. whether they want a/nother birth or not. Some respond that they are undecided. This study examines whether these persons are more like those who say they want more births or like those who say they want no more births. Data on married men and women in 29 Demographic and Health Surveys with sample sizes ranging from 300 to 3000 are used. A logistic regression equation is estimated within each country for those with known desires and then used to classify each person who was undecided. In all sub-Saharan African countries (n=20) and for both sexes, 50% or more of the undecided persons are classified as wanting more children (with one exception of wives in Kenya). By contrast in all five Latin American countries for both sexes less than 50% of the undecided were classified in the ‘want more’ group (with an exception of husbands in the Dominican Republic). Generally, the undecided tend to be classified the same as the majority among those in the survey with stated desires.
29
McLennan, John D. "Changes in caesarean section rates and milk feeding patterns of infants between 1986 and 2013 in the Dominican Republic." Public Health Nutrition 19, no. 15 (April 18, 2016): 2688–97. http://dx.doi.org/10.1017/s1368980016000847.
Full textAbstract:
AbstractObjectiveThe relationship between caesarean sections (C-sections) and infant feeding varies between different samples and indicators of feeding. The current study aimed to determine the relationship between C-sections and five indicators of infant milk feeding (breast-feeding within 1 h after delivery, at the time of the survey (current) and ever; milk-based prelacteal feeds; and current non-breast milk use) over time in a country with a rapidly rising C-section rate.DesignSecondary data analysis on cross-sectional data from Demographic and Health Surveys from six different time points between 1986 and 2013.SettingDominican Republic.SubjectsInfants under 6 months of age.ResultsOver 90 % of infants were ever breast-fed in each survey sample. However, non-breast milk use has expanded over time with a concomitant drop in predominant breast-feeding. C-section prevalence has increased over time reaching 63 % of sampled infants in the most recent survey. C-sections remained significantly related to three infant feeding practices – the child not put to the breast within 1 h after delivery, milk-based prelacteal feeds and current non-breast milk use – in multivariate models that included sociodemographic control variables. However, current non-breast milk use was no longer related to C-sections when milk-based prelacteal feeds were factored into the model.ConclusionsReducing or avoiding milk-based prelacteal feeds, particularly among those having C-sections, may improve subsequent breast-feeding patterns. Simultaneously, efforts are needed to understand and help reduce the exceptionally high C-section rate in the Dominican Republic.
30
Sibrian, Ricardo, Marco d’Errico, Patricia Palma de Fulladolsa, and Flavia Benedetti-Michelangeli. "Household Resilience to Food and Nutrition Insecurity in Central America and the Caribbean." Sustainability 13, no. 16 (August 13, 2021): 9086. http://dx.doi.org/10.3390/su13169086.
Full textAbstract:
Latin American and Caribbean countries, affected mainly by extreme climatic events, are heterogeneous in farming practices and the relevance of critical determinants of resilience. This paper fills the knowledge gap and informs on the application of the Resilience Index Measurement and Analysis version II (RIMA-II) for Resilience on Food and Nutrition Security (RFNS) indicators in five vulnerable countries in Central America and the Caribbean: Costa Rica, El Salvador, Guatemala, Honduras, and the Dominican Republic. Already-collected information on food consumption and social and economic dimensions, depicting key determinants or “pillars” as defined by RIMA-II methodology, is the basis for developing several models on RFNS. These findings are baselines for subnational territories and country-specific inputs for monitoring and enhancing Food and Nutrition Security (FNS) indicators. This paper fills three critical gaps in the literature on resilience. It presents cross-country data-driven evidence, highlighting consistencies and discrepancies by analyzing data on otherwise unexplored Latin American and Caribbean countries. It suggests the country-specific approach of resilience measurement for heterogeneous contexts. In addition, it provides policy indications to support the role of farm diversification in promoting household resilience.
31
Rosing, Howard. "Ataca el ácido úrico. Nutritional beliefs, imported pinto bean sales and the political economy of domestic bean avoidance in the Dominican Republic." Appetite 56, no. 2 (April 2011): 542. http://dx.doi.org/10.1016/j.appet.2010.11.252.
Full text
32
Fuster, Melissa. "Comparative analysis of dietary guidelines in the Spanish-Speaking Caribbean." Public Health Nutrition 19, no. 4 (July 10, 2015): 607–15. http://dx.doi.org/10.1017/s1368980015002153.
Full textAbstract:
AbstractObjectiveDietary guidelines are important education and policy tools to address local nutrition concerns. The current paper presents a comparative analysis of nutrition messages from three Spanish-speaking Caribbean countries (Cuba, Puerto Rico and Dominican Republic) to explore how these dietary guidelines address common public health nutrition concerns, contextualized in different changing food environments and food culture similarities.DesignQualitative, comparative analysis of current dietary guideline documents and key recommendations.ResultsKey recommendations were categorized into sixteen themes (two diet-based, ten food-based and four ‘other’). Only the Cuban dietary guidelines included diet-based key recommendations. Of the ten food-based key recommendations, only four themes overlapped across the three dietary guidelines (the encouragement of fruits and vegetables, addressing protein sources and fat). Other overlaps were found between dietary guideline pairs, except between Cuba and Puerto Rico. Further analysis revealed differences in levels of specificity and acknowledgement of local dietary patterns and issues, as well as the need to revise the guidelines to account for current scientific advances.ConclusionsThe present study underscored the importance of context in the framing of dietary advice and the influence of national socio-economic and political situations on nutrition policy and education efforts. The results contribute to inform efforts to improve nutrition communication in the region and among migrant communities.
33
Galal, Osman M. "The nutrition transition in Egypt: obesity, undernutrition and the food consumption context." Public Health Nutrition 5, no. 1a (February 2002): 141–48. http://dx.doi.org/10.1079/phn2001286.
Full textAbstract:
AbstractObjectives:To describe changing food consumption patterns in Egypt over the last several decades, current levels of overweight and obesity, and current data on obesity-related morbidity.Design:Secondary analysis and synthesis of existing data from national-level food consumption surveys, large recent surveys of hypertension and diabetes, and documentation of historical and policy context.Setting:Arab Republic of Egypt.Subjects:As selected and described in primary data sources.Results and conclusions: The nutrition transition in Egypt has occured in the context of abundant dietary energy availability, urbanisation and moderate fat intakes. The prevalence of obesity in adults is very high, particularly among women. The prevalences of diabetes mellitus and of hypertension parallel that of obesity, and both are very high. Little information is available on physical activity, but it is likely that a large proportion of the population is quite sedentary, particularly in the cities. At the same time, rates of early childhood malnutrition remain stubbornly stable and relatively high. Public awareness of the increasing prevalence of obesity and of diet-related chronic disease is increasing, and attention has turned to documenting the problem(s).
34
Marquez, Neal, and Jon Wakefield. "Harmonizing child mortality data at disparate geographic levels." Statistical Methods in Medical Research 30, no. 5 (February 1, 2021): 1187–210. http://dx.doi.org/10.1177/0962280220988742.
Full textAbstract:
There is an increasing focus on reducing inequalities in health outcomes in developing countries. Subnational variation is of particular interest, with geographically-indexed data being used to understand the spatial risk of detrimental outcomes and to identify who is at greatest risk. While some health surveys provide observations with associated geographic coordinates (point data), many others provide data that have their locations masked and instead only report the strata (polygon information) within which the data resides (masked data). How to harmonize these data sources for spatial analysis has been previously considered although only ad hoc methods and comparison of methods is lacking. In this paper, we present a new method for analyzing masked survey data, using a method that is consistent with the data-generating process. In addition, we critique two previously proposed approaches to analyzing masked data and illustrate that they are fundamentally flawed methodologically. To validate our method, we compare our approach with previously formulated solutions in several realistic simulation environments in which the underlying structure of the risk field is known. We simulate samples from spatiotemporal fields in a way that mimics the sampling frame implemented in the most common health surveys in low- and middle-income countries, the Demographic and Health Surveys and Multiple Indicator Cluster Surveys. In simulations, the newly proposed approach outperforms previously proposed approaches in terms of minimizing error while increasing the precision of estimates. The approaches are subsequently compared using child mortality data from the Dominican Republic where our findings are reinforced. The ability to accurately increase precision of child mortality estimates, and health outcomes in general, by leveraging various types of data, improves our ability to implement precision public health initiatives and better understand the landscape of geographic health inequalities.
35
Costa e Silva, Vera Luiza da, and Sergio Koifman. "Smoking in Latin America: a major public health problem." Cadernos de Saúde Pública 14, suppl 3 (1998): S109—S115. http://dx.doi.org/10.1590/s0102-311x1998000700010.
Full textAbstract:
Smoking has become a major public health problem in Latin America, and its scope varies from country to country. Despite difficulties in obtaining methodologically consistent data for the region, we analyzed the results from prevalence surveys in 14 Latin American countries. Smoking prevalence among men varied from 24.1% (Paraguay) to 66.3% (Dominican Republic) and among women from 5.5% (Paraguay) to 26,6% (Uruguay). By applying point prevalence data to the stage model of the tobacco epidemic in developed countries, we concluded that the Latin American countries are in stage 2, i.e., with a clearly rising prevalence among men, a prevalence for women that is beginning to increase, and mortality attributable to smoking among men still not reflecting peak prevalence. None of the countries analyzed appeared to have reached stage 3, in which one observes a downward trend in prevalence of smoking among men and peak prevalence among women, with broad impact on tobacco-related mortality. The only exception appears to be Paraguay, which is still emerging from stage 1, i.e., with low prevalence rates among men, too. Nevertheless, high lung cancer mortality rates in Uruguay and Argentina are comparable to those of the developed countries.
36
LEITE, IÚRI DA COSTA, NEERU GUPTA, and ROBERTO DO NASCIMENTO RODRIGUES. "FEMALE STERILIZATION IN LATIN AMERICA: CROSS-NATIONAL PERSPECTIVES." Journal of Biosocial Science 36, no. 6 (October 1, 2004): 683–98. http://dx.doi.org/10.1017/s0021932003006369.
Full textAbstract:
Fertility levels have dropped substantially in Latin America in recent decades, fuelled by increased contraceptive use and notably a method mix skewed towards female sterilization. This study examined choice of female sterilization in four Latin American countries: Brazil, Colombia, the Dominican Republic and Peru. Data were drawn from national Demographic and Health Surveys conducted in 1995–1996. Discrete-time hazard models were used on the five-year calendar modules of women’s reproductive histories to consider the effects of a number of sociodemographic and contextual determinants as they pertained to status at the moment of the event. The results revealed that the likelihood of a woman’s having undergone contraceptive sterilization was increasing over time in Brazil and Peru, suggesting that the potential for future growth of this method remains strong. A consistent pattern of increased probability of sterilization with higher education was seen across all countries, seemingly dispelling certain controversial claims that the procedure may have been disproportionately performed on the poor. At the same time, the multilevel analytical approach pointed to significant cluster-level random effects, suggesting that there were additional unmeasured contextual influences on women’s propensity to choose sterilization.
37
Ferri, Cleusa P., and Martin Prince. "10/66 Dementia Research Group: recently published survey data for seven Latin America sites." International Psychogeriatrics 22, no. 1 (September 7, 2009): 158–59. http://dx.doi.org/10.1017/s1041610209990901.
Full textAbstract:
We read with great interest the review by Nitrini et al. on the prevalence of dementia in Latin America recently published in International Psychogeriatrics (Nitrini et al., 2009). Accurate up-to-date figures are essential for policy-making and planning, therefore the review is very welcome. With unfortunate timing, the 10/66 Dementia Research Group's population-based surveys on the prevalence of dementia were published in the Lancet (Llibre Rodriguez et al., 2008a; 2008b) shortly after this review was submitted to International Psychogeriatrics. The 10/66 surveys included seven sites in five Latin American countries: Peru, Cuba, Dominican Republic, Mexico and Venezuela. The studies were all one-phase catchment area surveys, with samples of 2944 in Cuba and between 1904 and 2011 in other countries, giving a total sample size of 10,794. We present in Table 1 the prevalence of dementia according to our cross-culturally validated 10/66 diagnosis and according to DSM-IV criteria, in each of the Latin American sites, using the same age group stratification as per Nitrini's review. We also present the pooled estimates for each age group. The 10/66 estimates are in general more homogenous than those presented in the review, but similar to the overall pooled estimate. DSM-IV prevalence is lower. We have attributed this discrepancy to an under-reporting of cognitive decline and social/occupational impairment by relatives, particularly in rural and least developed regions (Llibre Rodriguez et al., 2008b). We have shown that, at least for Cuba, the 10/66 Dementia Diagnosis agreed better than the DSM-IV with a clinician gold standard diagnosis, as a high proportion of Clinical Dementia Rating mild and moderate cases were missed by DSM-IV (Prince et al., 2008).
38
Marques-Vidal, Pedro, Peter Vollenweider, Gérard Waeber, and Fred Paccaud. "Prevalence of overweight and obesity among migrants in Switzerland: association with country of origin." Public Health Nutrition 14, no. 7 (February 22, 2011): 1148–56. http://dx.doi.org/10.1017/s1368980011000103.
Full textAbstract:
AbstractObjectiveMigrants tend to present higher overweight and obesity levels, but whether this relationship applies to all nationalities has seldom been studied. The present study aimed to assess the prevalence of overweight and obesity according to nationality in adults.DesignCross-sectional population-based samples.SettingFive-year nationwide interview surveys (Swiss Health Surveys – SHS) from 1992 to 2007 (n 63 766) and a local examination survey (CoLaus Study in Lausanne 2004–2006, n 6743).SubjectsParticipants were separated into Swiss, French, German, Italian, Portuguese, Spanish nationals, those from the former Republic of Yugoslavia and from other European and other countries.ResultsCompared with Swiss nationals, German and French nationals presented a lower prevalence of overweight and obesity, whereas nationals from Italy, Spain, Portugal and the former Republic of Yugoslavia presented higher levels. Adjusting the SHS data for age, gender, education, smoking, leisure-time physical activity and survey year, a lower risk for overweight and obesity was found for German (OR = 0·80, 95 % CI 0·70, 0·92) and French (OR = 0·74, 95 % CI 0·61, 0·89) nationals, whereas higher risks were found for participants from Italy (OR = 1·45, 95 % CI 1·33, 1·58), Spain (OR = 1·36, 95 % CI 1·15, 1·61), Portugal (OR = 1·25, 95 % CI 1·06, 1·47) and the former Republic of Yugoslavia (OR = 1·98, 95 % CI 1·69, 2·32). Similar findings were observed in the CoLaus Study for Italian (OR = 1·63, 95 % CI 1·29, 2·06), Spanish (OR = 1·54, 95 % CI 1·17, 2·04) and Portuguese (OR = 1·49, 95 % CI 1·16, 1·91) participants and for those from the former Republic of Yugoslavia (OR = 5·34, 95 % CI 3·00, 9·50).ConclusionsOverweight and obesity are unevenly distributed among migrants in Switzerland. Migrants from Southern Europe and from the former Republic of Yugoslavia present higher prevalence rates. This suggests that preventive messages should be tailored to these specific populations.
39
Prina, A. M., C. P. Ferri, M. Guerra, C. Brayne, and M. Prince. "Co-occurrence of anxiety and depression amongst older adults in low- and middle-income countries: findings from the 10/66 study." Psychological Medicine 41, no. 10 (April 5, 2011): 2047–56. http://dx.doi.org/10.1017/s0033291711000444.
Full textAbstract:
BackgroundThere is relative little information about the prevalence and risk factors of co-morbid anxiety and depression in later life. These disorders are often associated with worse response to treatment than either condition alone, and researching their epidemiology in diverse settings is vital to policy makers. We therefore investigated the co-occurrence of anxiety and depressive syndromes amongst older adults living in developing countries and measured the separate and joint effect of these two disorders on levels of associated disability.MethodThe 10/66 study carried out cross-cultural surveys of all residents aged 65 years or over (n=15021) in 11 sites in seven countries (People's Republic of China, India, Cuba, Dominican Republic, Venezuela, Mexico and Peru). Anxiety was measured by using the Geriatric Mental State Examination and the Automated Geriatric Examination for Computer Assisted Taxonomy diagnostic system. Depression was assessed according to International Classification of Diseases 10th revision (ICD-10) and EURO-D criteria. Disability was measured by using the World Health Organization's Disablement Assessment Scale Version II. Zero-inflated negative binomial regression models were used to investigate the association of common mental disorders and disability.ResultsThe prevalence of co-occurring anxiety and depression (with the exclusion of subthreshold disorders) ranged between 0.9% and 4.2% across sites. Gender, socio-economic status, urbanicity and physical co-morbidities were associated with the different co-morbid states. Having both disorders was linked to higher disability scores than having anxiety or depression alone.ConclusionsGiven the close association of co-morbid anxiety and depression with disability, new policies to improve prevention, recognition and treatment will be needed to adapt to ageing populations and their mental health needs.
40
Hess, Sonja Y. "National Risk of Zinc Deficiency as Estimated by National Surveys." Food and Nutrition Bulletin 38, no. 1 (January 25, 2017): 3–17. http://dx.doi.org/10.1177/0379572116689000.
Full textAbstract:
Background: Information is needed on the national prevalence of zinc deficiency to guide program development and evaluation. Objective: To summarize results of national surveys that assessed plasma or serum zinc concentrations (PZC) and compare the prevalence of low PZC with other methods used to estimate countries’ risk of zinc deficiency. Methods: National surveys that included PZC were identified through Internet searches and personal contacts. A survey was eligible if a nationally representative sampling scheme was used, PZC was analyzed, and the survey was implemented in a low- or middle-income country. Twenty surveys were eligible; 19 countries assessed PZC in young children and 14 in women of reproductive age. Results: In 13 of the 19 surveys, the prevalence of low PZC in children was >20%. Only Afghanistan, Azerbaijan, Nigeria, the Republic of Maldives, Sri Lanka, and China found a low prevalence of inadequate PZC among children. Some of these conclusions may be due to the lower than recommended cutoff that was used. Similarly, in 13 of 14 surveys, the prevalence of low PZC in women was >20%. Estimates of percentage population with inadequate dietary zinc intake based on food balance sheets underestimate the risk of zinc deficiency. The national stunting prevalence seems to be a useful proxy, as both indicators categorized countries similarly into high versus low risk of zinc deficiency, with some exceptions. Conclusions: Results from 20 countries suggest that zinc deficiency is a public health concern in the majority of these countries and zinc intervention strategies should be considered.
41
Bhutta, Zulfiqar A., Nadia Akseer, Emily C. Keats, Tyler Vaivada, Shawn Baker, Susan E. Horton, Joanne Katz, et al. "How countries can reduce child stunting at scale: lessons from exemplar countries." American Journal of Clinical Nutrition 112, Supplement_2 (July 21, 2020): 894S—904S. http://dx.doi.org/10.1093/ajcn/nqaa153.
Full textAbstract:
ABSTRACT Background Child stunting and linear growth faltering have declined over the past few decades and several countries have made exemplary progress. Objectives To synthesize findings from mixed methods studies of exemplar countries to provide guidance on how to accelerate reduction in child stunting. Methods We did a qualitative and quantitative synthesis of findings from existing literature and 5 exemplar country studies (Nepal, Ethiopia, Peru, Kyrgyz Republic, Senegal). Methodology included 4 broad research activities: 1) a series of descriptive analyses of cross-sectional data from demographic and health surveys and multiple indicator cluster surveys; 2) multivariable analysis of quantitative drivers of change in linear growth; 3) interviews and focus groups with national experts and community stakeholders and mothers; and 4) a review of policy and program evolution related to nutrition. Results Several countries have dramatically reduced child stunting prevalence, with or without closing geographical, economic, and other population inequalities. Countries made progress through interventions from within and outside the health sector, and despite significant heterogeneity and differences in context, contributions were comparable from health and nutrition sectors (40% of change) and other sectors (50%), previously called nutrition-specific and -sensitive strategies. Improvements in maternal education, maternal nutrition, maternal and newborn care, and reductions in fertility/reduced interpregnancy intervals were strong contributors to change. A roadmap to reducing child stunting at scale includes several steps related to diagnostics, stakeholder consultations, and implementing direct and indirect nutrition interventions related to the health sector and nonhealth sector . Conclusions Our results show that child stunting reduction is possible even in diverse and challenging contexts. We propose that our framework of organizing nutrition interventions as direct/indirect and inside/outside the health sector should be considered when mapping causal pathways of child stunting and planning interventions and strategies to accelerate stunting reduction to achieve the 2030 Sustainable Development Goals.
42
Dibley, Michael J., Upul Senarath, and Kingsley E. Agho. "Infant and young child feeding indicators across nine East and Southeast Asian countries: an analysis of National Survey Data 2000–2005." Public Health Nutrition 13, no. 9 (May 4, 2010): 1296–303. http://dx.doi.org/10.1017/s1368980010000844.
Full textAbstract:
AbstractObjectiveTo compare infant and young child feeding practices in children aged 0–23 months across nine East and Southeast Asian countries.DesignSecondary analyses of cross-sectional data from available Demographic and Health Surveys (DHS; Indonesia, Philippines, Timor-Leste, Cambodia and Vietnam), Multiple Indicator Country Surveys (Lao People's Democratic Republic (Lao PDR) and Myanmar) and national nutrition surveys (Democratic People’s Republic of Korea (DPR Korea) and Mongolia) conducted between 2000 and 2005.SettingSeven countries from Southeast Asia and two from East Asia.SubjectsChildren aged 0–23 months with samples ranging from 826 to 5610 for DHS, and from 477 to 5860 for non-DHS data.ResultsMore than 93 % of infants were ever breast-fed, and over 75 % were currently breast-fed except in the Philippines. Timely initiation of breast-feeding varied from 32 % in Indonesia to 46 % in Timor-Leste. Exclusive breast-feeding (EBF) rate in infants under 6 months of age ranged from 11 % in Myanmar to 60 % in Cambodia. EBF rates were also low in Vietnam (15·5 %) and Lao PDR (23 %), and varied between 30 % and 40 % in Indonesia, Philippines and Timor-Leste. The proportion of infants under 6 months of age who were given breast milk with non-milk liquids was high except in Indonesia and Timor-Leste. Bottle-feeding rates were lower in DPR Korea (3 %), Lao PDR (6 %) and Myanmar (6 %) and higher in the Philippines (49 %) and Mongolia (31 %). Timely complementary-feeding rate varied widely across countries (6–99 %).ConclusionsAll the countries studied should make greater efforts to improve timely initiation of breast-feeding and EBF for 6 months. Measures should be taken to reduce high bottle-feeding rate in the Philippines, Mongolia, Indonesia and Vietnam, and improve complementary-feeding rate in Lao PDR, Myanmar, DPR Korea and Philippines.
43
Prina, A. Matthew, Cleusa P. Ferri, Mariella Guerra, Carol Brayne, and Martin Prince. "Prevalence of anxiety and its correlates among older adults in Latin America, India and China: cross-cultural study." British Journal of Psychiatry 199, no. 6 (December 2011): 485–91. http://dx.doi.org/10.1192/bjp.bp.110.083915.
Full textAbstract:
BackgroundAnxiety is a common mental disorder among older people who live in the Western world, yet little is known about its prevalence in low- and middle-income countries.AimsWe investigated the prevalence of anxiety and its correlates among older adults in low- and middle-income countries with diverse cultures.MethodCross-sectional surveys of all residents aged 65 or over (n = 15 021) in 11 catchment sites in 7 countries (China, India, Cuba, Dominican Republic, Venezuela, Mexico and Peru) were carried out as part of the 10/66 collaboration. Anxiety was measured by using the Geriatric Mental State Examination (GMS) and the Automated Geriatric Examination for Computer Assisted Taxonomy (AGECAT) diagnostic algorithm.ResultsThe age- and gender-standardised prevalence of anxiety varied greatly across sites, ranging from 0.1% (95% CI 0.0–0.3) in rural China to 9.6% (95% CI 6.2–13.1) in urban Peru. Urban centres had higher estimates of anxiety than their rural counterparts with adjusted (age, gender and site) odds ratios of 2.9 (95% CI 1.7–5.3). Age, gender, socioeconomic status and comorbid physical illnesses were all associated with a GMS/AGECAT diagnosis of anxiety, and so was disability (World Health Organization Disability Assessment Schedule II).ConclusionsAnxiety is common in Latin America. Estimates from this region are similar to the ones from high-income European countries found in the literature. As demographic change will occur more rapidly in these countries, further research exploring the mental health of older people in developing areas is vital, with the inclusion of other specific anxiety disorders, along with evidence for strategies for supporting those with these disorders.
44
Sharmanov, Almaz. "Anaemia in Central Asia: Demographic and Health Survey Experience." Food and Nutrition Bulletin 19, no. 4 (January 1998): 307–17. http://dx.doi.org/10.1177/156482659801900405.
Full textAbstract:
Nationally representative anaemia levels among women and children were recently determined in conjunction with the Demographic and Health Surveys in Kazakstan (1995), Uzbekistan (1996), and the Kyrgyz Republic (1997). Anaemia was assessed by measuring the haemoglobin level in capillary blood of women aged 15 to 49 and their children under the age of 3 using the photometric Hemocue technique. The numbers of women tested were 3,658, 4,333, and 3,760 in Kazakstan, Uzbekistan, and the Kyrgyz Republic, respectively. All three Central Asian republics had a high prevalence of anaemia. The highest overall rates were in the regions of Kazakstan and Uzbekistan near the Aral Sea, which are characterized by severe agrochemical pollution and other environmental and socio-economic problems. Approximately half (49%) of the women in Kazakstan, 60% of the women in Uzbekistan, and 40% of the women in the Kyrgyz Republic suffered from some degree of anaemia. Mild anaemia (haemoglobin level, 10.0–11.9 g/dl; 10.0–10.9 g/dl for pregnant women) was diagnosed in 37%, 45%, and 28% of the women in Kazakstan, Uzbekistan, and the Kyrgyz Republic, respectively. Eleven percent of the women in Kazakstan, 14% in Uzbekistan, and 9% in the Kyrgyz Republic had moderate anaemia (haemoglobin level 7.0–9.9 g/dl). Severe anaemia (haemoglobin level less than 7.0 g/dl) was found among 1% of the women in all three Central Asian republics. In Kazakstan, 69% of the children under the age of three suffered from some degree of anaemia. About the same number of children had mild (30%) and moderate (34%) anaemia. A smaller, but substantial, proportion of children (5%) were severely anaemic. In Uzbekistan and the Kyrgyz Republic, 61% and 50% of children, respectively, suffered from anaemia. The percentages of children with mild, moderate, and severe anaemia were 34%, 26%, and 1%, respectively, for Uzbekistan, and 24%, 24%, and 1%, respectively, for the Kyrgyz Republic. There is sufficient evidence to suggest that negative iron balance is probably a major cause of anaemia among both women and children in Central Asia. Our findings provide important information for the development of health intervention programmes to prevent iron-deficiency anaemia among women of certain ethnic, educational, and residential groups in this region. Based on the results of the Demographic and Health Survey as well as other geographically focused studies, the UNICEF Area Office for the Central Asian Republics and Kazakstan proposed an integrated strategy of education, supplementation, fortification, and research to address the problem and called for donors' support. It is expected that this approach can considerably improve maternal and child health in Central Asia.
45
Honyashiki, Mina, Cleusa P. Ferri, Daisy Acosta, Mariella Guerra, Yueqin Huang, K. S. Jacob, Juan J. Llibre-Rodrigues, et al. "Chronic diseases among older people and co-resident psychological morbidity: a 10/66 Dementia Research Group population-based survey." International Psychogeriatrics 23, no. 9 (April 4, 2011): 1489–501. http://dx.doi.org/10.1017/s1041610211000500.
Full textAbstract:
ABSTRACTBackground: This is the first study to investigate the associations between chronic health conditions of older people and their impact on co-resident psychological morbidity using population-based samples in low and middle income countries (LAMICs).Methods: Single-phase cross-sectional catchment area surveys were undertaken in urban sites in Cuba, Dominican Republic and Venezuela, and in rural and urban catchment areas in Mexico, Peru, India and China. All residents aged 65 years and over were interviewed with a co-resident key informant. Exposures were structured clinical diagnoses (10/66 and DSM-IV dementia and ICD-10 depression), self-reported diagnosis (stroke) and physical impairments. Mediating variables were dependence and disability (WHODAS 2.0), and the outcome was co-resident psychological morbidity assessed using SRQ-20.Results: Poisson regression analysis was used to estimate the prevalence ratios (PRs) for the associations between health conditions and psychological morbidity in each site, and meta-analysis was used to pool the estimates. 11,988 pairs comprising a participant and a co-resident informant were included in the analysis. After meta-analysis, independent effects were noted for depression (PR2.11; 95% CI 1.82–2.45), dementia (PR 1.98; 95% CI 1.72–2.28), stroke (PR 1.42; 95% CI 1.17–1.71) and physical impairments (PR 1.17; 95% CI 1.13–1.21). The effects were partly mediated through disability and dependence. The mean population attributable fraction of total chronic conditions was 30.1%.Conclusion: The prevalence of co-resident psychological morbidity is higher among co-residents of older people with chronic conditions. This effect was prominent for, but not confined to, depression and dementia. Attention needs to be directed to chronic conditions.
46
Rosenthal, Jorge, Jessica Casas, Douglas Taren, Clinton J. Alverson, Alina Flores, and Jaime Frias. "Neural tube defects in Latin America and the impact of fortification: a literature review." Public Health Nutrition 17, no. 3 (March 6, 2013): 537–50. http://dx.doi.org/10.1017/s1368980013000256.
Full textAbstract:
AbstractObjectiveData on the prevalence of birth defects and neural tube defects (NTD) in Latin America are limited. The present review summarizes NTD prevalence and time trends in Latin American countries and compares pre- and post-fortification periods to assess the impact of folic acid fortification in these countries.DesignWe carried out a literature review of studies and institutional reports published between 1990 and 2010 that contained information on NTD prevalence in Latin America.ResultsNTD prevalence in Latin American countries varied from 0·2 to 9·6 per 1000 live births and was influenced by methods of ascertainment. Time trends from Bogota, Costa Rica, Dominican Republic, Guatemala City, Mexico and Puerto Rico showed average annual declines of 2·5 % to 21·8 %. Pre- and post-fortification comparisons were available for Argentina, Brazil, Chile, Costa Rica, Puerto Rico and Mexico. The aggregate percentage decline in NTD prevalence ranged from 33 % to 59 %.ConclusionsThe present publication is the first to review data on time trends and the impact of folic acid fortification on NTD prevalence in Latin America. Reported NTD prevalence varied markedly by geographic region and in some areas of Latin America was among the lowest in the world, while in other areas it was among the highest. For countries with available information, time trends showed significant declines in NTD prevalence and these declines were greater in countries where folic acid fortification of staples reached the majority of the population at risk, such as Chile and Costa Rica.
47
Woodruff, Bradley A., James P. Wirth, Ismael Ngnie-Teta, Jean Max Beaulière, Daffe Mamady, Mohamed Ag Ayoya, and Fabian Rohner. "Determinants of Stunting, Wasting, and Anemia in Guinean Preschool-Age Children: An Analysis of DHS Data From 1999, 2005, and 2012." Food and Nutrition Bulletin 39, no. 1 (January 30, 2018): 39–53. http://dx.doi.org/10.1177/0379572117743004.
Full textAbstract:
Wasting, stunting, and anemia are persistent and important forms of malnutrition in preschool-age children in the less developed world, in particular the Republic of Guinea, which was the site of a large outbreak of Ebola virus disease in 2014 to 2015. We analyzed data from 3 Demographic and Health Surveys done in Guinea in 1999, 2005, and 2012 to identify possible determinants of wasting, stunting, and anemia. All analyses, both bivariate and multivariate, were carried out separately for each of 3 age groups: less than 6 months, 6 to 23 months, and 24 to 59 months. Variables found statistically significantly associated with stunting, wasting, or anemia in bivariate analysis were placed in an age-specific logistic regression model for that outcome. Overall, anthropometric indices were available for 9228 children and hemoglobin concentrations were available for 5681 children. Logistic regression found relatively few variables associated with nutrition outcomes in children younger than 6 months. More variables were associated with nutrition outcomes in children aged 6 to 23 months. Such variables measured a wide variety of conditions, including estimated birth size, child health and nutritional status, child caring practices, mother’s nutritional and health status, and household water source and sanitation. A similarly broad range of variables was statistically significantly associated with one or more nutrition outcomes in children aged 24 to 59 months. Few of the standard infant and young child feeding indicators were associated with any nutrition outcome. Improvement in the nutritional status of young children in Guinea may require a broad range of nutrition and health interventions.
48
Sheehy, Tony, and Sangita Sharma. "The nutrition transition in the Republic of Ireland: trends in energy and nutrient supply from 1961 to 2007 using Food and Agriculture Organization food balance sheets." British Journal of Nutrition 106, no. 7 (April 12, 2011): 1078–89. http://dx.doi.org/10.1017/s0007114511001395.
Full textAbstract:
Over the course of the last 50 years the Republic of Ireland has gone from being one of the poorest countries in Europe to one of the richest; however, it is now experiencing increasing rates of obesity and non-communicable chronic disease. Although several national nutrition surveys have been carried out in Ireland since 1990, there is little information on the Irish diet before then. We analysed the FAO food balance sheets for Ireland from 1961 to 2007 in order to characterise the changes in energy and nutrient supply that took place during that period. Food balance sheets were downloaded from the FAOSTAT database and per capita supply of commodities was analysed using dietary analysis software. Energy from carbohydrate as a percentage of total energy fell from 55 % in 1961 to 46 % in 2007, whereas energy from fat increased from 29 % to 34 %; these values are well outside WHO recommendations for the prevention of chronic disease. Energy from alcohol as a percentage of total energy has doubled within the last 20 years. On a nutrient-density basis, vitamins and minerals met or exceeded WHO recommendations, apart from vitamin D, folate, Ca and Fe. Although there are methodological limitations associated with the use of food balance sheets, the present results demonstrate that the current imbalances in the Irish diet were already evident several decades ago. Because they are so long established, they will be difficult to reverse unless major public health nutrition interventions are implemented.
49
Novotný, R., D. Černý, and V. Šrámek. "Nutrition of silver fir (Abies alba Mill) growing at the upper limit of its occurrence in the Šumava National Park and Protected Landscape Area." Journal of Forest Science 56, No. 9 (September 30, 2010): 381–88. http://dx.doi.org/10.17221/87/2009-jfs.
Full textAbstract:
In the second half of 20<sup>th</sup> century silver fir regeneration has been observed throughout all of the Europe, including the Czech Republic. The Bohemian Forest – Šumava Mts. is one of the regions where the silver fir percentage in forest stands is supposed to be increased from the present 2% to nearly 12%. During the period 2006–2007, in the Czech part of the Bohemian Forest, samples of silver fir were taken mainly in the upper altitudinal limit of silver fir occurrence. In the present paper the results of performed analyses are compared with similar surveys conducted in the other European regions. Samples from the Bohemian Forest, in contrast to other results, differ in higher phosphorus content and lower contents of calcium and manganese. Nitrogen content is slightly higher. Our values for the other elements (magnesium, potassium, zinc, sulphur) are comparable to those reported in Poland and Slovakia. In Germany, aside from the above mentioned differences, higher magnesium content was also found within the locality sampled.
50
Ismuratov, Sabit, Aida Dukeyeva, Saniya Abiltaevna Tulkubayeva, and Yuriy Valerievich Tulayev. "Field interpretation of earth remote sensing data and ground field surveys in the Republic of Kazakhstan, Kostanay region in the pre-sowing season." E3S Web of Conferences 176 (2020): 04001. http://dx.doi.org/10.1051/e3sconf/202017604001.
Full textAbstract:
The aim of the research is to carry out field and office work on conducting a sub-satellite survey on test sites of the Kostanay region of the Republic of Kazakhstan. Grain-sowing districts of the Kostanay region were selected as the objects of examination: Karabalyk, Fedorov, Mendykara, Uzunkol, Sarykol, Altynsarin, Kostanay, Denisov, Karasu, Taranov, Zhitikara, Auliekol, Kamysty, Naurzum. The determination of the reserves of productive soil moisture in the 0-100 cm layer by control points (100 points) carried out in the pre-sowing season of 2019 showed that the soils are characterized by satisfactory and, for the most part, insufficient moisture. The fields fixed in the coordinate system were evaluated by five indicators - pH, humus, nitrate nitrogen (N-NO3), mobile phosphorus (P2O5), and exchange potassium (K2O). Most of the soils examined had a soil solution reaction that was neutral or close to neutral. In terms of humus content, soils of the Karabalyk, Fedorov, Uzunkol and Sarykol districts had an average degree of availability, which exceeded the indicators of other districts of the Kostanai region and depended on the type of soil. The content of the basic elements of plant nutrition - nitrogen and phosphorus - varied within various limits, and, to a large extent, was determined by the previous culture, tillage, fertilizer application, and climatic conditions of the year. The level of exchangeable potassium in the soils of the examined districts of the Kostanay region was characterized as elevated or very high.