Log in

Relevant bibliographies by topics / ODNO / Journal articles

To see the other types of publications on this topic, follow the link: ODNO.

Journal articles on the topic 'ODNO'

Author: Grafiati

Published: 5 June 2025

Last updated: 2 August 2025

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic 'ODNO.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Шереметьева Елена, Сергеевна, та Лина Сюй. "ТЕКСТОВАЯ СКРЕПА ОДНО ДЕЛО ‒ ДРУГОЕ ДЕЛО: ОСОБЕННОСТИ ФУНКЦИОНИРОВАНИЯ В ПРЕДЛОЖЕНИИ И В ТЕКСТЕ". Дальневосточный филологический журнал, № 4 (26 грудня 2023): 9–16. http://dx.doi.org/10.24866/2949-2580/2023-4/9-16.

Full text

Abstract:

The article presents the results of the study of the textual connector odno delo ‒ drugoe delo serving as a means of communication both in a sentence and in a text. It is stated that the connector has a significant number of contextual modifications of the structure, but all varieties have the same semantics and common functions. The textual connector odno delo ‒ drugoe delo possesses a structure similar to two-place conjunctions and forms comparative relations within a sentence or text. In addition, as a textual means of connection, it introduces a text fragment justifying the reason or revea

APA, Harvard, Vancouver, ISO, and other styles

2

Esaulenko, D. I., Roman Viktorovich Rozhivanov, and Svetlana Yur'evna Kalinchenko. "Erektil'naya disfunktsiya kak odno iz proyavleniy dekompensatsii sakharnogo diabeta." Diabetes mellitus 8, no. 1 (2005): 32–33. http://dx.doi.org/10.14341/2072-0351-5438.

Full text

APA, Harvard, Vancouver, ISO, and other styles

3

Križić, Ivan. "RIMSKO-GOTSKI FOEDUS U IZVORIMA 3. I 4. STOLJEĆA." Historijska misao 9, no. 9 (2024): 13–46. https://doi.org/10.51558/2303-8543.2023.9.9.13.

Full text

Abstract:

Ovaj rad istražuje složen odnos iz- među Rimskog carstva i gotskog naroda od 238. do 382. godine. Analizom primarnih izvora kao što su Amijan Marcelin, Jordanes, Zo- sim, Prokopije i drugi, u radu se namjerava preispitati da li je pre- cizno ove sporazume nazvati fo- edus u klasičnom značenju te ri- ječi, s obzirom na njihove posebne karakteristike i historijski kon- tekst. Istraživanje naglašava raz- vojnu dinamiku moći između Rim- skog carstva i Gota, njihovih vojnih saveza, pregovora, identiteta i međusobne zavisnosti, kao i uloge Rimskog carstva i gotskih zajed- nica u ovom periodu. U kona

APA, Harvard, Vancouver, ISO, and other styles

4

Li, Dongmei, Idalia Cruz, Sharareh Sorkhabi, Patricia L. Foley, Julie Wagner, and Joseph A. Bellanti. "Dose-response studies of methylated and nonmethylated CpG ODNs from Bifidobacterium longum subsp. infantis for optimizing Treg cell stimulation." Allergy and Asthma Proceedings 46, no. 2 (2025): 98–104. https://doi.org/10.2500/aap.2025.46.250001.

Full text

Abstract:

Background: Allergen immunotherapy (AIT) is the most effective treatment for atopic allergic diseases, aiming to induce regulatory T cells (Treg) that modify the immune response to specific allergens, which leads to long-term tolerance and reduced symptoms. Enhancing Treg activity is crucial for improving immunotherapy outcomes. In a previous murine model study, we examined the effects of a synthetic methylated DNA oligodeoxynucleotide (ODN) from the Bl-T2 m5C motif of Bifidobacterium longum subsp. infantis. The ODN that contains the methylated BI-T2 m5C motif (methylated ODNA) sequence conjug

APA, Harvard, Vancouver, ISO, and other styles

5

Shcherbakov, Ivan A. "Solid state lasers: a major area of quantum electronics." Uspekhi Fizicheskih Nauk 174, no. 10 (2004): 1120. http://dx.doi.org/10.3367/ufnr.0174.200410i.1120.

Full text

APA, Harvard, Vancouver, ISO, and other styles

6

Selezneva, Elena Valentinovna, Elvira Valerevna Berdunova, Nadezhda Zhabarovna Medvedeva, and Natalia Aleksandrovna Barinova. "Teatral'no-igrovaia tekhnologiia v obrazovatel'nom protsesse DOU kak odno iz uslovii sotsializatsii doshkol'nikov." Interactive science, no. 5 (70) (May 28, 2022): 28–29. http://dx.doi.org/10.21661/r-556665.

Full text

APA, Harvard, Vancouver, ISO, and other styles

7

Kogan, M. I., V. V. Mitusov, R. I. Ametov, and S. V. Naranov. "Otdalennye rezul'taty odno- i mnogoetapnoy uretroplastiki bukkal'nym transplantatom pri spongioznykh strikturakh uretry dlinnee 5 sm." Urologicheskie vedomosti 5, no. 1 (2015): 59. http://dx.doi.org/10.17816/uroved5159-59.

Full text

APA, Harvard, Vancouver, ISO, and other styles

8

Dostović, Nihad. "PALANKA U TUZLANSKOM SIDŽILU 1644–1646. GODINE." Historijska misao 10, no. 10 (2024): 47–63. https://doi.org/10.51558/2303-8543.2024.10.10.47.

Full text

Abstract:

U ovom radu analizira se pet do- kumenata iz Sidžila tuzlanskog kadije 1644–1646. godine u ko- jima se spominje izraz palanka. Svih pet dokumenata su ferma- ni, odnosno zapovijesti poslane u sultanovo ime s Budimskog di- vana. Dva fermana bave se džer- ahorima – građevinskim radnici- ma iz reda povlaštene raje koji su radili na popravkama tvrđava. Dva fermana su o uzurpaciji službe čitanja/učenja molitvi za sultana – du’āgūluḳ. Jedan ferman se odno- si na lutalačke grupe Cigana, da nas Roma. U svim dokumentima palanka je uopšten termin; ni jed- no mjesto se ne spominje direktno kao palanka, ni

APA, Harvard, Vancouver, ISO, and other styles

9

Li, Dongmei, Sharareh Sorkhabi, Idalia Cruz, Patricia L. Foley, and Joseph A. Bellanti. "Studies of methylated CpG ODN from Bifidobacterium longum subsp. infantis in a murine model: Implications for treatment of human allergic disease." Allergy and Asthma Proceedings 46, no. 1 (2025): e13-e23. https://doi.org/10.2500/aap.2025.46.240100.

Full text

Abstract:

Background: Allergen immunotherapy (AIT) is currently the most effective immunologic form of treatment for patients with atopic allergic diseases commonly used by allergist/immunologists to reduce allergic symptoms by gradually desensitizing the immune system to specific allergens. Currently, the primary mechanism of AIT emphasizes the crucial role of immune regulation, which involves a shift from a T-helper type 2 (Th2) cell response, which promotes allergy, to a T-regulatory (Treg) cell population, which inhibits the allergic inflammatory response through the production of immunosuppressive

APA, Harvard, Vancouver, ISO, and other styles

10

Zhao, Dandan, Anh Thi Tram Tu, Miwako Shobo та ін. "Non-Modified CpG Oligodeoxynucleotide Forming Guanine-Quadruplex Structure Complexes with ε-Poly-L-Lysine Induce Antibody Production as Vaccine Adjuvants". Biomolecules 12, № 12 (2022): 1868. http://dx.doi.org/10.3390/biom12121868.

Full text

Abstract:

Unmethylated cytosine-phosphate-guanosine oligodeoxynucleotides (CpG ODNs) induce inflammatory cytokines and type I interferons (IFNs) to activate the immune system. To apply CpG ODNs as vaccine adjuvants, the cellular uptake and stability of phosphodiester-based, non-modified ODNs require further improvement. Previously developed new CpG ODNs forming guanine-quadruplex (G4) structures showed higher nuclease resistance and cellular uptake than linear CpG ODNs; however, the complex formation of G4-CpG ODNs with antigen proteins is necessary for their application as vaccine adjuvants. In this st

APA, Harvard, Vancouver, ISO, and other styles

11

Guang-Fu, Li, Zhu Hong-Fei, Shao Guo-Qing, Zhu Jian-Zhong, Ma Yan-Qing, and Zhang Zhao-Song. "Heterogeneity in the response of pigs and mice to specific CpG oligodeoxynucleotides." Chinese Journal of Agricultural Biotechnology 1, no. 2 (2004): 109–14. http://dx.doi.org/10.1079/cjb200422.

Full text

Abstract:

AbstractDifferences in immunostimulation activity of CpG oligodeoxynucleotides (ODNs) between pigs and mice were studied. In accordance with current research data, three kinds of CpG ODN – 2006, D19 and 1826, which were identified as optimally active in humans, pigs and mice, respectively – and control ODN D48, a non CpG-containing ODN, were selected and synthesized. Results indicated that CpG ODN D19 strongly stimulated the proliferation of porcine peripheral blood mononuclear cells (PBMCs), and the amount of γ-interferon in the supernatant of activated cells increased, exceeding that of all

APA, Harvard, Vancouver, ISO, and other styles

12

Tjapko, Galina. "Koncepcija suppletivizma v rossijskoj grammaticeskoj tradicii (na serbskom materiale)." Juznoslovenski filolog, no. 66 (2010): 481–96. http://dx.doi.org/10.2298/jfi1066481t.

Full text

Abstract:

S vvedenija v naucnyj oborot termina "suppletivizm" proslo bolee dvuh stoletij, no do sih por eto odno iz samyh neopredelennyh ponjatij. Eto svjazano s tem, cto v issledovanijah suppletivizma soslis' dva napravlenija - sravnitel'no-istoriceskoe (diahroniceskoe) i "funkcional'noe" (sinhronnoe). Oba napravlenija issledujut edinicy jazyka, obrazovannye "ne po pravilu", otnosjasciesja k "dopolnitel'noj distribucii". Odnako otbor edinic osuscestvljaetsja imi po raznym kriterijam i iz raznyh kontinuumov. Znacitel'nyj vklad v razrabotku problematiki suppletivnyh otnosenij vnesli rossijskie ucenye, iz

APA, Harvard, Vancouver, ISO, and other styles

13

Kuczera, Karol. "Identification of company decision-makers’ preferences for the dimensions of busi-ness models with ahp method – empirical findings." Ekonomiczne Problemy Usług 122 (2016): 299–308. http://dx.doi.org/10.18276/epu.2016.122-28.

Full text

APA, Harvard, Vancouver, ISO, and other styles

14

Viryasova, Galina M., Ekaterina A. Golenkina, Tibor Hianik, et al. "Magic Peptide: Unique Properties of the LRR11 Peptide in the Activation of Leukotriene Synthesis in Human Neutrophils." International Journal of Molecular Sciences 22, no. 5 (2021): 2671. http://dx.doi.org/10.3390/ijms22052671.

Full text

Abstract:

Neutrophil-mediated innate host defense mechanisms include pathogen elimination through bacterial phagocytosis, which activates the 5-lipoxygenase (5-LOX) product synthesis. Here, we studied the effect of synthetic oligodeoxyribonucleotides (ODNs), which mimic the receptor-recognized sites of bacterial (CpG-ODNs) and genomic (G-rich ODNs) DNAs released from the inflammatory area, on the neutrophil functions after cell stimulation with Salmonella typhimurium. A possible mechanism for ODN recognition by Toll-like receptor 9 (TLR9) and RAGE receptor has been proposed. We found for the first time

APA, Harvard, Vancouver, ISO, and other styles

15

Engelhard, Herbert H. "Antisense Oligodeoxynucleotide Technology: Potential Use for the Treatment of Malignant Brain Tumors." Cancer Control 5, no. 2 (1998): 163–70. http://dx.doi.org/10.1177/107327489800500207.

Full text

Abstract:

Background: Antisense oligodeoxynucleotides (ODNs) have been proposed as a new therapy for patients with cancer, including malignant brain tumors. Antisense ODNs are taken up by tumor cells and selectively block gene expression. Use of ODNs for brain tumors is attractive due to their theoretical specificity, relative ease of production and, to date, paucity of reported adverse effects. This article presents current information regarding antisense ODNs and their possible future use for the treatment of brain tumors. Methods: The available published experimental and clinical information regardin

APA, Harvard, Vancouver, ISO, and other styles

16

Husain, Ahmad, Forkas Tiroy Santos. B, Muhamad Irsan, and Ade Syahrul Ramdan. "Pelatihan Sistem Odoo (Open ERP) Sebagai Media Pengadaan Sparepart Pada Bengkel Mobil Said Motor." Jurnal Pengabdian Masyarakat Bangsa 2, no. 12 (2025): 5844–49. https://doi.org/10.59837/jpmba.v2i12.2087.

Full text

Abstract:

Pelatihan ini bertujuan untuk meingplementasikan sistem Enterprise Resource Planning (ERP) berbasis Odoo pada proses pengadaan sparepart pada bengkel mobil Said Motor, untuk mengadopsi teknologi yang dapat meningkatkan operasional dan penjualan. Sistem ERP dirancang untuk mengintegrasikan data dan informasi ke dalam satu sistem yang mendukung kebutuhan bisnis.Odoo dipilih sebagai perangkat lunak ERP karena sifatnya yang open source dan dapat dikustomisasi sesuai kebutuhan berdasarkan fit dan gap analisis. ODDO adalah perangkat lunak manajemen all-in-one yang menawarkan berbagai aplikasi bisnis

APA, Harvard, Vancouver, ISO, and other styles

17

Fehér, Krisztina. "Single Stranded DNA Immune Modulators with Unmethylated CpG Motifs: Structure and Molecular Recognition by Toll-Like Receptor 9." Current Protein & Peptide Science 20, no. 11 (2019): 1060–68. http://dx.doi.org/10.2174/1389203720666190830162149.

Full text

Abstract:

Single stranded microbial DNA fragments with unmethylated deoxycytidylyldeoxyguanosine dinucleotide (CpG) motifs are interpreted as danger signals by the innate immune system via recognition by the Toll-like Receptor 9 (TLR9). Their synthetic analogues, Oligodeoxynucleotides (ODN) comprise a promising class of immune modulators with potential applications in the treatment of multiple diseases, such as cancer, autoimmune diseases or allergy. ODN molecules contain a core hexamer sequence, which is species specific consisting of GACGTT and AACGT for mouse and GTCGTT in humans. Assessment of struc

APA, Harvard, Vancouver, ISO, and other styles

18

Chuang, Yu-Chen, Jen-Chih Tseng, Jing-Xing Yang, et al. "Toll-Like Receptor 21 of Chicken and Duck Recognize a Broad Array of Immunostimulatory CpG-oligodeoxynucleotide Sequences." Vaccines 8, no. 4 (2020): 639. http://dx.doi.org/10.3390/vaccines8040639.

Full text

Abstract:

CpG-oligodeoxynucleotides (CpG-ODNs) mimicking the function of microbial CpG-dideoxynucleotides containing DNA (CpG-DNA) are potent immune stimuli. The immunostimulatory activity and the species-specific activities of a CpG-ODN depend on its nucleotide sequence properties, including CpG-hexamer motif types, spacing between motifs, nucleotide sequence, and length. Toll-like receptor (TLR) 9 is the cellular receptor for CpG-ODNs in mammalian species, while TLR21 is the receptor in avian species. Mammalian cells lack TLR21, and avian cells lack TLR9; however, both TLRs are expressed in fish cells

APA, Harvard, Vancouver, ISO, and other styles

19

BIESSEN, Erik A. L., Helene VIETSCH, Erik T. RUMP, et al. "Targeted delivery of oligodeoxynucleotides to parenchymal liver cells in vivo." Biochemical Journal 340, no. 3 (1999): 783–92. http://dx.doi.org/10.1042/bj3400783.

Full text

Abstract:

Anti-sense oligodeoxynucleotides (ODNs) hold great promise for correcting the biosynthesis of clinically relevant proteins. The potential of ODNs for modulating liver-specific genes might be increased by preventing untimely elimination and by improving the local bioavailability of ODNs in the target tissue. In the present study we have assessed whether the local ODN concentration can be enhanced by the targeted delivery of ODNs through conjugation to a ligand for the parenchymal liver cell-specific asialoglycoprotein receptor. A capped ODN (miscellaneous 20-mer sequence) was derivatized with a

APA, Harvard, Vancouver, ISO, and other styles

20

Shahsavari, Shahien, Dhananjani N. A. M. Eriyagama, Bhaskar Halami, et al. "Electrophilic oligodeoxynucleotide synthesis using dM-Dmoc for amino protection." Beilstein Journal of Organic Chemistry 15 (May 20, 2019): 1116–28. http://dx.doi.org/10.3762/bjoc.15.108.

Full text

Abstract:

Solid-phase synthesis of electrophilic oligodeoxynucleotides (ODNs) was achieved using dimethyl-Dmoc (dM-Dmoc) as amino protecting group. Due to the high steric hindrance of the 2-(propan-2-ylidene)-1,3-dithiane side product from deprotection, the use of excess nucleophilic scavengers such as aniline to prevent Michael addition of the side product to the deprotected ODN during ODN cleavage and deprotection was no longer needed. The improved technology was demonstrated by the synthesis and characterization of five ODNs including three modified ones. The modified ODNs contained the electrophilic

APA, Harvard, Vancouver, ISO, and other styles

21

Li, Chenfei, Xiangyu Huang, Jiaxi Cai, et al. "The Immunomodulatory Functions of Various CpG Oligodeoxynucleotideson CEF Cells and H9N2 Subtype Avian Influenza Virus Vaccination." Vaccines 10, no. 4 (2022): 616. http://dx.doi.org/10.3390/vaccines10040616.

Full text

Abstract:

CpG oligodeoxynucleotides (CpG ODN) present adjuvant activities for antigen proteins, which can induce humoral and cellular immune responses to antigens. However, the immunomodulatory functions of CpG ODNs with different sequences are very different. In this paper, six CpG ODNs with different sequences were designed based on CpG2007 as a template. Through the screening of CEF cells in vitro, the stimulating activity of CpG ODNs was determined. Then, two selected CpG ODN sequence backbones were modified by substituting the oxygen with sulfur (S-CpG) and verifying the immune activity. Next, to p

APA, Harvard, Vancouver, ISO, and other styles

22

Tamm, Ingo. "Antisense therapy in malignant diseases: status quo and quo vadis?" Clinical Science 110, no. 4 (2006): 427–42. http://dx.doi.org/10.1042/cs20050284.

Full text

Abstract:

Preclinical and clinical studies indicate a role for AS ODNs (antisense oligonucleotides) as therapeutics for malignant diseases. The principle of antisense technology is the sequence-specific binding of an AS ODN to the target mRNA, resulting in a translational arrest. The specificity of hybridization makes antisense strategy attractive to selectively modulate the expression of genes involved in the pathogenesis of malignant diseases. One antisense drug has been approved for local therapy of CMV (cytomegalovirus) retinitis, and a number of AS ODNs are currently being tested in clinical trials

APA, Harvard, Vancouver, ISO, and other styles

23

Dryden, S., L. Pickavance, D. Tidd, and G. Williams. "The lack of specificity of neuropeptide Y (NPY) antisense oligodeoxynucleotides administered intracerebroventricularly in inhibiting food intake and NPY gene expression in the rat hypothalamus." Journal of Endocrinology 157, no. 1 (1998): 169–75. http://dx.doi.org/10.1677/joe.0.1570169.

Full text

Abstract:

To evaluate the role of neuropeptide Y (NPY), a potent appetite stimulant, in controlling food intake and body weight, we investigated the use of antisense oligodeoxynucleotides (ODNs) to inhibit NPY gene expression in the hypothalamus. We compared the hypothalamic distribution of fluorescein-labelled ODNs administered intracerebroventricularly, and effects on food intake and NPY gene expression, of three different structural modifications of an antisense ODN sequence against NPY. Rats had either the antisense or missense ODNs (24 micrograms/day) or saline infused into the third ventricle by o

APA, Harvard, Vancouver, ISO, and other styles

24

Gramzinski, Robert A., Denise L. Doolan, Martha Sedegah, Heather L. Davis, Arthur M. Krieg, and Stephen L. Hoffman. "Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice." Infection and Immunity 69, no. 3 (2001): 1643–49. http://dx.doi.org/10.1128/iai.69.3.1643-1649.2001.

Full text

Abstract:

ABSTRACT Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with th

APA, Harvard, Vancouver, ISO, and other styles

25

Liu, Yi, Reginald Gray, Gareth Hardy, et al. "CpG-B oligodeoxynucleotides inhibit Toll-like receptor-dependent and -independent induction of type I IFN in dendritic cells (136.10)." Journal of Immunology 184, no. 1_Supplement (2010): 136.10. http://dx.doi.org/10.4049/jimmunol.184.supp.136.10.

Full text

Abstract:

Abstract CpG oligodeoxynucleotides (ODNs) signal through TLR9 to induce type-I IFN (IFNαβ) in dendritic cells. CpG-A ODNs are more efficacious than CpG-B ODNs for induction of IFNαβ. Because IFNαβ may contribute to autoimmunity, it is important to identify mechanisms to inhibit induction of IFNαβ. In our studies, CpG-B ODN inhibited induction of IFNαβ by CpG-A ODN, while induction of TNFα and IL-12p40 by CpG-A ODN was not affected. CpG-B inhibition of IFNαβ was observed in Flt3L-induced murine DCs, purified murine mDCs and pDCs, and human PBMCs. CpG-B ODN inhibited induction of IFNαβ by agonis

APA, Harvard, Vancouver, ISO, and other styles

26

Almsherqi, Zakaria, Stephen Hyde, Malarmathy Ramachandran, and Yuru Deng. "Cubic membranes: a structure-based design for DNA uptake." Journal of The Royal Society Interface 5, no. 26 (2008): 1023–29. http://dx.doi.org/10.1098/rsif.2007.1351.

Full text

Abstract:

Cubic membranes are soft three-dimensional crystals found within cell organelles in a variety of living systems, despite the aphorism of Fedorov: ‘crystallization is death’. They consist of multi-bilayer lipid–protein stacks, folded onto anticlastic surfaces that resemble triply periodic minimal surfaces, forming highly swollen crystalline sponges. Although cubic membranes have been observed in numerous cell types and under different pathophysiological conditions, knowledge about the formation and potential function(s) of non-lamellar, cubic structures in biological systems is scarce. We repor

APA, Harvard, Vancouver, ISO, and other styles

27

Chillar, Komal, Rohith Awasthy, Marina Tanasova, and Shiyue Fang. "Synthesis of Sensitive Oligodeoxynucleotides Containing Acylated Cytosine, Adenine, and Guanine Nucleobases." DNA 5, no. 2 (2025): 25. https://doi.org/10.3390/dna5020025.

Full text

Abstract:

Background/Objective: Oligodeoxynucleotides (ODNs) containing base-labile modifications such as N4-acetyldeoxycytidine (4acC), N6-acetyladenosine (6acA), N2-acetylguanosine (2acG), and N4-methyoxycarbonyldeoxycytidine (4mcC) are highly challenging to synthesize because standard ODN synthesis methods require deprotection and cleavage under strongly basic and nucleophilic conditions, and there is a lack of ideal alternative methods to solve the problem. The objective of this work is to explore the capability of the recently developed 1,3-dithian-2-yl-methoxycarbonyl (Dmoc) method for the incorpo

APA, Harvard, Vancouver, ISO, and other styles

28

Abe, T., S. Suzuki, T. Hatta, K. Takai, T. Yokota, and H. Takaku. "Specific Inhibition of Influenza Virus RNA Polymerase and Nucleoprotein Gene Expression by Liposomally Encapsulated Antisense Phosphorothioate Oligonucleotides in MDCK Cells." Antiviral Chemistry and Chemotherapy 9, no. 3 (1998): 253–62. http://dx.doi.org/10.1177/095632029800900306.

Full text

Abstract:

We have demonstrated that antisense phosphorothioate oligonucleotides (S-ODNs) inhibit influenza A virus replication in MDCK cells. Liposomally encapsulated and free antisense S-ODNs with four target sites (PB1, PB2, PA and NP genes) were tested for their abilities to inhibit virus-induced cytopathogenic effects in a MTT assay using MDCK cells. The liposomally encapsulated S-ODN complementary to the site around the PB2 AUG initiation codon showed highly inhibitory effects. In contrast, the inhibitory effect of the liposomally encapsulated S-ODN targeted to PB1 was considerably decreased in com

APA, Harvard, Vancouver, ISO, and other styles

29

Segal, GM, TD Smith, MC Heinrich, FS Ey, and GC Bagby. "Specific repression of granulocyte-macrophage and granulocyte colony- stimulating factor gene expression in interleukin-1-stimulated endothelial cells with antisense oligodeoxynucleotides." Blood 80, no. 3 (1992): 609–16. http://dx.doi.org/10.1182/blood.v80.3.609.609.

Full text

Abstract:

Abstract Antisense oligodeoxynucleotides (ODNs) have been used to effect the specific inhibition of cellular gene expression. We have evaluated the application of this approach to the inhibition of interleukin-1 (IL-1)- induced granulocyte-macrophage colony-stimulating factor (GM-CSF) and granulocyte colony-stimulating factor (G-CSF) expression in cultured human umbilical vein endothelial cells. Antisense ODNs or control ODNs (sense ODNs or missense ODNs containing random base substitutions) were added to cultures of endothelial cells, the cells were induced with IL- 1 alpha, and the condition

APA, Harvard, Vancouver, ISO, and other styles

30

Segal, GM, TD Smith, MC Heinrich, FS Ey, and GC Bagby. "Specific repression of granulocyte-macrophage and granulocyte colony- stimulating factor gene expression in interleukin-1-stimulated endothelial cells with antisense oligodeoxynucleotides." Blood 80, no. 3 (1992): 609–16. http://dx.doi.org/10.1182/blood.v80.3.609.bloodjournal803609.

Full text

Abstract:

Antisense oligodeoxynucleotides (ODNs) have been used to effect the specific inhibition of cellular gene expression. We have evaluated the application of this approach to the inhibition of interleukin-1 (IL-1)- induced granulocyte-macrophage colony-stimulating factor (GM-CSF) and granulocyte colony-stimulating factor (G-CSF) expression in cultured human umbilical vein endothelial cells. Antisense ODNs or control ODNs (sense ODNs or missense ODNs containing random base substitutions) were added to cultures of endothelial cells, the cells were induced with IL- 1 alpha, and the conditioned media

APA, Harvard, Vancouver, ISO, and other styles

31

Smith, R. C., W. M. Bement, M. A. Dersch, E. Dworkin-Rastl, M. B. Dworkin, and D. G. Capco. "Nonspecific effects of oligodeoxynucleotide injection in Xenopus oocytes: a reevaluation of previous D7 mRNA ablation experiments." Development 110, no. 3 (1990): 769–79. http://dx.doi.org/10.1242/dev.110.3.769.

Full text

Abstract:

Microinjection of oligodeoxynucleotides (ODNs) complementary to cellular mRNAs has been advanced as an experimental approach to degrade target mRNAs in vivo and thereby obtain information as to the function of their cognate proteins. It is shown here that ODNs can induce a variety of aberrations in cell metabolism and structure when injected into Xenopus oocytes. Examination of histological sections of ODN-injected oocytes revealed the frequent abnormal accumulation of heavily staining basophilic material in the area of the germinal vesicle (gv). Ultrastructural analysis detected further abnor

APA, Harvard, Vancouver, ISO, and other styles

32

Oxenius, Annette, Marianne M. A. Martinic, Hans Hengartner, and Paul Klenerman. "CpG-Containing Oligonucleotides Are Efficient Adjuvants for Induction of Protective Antiviral Immune Responses with T-Cell Peptide Vaccines." Journal of Virology 73, no. 5 (1999): 4120–26. http://dx.doi.org/10.1128/jvi.73.5.4120-4126.1999.

Full text

Abstract:

ABSTRACT Synthetic nonmethylated oligonucleotides containing CpG dinucleotides (CpG-ODNs) have been shown to exhibit immunostimulatory activity. CpG-ODNs have the capacity to directly activate B cells, macrophages, and dendritic cells, and we show here that this is reflected by cell surface binding of oligonucleotides to these cell subsets. However, T cells are not directly activated by CpG-ODNs, which correlates with the failure to bind to the T-cell surface. Efficient competition for CpG-induced B-cell activation by non-CpG-containing oligonucleotides suggests that oligonucleotides might bin

APA, Harvard, Vancouver, ISO, and other styles

33

Matsuda, M., J. G. Park, D. C. Wang, S. Hunter, P. Chien, and A. D. Schreiber. "Abrogation of the Fc gamma receptor IIA-mediated phagocytic signal by stem-loop Syk antisense oligonucleotides." Molecular Biology of the Cell 7, no. 7 (1996): 1095–106. http://dx.doi.org/10.1091/mbc.7.7.1095.

Full text

Abstract:

The role of Syk kinase in Fc gamma receptor (Fc gamma R) IIA-mediated phagocytosis was examined with two forms of antisense oligodeoxynucleotides (ODNs) designed to hybridize to human Syk mRNA. Monocytes were incubated with linear and stem-loop antisense ODNs targeted to Syk mRNA. When complexed with cationic liposomes, stem-loop Syk antisense ODN with phosphorothioate modification exhibited stability in fetal bovine and human serum. The stem-loop Syk antisense ODN at a concentration of 0.2 microM inhibited Fc gamma RIIA-mediated phagocytosis by 90% and completely eliminated Syk mRNA and prote

APA, Harvard, Vancouver, ISO, and other styles

34

Zhang, Zhongkun, Jimmy Chun-Tien Kuo, Siyu Yao, Chi Zhang, Hira Khan, and Robert J. Lee. "CpG Oligodeoxynucleotides for Anticancer Monotherapy from Preclinical Stages to Clinical Trials." Pharmaceutics 14, no. 1 (2021): 73. http://dx.doi.org/10.3390/pharmaceutics14010073.

Full text

Abstract:

CpG oligodeoxynucleotides (CpG ODNs), the artificial versions of unmethylated CpG motifs that were originally discovered in bacterial DNA, are demonstrated not only as potent immunoadjuvants but also as anticancer agents by triggering toll-like receptor 9 (TLR9) activation in immune cells. TLR9 activation triggered by CpG ODN has been shown to activate plasmacytoid dendritic cells (pDCs) and cytotoxic T lymphocytes (CTLs), enhancing T cell-mediated antitumor immunity. However, the extent of antitumor immunity carried by TLR agonists has not been optimized individually or in combinations with c

APA, Harvard, Vancouver, ISO, and other styles

35

ADEDJOBI, Titilayo Kemi Sophia Nelly, Daniel Kariuki, and James Kimotho. "Co-administration of a Hepatitis B vaccine with CpG-ODN 2395 induces stronger immune response in BALB/c mice." F1000Research 13 (April 26, 2024): 404. http://dx.doi.org/10.12688/f1000research.145766.1.

Full text

Abstract:

Background Proof of effects of Cytosine Phosphoguanine Oligodeoxynucleotides (CpG ODNs), adjuvanted Hepatitis B Virus (HBV) vaccine on immune response is limited. This study aimed to assess the effect of five CpG ODNs in HBV Vaccine-immunized BALB/c mice and to identify the most effective CpG ODN adjuvant. Methods This laboratory-based experimental study was conducted using a total of 36 female BALB/c mice, which were clustered into 12 groups and immunized intramuscularly. Group 1 was immunized with CpG ODN 18281-1 alone, group 2 with vaccine plus CpG ODN 18281-1, group 3 with CpG ODN 18281-2

APA, Harvard, Vancouver, ISO, and other styles

36

Luganini, Anna, Patrizia Caposio, Santo Landolfo, and Giorgio Gribaudo. "Phosphorothioate-Modified Oligodeoxynucleotides Inhibit Human Cytomegalovirus Replication by Blocking Virus Entry." Antimicrobial Agents and Chemotherapy 52, no. 3 (2008): 1111–20. http://dx.doi.org/10.1128/aac.00987-07.

Full text

Abstract:

ABSTRACT Studies in animal models have provided evidence that Toll-like receptor 9 (TLR9) agonists, such as synthetic oligodeoxynucleotides (ODNs) that contain immunostimulatory deoxycytidyl-deoxyguanosine (CpG) motifs (CpG ODNs), protect against a wide range of viral pathogens. This antiviral activity has been suggested to be indirect and secondary to CpG-induced cytokines and inflammatory responses triggered through TLR9 activation. However, few studies have addressed the potential of CpG ODNs as direct antiviral agents. Here, we report on the ability of some CpG ODNs to directly suppress, a

APA, Harvard, Vancouver, ISO, and other styles

37

Ostanin, A. A., O. Y. Leplina, E. A. Burakova, et al. "Phosphate-modified CpG oligonucleotides induce in vitro maturation of human myeloid dendritic cells." Vavilov Journal of Genetics and Breeding 24, no. 6 (2020): 653–60. http://dx.doi.org/10.18699/vj20.659.

Full text

Abstract:

Myeloid dendritic cells (DCs) play an important role in the immune response; therefore, the search for compounds that can effectively activate DCs is a needful goal. This study was aimed to investigate the effect of synthetic CpG oligodeoxynucleotides (CpG-ODN) on the maturation and allostimulatory activity of myeloid DCs in comparison with other PAMP and DAMP molecules. For the research, we synthesized known CpG-ODN class C (SD-101 and D-SL03) containing thiophosphate internucleotide groups, and their original phosphate-modified analogues (SD-101M and D-SL03M) with mesylphosphoramide internuc

APA, Harvard, Vancouver, ISO, and other styles

38

Pathak, Soumitra, Nguyen Bui Thao Le, Taiji Oyama, et al. "Immunostimulatory Effects of Guanine-Quadruplex Topologies as Scaffolds for CpG Oligodeoxynucleotides." Biomolecules 15, no. 1 (2025): 95. https://doi.org/10.3390/biom15010095.

Full text

Abstract:

Synthetic cytosine-phosphate-guanine oligodeoxynucleotides (CpG ODNs) are promising candidates for vaccine adjuvants, because they activate immune responses through the Toll-like receptor 9 (TLR9) pathway. However, unmodified CpG ODNs are quickly degraded by serum nucleases, and their negative charge hinders cellular uptake, limiting their clinical application. Our group previously reported that guanine-quadruplex (G4)-forming CpG ODNs exhibit enhanced stability and cellular uptake. G4 structures can form in parallel, anti-parallel, or hybrid topologies, depending on strand orientation, but th

APA, Harvard, Vancouver, ISO, and other styles

39

Chang, Ho, Yan Chyuan Wu, Chih Hao Chen, Ren Jei Chung, Kung Ching Cho, and Wei Lin Lin. "Hybridization of ODNs with the Core-Shell Structure of Fe₃O₄ Nanoparticles and CS/ALG Composite Structure." Applied Mechanics and Materials 52-54 (March 2011): 349–53. http://dx.doi.org/10.4028/www.scientific.net/amm.52-54.349.

Full text

Abstract:

This study develops a nanocomposite structure with magnetism and biocompatibility. Composite structures with magnetism can be applied for biomarkers, specific tissue cell detection and targeted drug therapy. This study adopts a chemical disposition method to prepare Fe3O4 magnetic nanoparticles with the average size of 20-25nm. The complex biocompatible chitosan-alginate membrane covers Fe3O4 magnetic nanoparticles and the thickness of the complex membrane is controlled at 50-80nm. The efficiency of the oligonucleotide (ODN) combination is increased through the high biocompatibility of this co

APA, Harvard, Vancouver, ISO, and other styles

40

Garnier, Romain. "On the Origin of Gerund and Gerundive in Latin: A New Reassessment." Acta Antiqua Academiae Scientiarum Hungaricae 59, no. 1-4 (2020): 181–87. http://dx.doi.org/10.1556/068.2019.59.1-4.17.

Full text

Abstract:

SummaryThis short paper addresses a very vexed issue, to which a huge literature has been dedicated so far: the origin of the so-called gerunds and gerundives in Latin. Any previous attempt has proved un- conclusive, mainly because of the proliferation of ad hoc rules assumed to account for the nd-forms and even more because of the plethora of solutions. Instead of assuming another etymon for the sake of antago- nism, this paper intends to reassess the whole issue within Latin itself: as shown by non-standard syntacti- cal features of Plautinian and Late Latin, there is a morphological relatio

APA, Harvard, Vancouver, ISO, and other styles

41

Nehete, Pramod N., Sriram Chitta, Bharti P. Nehete, Lawrence E. Williams, Thomas Wisniewski та Henrieta Scholtzova. "Plasmacytoid dendritic cells (pDCs) and IFN-α production in aged squirrel monkeys (Saimiri boliviensis boliviensis) stimulated with Class C CpG Oligodeoxynucleotides". Journal of Immunology 204, № 1_Supplement (2020): 148.13. http://dx.doi.org/10.4049/jimmunol.204.supp.148.13.

Full text

Abstract:

Abstract Synthetic CpG oligodeoxynucleotides (ODNs) with defined CpG motifs and immunomodulatory properties signal through an endosomal membrane-based type of pattern recognition receptor (PRR), the Toll-like receptor 9 (TLR9), that has been identified in dendritic cells (DCs), B cells, and other human immune cell types. CpG-ODNs influence several signaling pathways, leading to cytokine production in many mammalian species that make CpG ODNs suitable as therapeutic interventions in a variety of human disease conditions. The squirrel monkey (SQM), a well-established New World non-human primate

APA, Harvard, Vancouver, ISO, and other styles

42

Ito, Ichiaki, Kamlesh Bhopale, Tomoki Nishiguchi, et al. "Human CCL1 antisense oligodeoxynucleotide (ODN) screened as a potent inhibitor of M2b monocytes (INC6P.322)." Journal of Immunology 194, no. 1_Supplement (2015): 192.24. http://dx.doi.org/10.4049/jimmunol.194.supp.192.24.

Full text

Abstract:

Abstract In a murine model of γ-irradiation, bacterial translocation and subsequent sepsis have been effectively controlled by CCL1 antisense ODN, a M2b macrophage reverter. In the present study, we tried to obtain human CCL1 antisense ODN which is inhibitory on human M2b macrophages. Twenty human CCL1 antisense ODNs were synthesized based on the prediction of CCL1 mRNA secondary structure, calculation of GC content, and binding energy of ODNs. To evaluate the activity of these ODNs, an amount of CCL1 in culture fluids of M2b monocytes cultured with the ODNs was determined by ELISA. M2b monocy

APA, Harvard, Vancouver, ISO, and other styles

43

Sparwasser, Tim, Lothar Hültner, Eva Sophie Koch, Arne Luz, Grayson B. Lipford, and Hermann Wagner. "Immunostimulatory CpG-Oligodeoxynucleotides Cause Extramedullary Murine Hemopoiesis." Journal of Immunology 162, no. 4 (1999): 2368–74. http://dx.doi.org/10.4049/jimmunol.162.4.2368.

Full text

Abstract:

Abstract Bacterial DNA and the synthetic CpG-oligodeoxynucleotides (ODNs) derived thereof have attracted attention because they activate cells of the adaptive immune system (lymphocytes) and the innate immune system (APCs) in a sequence-dependent manner. Here, we addressed whether CpG-ODNs affect hemopoiesis. Challenging mice with immunostimulatory CpG-ODN sequences led to transient splenomegaly, with a maximum increase of spleen weight at day 6. The induction of splenomegaly by CpG-ODNs was sequence-specific, dose-dependent, and associated with an increase in splenic cell count, in numbers of

APA, Harvard, Vancouver, ISO, and other styles

44

Martinho, José M. G., Telmo J. V. Prazeres, Leila Moura, and José P. S. Farinha. "Fluorescence of oligonucleotides adsorbed onto the thermoresponsive poly(isopropyl acrylamide) shell of polymer nanoparticles: Application to bioassays." Pure and Applied Chemistry 81, no. 9 (2009): 1615–34. http://dx.doi.org/10.1351/pac-con-08-11-11.

Full text

Abstract:

The fluorescence of a rhodamine X dye covalently linked to the 5' terminus of a 25-mers thymine oligodeoxynucleotide (dT25-ROX), adsorbed on the shell of thermoresponsive core-shell polymer particles, was used to probe the polarity, mobility, and distribution of the oligodeoxynucleotides (ODNs) in the shell. The particles have a glassy core of poly(methyl methacrylate) (PMMA) with a 67-nm radius, and a thermoresponsive shell of poly(N-isopropyl acrylamide) (PNIPAM) whose thickness changes from 42 nm at 11 ºC to 5 nm at 45 ºC. The variation in polarity of the shell with temperature was obtained

APA, Harvard, Vancouver, ISO, and other styles

45

Gursel, Ihsan, Gizem Tincer, Kutay Karatepe, and Mayda Gursel. "Immunoregulatory Activities of Self-Nanoparticle Forming CpG ODN (89.52)." Journal of Immunology 184, no. 1_Supplement (2010): 89.52. http://dx.doi.org/10.4049/jimmunol.184.supp.89.52.

Full text

Abstract:

Abstract CpG ODN patterned after bacterial DNA can be harnessed in different clinical settings to provide an advantage to host. Several challenges hampers utilization of synthetic ODNs in the clinic. There are at least three distinct classes of CpGODNs displaying differential immune activation. Of note, the efficacy of these synthetic ODNs is reduced under physiological conditions due to premature clearance, nuclease digestion and low levels of internalization. Moreover, D-ODN as one of the most potent IFNα inducer has a large-scale production problem due to 3’polyG-runs hampering its entry in

APA, Harvard, Vancouver, ISO, and other styles

46

Huang, Yu-Hui, Chia-Wei Wang, Wen-Tsen Chen, Li-Yi Chen, and Huan-Tsung Chang. "Nanomaterial based mass spectrometry of oligodeoxynucleotide–drug complexes." Analytical Methods 7, no. 15 (2015): 6360–64. http://dx.doi.org/10.1039/c5ay00990a.

Full text

APA, Harvard, Vancouver, ISO, and other styles

47

Wang, Ruping, Qingfen Li, and Dale D. Tang. "Role of vimentin in smooth muscle force development." American Journal of Physiology-Cell Physiology 291, no. 3 (2006): C483—C489. http://dx.doi.org/10.1152/ajpcell.00097.2006.

Full text

Abstract:

Vimentin intermediate filaments undergo spatial reorganization in cultured smooth muscle cells in response to contractile activation; however, the role of vimentin in the physiological properties of smooth muscle has not been well elucidated. Tracheal smooth muscle strips were loaded with antisense oligonucleotides (ODNs) against vimentin and then cultured for 2 days to allow for protein degradation. Treatment with vimentin antisense, but not sense, ODNs suppressed vimentin protein expression; neither vimentin antisense nor sense ODNs affected protein levels of desmin and actin. Force developm

APA, Harvard, Vancouver, ISO, and other styles

48

Le, Nguyen Bui Thao, Anh Thi Tram Tu, Dandan Zhao, et al. "Influence of the Charge Ratio of Guanine-Quadruplex Structure-Based CpG Oligodeoxynucleotides and Cationic DOTAP Liposomes on Cytokine Induction Profiles." Biomolecules 13, no. 11 (2023): 1639. http://dx.doi.org/10.3390/biom13111639.

Full text

Abstract:

Cationic liposomes, specifically 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP) liposomes, serve as successful carriers for guanine-quadruplex (G4) structure-based cytosine-guanine oligodeoxynucleotides (CpG ODNs). The combined benefits of CpG ODNs forming a G4 structure and a non-viral vector carrier endow the ensuing complex with promising adjuvant properties. Although G4-CpG ODN-DOTAP complexes show a higher immunostimulatory effect than naked G4-CpG ODNs, the effects of the complex composition, especially charge ratios, on the production of the pro-inflammatory cytokines interleukin (IL)

APA, Harvard, Vancouver, ISO, and other styles

49

Fujii, Hisaki, Jacqueline D. Trudeau, David T. Teachey, et al. "In vivo control of acute lymphoblastic leukemia by immunostimulatory CpG oligonucleotides." Blood 109, no. 5 (2006): 2008–13. http://dx.doi.org/10.1182/blood-2006-02-002055.

Full text

Abstract:

Abstract Despite considerable success in treating newly diagnosed childhood acute lymphoblastic leukemia (ALL), relapsed disease remains a significant clinical challenge. Using a NOD/SCID mouse xenograft model, we report that immunostimulatory DNA oligonucleotides containing CpG motifs (CpG ODNs) stimulate significant immune activity against primary human ALL cells in vivo. The administration of CpG ODNs induced a significant reduction in systemic leukemia burden, mediated continued disease control, and significantly improved survival of mice with established human ALL. The death of leukemia c

APA, Harvard, Vancouver, ISO, and other styles

50

Marzano, Maria, Andrea Falanga, Stefano D’Errico, et al. "New G-Quadruplex-Forming Oligodeoxynucleotides Incorporating a Bifunctional Double-Ended Linker (DEL): Effects of DEL Size and ODNs Orientation on the Topology, Stability, and Molecularity of DEL-G-Quadruplexes." Molecules 24, no. 3 (2019): 654. http://dx.doi.org/10.3390/molecules24030654.

Full text

Abstract:

G-quadruplexes (G4s) are unusual secondary structures of DNA occurring in guanosine-rich oligodeoxynucleotide (ODN) strands that are extensively studied for their relevance to the biological processes in which they are involved. In this study, we report the synthesis of a new kind of G4-forming molecule named double-ended-linker ODN (DEL-ODN), in which two TG4T strands are attached to the two ends of symmetric, non-nucleotide linkers. Four DEL-ODNs differing for the incorporation of either a short or long linker and the directionality of the TG4T strands were synthesized, and their ability to

APA, Harvard, Vancouver, ISO, and other styles

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!