To see the other types of publications on this topic, follow the link: Oligo DNA microarray.
Journal articles on the topic 'Oligo DNA microarray'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 46 journal articles for your research on the topic 'Oligo DNA microarray.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Ranjbar, Reza, Payam Behzadi, Ali Najafi, and Raheleh Roudi. "DNA Microarray for Rapid Detection and Identification of Food and Water Borne Bacteria: From Dry to Wet Lab." Open Microbiology Journal 11, no. 1 (2017): 330–38. http://dx.doi.org/10.2174/1874285801711010330.
Full textAbstract:
Background:A rapid, accurate, flexible and reliable diagnostic method may significantly decrease the costs of diagnosis and treatment. Designing an appropriate microarray chip reduces noises and probable biases in the final result.Objective:The aim of this study was to design and construct a DNA Microarray Chip for a rapid detection and identification of 10 important bacterial agents.Method:In the present survey, 10 unique genomic regions relating to 10 pathogenic bacterial agents includingEscherichia coli (E.coli), Shigella boydii, Sh.dysenteriae, Sh.flexneri, Sh.sonnei, Salmonella typhi, S.typhimurium, Brucella sp., Legionella pneumophila,andVibrio cholerawere selected for designing specific long oligo microarray probes. For this reason, the in-silico operations including utilization of the NCBI RefSeq database, Servers of PanSeq and Gview, AlleleID 7.7 and Oligo Analyzer 3.1 was done. On the other hand, thein-vitropart of the study comprised stages of robotic microarray chip probe spotting, bacterial DNAs extraction and DNA labeling, hybridization and microarray chip scanning. In wet lab section, different tools and apparatus such as Nexterion® Slide E, Qarrayminispotter, NimbleGen kit, TrayMixTMS4, and Innoscan 710 were used.Results:A DNA microarray chip including 10 long oligo microarray probes was designed and constructed for detection and identification of 10 pathogenic bacteria.Conclusion:The DNA microarray chip was capable to identify all 10 bacterial agents tested simultaneously. The presence of a professional bioinformatician as a probe designer is needed to design appropriate multifunctional microarray probes to increase the accuracy of the outcomes.
2
Ranjbar, Reza, Payam Behzadi, and Caterina Mammina. "Respiratory Tularemia: Francisella Tularensis and Microarray Probe Designing." Open Microbiology Journal 10, no. 1 (2016): 176–82. http://dx.doi.org/10.2174/1874285801610010176.
Full textAbstract:
Background:Francisella tularensis(F. tularensis) is the etiological microorganism for tularemia. There are different forms of tularemia such as respiratory tularemia. Respiratory tularemia is the most severe form of tularemia with a high rate of mortality; if not treated. Therefore, traditional microbiological tools and Polymerase Chain Reaction (PCR) are not useful for a rapid, reliable, accurate, sensitive and specific diagnosis. But, DNA microarray technology does. DNA microarray technology needs to appropriate microarray probe designing.Objective:The main goal of this original article was to design suitable long oligo microarray probes for detection and identification ofF. tularensis.Method:For performing this research, the complete genomes ofF. tularensissubsp.tularensisFSC198,F. tularensissubsp.holarcticaLVS,F. tularensissubsp.mediasiatica,F. tularensissubsp.novicida(F. novicidaU112), andF. philomiragiasubsp.philomiragiaATCC 25017 were studiedviaNCBI BLAST tool, GView and PanSeq Servers and finally the microarray probes were produced and processedviaAlleleID 7.7 software and Oligoanalyzer tool, respectively.Results:In thisin silicoinvestigation, a number of long oligo microarray probes were designed for detecting and identifyingF. tularensis. Among these probes, 15 probes were recognized as the best candidates for microarray chip designing.Conclusion:Calibrated microarray probes reduce the biasis of DNA microarray technology as an advanced, rapid, accurate and cost-effective molecular diagnostic tool with high specificity and sensitivity. Professional microarray probe designing provides us with much more facility and flexibility regarding preparation of a microarray diagnostic chip.
3
Iwahashi, Hitoshi, Emiko Kitagawa, Yoshiteru Suzuki, et al. "Evaluation of toxicity of the mycotoxin citrinin using yeast ORF DNA microarray and Oligo DNA microarray." BMC Genomics 8, no. 1 (2007): 95. http://dx.doi.org/10.1186/1471-2164-8-95.
Full text
4
Mingjun Zhang, Ou Ma, and Xiumin Diao. "Dynamics modeling and analysis of inkjet technology-based oligo DNA microarray spotting." IEEE Transactions on Automation Science and Engineering 3, no. 2 (2006): 159–68. http://dx.doi.org/10.1109/tase.2006.871480.
Full text
5
Rahmann, Sven. "Fast Large Scale Oligonucleotide Selection Using the Longest Common Factor Approach." Journal of Bioinformatics and Computational Biology 01, no. 02 (2003): 343–61. http://dx.doi.org/10.1142/s0219720003000125.
Full textAbstract:
We present a fast method that selects oligonucleotide probes (such as DNA 25-mers) for microarray experiments on a truly large scale. For example, reliable oligos for human genes can be found within four days, a speedup of one to two orders of magnitude compared to previous approaches. This speed is attained by using the longest common substring as a specificity measure for candidate oligos. We present a space- and time-efficient algorithm, based on a suffix array with additional information, to compute matching statistics (lengths of longest matches) between all candidate oligos and all remaining sequences. With the matching statistics available, we show how to incorporate constraints such as oligo length, melting temperature, and self-complementarity into the selection process at a postprocessing stage. As a result, we can now design custom oligos for any sequenced genome, just as the technology for on-site chip synthesis is becoming increasingly mature.
6
Zammatteo, Nathalie, Laurence Lockman, Francis Brasseur, et al. "DNA Microarray to Monitor the Expression of MAGE-A Genes." Clinical Chemistry 48, no. 1 (2002): 25–34. http://dx.doi.org/10.1093/clinchem/48.1.25.
Full textAbstract:
Abstract Background: The MAGE-A genes encode antigens that are of particular interest for antitumor immunotherapy because they are strictly tumor specific and are shared by many tumors. We developed a rapid method to identify the MAGE-A genes expressed in tumors. Methods: A low-density DNA microarray was designed to discriminate between the 12 MAGE-A cDNAs amplified by PCR with only one pair of consensus primers. The assay involved reverse transcription of total RNA with oligo(dT) primer, followed by PCR amplification and hybridization on a microarray. Amplification in the presence of Biotin-16-dUTP allowed subsequent detection of the amplicons on the microarray carrying 12 capture probes, each being specific for a MAGE-A gene. Probe–amplicon hybrids were detected by a streptavidin-based method. Results: PCR conditions were optimized for low detection limits and comparable amplification efficiencies among all MAGE-A nucleotide sequences. The microarray assay was validated with a panel of 32 samples, by comparison with well-established reverse transcription-PCR assays relying on amplification with primers specific for each gene. Virtually identical results were obtained with both methods, except for MAGE-A3 and MAGE-A5. Detection of MAGE-A5 was more sensitive with the microarray assay. Detection of MAGE-A3 was hampered by the presence of MAGE-A6, which is 98% identical: the MAGE-A3 capture probe cross-hybridized with MAGE-A6 amplicons because these sequences differed by only a single base. Conclusions: This post-PCR microarray assay could be useful to evaluate MAGE expression in tumors before therapeutic vaccinations with MAGE-A gene products.
7
Yee, Joon Chong, Katie Fraass Wlaschin, Song Hui Chuah, Peter Morin Nissom, and Wei-Shou Hu. "Quality assessment of cross-species hybridization of CHO transcriptome on a mouse DNA oligo microarray." Biotechnology and Bioengineering 101, no. 6 (2008): 1359–65. http://dx.doi.org/10.1002/bit.21984.
Full text
8
Kawaura, Kanako, Keiichi Mochida, Yukiko Yamazaki, and Yasunari Ogihara. "Transcriptome analysis of salinity stress responses in common wheat using a 22k oligo-DNA microarray." Functional & Integrative Genomics 6, no. 2 (2005): 132–42. http://dx.doi.org/10.1007/s10142-005-0010-3.
Full text
9
Slovak, Marilyn L., Ya-Hsuan Hsu, Jennifer A. Otani-Rosa, et al. "Microarray-Based Genomic Profiling Facilitates Genetic Subgrouping and Detects Critical Submicroscopic Aberrations Associated with Prognosis in Pediatric Acute Lymphoblastic Leukemia (ALL)." Blood 120, no. 21 (2012): 1444. http://dx.doi.org/10.1182/blood.v120.21.1444.1444.
Full textAbstract:
Abstract Abstract 1444 Objective: Risk-adapted therapeutic categories in acute lymphoblastic leukemia (ALL) take into account several key parameters, including cytogenetics. Because accurate conventional chromosome (CC) studies in ALL are hampered by low mitotic indexes and poor chromosome morphology, fluorescence in situ hybridization (FISH) and other molecular methods such as RT-PCR are currently used to complement karyotyping. We evaluated the contribution of oligo/SNP microarrays for providing additive genetic information in ALL that is not obtained by karyotype studies. Methods: Specimens from 24 children and young adults (12 M;12 F), including 3 patients with Down syndrome (DS), were processed for pre-B ALL cytogenetics work-up plus SNP/Oligo microarray. The median age was 4 y (range, 2–21 y); 23 patients had a pre-B-cell immunophenotype. Unstimulated CC (n=23) and pre-B ALL FISH studies (n=20) were performed using standard protocols. Genomic DNA was extracted from the residual bone marrow samples and processed for genome-wide copy number analyses on the Cytoscan HD oligo/SNP microarray (Affymetrix). Results: CC detected abnormalities that allowed prognostic subgrouping in 19 (83%) of 23 patients tested; the 24th patient was not tested with CC but showed an ETV6-RUNX1 fusion on FISH. Microarray genomic profiling allowed genetic subgrouping in the 4 cases with suboptimal or non-informative CC results. Overall, microarray detected a median of 5 additional copy number aberrations (CNAs) per patient (range, 1–27), including 18 additional CNAs in a T-cell ALL patient with only deletion 9p detected by CC and FISH. The 4 most common deletions detected by array involved CDKN2A (n=10, including 4 biallelic deletions) and ETV6, SESN1/6q16.1, and IKZF1 (6 cases each); sporadic deletions involved genes affecting B-cell development, cell cycle progression, DNA repair, and tumor progression were also seen. Five of the 7 patients with ETV6-RUNX1 translocation also showed deletions or disruptions at or near these 2 loci, suggesting the presence of the “cryptic” t(12;21). No balanced translocations were detected. Clonal diversity was easily detectable by microarray; however, a case with 64 chromosomes and a case with both 2n and 4n clones were difficult to interpret. At least 1 extended area of copy neutral loss-of heterozygosity (>5 Mb) was seen in 8/24 (33%) cases, including a 17q region that encompassed IKZF3; however, in most cases the significance of these CN-LOH changes was not clear. Significant “high risk” prognostic alterations identified by array but not detected by CC included 3 CRLF2-rearragements (found in 2 of the 3 DS patients) and disruption of the IKZF1 locus (6 patients). IKZF1 deletions were detected in a 5-y-old DS-ALL patient with CRLF2-P2PY8, a 20-y-old DS-ALL patient with high hyperdiploidy, an 18-y-old patients with IGH-CRLF2 confirmed by FISH (CC failed), another 18-y-old patient with a normal karyotype, and 1 patient each with iAMP(21) and dic(9;20) ALL. Conclusion: Submicroscopic IKZF1 deletions have been associated with drug resistance and a high risk of treatment failure in ALL, signifying critically important prognostic information needed for clinical management. Accordingly, OligoSNP arrays provide a comprehensive approach for accurately identifying clinically significant abnormalities in ALL that may be missed by routine chromosome study and targeted FISH panels alone. Array testing is a highly sensitive complementary molecular cytogenetic assay that should be offered to newly-diagnosed ALL patients, especially when CC is non-informative, to facilitate genetic subgrouping and define tumor markers that may help monitor a patient's clinical course. Disclosures: No relevant conflicts of interest to declare.
10
Slovak, Marilyn L., Ya-Hsuan Hsu, Hseuh-Hua Chen, et al. "Comprehensive Workup of Myelodysplastic Syndromes: Comparing Targeted DNA Sequencing, Oligo/SNP Microarray and Higher Dimensional Flow Cytometry." Blood 120, no. 21 (2012): 2519. http://dx.doi.org/10.1182/blood.v120.21.2519.2519.
Full textAbstract:
Abstract Abstract 2519 The myelodysplastic syndromes (MDS) comprise a heterogeneous group of clonal hematopoietic diseases characterized by ineffective hematopoiesis, cytopenias, and dysplasia in the erythroid, myeloid or megakaryocytic lineages. However, MDS can be difficult to recognize when blasts are not increased. Subtle phenotypic shifts in early MDS can be detected using higher-dimensional flow cytometry, by DNA mutation profiling, or by detection of a range of large and small genomic abnormalities by genome-wide SNP microarray. We compared the diagnostic potential of these 3 modalities in a group of 33 patients >50 years old referred for workup of cytopenia (17 blood, 16 bone marrow aspirate samples). Platforms compared were an oligo/SNP 2.6 million-probe microarray (Cytoscan HD, Affymetrix), a 161-amplicon targeted exome sequencing assay that includes TET2, ASXL1, EZH2, IDH1, IDH2, JAK2, KRAS, and NRAS (Ion Torrent protocol with PCR/product harvesting using Fluidigm Access Array), and flow cytometry using a 6-color, 22-marker panel and an 8-color, 26-marker panel (BD FACS Canto II). Nine patients had increased myeloblasts consistent with MDS (up to 20% in blood or 5%–20% in bone marrow)(Group 1), 23 had cytopenia(s) without increase in blasts (Group 2); an additional patient had a B-cell lymphoma. Group 1 patients all had aberrations detected by at least 1 of the 3 modalities (Table). In Group 2, 1 patient had unequivocal alterations by all 3 methods, 8 by 2 assays, and 6 by 1 assay; the other 9 patients had no unequivocal aberrations (Table). Copy-neutral loss of homozygosity (CN-LOH) of >10 Mb was the sole genomic aberration observed in 3 cases of cytopenia without an increase in blasts (affecting 5q, 7q and 20q), whereas others had losses/gains at chromosomal sites characteristic of MDS [i.e., partial 1q trisomy, del(5q), del(7q), +8, del(13q) and del(20q)]. Genes with mutations detected by sequencing Submicroscopic gene deletions or CN-LOH detected by array Flow cytometry abnormality Group 1: Cytopenia(s) with increased blasts (n=9) ASXL1 (2) TET2 (1) KRAS (1) EZH2 (1) JAK2 (1) BRAF (3) EZH2 (3) FLT3 (2) TP53 (2) RPS14 (2) EPO (2) ASXL1 (1) ETV6 (1) Myeloid maturation (9/9) CD56 expression (5/9) Group 2: Cytopenia(s) without increased blasts (n=24) TET2 (4) ASXL1 (2) KRAS (2) IDH2 (1) BRAF (2) EZH2 (2) TET2 (2) ASXL1 (1) ETV6 (1) RPS14 (1) EPO (1) TP53 (1) Myeloid maturation (9/24) CD56 expression (1/24) Among older MDS patients with cytopenias(s) but no increase in blasts, phenotypic and genomic profiling can frequently identify aberrations similar to those seen in higher-grade MDS. Locations of some submicroscopic deletions included loci commonly implicated in MDS pathogenesis. Detection of these aberrations in peripheral blood should facilitate the diagnosis of early MDS. Disclosures: No relevant conflicts of interest to declare.
11
Maxwell, Patrick H., Candice Coombes, Alison E. Kenny, Joseph F. Lawler, Jef D. Boeke, and M. Joan Curcio. "Ty1 Mobilizes Subtelomeric Y′ Elements in Telomerase-Negative Saccharomyces cerevisiae Survivors." Molecular and Cellular Biology 24, no. 22 (2004): 9887–98. http://dx.doi.org/10.1128/mcb.24.22.9887-9898.2004.
Full textAbstract:
ABSTRACT When telomerase is inactivated in Saccharomyces cerevisiae, telomeric DNA shortens with every cell division, and cells stop dividing after ∼100 generations. Survivors that form in these senescent populations and resume growing have variably amplified arrays of subtelomeric Y′ elements. We marked a chromosomal Y′ element with the his3AI retrotransposition indicator gene and found that Y′HIS3 cDNA was incorporated into the genome at ∼10- to 1,000-fold-higher frequencies in survivors compared to telomerase-positive strains. Y′HIS3 cDNA mobility was significantly reduced if assayed at 30°C, a nonpermissive temperature for Ty1 retrotransposition, or in the absence of Tec1p, a transcription factor for Ty1. Microarray analysis revealed that Y′ RNA is preferentially associated with Ty1 virus-like particles (VLPs). Genomic copies of Y′HIS3 cDNA typically have downstream oligo(A) tracts, followed by a complete Ty1 long terminal repeat and TYA1 or TYB1 sequences. These data are consistent with the use of Ty1 cDNA to prime reverse transcription of polyadenylated Y′ RNA within Ty1 VLPs. Unmarked Y′-oligo(A)-Ty1 cDNA was also detected in survivors, reaching copy numbers of ∼10−2 per genome. We propose that Y′-oligo(A)-Ty1 cDNA recombines with Y′ elements at eroding telomeres in survivors and may play a role in telomere maintenance in the absence of telomerase.
12
Baker, Angela S., Tae-Hoon Chung, Tyler S. Pidgeon, et al. "A Comparative Analysis of Chromosome 13 Gene Expression and Copy Number Changes in Multiple Myeloma Using Array-Based Methods." Blood 106, no. 11 (2005): 1557. http://dx.doi.org/10.1182/blood.v106.11.1557.1557.
Full textAbstract:
Abstract Chromosome 13 (Δ13) abnormalities are found in greater than 50% of patients with Multiple Myeloma (MM). MM is most commonly defined by chromosome 13 monosomy or 13q loss (85%). Interstitial deletions comprise the remaining 15%. Many studies have revealed that Δ13 in MM are associated with poor survival and reduced response to therapy. Genes mapping to chromosome 13 may be involved in pathogenesis and/or progression of the disease due to loss of function from gene mutation or from epigenetic effects such as haploinsufficiency. In this study, array-based comparative genomic hybridization coupled with microarray technology (aCGH) is used to detect gene copy number loss on chromosome 13 from nine MM patient samples. Whole genome long-oligo microarrays constructed by Agilent Technologies were used which contain 40,000 genes that span the human genome with an average spatial resolution of ~75 kb. Using genomic DNA isolated from MM patients with interstitial deletions on chromosome 13, DNA was amplified, labeled and hybridized with a differentially labeled normal DNA reference to determine gene/genomic copy number changes. Arrays were analyzed to search for the minimum region of loss based upon single copy loss for a series of nearby mapping transcripts. A common region of loss of 2.2 Mb, at 13q14.2 was detected. Additionally, we investigated the correlation between genomic copy number change and the expression level for MM patients in the13q region. From an independent gene expression data set whose expression measurements were conducted with Affymetrix HG-U133A v2 microarrays, data was selected that corresponded to the samples used for current aCGH. Expression values from MM samples were divided by the mean expression values from 12 normal bone marrow samples for each gene and the resulting values were treated as surrogate ratios between MM and normal samples. Probes from both microarrays were then aligned according to their chromosomal positions and merged if their chromosomal positions overlapped. Composite chromosomal maps were generated that displayed the expression levels and copy number changes. The maps were used to differentiate chromosomal regions in 13q where copy number changes and expression levels show high correlation and regions where such correlation was not observed. Although the number of probes sampled in the expression microarray was much smaller than those in aCGH microarray, a chromosomal region of great interest, that encompasses 13q14.2, arose naturally from this analysis. Although the mechanism by which loss of 13q effects tumorigenesis in MM could be a haploinsufficiency model, we are not ruling out the presence of a tumor suppressor gene in this region. We are evaluating candidate tumor suppressor genes in the region for loss of function by mutational analysis and hypermethylation studies.
13
Ferraresso, Serena, Massimo Milan, Caterina Pellizzari, et al. "Development of an oligo DNA microarray for the European sea bass and its application to expression profiling of jaw deformity." BMC Genomics 11, no. 1 (2010): 354. http://dx.doi.org/10.1186/1471-2164-11-354.
Full text
14
Zhu, Yun, Keiko Kitamura, Akihiko Maruyama, Takanori Higashihara, and Ryoiti Kiyama. "Estrogenic activity of bio-degradation products of C-heavy oil revealed by gene-expression profiling using an oligo-DNA microarray system." Environmental Pollution 168 (September 2012): 10–14. http://dx.doi.org/10.1016/j.envpol.2012.04.005.
Full text
15
Bakku, Ranjith Kumar, Randeep Rakwal, Junko Shibato, et al. "Transcriptomics of Mature Rice (Oryza Sativa L. Koshihikari) Seed under Hot Conditions by DNA Microarray Analyses." Atmosphere 11, no. 5 (2020): 528. http://dx.doi.org/10.3390/atmos11050528.
Full textAbstract:
Higher temperature conditions during the final stages of rice seed development (seed filling and maturation) are known to cause damage to both rice yield and rice kernel quality. The western and central parts of Japan especially have seen record high temperatures during the past decade, resulting in the decrease of rice kernel quality. In this study, we looked at the rice harvested from a town in the central Kanto-plains (Japan) in 2010. The daytime temperatures were above the critical limits ranging from 34 to 38 °C at the final stages of seed development and maturity allowing us to investigate high-temperature effects in the actual field condition. Three sets of dry mature rice seeds (commercial), each with specific quality standards, were obtained from Japan Agriculture (JA Zen-Noh) branch in Ami-town of Ibaraki Prefecture in September 2010: grade 1 (top quality, labeled as Y1), grade 2 (medium quality, labeled as Y2), and grade 3 (out-of-grade or low quality, labeled as Y3). The research objective was to examine particular alterations in genome-wide gene expression in grade 2 (Y2) and grade 3 (Y3) seeds compared to grade 1 (Y1). We followed the high-temperature spike using a high-throughput omics-approach DNA microarray (Agilent 4 × 44 K rice oligo DNA chip) in conjunction with MapMan bioinformatics analysis. As expected, rice seed quality analysis revealed low quality in Y3 > Y2 over Y1 in taste, amylose, protein, and fatty acid degree, but not in water content. Differentially expressed gene (DEG) analysis from the transcriptomic profiling data revealed that there are more than one hundred upregulated (124 and 373) and downregulated (106 and 129) genes in Y2 (grade 2 rice seed) and Y3 (grade 3 rice seed), respectively. Bioinformatic analysis of DEGs selected as highly regulated differentially expressed (HRDE) genes revealed changes in function of genes related to metabolism, defense/stress response, fatty acid biosynthesis, and hormones. This research provides, for the first time, the seed transcriptome profile for the classified low grades (grade 2, and out-of-grade; i.e., grade 3) of rice under high-temperature stress condition.
16
Widiyanti, Prihartini, Hartmut Kuehn, and Soetjipto Soetjipto. "Osteoblast iron genes: real time PCR and microarray hybridization approach under hyperoxia." Journal of Basic and Clinical Physiology and Pharmacology 32, no. 4 (2021): 491–96. http://dx.doi.org/10.1515/jbcpp-2020-0471.
Full textAbstract:
Abstract Objectives Iron is essential for cell growth, differentiation, electron transfer, and oxygen transport. Hyperoxia may increase the turnover of bone matrix components with a net effect of accelerated bone growth. Although hyperoxia was claimed could increase osteoblast activity, but expression level in possible genes which play role in proliferation is still unclear. This research aims to prove the differences of expression level of transferrin receptor gene and iron regulated transporter and other genes of 7F2 under 24 h normoxia, 24 h hyperoxia, and 48 h hyperoxia and the effect of hyperoxia by using osteoblast cell culture 7F2. Methods Reverse transcriptase, real time Polymerase Chain Reaction (PCR), and microarray is used to qualitatively detect gene expression. The computer softwares such as National Center for Biotechnology Information (NCBI) data base, Software Affymetrix, DNA Strider program, Genomatix – DiAlign program, Oligo 5.0 program (Software primer design) from Wojciech & Piotr Rychlik, and Genetyx-Mac version 8.0 have been used to analyze the PCR result. Results Under 24 h hyperoxia, there were 3,884 copies of transferrin receptor mRNA per 1,000,000 copies of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA. After 24 h hyperoxia, 8,325 copies of transferrin receptor mRNA per 1,000,000 GAPDH mRNA copies were found showing 2.1-fold up regulation. After 48 h hyperoxia, there was no significant increase at the level of expression of transferrin receptor mRNA, 8,079 mRNA copies per 1,000,000 copies of mRNA were found (2.0-fold up regulation compared with 24 h normoxia). Conclusions It can be concluded that hyperoxia might have an effect on upregulating the expression of some osteoblast genes which might have an impact on osteoblast activity.
17
Shen, Li-Jing, Fang-Yuan Chen, Lan-Fang Cao, Yong Zhang, and Hua Zhong. "Functional Enrichment Analysis by David in Transgenic MYCN Zebrafish Model." Blood 120, no. 21 (2012): 5114. http://dx.doi.org/10.1182/blood.v120.21.5114.5114.
Full textAbstract:
Abstract Abstract 5114 Introduction The MYCN oncogene encodes a basic helix-loop-helix/leucine zipper (bHLH/LZ) transcription factor that is frequently overexpressed in hematologic malignancies neoplasms (including acute leukemia, T-cell lymphoma, and so on). MYCN acts as a poor prognostic marker to promote an aggressive phenotype. However, the mechanisms of action and pathways affected by MYCN are still largely unclear. Methods We induced murine MYCN gene overexpression in embryonic zebrafish through heat-shock promoter and established stable germline Tg(MYCN:HSE:EGFP) zebrafish. RNA was extracted at 3 days post fertilization from wild type (WT) and transgenic zebrafish F1 generation (TG) embryo hematopoietic cells, collected by the flow cytometer, for microarray analysis. The samples were processed and subsequently analyzed in triplicate on Zebrafish Oligo Microarrays (Agilent Technologies), containing 43, 554 sets of probe, at the Advanced Throughput Inc. The microarrays were scanned in an Agilent DNA Microarray Scanner and the images were processed using Feature Extraction software. A False Discovery Rate≤0. 05 for overall interactions effect and P<0. 001 between comparisons were used to determine differentially expressed genes (DEG). Ingenuity Pathway Analysis and DAVID performed the functional analysis of DEG. Results Microarray analysis revealed 626 (342 genes up-regulated and 284 genes down-regulated) DEG that showed >2-fold change in TG comparing with that of WT. Using functional enrichment analysis by DAVID, several signaling pathways were regulated in TG samples (Table 1). MAPK signaling pathway was high activated through FGF, PDGF, BDNF and CACN high expression, promoting up-regulated of Ras and MKP, enhancing phosphorylation and leading to increase of cells proliferation. TGFβ signaling was inhibited by up-regulation of IFN Ã and Smad 6/7, which negative control of TGFβR and Smad 2/3. Further, we found that MYCN enhances the expression of skp2, via decreased p21 and increased CDK2, promoting cell cycle progression (Fig. 1). In addition, overexpression of MYCN weakened the function of mismatch repair, base excision repair, while increased apoptosis pathway mediated by p53 (up-regulated Bid gene). Meanwhile, Glycolysis/gluconeogenesis pathway was significantly up-regulated in TG fish. Conclusions Overexpression of MYCN induced up-regulation of cell proliferation and Glycolysis/gluconeogenesis pathway (as the Warburg effect in rapidly proliferating tumors), attenuation of repair function, all of which are phenomena associated with proliferation and malignancies transformation of blood cell feature. We found that MYCN down-regulates p27kip1, p57kip2 and p21cip1 through up-regulate Skp2, thus up-regulates CDK2, CycA, CycB, CycD and CycE. All above changes shortened the time taken to progress through the cell cycle. Increased MARK signaling and decreased TGFβ signaling pathways also contributed to promote cell cycle. (Red star marks the up-regulated genes). Disclosures: No relevant conflicts of interest to declare.
18
Zhang, Chunlei, Baoqiang Li, Rakhshandra Talpur, C. Cameron Yin, and Madeleine Duvic. "Biomarkers of Vorinostat Resistance in Cutaneous T-Cell Lymphoma." Blood 110, no. 11 (2007): 1381. http://dx.doi.org/10.1182/blood.v110.11.1381.1381.
Full textAbstract:
Abstract Profiling gene expression with DNA microarray technology has elucidated novel therapeutic targets and led the approval of a number of targeted therapeutic agents for the treatment of cancer. Vorinostat (suberoylanilide hydroxamic acid, SAHA) is a pan-histone deacetylase (HDAC) inhibitor that has demonstrated an overall response rate of approximately 24–30% in two phase II studies of cutaneous T cell lymphoma (CTCL) patients. There are currently no known specific biomarkers to indicate resistance to vorinostat. To identify genes resistant to vorinostat we compared profiles using the Aligent whole human genome oligo microarrays containing ∼41,000 genes/transcripts in vitro in vorinostat-resistant MJ and -sensitive HH CTCL cell lines treated with 1 μM of vorinostat for 24 hours and compared them to patients’ peripheral blood mononuclear cells (PBMCs) before and during oral therapy. There were 3151 (7.7%) genes/transcripts differentially expressed in vitro in treated resistant MJ cells compared to untreated vehicle control (p < 0.001). We also studied differential gene expression in two clinically resistant Sézary patients’ PBMCs taken at baseline and four weeks after oral vorinostat (400 mg daily or 300 mg bid 3 days/wk). In patients’ PBMCs, 585 (1.4%) and 2744 (6.7%) differentially expressed genes/transcripts (p < 0.001) were identified, respectively. Genes that were up-regulated both in vitro and in vivo included a tumor necrosis factor receptor super-family member 11a (TNFRSF11a or RANK), matrix metallopeptidase 9 (MMP9), suppressor of cytokine signaling 3 (SOCS3), vinculin (VCL) and KIAA1840. Genes that were down-regulated in both included adenylate kinase 3-like 1 (AK3L1), leucine rich repeat and fibronectin type III domain containing 4 (LRFN4), and AL359650. Increased RANK, MMP9 and SOCS3 mRNA expression in MJ compared to HH cells and in three resistant versus three vorinostat responding Sézary patients’ PBMCs was confirmed using quantitative real-time PCR. In conclusion, our results suggest that oligonucleotide microarray analysis may identify biomarkers of resistance to vorinostat which would be helpful to select patients who may not benefit from treatment. These findings provide the rationale for future functional studies and development of more effective use of HDAC inhibitors for CTCL patients.
19
Le Bousse-Kerdiles, Marie-Caroline, Christophe Desterke, Carole Tonetti, et al. "Microarray Functional Comparison of CD34+ and Megakaryocytic Cell Transcriptomes in Myeloid Metaplasia with Myelofibrosis." Blood 106, no. 11 (2005): 3505. http://dx.doi.org/10.1182/blood.v106.11.3505.3505.
Full textAbstract:
Abstract Myeloid Metaplasia with Myelofibrosis (MMM) is a myeloproliferative disorder (MPD) associating ineffective and extramedullary hematopoiesis with progressive splenomegaly, bone marrow fibrosis and neoangiogenesis. The myeloproliferation is characterized by an increased number of circulating CD34+ cells with the prominent amplification of dystrophic megakaryocytes (Mk). We compared the transcriptome of CD34+ and Mk cell from the peripheral blood (PB) of MMM patients and from the PB and bone-marrow (BM) of unmobilized healthy donors. Application of multivariate analyses (principal component analysis and classification by partitioning around medoids algorithm) on Gene Ontology annotation of differential genes allowed a global functionally approach of the main cellular dysregulated pathways in MMM. Each sample cRNA probe was individually and differentially hybridized to the cRNA reference probe on a Human Oligo-microarray 22K (Agilent) and data were normalized by application of the local LOWESS algorithm. Comparison of the CD34+ cell transcriptome between MMM and healthy donors revealed a global down regulation of 2/3 of the expressed genes in contrast to 1/3 of genes that are up-regulated after data filtration by significance analysis microarray (SAM) algorithm (threshold p&lt;0.01). The down-regulation mainly concerns genes involved in hematopoiesis inhibition such as interferon pathway and of lymphoid and apoptotic functions such as BCL6. Such a downregulation is in favour of a lost of survival/proliferation suppression signals rather than of a positive activation process. Up regulated genes included genes linked to Mk differentiation/function, hemostasis and migration process such as tetraspanines and chemokines. In contrast to CD34+ cell, comparison of the transcriptomes from MMM and control Mk revealed an approximate equal number of down- and up-regulated genes after data filtration by Student test algorithm at p-value threshold p&lt;0.05. The gene expression profile of MMM Mk cell exhibited an intense metabolic disturbance (16S proteasome), infidelity of DNA repair compensated by an increase in the control of DNA damage (RINT-1) and possible disturbance of the angiogenic message as show by the down regulation of the TNNI3 troponin. Modulation of these genes might participate in the dysmegakaryopoiesis and the angiogenesis that features MMM. Comparison of CD34+ and Mk cell transcriptomes from patients and healthy donors shows that the two populations exhibit distinct expression profiles. No common differential genes that could be a unique signature of MMM have been identified, confirming the multifactorial and multistep feature of this heterogenous disease. Our data are in agreement with the main pathological features of MMM, especially concerning key genes involved in cell cycle status, proliferation, mobilization and transduction pathways. Furthermore, among these differentially expressed genes, the CD9 tetraspanine and FLT3 genes could be individualized and might represent molecular markers for the diagnosis of JAK2 V617F negative MMM and to distinguish MMM from other MPD.
20
Castro, F. O., S. Sharbati, L. L. Rodríguez-Alvarez, J. F. Cox, C. Hultschig, and R. Einspanier. "49 REPROGRAMMING OF MICRO RNA IN BOVINE CLONED ELONGATED EMBRYOS." Reproduction, Fertility and Development 22, no. 1 (2010): 182. http://dx.doi.org/10.1071/rdv22n1ab49.
Full textAbstract:
MicroRNAs (miRNA) are key regulators of gene expression in vertebrate development; however, little information exists about their expression in pre-implantation mammalian embryos. We studied the expression of miRNA in bovine cloned and IVF-elongated embryos using microarrays and quantitative RT-PCR (qRT-PCR). Day-7 IVF or handmade cloned blastocysts from an adult cell line that previously yielded live cloned calves were transferred to synchronized heifers and recovered at Day 17 as elongated embryos. MicroRNAs were purified using miRVANA kit+Flash Page fractionator column (Ambion, Austin, TX, USA) coupled to amine reactive dyes CyDye™ or used in qRT-PCR. Arrays were custom-made from 271 mice, human, and rat and 104 predicted miRNAs. After overnight hybridization, slides were scanned and data analyzed. Only miRNAs showing hybridization in 3 out of 6 features per slide were considered to be expressed. MicroRNAs were simultaneously converted to complementary (c)DNA and elongated using miRNA-specific DNA-oligo with 5′ overhang and primer extension by reverse transcription, followed by SYBR Green qPCR with another miRNA-specific primer and an excess of universal forward and reverse primers. The qPCR were normalized against 5S rRNA. Data were analyzed using Kruskal-Wallis nonparametric test for P-values < 0.05. Cloned (n = 48) and IVF (n = 28) blastocysts were transferred into 10 and 4 surrogate cattle, and 42 elongated embryos were recovered; 13 of these with embryonic disc were used for miRNA extraction and analysis. In experiment 1, miRNA profiling (1 slide) from 4 cloned embryos and donor cells yielded 34 and 22 miRNAs expressed in the embryos and cells, respectively. In experiment 2 (differential expression; 3 replicates), 39 miRNAs were expressed in cloned embryos and 32 in IVF embryos. Fifteen of these miRNAs were differentially expressed: 7 were up-regulated in the cloned elongated embryos and 8 in the elongated IVF embryos. The profiles of miRNA expression of cloned embryos, IVF embryos, and the donor cells were compared and reprogramming patterns analyzed. Reprogramming means similar expression among cloned and IVF embryos, but different from the somatic cells. Overall, 50 miRNAs were subjected to nuclear reprogramming; 31 (62%) were reprogrammed correctly, 10 aberrantly (20%), and 9 were not reprogrammed (18%). Most of the aberrantly reprogrammed miRNAs (90%) were switched on after nucleus transfer. Some of the reprogrammed miRNAs clustered in the same genomic location. Based on microarray data, 3 miRNAs over-expressed in the IVF embryos (let7-b, miR-200c, and miR-24), and 1 equally expressed (miR-16) and 2 over-expressed in the cloned embryos (miR-21 and miR-103) were analyzed by qRT-PCR. Expression of all the assayed miRNAs except miR-200c correlated adequately with microarray data (Pearson coefficient of correlation R2 = 0.9; P = 0.01). Here we present the first description of miRNA expression and reprogramming in bovine elongated cloned embryos. This can have profound implications for the understanding of nuclear reprogramming in somatic cloning.
21
Usvasalo, Anu, Riikka Räty, Arja Harila-Saari, et al. "Acute Lymphoblastic Leukemia with “Normal” Karyotype is not without Genomic Aberrations." Blood 112, no. 11 (2008): 1491. http://dx.doi.org/10.1182/blood.v112.11.1491.1491.
Full textAbstract:
Abstract Development of cytogenetic methods has contributed to the understanding that ALL is not a homogenous disease. Detection of structural and numerical alterations in the chromosomes of lymphoblasts has identified several different ALL subgroups. G-banding reveals about 60–70% of these changes. The development of FISH and PCR methods has decreased the proportion of apparently normal karyotype to less than 20%. Still a part of ALL patients have no chromosomal aberrations detected with conventional cytogenetics. It seems likely, however, that ALL with a normal karyotype reflects rather our inadequate capability to detect all possible aberrations than a true normality of the lymphoblast genome. Microarray methods offer an effective tool to define novel cytogenetic changes in ALL. In our study characterizing and evaluating ALL in adolescents and young adults aged 10–25 years in Finland, we analyzed patients diagnosed during 1990–2007 (n=231). Eighty-nine patients had normal (n=80) or failed (n=9) karyotype at diagnosis. DNA from initial samples was available for 27 of these 89 patients. 26 patients had normal karyotypes, for one patient the karyotype analysis failed by G-banding at diagnosis. The key clinical characteristics of the 27 patients did not differ from the rest of the patients with normal or failed karyotype. Genomic DNA was extracted from diagnostic bone marrow samples. Digestion, labeling and hybridization of DNA was performed according to the Agilent protocol version 2.0 for 44K arrays. Labeled samples were hybridized against gender matched reference DNAs to Human Genome CGH 44B oligo microarray slides (Agilent Technologies Santa Clara, CA, USA). For data-analysis Agilent’s CGH Analytics software version 3.5 was used. The starting and ending points of the aberrations were confirmed by the ADM-2 algorithm with 10.0 threshold. The immunophenotype of the patients was as follows: T-cell ALL 8/27 patients, precursor B ALL 13/27, mixed lineage 5/27 (according to the European Group for the Immunological Characterization of Leukemias), not known 1/27. Seventeen patients had normal karyotype and no other marker for MRD follow-up, while 9 patients had either immunoglobulin and/or T-cell receptor gene rearrangement (n=8) or over-expression of Willms Tumor gene 1 (WT1) (n=1). In total 58 aberrations were detected in the 27 patient samples (1–7 aberrations per sample, mean 2.1) (Figure 1). Four samples (15%) did not show any aberration (two with immunoglobulin and/or T-cell receptor gene rearrangements). Losses were detected in 20/27 cases and gains in 10/27 cases. Cases with losses only were more frequent (n=13, 48%) than those with gains only (n=3, 11%). Losses were more numerous than gains (44/20 vs. 14/10). Single aberrations were seen in seven patients. Five of these were deletions affecting 9p21.3, two were gains in 21q. In the 27 cases, the most commonly detected aberrations were deletions involving 9p21.3 (n=10), 5/10 (50%) being T-ALL. In all the 10 cases the CDKN2A gene was affected. Other aberrations seen more than once were deletion of 6q (n=4), amplification of the terminal part of 21q (n=3), amplification of 1q (n=2), deletion of 12p (n=2), deletion in 12q23-q24 (n=2), deletion in 16q22 (n=2), deletion in 17q11 (n=2) and deletion in 22q11 (n=2). Nineteen relatively small aberrations (about 2 Mb or less in size) were detected in 15 cases and such deletion was found to be the only aberration in 4/15 cases. Our data indicate that a subgroup of ALL with fully normal cytogenetics may not exist. Microarray CGH shows a clear benefit in more detailed examination of the blast cell DNA. In 85% (23/27) of the patients with initially normal karyotypes we determined single or multiple aberrations with array CGH. Losses were more frequent than gains. Seven patients (26%) had only a single aberration, three of these being submicroscopic (&lt;200 kb).We conclude that microarray CGH enables to detect molecular-genetic changes also in ALL cases having a “normal” karyotype using conventional cytogenetics. We are getting closer to the point where normal molecular-genetic findings do not exist in leukemic lymphoblasts. Figure 1. DNA copy number alterations detected with array CGH in 27 adolescent ALL patients with initially normal or failed karyotype. Vertical lines to the left and right of each chromosome represents copy number losses and gains, respectively. Figure 1. DNA copy number alterations detected with array CGH in 27 adolescent ALL patients with initially normal or failed karyotype. Vertical lines to the left and right of each chromosome represents copy number losses and gains, respectively.
22
Schultz, Roger A., Theresa C. Brown, Lynda J. Campbell, et al. "Detection of Copy Number Alterations in DNA Repair/Repair-Related Genes for a Diversity of Hematologic Malignancies Identifies Disease-Specific Biomarkers of Potential Clinical Relevance." Blood 120, no. 21 (2012): 2531. http://dx.doi.org/10.1182/blood.v120.21.2531.2531.
Full textAbstract:
Abstract Abstract 2531 DNA repair and repair-related genes encode molecules that function as critical guardians of the genome, both in terms of chromosome stability and single base integrity. Defects in such functions, both inherited and acquired, represent key factors that contribute to the etiology of cancer (e.g., RB1, TP53 and ATM). Copy number alterations (CNAs) in such genes have been described for one or more hematologic malignancies and disease-specific testing is routinely employed for the detection of these important diagnostic/prognostic markers. Additional DNA repair genes have been implicated as potential factors influencing the onset, progression, and/or chemo-resistance of disease. In the present study, we analyzed 155 DNA repair/repair-related genes for CNAs in 425 cases of hematologic malignancy using microarray analysis. Cases represented nine distinct clinical entities with at least 30 cases per entity. Disorders represented include myelodysplastic syndrome (MDS), chronic lymphocytic leukemia (CLL), myeloproliferative neoplasm (MPN), chronic myeloid leukemia (CML), B-cell and T-cell acute lymphoblastic leukemia (B-ALL, T-ALL), acute myeloid leukemia (AML), non-Hodgkin lymphoma (NHL), and multiple myeloma (MM). An oligo-based microarray platform was employed with higher density coverage for the DNA repair/ repair-related genes (1 probe/0.2–7.0 kb). Results were assessed relative to multiple databases of known benign variation. A proof of principal analysis included RB1, TP53 and ATM, for which genomic alterations and disease preference have been well established. Analysis of RB1 revealed CNAs in 74 cases (4 gains and 70 losses) (17.4% of total) with copy gains uniformly attributable to trisomy 13 in cases of B-ALL. As expected, loss of RB1 typically reflected either monosomy 13 (31/70 seen predominately in MM) or smaller deletions (∼1 Mb, seen in CLL). CNAs in TP53 included 2 gains and 42 losses (10.4% of total), with gains again related to trisomy (exclusively hyperdiploid B-ALL), whereas deletions varied in size and disease association. CNAs in the ATM included 28 gains and 19 losses (11.1% of total). Gains reflecting trisomy correlated with diverse diagnoses, while more focal gains (∼10 Mb) were seen exclusively in B-ALL (3 cases). Not surprisingly, small losses of ATM (<10 Mb) occurred almost exclusively in CLL. Thus, microarray findings for these classic tumor suppressor genes correlated well with disease specificity for alterations submicroscopic in size (<10 Mb). An additional 152 DNA repair/repair-related genes were analyzed and a number of genes showed disease-specific correlations for submicroscopic CNAs. For example, deletion of ERCC5 was seen in B-ALL (2 cases); however, co-deletion of ERCC5 and LIG4 was confined to NHL (3 cases). Smaller deletions involving a number of other genes also occurred specifically in NHL (GTF2H4, POLQ, REV1L, FANCL, BRCA2, and NUDT1). While abnormalities in TERT were infrequent (21 gains and 4 losses) and nearly always associated with aneuploidy, an intragenic duplication of three exons was seen in a single case of diffuse large B-cell lymphoma with a history of failed therapy. Regarding AML, deletion of UBE2V2 was seen in a case exhibiting numerous multi-megabase amplifications, a potential consequence of dysregulated DNA replication. AML-specific CNAs include deletions of RPA2 that always associated with translocation-positive cases (PML/RARA; MLL/MLLT3; MLL/MLLT4), and deletions of APTX (reduced expression correlates with favorable therapy response), as well as an intronic duplication within MGMT (therapy resistance associates with overexpression). Smaller CNAs involving ALKBH3 were seen specifically in MM (3 cases), while deletions of ALKBH5 impacting nearby TOP3A were seen in MDS (2 cases). Additional genes in which recurrent CNAs were associated with multiple disorders included NEIL1, PMS2, ENDOV, CHEK2, and HELQ. The data reveal CNAs in DNA repair and repair related genes; many are recurrent abnormalities that exhibit disease specificity. The findings are consistent with previous data addressing biological function, disease progression and response to therapy. Further study is warranted to validate these alterations as diagnostic/prognostic biomarkers or as predictive biomarkers useful in directing more personalized treatment decisions. They may also represent potential new targets for therapy. Disclosures: Schultz: Signature Genomic Laboratories, PerkinElmer Inc.: Employment. McDaniel:Signature Genomic Laboratories, PerkinElmer Inc.: Employment. Shaffer:Signature Genomic Laboratories, PerkinElmer Inc.: Employment, Equity Ownership. Ballif:Signature Genomic Laboratories, PerkinElmer Inc.: Employment, Equity Ownership.
23
Ren, Ke, Svetlana I. Novikova, Fang He, Ronald Dubner, and Michael S. Lidow. "Neonatal Local Noxious Insult Affects Gene Expression in the Spinal Dorsal Horn of Adult Rats." Molecular Pain 1 (January 1, 2005): 1744–8069. http://dx.doi.org/10.1186/1744-8069-1-27.
Full textAbstract:
Neonatal noxious insult produces a long-term effect on pain processing in adults. Rats subjected to carrageenan (CAR) injection in one hindpaw within the sensitive period develop bilateral hypoalgesia as adults. In the same rats, inflammation of the hindpaw, which was the site of the neonatal injury, induces a localized enhanced hyperalgesia limited to this paw. To gain an insight into the long-term molecular changes involved in the above-described long-term nociceptive effects of neonatal noxious insult at the spinal level, we performed DNA microarray analysis (using microarrays containing oligo-probes for 205 genes encoding receptors and transporters for glutamate, GABA, and amine neurotransmitters, precursors and receptors for neuropeptides, and neurotrophins, cytokines and their receptors) to compare gene expression profiles in the lumbar spinal dorsal horn (LDH) of adult (P60) male rats that received neonatal CAR treatment within (at postnatal day 3; P3) and outside (at postnatal 12; P12) of the sensitive period. The data were obtained both without inflammation (at baseline) and during complete Freund's adjuvant induced inflammation of the neonatally injured paw. The observed changes were verified by real-time RT-PCR. This study revealed significant basal and inflammation-associated aberrations in the expression of multiple genes in the LDH of adult animals receiving CAR injection at P3 as compared to their expression levels in the LDH of animals receiving either no injections or CAR injection at P12. In particular, at baseline, twelve genes (representing GABA, serotonin, adenosine, neuropeptide Y, cholecystokinin, opioid, tachykinin and interleukin systems) were up-regulated in the bilateral LDH of the former animals. The baseline condition in these animals was also characterized by up-regulation of seven genes (encoding members of GABA, cholecystokinin, histamine, serotonin, and neurotensin systems) in the LDH ipsilateral to the neonatally-injured paw. The largest aberration in gene expression, however, was observed during inflammation of the neonatally injured hindpaws in the ipsilateral LDH, which included thirty-six genes (encoding numerous members of glutamate, serotonin, GABA, calcitonin gene-related peptide, neurotrophin, and interleukin systems). These findings suggest that changes in gene expression may be involved in the long-term nociceptive effects of neonatal noxious insult at the spinal level.
24
Caliendo, Irene, Rosanna Di Concilio, Paolo Danise, et al. "Myelodisplastic Syndrome with Trysomy 21 IN A Patient with Constitutional Submicroscopic 21Q22 Deletion." Blood 114, no. 22 (2009): 4831. http://dx.doi.org/10.1182/blood.v114.22.4831.4831.
Full textAbstract:
Abstract Abstract 4831 Introduction Previous studies showed that chromosomal and genomic aberrations leading to activation of oncogenes or haploisufficiency of tumor suppressor genes are well-known pathogenic mechanisms in cancer. Additional copies of chromosme 21 are frequently found in Myelodisplastic Syndrome (MDS) and in Acute Myeloid Leukemia (AML); the presence of these chromosomal abnormalities and the high incidence of acute leukemias in subjects with constitutional trisomy 21, suggest that genes on chromosome 21, including RUNX1/AML1, play a particular role in leukemogenesis and hematopoiesis. We describe a patient with syndromic trombocytopenia ( average platelet count= 70000/mm3), psychomothor delay, microcephaly and low stature, that developed a progressive anemia and became transfusion-dependent at seventeen years of age. Materials and methods Cytogenetic analysis was performed on bone marrow cells and on peripheral blood lymphocytes, with standard techniques and evaluated with Giemsa-trypsin-Giemsa banding according to International System for Human Cytogenetic Nomenclature (ISCN 2005). Fluorescent In Situ Hybridization (FISH) experiments was performed on bone marrow samples with LSI AML1/ETO Dual Color, Dual Fusion Translocation and, at the same time, the High-resolution oligo array-CGH (Agilent Human Genome CGH Microarray 44B) was performed on the DNA of the patient. Results The bone marrow cells showed marked dysplastic morphology and the following abnormal karyotype: 46,XX[14]/47,XX,+21[6]; the peripheral blood karyotype was normal. The High-resolution oligo array-CGH demonstrated a constitutional de novo microdeletion of one chromosome 21. The interstitial deletion was found to be approximately 4,4Mb (Megabases), extending from 32,29 Mb to 36,51 Mb on band 21q22.11-12, involving MRAP, IFNAR2, IFNGRR2, KCNE2, KCNE1 and RUNX1 genes. The FISH performed on bone marrow cells, revealed two orange signals representing normal copies of ETO and one green signal for AML1 in 60% interphase cells and two orange signals and two green signals in the remaining 40% cells. The first pattern of signals, for AML1, is related to cells with karyotype 46,XX, while the second pattern of signals is related to cells with karyotype 47,XX,+21. These results indicate that in the myelodisplastic clone the third chromosome 21 are not deleted on band 21q22. Conclusion Three cases were recently published of syndromic thrombocytopenia with 21q22 constitutional deletion, including RUNX1, and variable degree of dysmorphic features and mental delay. One of the three patients developed LMA at the age of six years. Our results further support the fundamental role, in the pathogenetic mechanism of syndromic trombocytopenia and MDS/AML, of the numerical abnormalities of chromosome 21 associated with submicroscopic rearrangement of RUNX1 and other dosage-sensitive unknown genes on chromosome 21. Disclosures No relevant conflicts of interest to declare.
25
Slovak, Marilyn L., Yi Ning, Lei Yu, et al. "Targeted Microarray Analyses Augment the Clinical Cytogenetic Diagnosis of Acute Lymphoblastic Leukemia (ALL): Submicroscopic Genetic Events Improve Diagnosis, Contribute to Risk Stratification, and Provide Genetic Markers for Minimal Residual Disease (MRD) Testing." Blood 116, no. 21 (2010): 2690. http://dx.doi.org/10.1182/blood.v116.21.2690.2690.
Full textAbstract:
Abstract Abstract 2690 Cytogenetic aberrations are key diagnostic and prognostic markers in ALL; however, suboptimal chromosome morphology, low lymphoblast mitotic activity in cell culture and the inability to detect subtle (≤ 5∼10 Mb) abnormalities often preclude a rapid and accurate ALL clinical cytogenetic workup. Recent genome-wide microarray studies have reported submicroscopic DNA copy number alterations (CNAs) in ALL that target key genes involved in B-cell and T-cell cellular processes (cell cycle regulation, differentiation, proliferation and survival) and alterations of these genes are rapidly being associated with clinical treatment and outcome (e.g., IKZF1, NUP214/ABL1, NUP214/SET, PTEN, PTPN2). To improve the cytogenetic diagnosis of ALL, we analyzed DNA samples from 22 newly-diagnosed, pediatric T-cell and 22 B-cell (16 newly diagnosed and 6 relapse) ALL patients (pts) using a 133K targeted oligo-based microarray. The aCGH results were compared to their cytogenetic, FISH and clinic-pathological findings. When sufficient material was available, locus-specific FISH studies were performed to confirm the submicroscopic CNAs. The 22 pediatric T-cell samples, obtained from the COG Cell Bank, showed the following karyotypes: del(6q) alone (n=10), del(6q) with one or two additional abnormalities (n=8), or normal karyotypes (n=4). The B-cell ALL karyotypes showed one to three abnormalities (n=10), ≥5 abnormalities (n=10), including hypodiploidy/hyperdiploidy/near-triploid/near tetraploidy, or normal karyotypes (n=2). Twelve B-cell ALL pts showed prognostically-significant translocations. By aCGH, CNAs were observed in all 44 cases, ranging from five to14 (median, 8) CNAs in T-cell and three to 35 (median, 10) CNAs in B-cell ALL. aCGH detected del(6q) in all 18 known T-cell pts (size range, 16.8 kb to 106 Mb) and in six B-cell pts. Submicroscopic aberrations detected in T-cell ALL included: CDKN2A (mono or bi-allelic) deletions (n=19), ranging in size from 24 kb to 6.76 Mb, including 6 focal deletions under 200 kb, a ∼77 Kb deletion in 1p33, resulting in a STIL/TAL1 fusion (n=8), other TAL1 or STIL deletions (n=3), PTEN deletions (n=6) ranging from 15 kb to 1 Mb (n=6), 49 kb biallelic GSTT1 deletions (n=4), and TLX3 rearrangements (n=2) including a case with a ABL1/NUP214 fusion and a focal biallelic PTPN2 deletion. Cryptic deletions in 4q31.3/FBXW7 and in 9q34 resulting in a SET/NUP214 fusion and duplication of MYB were observed in a single case. In B-cell ALL, recurring “cryptic” deletions were of IKZF1 (n=6), TOX (n=3), PAX5 (n= 5) CDKN2A (mono- or bi-allelic) (n=10), ETV6 (n=6), BTG1 (n=4), C20orf94 (n=3), EBF1 (n=2), TP53 (n=2), and miR650 (n=2). Single CNAs observed in B-cell ALL included: CDKN2C, LCK, BTLA, MECOM, TBL1XR1, AFF1, LEF1, HEF, RAG1, ATF7IP, JAK2, PTEN, ID4, CASC3, COMMD1, and the drug receptor gene NRCC1. Gains observed in residual or relapsed B-cell ALL were MYC, MLL, miR657, and at 13q31.3, which includes GPC5 and multiple miRNAs (latter also seen in three cases of T-cell), and PPP2R5A in a t(4;11) pt. Imbalances in TRG (7p14), TRB (7q34), and TRA/TRD (14q11.2) were noted in T-cell pts whereas IGH, IGK and/or IGL were clearly seen in B-cell pts. Three translocations, t(9;22), t(4;11) and t(12;21), were also detected by microarray using linear amplification followed by aCGH. These findings demonstrated that aCGH can improve the cytogenetic diagnosis of ALL, contribute to risk stratification, and provide genetic markers for MRD testing. Moreover, these results provide a rationale for the integration of targeted microarray technology in the clinical evaluation of ALL. Disclosures: Slovak: PerkinElmer: Employment. Hunger:bristol myers squibb: Equity Ownership, Membership on an entity's Board of Directors or advisory committees; eisai: Honoraria, Membership on an entity's Board of Directors or advisory committees. Shaffer:PerkinElmer: Employment; American College of Medical Genetics Foundation: Membership on an entity's Board of Directors or advisory committees. Ballif:PerkinElmer: Employment. Schultz:PerkinElmer: Employment.
26
Saravanamuthu, Senthil Selvan, Franz von Götz, Prabhakar Salunkhe, et al. "Evidence for Polyadenylated mRNA in Pseudomonas aeruginosa." Journal of Bacteriology 186, no. 20 (2004): 7015–18. http://dx.doi.org/10.1128/jb.186.20.7015-7018.2004.
Full textAbstract:
ABSTRACT In this paper, we report the synthesis of Pseudomonas aeruginosa cDNA in the presence of oligo(dT) primers. Hybridization of oligonucleotide DNA microarrays indicates that under the experimental conditions used, at least 43.7% of the expressed genes from P. aeruginosa PAO1, representing many different functional classes, can be detected by using oligo(dT)-primed cDNAs.
27
Ishioka, C., S. Takahashi, T. Ishida, T. Moriya, and N. Ohuchi. "Expression signature of p53 status (p53 signature) for the prediction of TP53 mutation and prognosis in breast cancer." Journal of Clinical Oncology 24, no. 18_suppl (2006): 652. http://dx.doi.org/10.1200/jco.2006.24.18_suppl.652.
Full textAbstract:
652 Background: The current risk evaluation criteria, such as the St. Gallen and NIH, are not sufficient for predicting which BC patients are at high risk for recurrence and mortality. The TP53 mutations are associated with worse RFS and OS, independent other risk factors in BC, but the p53 status is not simply determined and often determined incorrectly (Soussi et al. Nat Rev Cancer 2006). Our purpose was to identify the gene sets that determine expression signature of the p53 status and to correlate the gene expression profile (GEP) with clinical outcome. Methods: Comprehensive expression analysis (Agilent 41K human genome oligo microarray) and DNA sequencing of the TP53 gene in 38 Japanese BC (30 Stage I-II, 8 stage III-IV; 20 TP53 wt, 20 TP53 mt) were performed using RNA and DNA obtained from the microdissected frozen tumor samples. We determined a gene set consisted of 33 genes from differentially expressed genes depending on the p53 status in the 26 BC (training set) and validated the ability to predict p53 status in the remaining 12 BC (test set). Prognostic value of the gene set was analyzed in 29 BC (stage I or II), and were validated using publicly available dataset of the independent 295 BC (stage I or II), van de Vijver et al. NEJM 2002). Results: The GEP using the 33 genes, many of which related in cell cycle and cell division, predicted the p53 status (wt or mt p53 signature) accurately in the test set (accuracy: 83%, overall accuracy: 95%). The p53 signature has the ability to predict RFS of the 29 early BC (Log Rank, P=0.032). It divided the 295 early BC into 176 wt and 119 mt group, and also has the ability to predict both RFS and OS (Log Rank, both P<0.0001). This was also true when the cohort were stratified by ER status, LN status, St. Gallen criteria and NIH criteria, and retained the predicted value in ER+, LN+, LN-, St. Gallen (intermediate/high) and NIH (high) subgroups (Log Rank, P<0.0001). Conclusions: The p53 signature is a powerful and independent predictor of the outcome of disease in early breast cancer than standard systems based on clinical and histologic criteria. No significant financial relationships to disclose.
28
Salgado, Rocio, Octavio Servitje, Fernando Gallardo, et al. "Genome Wide Analysis of 41 Mycosis Fungoides Tumor Stage Using Array Comparative Genomic Hybridization Technology." Blood 112, no. 11 (2008): 1769. http://dx.doi.org/10.1182/blood.v112.11.1769.1769.
Full textAbstract:
Abstract Introduction : Primary cutaneous T cell lymphomas (CTCL) represent 70% of all cutaneous lymphomas. The most frequent is mycosis fungoides/Sézary syndrome (MF/ SS). In this entity, few high resolution cytogenetic studies have been performed. Our aim was to analyze chromosomal abnormalities in MF tumoral stage by array comparative genomic hybridization (ArrayCGH) and to describe potential candidate genes related to this disease. Patients and methods : Forty-one patients (22 males/19 females) with MF tumor stage were included from centres collaborating in the EORTC Cutaneous Lymphoma Group. DNA was extracted from frozen tissues containing more than 70% of tumor cells. ArrayCGH tecnhology was performed to detect genomic imbalances (gains/losses) using the Humane Genome CGH Microarray Kit 44B (Agilent Techologies). This array consists on 44.000 oligo probes of 60 bp covering all the human genome with a mean resolution of 50–100 Kb. CGH-Analytics 3.2.25 and InSilicoArray CGH (http://isacgh.bioinfo.cipf.es) was used for array analysis and to define SORIs (Smallest Overlapping Region of Imbalance). Results: Genomic abnormalities were observed in thirty-two cases (76%). Losses (62.36%) were more frequently detected than gains (37.64%). The mean chromosomal imbalances per case were 3.5 gains (0–14) and 5.6 losses (0–30). The minimal common regions altered were gains of 7q33.3 (55%), 17q21.1q21.3 (42.5%) and 8q24.21. Regarding to the losses, 9p21.3 (42,5%), 17p13.1 (42,5%) and 10p11.22 (17,5%) were the most frequent detected. SORIs and potential candidates genes from the most frequently altered regions are summarized in the following table. Type of change Cytoband First gene start (Kbp) size (Mb) Frequency Candidate genes Loss 9p21.3 MTAP 21795 0,2 42,50% MTAP, CDKN2A, CDKN2B Loss 17p13.1 DULLARD 7094 1,01 27,5% TP53 Loss 10p11.22 chr10:031132968 31132 1,5 17,5% TCF8 Gain 7q33.3 BG495318 135521 14,1 55% BRAF Gain 17q21.1q21.3 SMARCE1 36050 4,7 42,5% STAT5A/STATB Gain 8q24.21 M13930 128816 0,75 32,5% C-MYC Conclusions : Our results have shown high recurrent chromosomal abnormalities. Moreover, arrayCGH technology has allowed us to define in detail new common regions and to describe potential candidate genes in MF tumor stage as STAT5A/STA5B (17q21.2), BRAF (7q33) and TCF8 (10p11.22). Our findings are similar to those recently published by Vermeer et al in Sézary Syndrome, which lead to confirm the relationship between these two entities. Deletion of 9p21.3 (CDKN2A, CDKN2B, MTAP genes) and 17p13.1 (TP53) are concordance to previous studies.
29
Liu, ChaoYan, Qi-Hong Sun, and Gian Paolo Visentin. "Global Gene Expression Profiles of Activated CD4+CD25high (Regulatory) and CD4+CD25− (Non-Regulatory) T Cells." Blood 106, no. 11 (2005): 3308. http://dx.doi.org/10.1182/blood.v106.11.3308.3308.
Full textAbstract:
Abstract Autoreactive T and B cells can be detected in healthy individuals but are normally kept in check by regulatory mechanisms. Among those is an active suppression of naïve T cells by endogenous T regulatory (Tr) cells. Several types of Tr cells exist, including CD4+ T cells which constitutively express the IL-2 receptor α chain (CD25), do not secrete IL-10, and suppress immune responses via direct cell-to-cell interactions. CD4+CD25+ T regulatory cells represent 5%–10% of the endogenous CD4+ T cells subset and are able to suppress CD4+ and CD8+ T cell responses in vitro and in vivo upon TCR ligation. Our recent observation that human platelet factor 4 (PF4; CXCL4) inhibits the proliferative response of human CD4+CD25− T cells, while inducing expansion of CD4+CD25+ Tr cells, and that PF4-induced CD4+CD25+ Tr cells lose their potent suppressor function in vitro, suggests a previously unrecognized role of PF4 in the regulation of immune responsiveness (Liu, et al. J Immunol174:2680–86, 2005). A large body of evidence suggests that human CD4+CD25+ Tr cells share many of the characteristics of murine CD4+CD25+ Tr cells. McHugh et al. (Immunity16:311–23, 2002), have successfully used the microarray approach to identify genes differentially expressed in resting CD4+CD25+ and CD4+CD25− mouse T cells, but with the only exception of a small preliminary report (Pati et al. Ann N Y Acad Sci. 1005:279–83, 2003), little information is available on the gene expression profile of human CD4+CD25+ and CD4+CD25− T cells. We performed global gene expression analysis using oligo-DNA microarrays (CodeLink, Amersham Biosciences) that monitor the expression of whole human genome, to define the gene expression profiles in CD4+CD25+ Tr cells stimulated by anti-CD3 mAb and exposed to PF4. CD4+ T cells were isolated from normal donor’s peripheral blood mononuclear cells by positive selection on magnetic beads (Miltenyi Biotec, Auburn, CA), then labeled with PE-conjugated anti-CD4 and FITC-conjugated anti-CD25 and sorted on a FACStar (BD Biosciences, San Jose, CA) to obtain a homogeneous population of T cells consisting of CD4+CD25+ Tr cells expressing CD25 at high levels (CD4+CD25high) and CD4+CD25− T cells (non-regulatory). Total RNA was extracted from the freshly isolated CD4+CD25high and CD4+CD25− T cells subsets, stimulated with anti-CD3 mAb in the presence or the absence of PF4 for 24 hours. Using this approach, we have identified a little over 100 genes that are differentially expressed, in the presence of PF4, in CD4+CD25+ Tr cells following activation with anti-CD3 mAb. We have focused our attention on about 40 target genes whose increased expression has been validated using real time PCR and, were appropriate, at the protein levels, by flow cytometry or Luminex 100 multiplex cytokine quantification (Table 1). Our data suggest that PF4 modulates proliferation and function of CD4+CD25+ Tr cells by the coordinate increasing expression of a relatively large number of genes, coupled with a further enhanced expression of a limited number of growth promoting genes and the specific silencing of a small subset of negative growth regulatory genes.
30
Zhou-Da, Xu, Jing Rui-Lian, Gan Qiang, et al. "Drought-tolerant gene screening in wheat using rice microarray." Chinese Journal of Agricultural Biotechnology 5, no. 1 (2008): 43–48. http://dx.doi.org/10.1017/s1479236207001969.
Full textAbstract:
AbstractTo investigate the wheat transcriptional profile under drought stress, a drought-tolerant variety of wheat (Triticum aestivum), Hanxuan 10, was treated with polyethylene glycol (PEG6000) and samples were collected at 0, 1, 6 and 24 h. Complementary DNA was labelled with fluorescent dye and hybridized with the BGI-RiceChip, a whole genome rice gene chip platform, which contains over 60 000 oligos based on the rice genome sequence. Data analysis detected 166, 207 and 328 differentially expressed genes (DGs), respectively, at 1, 6 and 24 h, indicating that the number of DGs increased with the length of the PEG treatment. Functional category analysis showed that the number of DGs related to energy metabolism pathways increased – 4.2%, 8.2% and 16.8%, respectively, as a proportion of the total number of DGs. Most of the photosynthesis-related genes were up-regulated. It is interesting to note that Psbr and ribulose-bisphosphate carboxylase (Rubisco)-coding genes were down-regulated, suggesting their potential role in the response to drought tolerance.
31
Li, Dan, Hua Li, Shoudan Liang, Jeffrey J. Molldrem, and Qing Ma. "LFA-1 Regulates CD8 + T Cell Activation and Immune Signal Network." Blood 114, no. 22 (2009): 1641. http://dx.doi.org/10.1182/blood.v114.22.1641.1641.
Full textAbstract:
Abstract Abstract 1641 Poster Board I-667 LFA-1 regulates T cell activation and signal transduction through the immunological synapse. TCR stimulation rapidly activates LFA-1, which provides unique LFA-1-dependent signals to promote T cell activation. We found LFA-1 directly participates in Erk1/2 signaling upon TCR stimulation in CD8+ T cells. The presence of LFA-1, not ligand binding, is required for the TCR-mediated Erk1/2 signal pathway. LFA-1-KO T cells have defects in sustained Erk1/2 signaling and TCR/CD3 clustering, which subsequently prevents MTOC re-orientation, cell-cycle progression and mitosis. LFA-1 regulates the TCR-mediated Erk1/2 signal pathway in the context of immunological synapse for recruitment and amplification of Erk1/2 signal. In addition, LFA-1 ligation with ICAM-1 generates an additional Erk1/2 signal, which synergizes with the existing TCR-mediated Erk1/2 signal to enhance T cell activation. We demonstrated that the function of LFA-1 is to enhance TCR signaling through the immunological synapse and deliver distinct signal in CD8+ T cell activation. Based on our results, we proposed a model of TCR-mediated and LFA-1-mediated Erk1/2 signal pathways in CD8+ T cell activation. However, the detailed molecular pathways that regulate these processes and global impact on immune functions are poorly defined. With the launching of The Immunological Genome Project, we have generated data with CD8+ T cell expression array to explore and understand the LFA-1 and TCR signaling network. GeneChip hybridization and analysis CD8+ T cells from C57BL/6 mice and LFA-1-KO mice were collected before and after stimulation. Microarray experiments were carried out using the “ Mouse Whole Genome Oligo Microarray Kit” from Agilent. Differentially expressed gene lists between samples were considered significant if their p values were <0.0001 and their fold-change >1.8. The results are summarized below: 1) 641 genes were up-regulated and 174 were down-regulated in unstimulated LFA-1-KO CD8+ T cells comparing to these in unstimulated WT CD8+ T cells; 2)1036 genes were up-regulated and 406 were down-regulated in activated LFA-1-KO CD8+ T cells comparing to these in activated WT CD8+ T cells after 1 hours stimulation with unstimulated CD8+ T cells as control; 3)636 genes were up-regulated and 354 were down-regulated in activated LFA-1-KO CD8+ T cells comparing to these in activated WT CD8+ T cells after 8 hours stimulation with unstimulated CD8+ T cells as control. To estimate which pathways are significantly enriched among the genes that are differentially expressed, we used a database IPA (Ingenuity Pathways Analysis) software. Signaling pathways enriched by the genes differentially expressed in activated LFA-1-KO CD8+ T cells vs WT CD8+ T cells after 8 hours stimulation generated the most highly enriched differentially expressed genes in signaling pathways displayed below: 1) Pattern Recognition Receptors in Recognition of Bacteria and Viruses; 2) Activation of IRF by Cytosolic Pattern Recognition Receptors; 3) Aryl Hydrocarbon Receptor Signaling; 4) IL-10 Signaling; p38 MAPK Signaling; 5) LPS/IL-1 Mediated Inhibition of RXR Function; Cell Cycle: G2/M DNA Damage Checkpoint Regulation; 6) Notch Signaling; Natural Killer Cell Signaling; 7) Cell Cycle: G1/S Checkpoint Regulation and Chemokine Signaling. Furthermore, we examined the biological functions enriched by the genes differentially expressed in activated LFA-1-KO CD8+ T cells vs WT CD8+ T cells. The LFA-1-KO CD8+ T cells vs WT CD8+ T cells after 8 hours stimulation generated the most highly enriched differentially expressed genes in following biological functions: Immunological Disease; Antigen Presentation; Cell-mediated Immune Response; Humoral Immune Response; Inflammatory Response; Cellular Development; Cell-To-Cell Signaling and Interaction; Hematological System Development and Function; Immune Cell Trafficking; Cellular Growth and Proliferation; Inflammatory Disease; Cellular Movement; Hematopoiesis Cell Death; Hematological Disease; Lymphoid Tissue Structure and Development; Infectious Disease; Tissue Development and Cancer. Our results indicate that LFA-1 plays an important role in the immune signal network and has a global impact on immune system. Disclosures No relevant conflicts of interest to declare.
32
Masri, Azzah Al, Tammy Price-Troska, Marta Chesi, et al. "MicroRNA Expression Analysis in Multiple Myeloma." Blood 106, no. 11 (2005): 1554. http://dx.doi.org/10.1182/blood.v106.11.1554.1554.
Full textAbstract:
Abstract Introduction: The analysis of what goes awry in a malignant cell has focused primarily on mutations of protein-encoding genes and their regulatory sequences. However, recent work on microRNA (miRNA) has shed light on the possible involvement of miRNA genes in human disease. miRNA are small “noncoding” or “non-messenger” RNAs of about 21–25 nucleotides in length that function as regulators of gene expression essentially by pairing to the mRNA of protein-coding genes to initiate mRNA degradation or repression of translation. We are interested in characterizing miRNA expression profiles in human myeloma cell lines (HMCLs) and myeloma patient samples. Multiple myeloma (MM) is a plasma cell tumor characterized by frequent chromosomal translocations. Materials and methods: The expression of miRNA in HMCLs, primary MM cells (hyperdiploid samples) and normal plasma cells was determined using human microRNA chips. The GenoExporerTM Human microRNA chips were developed by GenoSensor (Tempe, AZ) and the microarray contains 226 human microRNA sequences in addition to control sequences. The DNA oligo probes are synthesized and immobilized on the chips (1”x 3” standard glass microslide). The probes are designed based on the active mature miRNA sequences and some of their flanking sequences. Our analysis included seven myeloma patients (hyperdiploid MM), eight different HMCLs (MM1, 8226 with t(14;16); SKMM2, U266, INA-6 with t(11;14) and H929, KMS11, UTMC-2 with t(4;14)), and eight normal human plasma cells. The normal human plasma cells were collected at Mayo Clinic Rochester from bone samples of patients undergoing orthopedic surgery. For the assay 5–10 μg of total RNA per sample were used at a concentration of 1 μg/μL. The RNA is directly labeled with biotin and used as a target for the on-chip hybridization assays. A streptavidin-Alexa dye is used to stain the hybridized targets and the fluorescent signals are captured and analyzed. The gene signal intensities were normalized to tRNA signal intensity. Results: The primary MM cells and HMCLs displayed a distinctive miRNA expression profile compared with normal plasma cells. Using the GeneSpring 7 (Agilent Technologies, Palo Alto, CA) for gene expression analysis we have identified miRNA genes with significant variation in expression levels between tumor and normal samples including miR-125b, miR-133a, miR1, and miR-124a (p&lt;0.01). Recently defined algorithms were used to identify putative targets for the miRNA genes of interest such as leukemia inhibitory factor (LIF) as targets of miR-125b and Stat3 and angiopoietin-1 precursor as targets of miR-124a (Lewis et al. 2003). Of note, miR-15 and miR-16, previously identified to be downregulated in CLL, were expressed at low levels in some MM patients and HMCLs, but not in the normal plasma cells. Further analysis will be carried out to validate the data from miRNA profiling using northern blot analysis or real-time RT-PCR to measure expression levels of miRNA genes and that of their target genes. Conclusion: Analysis of miRNA expression pattern (along with aCGH and gene expression profiling studies) will undoubtedly refine our understanding of the various genotypic subtypes of multiple myeloma.
33
Henderson, D. C., M. D. Reinsel, K. F. Fischer, and J. Hammond. "First Detection of Ligustrum necrotic ringspot virus, Cucumber mosaic virus, and Alternanthera mosaic virus in Mazus reptans in the United States." Plant Disease 98, no. 10 (2014): 1446. http://dx.doi.org/10.1094/pdis-03-14-0227-pdn.
Full textAbstract:
Mazus reptans N.E. Br (creeping mazus; Phrymaceae) is a perennial flowering groundcover plant. A plant of M. reptans ‘Alba’ with mild mosaic symptoms was obtained from a Maryland nursery in 2010. Electron microscopy (EM) revealed slightly flexuous particles of 595 to 674 nm in length and smaller fragments, typical of carlaviruses. This sample was analyzed using a recently-developed Universal Plant Virus Microarray (UPVM [4]), and UPVM results confirmed by RT-PCR and sequencing. For UPVM analysis, complementary DNA (cDNA) was prepared from total nucleic acid extracts using a combination of oligo(dT) and random (6- to 9-mer) primers and high copy sequences (primarily ribosomal) were reduced using duplex-specific nuclease. Treated cDNA was labeled by incorporation of amino-allyl dUTP, followed by coupling of Cy3 dye and hybridization to a UPVM slide (4). Analysis of UPVM hybridization results using associated Uchip and T-Predict software (4) identified Ligustrum necrotic ringspot virus (LNRV; Carlavirus) and Cucumber mosaic virus subgroup I (CMV sgI; Cucumovirus). To confirm the UPVM results, we used NSNC-odT (3) primed cDNA, and LNRV-specific primer Lig1 (GTTGATCCTTTAGGTTTACAGGT) paired with NSNC-odT to amplify the 3′ region of the LNRV genome. We used random-primed cDNA with generic cucumovirus coat protein (CP) primers CPTALL-5/CPTALL-3 (2), and CMV subgroup (sg)-specific primers CMV I(F)/CMV I(R) and CMV II(F)/CMV II(R) (1) to amplify the full CMV CP gene or internal portions. A ~1.35 kb PCR product from the LNRV-specific amplification was cloned, sequenced (GenBank Accession No. KJ187250), and found to have 84.6% nt identity to the LNRV-type (EU074853), with 97.0% CP amino acid (AA) identity and 94.7% nucleic acid binding protein (NABP) AA identity to LNRV-Impatiens (GQ411367) excluding an additional 14 N-terminal AA present in the NABP of both the type and impatiens isolates. CMV sgI-specific primers yielded a product of ~600 bp, and generic primers CPTALL-5/CPTALL-3 a ~940 bp product; no product was obtained with sgII-specific primers. The full CP gene product was cloned and sequenced (KJ486271), and had 99% nt identity to CMV-Fny (U20668), a subgroup I isolate, and <75% to characterized sgII isolates (5); CMV-Mazus CP had 100% AA identity to CMV-Fny, and <82.6% to the sgII isolates. One plant of purple M. reptans obtained in 2012, and four purple-flowered and three ‘Alba’ in 2014 from three separate sources, also showed mild mosaic. LNRV was detected by EM of carlavirus-like particles (2012 sample), and in all eight plants by LNRV-specific PCR and sequencing (KJ187247 for 2012 sample). Alternanthera mosaic virus (AltMV; Potexvirus) was also detected from two plants of ‘Alba’ by PCR, sequencing, bioassay (Nicotiana benthamiana, Chenopodium quinoa), and ELISA (3). To our knowledge, this is the first report of LNRV, CMV, or AltMV in M. reptans, a commonly grown groundcover plant. While CMV and AltMV are known to have wide host ranges, LNRV has previously been reported only from Ligustrum and Impatiens sp. The mild symptoms hinder symptom-based detection, and M. reptans may thus serve as a conduit for LNRV, CMV, and AltMV infection of other ornamentals. References: (1) S. Chen et al. Acta Biochim. Biophys. Sin. 43:465, 2011. (2) S. K. Choi et al. J. Virol. Meth. 83:67, 1999. (3) J. Hammond et al. Arch. Virol. 151:477, 2006. (4) J. Hammond et al. Phytopathology 102(S4):49, 2012. (5) J. Thompson and M. Tepfer. J. Gen. Virol. 90:2293, 2009.
34
YAMADA, TOMOYUKI, and SHINICHI MORISHITA. "COMPUTING HIGHLY SPECIFIC AND NOISE-TOLERANT OLIGOMERS EFFICIENTLY." Journal of Bioinformatics and Computational Biology 02, no. 01 (2004): 21–46. http://dx.doi.org/10.1142/s0219720004000454.
Full textAbstract:
The sequencing of the genomes of a variety of species and the growing databases containing expressed sequence tags (ESTs) and complementary DNAs (cDNAs) facilitate the design of highly specific oligomers for use as genomic markers, PCR primers, or DNA oligo microarrays. The first step in evaluating the specificity of short oligomers of about 20 units in length is to determine the frequencies at which the oligomers occur. However, for oligomers longer than about fifty units this is not efficient, as they usually have a frequency of only 1. A more suitable procedure is to consider the mismatch tolerance of an oligomer, that is, the minimum number of mismatches that allows a given oligomer to match a substring other than the target sequence anywhere in the genome or the EST database. However, calculating the exact value of mismatch tolerance is computationally costly and impractical. Therefore, we studied the problem of checking whether an oligomer meets the constraint that its mismatch tolerance is no less than a given threshold. Here, we present an efficient dynamic programming algorithm solution that utilizes suffix and height arrays. We demonstrated the effectiveness of this algorithm by efficiently computing a dense list of numerous oligo-markers applicable to the human genome. Experimental results show that the algorithm runs faster than well-known Abrahamson's algorithm by orders of magnitude and is able to enumerate 65%~76% of qualified oligomers.
35
Pasrija, Teena, Shawn A. Mahmud, John D. Belcher, Gregory M. Vercellotti, and Arne Slungaard. "Gene-Specific Effects of the Histone Deacetylase Inhibitor TSA on Activation of a Pro-Inflammatory Endothelial Cell Phenotype by the Major Phagocyte Peroxidase-Derived Oxidant HOSCN." Blood 112, no. 11 (2008): 1274. http://dx.doi.org/10.1182/blood.v112.11.1274.1274.
Full textAbstract:
Abstract Thiocyanate (SCN−) is, unexpectedly, the principal physiologic substrate for eosinophil peroxidase (EPO) and a major (i.e., accounting for 50% of H2O2 consumed) substrate for myeloperoxidase (MPO). The product of these reactions is HOSCN, a weak, exclusively sulfhydryl-reactive oxidant that we have previously shown to be a uniquely potent (up to 100-fold) oxidant transcriptional inducer of human umbilical vein endothelial cell (HUVEC) tissue factor (TF), ICAM-1, E-selectin, and VCAM-1 expression via a mechanism dependent upon NF-κB p65/p50 activation. Histone deacetylase inhibitors (HDACi) have recently been found capable of gene-specific transcriptional regulation by acetylating lysine residues on transcription factors, including p65. Because of previous reports of beneficial effects of the HDACi trichostatin (TSA) in vivo in murine models of SLE and asthma inflammation, we hypothesized that TSA might exert antiinflammatory effects by downregulating endothelial expression of proinflammatory mediators induced by physiologic agonists such as HOSCN. We analyzed the effects of HOSCN and TSA on the HUVEC transcriptome by incubating HUVEC monolayers (n=3, single donor-derived preparations) 4 hours in M199 medium containing 10% FCS supplemented with buffer control, 150 μM HOSCN, 100 nM TSA, or HOSCN + TSA prior to total RNA extraction and analysis using Affymetrix® U133 2.0 Plus Microarray Chips. HOSCN significantly (i.e., &gt; 2-fold) upregulated 0.5% of HUVEC genes, but most strikingly stimulated (10–100 fold) the adhesion molecules VCAM-1, ICAM-1, and E-selectin, chemokines IL-8, MCP-1, CXCL-1 and CXCL2 and COX2, all NF-kB – regulated genes. TSA suppressed 0.03% of genes in HOSCN-treated HUVEC, including, notably, VCAM-1 (but not ICAM-1), IL-8 and CCL2, and COX2. Pursuing the discordant effects of TSA upon HOSCN-stimulated VCAM-1 and ICAM-1 mRNA levels, we confirmed by qRT-PCR that HOSCN increases VCAM-1 mRNA 10–16x at 3–4 h and TSA inhibits this by 85%. In contrast, ICAM-1 mRNA increases 7x in response to HOSCN but is stimulated another 4-fold by TSA. We assessed HUVEC expression of VCAM-1 and ICAM-1 protein by western blot after a 4h exposure to 150 μM HOSCN and found them upregulated 10- and 5-fold, respectively. TSA (ED50 30 nM) suppressed HOSCN-mediated VCAM-1 expression by &gt;90% but increased expression of ICAM-1 2–3x. EMSA and anti-p50 and anti-p65 supershift confirmed HOSCN activation of p65/p50 binding to VCAM-1 and ICAM-1 sequence-derived NF-kB motif oligo probes but, paradoxically, TSA inhibited p65/p50 binding to both VCAM-1 and ICAM-1 probes. In direct contrast, chromatin immunoprecipitation using anti-p65 showed that TSA decreased HOSCN-induced p65 binding to the endogenous HUVEC genomic DNA VCAM-1 NF-kB binding site but did not diminish its binding to the ICAM-1 site. In a static adhesion assay human eosinophils bound to HUVEC exposed 4h to 150 μM HOSCN increased to 4x baseline and 1 μM TSA completely blocked this increase whereas a blocking anti VCAM-1 antibody diminished it by 50%. We conclude that the HDACi TSA is a potent and relatively specific inhibitor of several NF-kB-dependent pro-inflammatory genes, but not ICAM-1, in HUVEC activated by the physiologic oxidant agonist HOSCN. We hypothesize that differential TSA regulation of VCAM-1 and ICAM-1 may be attributable to variations in the nucleotide sequence of their NF-kB-binding motifs or, alternatively, differential recruitment of NFkB transcriptional cofactors such as p300/CBP. We propose that HDACi have significant therapeutic potential as anti-inflammatory agents, particularly in those disease states most dependent upon VCAM-1.
36
Fujiwara, Tohru, Ryoyu Niikuni, Koji Okamoto, et al. "Exploring the Potential Usefulness of 5-Aminolevulinic Acid for X-Linked Sideroblastic Anemia." Blood 124, no. 21 (2014): 215. http://dx.doi.org/10.1182/blood.v124.21.215.215.
Full textAbstract:
Abstract (Backgroun d) Congenital sideroblastic anemia (CSA) is an inherited disease; it is a microcytic type of anemia characterized by bone marrow sideroblasts with excess iron deposition in the mitochondria. The most common form of CSA is XLSA (X-linked sideroblastic anemia), which is attributed to mutations in the X-linked gene ALAS2 (erythroid-specific 5-aminolevulinate synthase). ALAS2 encodes the first and rate-limiting enzyme involved in heme biosynthesis in erythroid cells, which utilizes glycine and acetyl-coenzyme A to form 5-aminolevulinic acid (ALA) and also requires pyridoxal 5'-phosphate (PLP, vitamin B6) as a cofactor. Based on the evidence that half of the XLSA cases were unresponsive to PLP (Ohba et al. Ann Hematol 2013), ALA supplementation could emerge as an alternative therapeutic strategy to restore heme synthesis in CSA caused by ALAS2 defects. As a preclinical study, we focused our study on the effect of ALA on human erythroid cells. Furthermore, we investigated the molecular mechanism by which ALA is transported into erythroid cells. (Method ) Human K562 erythroid cells as well as human induced pluripotent stem-derived erythroid progenitor (HiDEP) cells (Kurita et al. PLoS ONE 2013) were used for the analysis. We investigated the effects of ALA (0.01, 0.1, and 0.5 mM for 72 h) on heme content, hemoglobinization, and erythroid-related gene expression. Heme content was determined fluorometrically at 400 nm (excitation) and 662 nm (emission). Small interfering RNA (siRNA)-mediated knockdown of ALAS2 was conducted using Amaxa Nucleofector™ (Amaxa Biosystems, Koln, Germany). For transcription profiling, Human Oligo chip 25K (Toray, Tokyo, Japan) was used for control and ALAS2 siRNA-treated HiDEP cells. Gamma-aminobutyric acid (GABA) (Sigma, St. Louis, MO, USA) was used at concentrations of 10 and 20 mM. (Results) First, we demonstrated that ALA treatment resulted in significant dose-dependent accumulation of heme in K562 cells. Concomitantly, the treatment substantially induces erythroid differentiation as assessed using hemoglobin (benzidine) staining. Quantitative reverse transcription-polymerase chain reaction (RT-PCR) analysis confirmed significant upregulation of heme-regulated genes such as the globin genes (HBA and HBG) and the heme oxygenase 1 (HMOX1) gene in K562 cells. To investigate the mechanism by which ALA was transported into erythroid cells, we conducted quantitative RT-PCR analysis for previously reported ALA transporters, including SLC15A1, SLC15A2, SLC36A1, and SLC6A13 (Frølund et al. Br J Pharmacol 2010; Ahlin et al. Drug Metab Dispos 2009; Moretti et al. Br J Cancer 2002). The analysis revealed that SLC36A1 was abundantly expressed in K562 and HiDEP cells. Thus, GABA was added to K562 cells to competitively inhibit SLC36A1-mediated transport (Frølund et al. Br J Pharmacol 2010). GABA treatment significantly impeded the ALA-mediated increase in the number of hemoglobinized cells. Next, siRNA-mediated knockdown of ALAS2 in HiDEP cells resulted in a significant decrease in the expression of globin genes as well as HMOX1; however, ringed sideroblasts were not observed. Microarray analysis revealed >2-fold up- and down-regulation of 38 and 68 genes caused by ALAS2 knockdown, respectively. The downregulated gene ensemble included globins (HBZ, HBG, HBE, HBD, and HBM) as well as genes involved in iron metabolism (ferritin heavy chain 1: FTH1, transferrin receptor: TFRC and glutaredoxin-1: GLRX5). Gene ontology analysis revealed significant enrichment of cellular iron ion homeostasis (p = 0.000076), cell division (p = 0.00062), DNA repair (p = 0.0006) and translation (p = 0.018), implying that heme was involved in various biological processes in erythroid cells. Interestingly, ALA treatment significantly improved the consequences of ALAS2 knockdown-mediated downregulation of HBA, HBG, and HMOX1. (Conclusion) ALA appears to enter into erythroid cells mainly by SLC36A1 and utilized to generate heme precursor. Thus,ALA may represent a novel therapeutic option for CSA, particularly for cases harboring ALAS2 mutations. Disclosures Fujiwara: Chugai Pharmaceutical, CO., LTD.: Research Funding.
37
Martin, Ruth C., Po-Pu Liu, and Hiroyuki Nonogaki. "Simple purification of small RNAs from seeds and efficient detection of multiple microRNAs expressed in Arabidopsis thaliana and tomato (Lycopersicon esculentum) seeds." Seed Science Research 15, no. 4 (2005): 319–28. http://dx.doi.org/10.1079/ssr2005220.
Full textAbstract:
MicroRNAs (miRNAs) play critical roles in the development of animals and plants. Characterizing the stage- and tissue-specific expression of miRNAs that potentially regulate target transcription factor expression is becoming more important for understanding the regulatory mechanisms of critical events during plant development. A simple method for purifying small RNAs from seeds is described, as well as an efficient non-radioactive labelling system for making miRNA probes. In Arabidopsis thaliana seed extracts, low molecular-weight (LMW) RNAs (e.g. 5S rRNA, tRNA and miRNA) were separated from high molecular-weight (HMW) nucleic acids (e.g. 28S and 18S rRNA, mRNA and genomic DNA) by fractionation using isopropanol. HMW RNAs precipitated in 20% isopropanol, while most LMW RNAs remained in the supernatant. The purified LMW RNAs were used successfully for RNA gel blotting to detect miRNAs expressed in Arabidopsis and tomato (Lycopersicon esculentum) seeds. To increase the detection sensitivity of the microRNA probes, additional digoxigenin-labelled uridine triphosphates (UTPs) were incorporated into the miRNA probes by designing template oligo DNAs with three extra adenines (A) at each end of their sequence. These DNA oligomers were used to make double-stranded DNA templates for miRNA probe synthesis. This probe (termed AAAPLUS) exhibited stronger signals than normal probes. A technique was also developed to quickly screen expressed miRNAs in seeds using a miniblot system, which enabled simultaneous examination with multiple miRNA probes. This method provides a simple alternative to microRNA microarrays to identify the major miRNAs expressed in seeds.
38
Saito, Kei, Tohru Fujiwara, Shunsuke Hatta, et al. "Generation and Molecular Characterization of Human Ring Sideroblasts." Blood 132, Supplement 1 (2018): 3613. http://dx.doi.org/10.1182/blood-2018-99-111066.
Full textAbstract:
Abstract (Background) Sideroblastic anemias are heterogeneous congenital and acquired refractory anemias characterized by bone marrow ring sideroblasts, reflecting excess mitochondrial iron deposition. While the disease is commonly associated with myelodysplastic syndrome, the congenital forms of sideroblastic anemias comprise a diverse class of syndromic and non-syndromic disorders, which are caused by the germline mutation of genes involved in iron-heme metabolism in erythroid cells. Although the only consistent feature of sideroblastic anemia is the bone marrow ring sideroblasts, evidence on the detailed molecular characteristics of ring sideroblasts is scarce owing to a lack of the biological models. We have recently established ring sideroblasts by inducing ALAS2 gene mutation based on human-induced pluripotent stem cell-derived erythroid progenitor (HiDEP) cells (ASH 2017) and have further extended the molecular characterization of human ring sideroblasts to gain new biological insights. (Method) We targeted the GATA-1-binding region of intron 1 of the human ALAS2 gene in HiDEP cells and established two independent clones [X-linked sideroblastic anemia (XLSA) clones]. A co-culture with OP9 stromal cells (ATCC) was conducted with IMDM medium supplemented with FBS, erythropoietin, dexamethasone, MTG, insulin-transferrin-selenium, and ascorbic acid. To obtain human primary erythroblasts, CD34-positive cells isolated from cord blood were induced in a liquid suspension culture (Fujiwara et al. JBC 2014). Bone marrow glycophorin A (GPA)-positive erythroblasts of patients with XLSA and normal individuals were separated using the MACS system (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany) after obtaining written informed consent. For transcription profiling, Human Oligo chip 25K (Toray) was used. (Results) We previously demonstrated that co-culture with OP9 cells in the medium supplemented with 100 uM sodium ferrous citrate (SFC) promoted erythroid differentiation of XLSA clones, which enabled the establishment of ring sideroblasts (ASH 2017). To confirm the importance of SFC in terminal erythroid differentiation, we further demonstrated that the addition of SFC, and not transferrin-loaded iron, induced the frequency of GPA+ cells and TfR1-GPA+ mature erythroid population, based on primary erythroblasts derived from human CD34-positive cells. Subsequently, to reveal the molecular mechanism by which abnormal iron mitochondrial iron accumulation occurs by co-culture with SFC, we evaluated the expressions of various metal transporters, demonstrating that the addition of SFC significantly increased the expressions of mitoferrin 1 (MFRN1; a ferrous iron transporter in mitochondria), divalent metal transporter 1 (DMT1), and Zrt- and Irt-like protein 8 (ZIP8; a transmembrane zinc transporter, recently known as a ferrous iron transporter) in the XLSA clone than the wild-type cells, which would have contributed to the formation of ring sideroblasts. Moreover, we performed expression analyses to elucidate the biochemical characteristics of ring sideroblasts. After co-culture with OP9 in the presence of SFC, ring sideroblasts exhibited more than two-fold upregulation and downregulation of 287 and 143 genes, respectively, than the wild-type cells. Interestingly, when compared with the expression profiling results before co-culture (ASH 2017), we noticed prominent upregulation of gene involved in anti-apoptotic process (p = 0.000772), including HSPA1A, superoxide dismutase (SOD) 1, and SOD2. In addition, we conducted a microarray analysis based on GPA-positive erythroblasts from an XLSA patient and a normal individual. The analysis revealed significant upregulation of genes involved in the apoptosis process, as represented by apoptosis enhancing nuclease, DEAD-box helicase 47, and growth arrest and DNA-damage-inducible 45 alpha, and anti-apoptotic genes, such as HSPA1A and SOD2. Concomitantly, when the XLSA clone was co-cultured with OP9 in the presence of SFC, the apoptotic cell frequency as well as DNA fragmentation were significantly reduced compared with the XLSA clone co-cultured without SFC, indicating that ring sideroblasts avoid cell death by inducing anti-apoptotic properties. (Conclusion) Further characterization of the XLSA model would help clarify its molecular etiology as well as establish novel therapeutic strategies. Disclosures Fukuhara: Celgene: Research Funding; Chugai: Research Funding; Daiichi-Sankyo: Research Funding; Boehringer Ingelheim: Research Funding; Eisai: Honoraria, Research Funding; GlaxoSmithKline: Research Funding; Janssen: Honoraria, Research Funding; Japan Blood Products Organization: Research Funding; Kyowa Hakko Kirin: Honoraria, Research Funding; Mitsubishi Tanabe: Research Funding; Mundipharma: Honoraria, Research Funding; MSD: Research Funding; Nippon-shinyaku: Research Funding; Novartis pharma: Research Funding; Ono: Honoraria, Research Funding; Otsuka Pharmaceutical: Research Funding; Pfizer: Research Funding; Sanofi: Research Funding; Symbio: Research Funding; Solasia: Research Funding; Sumitomo Dainippon: Research Funding; Taiho: Research Funding; Teijin Pharma: Research Funding; Zenyaku Kogyo: Honoraria, Research Funding; Takeda: Honoraria; Baxalta: Research Funding; Bristol-Myers Squibb: Honoraria, Research Funding; Bayer Yakuhin: Research Funding; Alexionpharma: Research Funding; AbbVie: Research Funding; Astellas: Research Funding; Nihon Ultmarc: Research Funding.
39
Jiang, Qiang, Jamie Zagozewski, Paolo Nozza, Beverly Wilson, Frank Van Landeghem, and David Eisenstat. "60 Are gangliogliomas in children and adults disorders of nervous system development?" Canadian Journal of Neurological Sciences / Journal Canadien des Sciences Neurologiques 45, S3 (2018): S10. http://dx.doi.org/10.1017/cjn.2018.288.
Full textAbstract:
INTRODUCTION: Gangliogliomas (GGs) are neuroepithelial tumours of the central nervous system (CNS) composed of mature ganglion cells or a mixed population of ganglion and glial cells. Microarray data of low grade gliomas (LGG) including GGs revealed overexpression of the Dlx2 gene, a homeobox gene essential for interneuron migration and differentiation. We hypothesized that GGs are arrested in development, and began to explore the role of the Dlx2 gene. BRAF rearrangements and BRAF V600E point mutations have been reported in pediatric LGG. METHODS: DLX2 expression was examined in GGs using immunofluorescence (IF) and immunohistochemistry (IHC) labelling of formalin fixed paraffin embedded (FFPE) tissue sections, along with staining of glial and neuronal markers. BRAF mutations were detected using a commercial antibody and/or sequence verification of the DNA extracted from the FFPE blocks. RESULTS: In the Discovery cohort 10/30 were DLX2+ (33.3%) and in the Validation cohort 15/40 were DLX2+ (37.5%). Of these 15 cases, 15 were GFAP+ (100%), 15 were synaptophysin and/or NeuN+ (100%), and 13 were OLIG2+ (86.7%); 6 had a BRAF V600E mutation (40.0%). For the Validation cohort of 40 GGs, 28 were OLIG2+ (70.0%); 13/28 co-expressed DLX2 (46.4%). 18/40 cases had a BRAF V600 mutation(17 V600E, 1 V600G; 45.0%) and 6/18 were DLX2+ (33.3%). CONCLUSIONS: DLX2 is expressed in GGs in both neuronal and glial marker expressing tumour cells. Our results support that GGs arise from CNS progenitors arrested at the neuronal-glial cell fate “decision” point.
40
Kroeger, Heike, Jaroslav Jelinek, Marcos R. H. Estécio, et al. "Aberrant CpG island methylation in acute myeloid leukemia is accentuated at relapse." Blood 112, no. 4 (2008): 1366–73. http://dx.doi.org/10.1182/blood-2007-11-126227.
Full textAbstract:
AbstractDNA methylation of CpG islands around gene transcription start sites results in gene silencing and plays a role in leukemia pathophysiology. Its impact in leukemia progression is not fully understood. We performed genomewide screening for methylated CpG islands and identified 8 genes frequently methylated in leukemia cell lines and in patients with acute myeloid leukemia (AML): NOR1, CDH13, p15, NPM2, OLIG2, PGR, HIN1, and SLC26A4. We assessed the methylation status of these genes and of the repetitive element LINE-1 in 30 patients with AML, both at diagnosis and relapse. Abnormal methylation was found in 23% to 83% of patients at diagnosis and in 47% to 93% at relapse, with CDH13 being the most frequently methylated. We observed concordance in methylation of several genes, confirming the presence of a hypermethylator pathway in AML. DNA methylation levels increased at relapse in 25 of 30 (83%) patients with AML. These changes represent much larger epigenetic dysregulation, since methylation microarray analysis of 9008 autosomal genes in 4 patients showed hypermethylation ranging from 5.9% to 13.6% (median 8.3%) genes at diagnosis and 8.0% to 15.2% (median 10.6%) genes in relapse (P < .001). Our data suggest that DNA methylation is involved in AML progression and provide a rationale for the use of epigenetic agents in remission maintenance.
41
Trépant, Anne-Laure, Christelle Bouchart, Sandrine Rorive, et al. "Identification of OLIG2 as the most specific glioblastoma stem cell marker starting from comparative analysis of data from similar DNA chip microarray platforms." Tumor Biology 36, no. 3 (2014): 1943–53. http://dx.doi.org/10.1007/s13277-014-2800-5.
Full text
42
Al-Katib, Ayad, Ebrahim Abdul Shukkur, Ali M. Gabali, ALI Raufi, Salah Ebrahim, and Mustapha Kandouz. "Isolation and Characterization of a CD34+ Sub-Clone in B-Cell Lymphoma." Blood 134, Supplement_1 (2019): 3970. http://dx.doi.org/10.1182/blood-2019-130738.
Full textAbstract:
Non-Hodgkin's lymphoma (NHL) is the most common hematological malignancy in the US. Many types remain incurable despite response to initial therapy and achievement of complete remission (CR). Advanced laboratory techniques like multicolor flow cytometry (MCF) and polymerase chain reaction (PCR) have demonstrated persistence of rare malignant cell population post therapy referred to as minimal residual disease (MRD). However, the functional and biological characteristics of this population have not been fully elucidated. Established B-lymphoma cell lines (B-NHL) and patient-derived samples (PDS) were analyzed using 8-color FCM of leukemia and lymphoma antibody panels (28 antibodies). The CD34+ sub-population was enriched using in vitro exposure to 2-chlorodeoxyadenosine (2-CdA), and a CD34-coated magnetic beads isolation procedure (Miltenyi Biotech). Genetic analysis of CD34+ and CD34-/parent cell fractions was done by karyotyping, and by chromosomal microarray (CMA) using the oligonucleotide-single nucleotide polymorphism (Oligo-SNP), whole genome Agilent 180K GGXChip+SNP (Agilent Technologies, Inc). Sensitivity to chemotherapy was assayed by short-term in vitro exposure to drugs. Clonogenicity was determined by soft agar colony formation assay, and proliferation was determined using DNA staining with propidium iodide and flow cytometry. The side population was determined using the fluorescent vital dye Hoechst 33342 and flow cytometry. Analysis of three B-NHL cell lines revealed the presence of a minute sub-clone (<1%) of monotypic B-cells that expresses CD34. This sub-population enriched several folds in response to exposure of the cells to 2-CdA. Enrichment was highest in the follicular lymphoma cell line, WSU-FSCCL reaching more than 50 folds compared with control (13.2% vs 0.26%), followed by WSU-WM, 10-fold (2.36% vs 0.23%), and least in WSU-DLCL2 (1.25% vs 0.71%). Using a CD34 microbead positive selection technique, we were able to enrich the CD34+ population up to 80% purity. Western blots confirmed higher expression of CD34 protein in the enriched population compared with parent cells. Using StemPro media (Gibco by Life Technologies), CD34+ cell fraction of WSU-WM showed more sustained growth and viability in culture over 9-day period compared with parent cells. This technique allowed the generation of large number of CD34+ cells for further characterization. Except for CD34 expression, this cell fraction expressed identical phenotype, karyotype, SNP and MCA profile to parent cells. However, the CD34+ fraction was more proliferative with an increase in S-phase cells (~60% vs 20% in control cells) and Hoechst 33342-positive cells (~40%). These cells were clonogenic even in presence of the cytotoxic agents Doxorubicin and 2-CdA that completely inhibited colony formation in parent cells. Resistance to chemotherapy was also noticed in liquid culture. A CD34+ population within clonal B-cells was also detected in 8 of 8 PDS. The lowest number of CD34+ cells was detected in chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL) and the highest (5.35%) was seen in Richter's transformation of CLL. The isolated CD34+ cells in this study show many features of what is known as Lymphoma Stem Cells implicated in resistance to therapy and disease recurrence. Its relatedness to MRD cells is uncertain, however, since CD34 is not routinely included in MRD antibody panel. The observation that CD34+ cells are genetically identical to parent cells suggests an epigenetic modification. This conclusion is supported by our finding that Ehd3 expression is dramatically reduced in the CD34+ cell population of WSU-DLCL2 compared with parent cells. Ehd3 was recently identified as an epigenetically-silenced gene in solid tumors and in hematological malignancies including leukemia and lymphoma. The Ehd3-encoded protein belongs to the family of C-terminal Eps15 homology domain-containing (EHD) proteins, implicated in intracellular trafficking of tubular recycling endosomes (TRE), apoptosis, and cell cycle arrest. Further studies are underway to determine the contribution of Ehd3 to the biological and functional characteristics of the CD34+ cells in B-NHL. Utilizing the CD34+ monotypic B-cells in B-NHL as a model for screening new therapeutic agents and to identify potential new therapeutic strategies may lead to a more effective treatment of B-NHL. Disclosures No relevant conflicts of interest to declare.
43
Ying, Zuolin, Madeleine Duvic, Lisa Shiue, Timothy Langridge, Meghali Goswami, and Xiao Ni. "Blood Transcriptional Profiling in Patients with Leukemic Cutaneous T-Cell Lymphoma on Extracorporeal Photopheresis Reveals the Integrin Signaling As the Top Pathway Associated with Clinical Response." Blood 126, no. 23 (2015): 3981. http://dx.doi.org/10.1182/blood.v126.23.3981.3981.
Full textAbstract:
Abstract Extracorporeal photopheresis (ECP) is an effective frontline therapy for patients with leukemic cutaneous T-cell lymphoma (L-CTCL), but the mechanisms of action are not fully understood. To elucidate molecular mechanisms underlying the efficacy of ECP, we used Agilent Whole Human Genome Microarrays to examine blood transcriptional profiles in L-CTCL patients after ECP therapy. Ten L-CTCL patients including 5 clinical responders and 5 non-responders were studied. Their peripheral blood was collected before ECP (baseline), at Day 2, and one month post-ECP. Total RNA extracted from peripheral blood mononuclear cells was assayed with Whole Human Genome Oligo Microarrays (4 × 44 K) (Agilent, Santa Clara, CA). The differentially expressed gene analysis (DGA) was done using the paired t-test with Benjamini- Hochberg correction (P value < 0.05) between post-ECP and baseline. The fold change of gene expression between post-ECP and baseline were calculated from the normalized values. Hierarchical clustering of differentially expressed genes was performed with the Pearson correlation. The DGA between responders and non-responders were cross-compared. Canonical biological pathways were identified using Ingenuity Pathway Analysis (IPA, Ingenuity Systems, Redwood City, CA). Differentially expressed gene profiles were different in responders from non-responders. As indicated in Figure 1, there were more genes differentially regulated in responders than in non-responders post-ECP at both Day 2 (549 genes in responders versus 66 genes in non-responders) and at one month (472 genes in responders versus 95 genes in non-responders). Among 472 differentially expressed genes in responders at one month post-ECP, almost twice as many genes (313) were down-regulated compared to up-regulated genes (159). The top down-regulated genes were IL-1β, EGR1, CCL3, CCL3L3, and CXCL2. The down-regulated genes were mainly related to functions of platelets, immune and/or stress responses, and chromatin remodeling. The upregulated genes were mainly related to functions of the nucleolus and included USP34, POLR3F, ZNF529, C22orf35, and BAT2D1. The ingenuity pathway analysis revealed that the top 5 pathways affected by ECP at one-month in responders were 1) integrin signaling; 2) granulocyte adhesion and diapedesis; 3) signaling by Rho Family GPTases; 4) agranulocytes (lymphocyte, monocyte and macrophage) adhesion and diapedesis; and 5) triggering receptor expressed on myeloid cells 1 (TREM1) signaling (Table 1). In contrast, these pathways and genes were less affected in non-responders. Of note, a comparison of all DGA results indicated that the responder group overlapped in the differentially expressed genes between Day 2 group (RD2) and one month group (RM1), but had few genes in common to the non-responder group (NM1). There were 94 genes consistently downregulated among RD2 and RM1 while only 6 genes were found in common between the RM1 and NM1 group. Similarly, 61 genes were consistently upregulated in group RD2 and RM1 while only 3 genes were found in common between the RM1 and NM1 group. In summary, the blood transcriptional profiling by this study identifies a signature of genes and pathways relevant to clinical response to ECP in L-CTCL patients. These findings expand our understanding of molecular mechanisms of ECP. Further validation of these genes and pathways is warranted in the future studies. Table 1. Top canonical pathways affected by ECP in L-CTCL patients responded to ECP at one-month Canonical Pathways Downregulated genes Upregulated genes Integrin Signaling 15/201 (7%) ITGA2B, MAP3K11, ITGA5, MYLK, ITGB3, MYL9, PARVB, AKT1, RHOB, CAPN1, ACTN4, CTTN, ARPC4, ACTN1, ITGB5 2/201 (1%) ITGB1, PPP1R12A Granulocyte Adhesion and Diapedesis 14/179 (8%) CSF3R, ICAM1, PPBP,ITGA5, CXCL5, SDC4, CCL3, ITGB3, GNAI2, CLDN5, CCL3L3, IL1B, CXCL1, CXCL2 1/179 (1%) ITGB1 Signaling by Rho Family GTPases 13/236 (6%) SEPT5, MAP3K11, ITGA5, MYLK, GNAZ, CDC42EP2, GNAI2, MYL9, GNG11, GNA15, RHOB, GNB2, ARPC4 3/236 (1%) ITGB1, DIAPH3, PPP1R12A Agranulocyte Adhesion and Diapedesis 13/190 (7%) ICAM1, PPBP, ITGA5, CXCL5, SDC4, CCL3, GNAI2, MYL9, CLDN5, CCL3L3, IL1B, CXCL1, CXCL2 1/190 (1%) ITGB1 TREM1 Signaling 7/76 (9%) ICAM1, AKT1, NLRP12, ITGA5, IL1B, CD83, CCL3 2/76 (3%) ITGB1, NLRC3 Figure 1. Differentially expressed genes post-ECP between responders and non-responders Figure 1. Differentially expressed genes post-ECP between responders and non-responders Disclosures Duvic: Therakos: Research Funding. Ni:Therakos: Research Funding.
44
Chng, Wee-Joo, Angela Baker, Travis Henry, et al. "Combined High Resolution Array Comparative Genomic Hybridization and Gene Expression Profiling Reveal Rb1 Haploinsufficiency as a Possibile Tumorigenic Mechanism in Myeloma." Blood 108, no. 11 (2006): 113. http://dx.doi.org/10.1182/blood.v108.11.113.113.
Full textAbstract:
Abstract Chromosome 13 deletion (Δ13) is one the most common genetic abnormalities observed in multiple myeloma (MM) and confers a poor prognosis. Studies to identify critical tumor suppressor genes in MM till date have lack adequate resolution, and the molecular phenotype associated with Δ13 has not been established. In this study we seek to establish a molecular profile for Δ13 and to finely map the minimal common region of deletion (CDR) on chromosome 13 by using gene expression profiling (GEP) and array comparative genomic hybridization (aCGH). GEP was performed on RNA from purified plasma cells of 72 newly diagnosed MM and 50 human myeloma cell lines (HMCLs) using the Affymetrix U133A chip and U133plus chip (Affymetrix, Santa Clara, CA) respectively. Patients were assigned TC classes which correlates with underlying genetic subtypes. In addition, aCGH was performed on 79 MM samples (36 with GEP data) and 50 myeloma cell lines (HMCLs; 48 with GEP data) using a platform utilizing 60-mer oligonucleotides (Human Genome CGH 44B Oligo Microarrays, Agilent Technologies), which have a resolution of about 70Kb. Raw data was extracted using the Feature Extraction 8.1 and visualized using CGH Analytics 3.2 (Agilent Technologies). To define a signature that reflects the biological consequences of Δ13 and not its close association with some genetic subtypes of MM (example, t(4;14) and t(14;16)), we selected a training cohort consisting of cases belonging to D1, D2, 11q13 and none TC class such that cases with and without Δ13 are balanced for ploidy and TC classes (n=28). A 152-gene Δ13 signature was identified. Its specificity was confirmed by leave-one-out cross validation using the K-nearest neighbor (KNN) class prediction algorithm (predictive accuracy of 100% in the training cohort). It was subsequently validated in a validation cohort that includes t(4;14) and t(14;16) that were not use to derive this gene signature, maintaining a high predictive accuracy (88%). This gene-set may therefore reflect core transcriptional consequences of Δ13 and is enriched for genes involved in the cell cycle and apoptosis. Using aCGH, 20 patients have Δ13 (mostly whole chromosome) all involving the 13q14–q21 region. Of the 32 HMCLs with Δ13 (whole chromosome or interstitial), 22 have mono-allelic loss of RB1 whereas 4 had bi-allelic loss. Besides RB1, bi-allelic loss of several other genes in the 13q14–q21 region (CYSLTR2, CDADC1, ITM2B, PCDH9) was also observed. As the CDR is large and contains a number of genes, we utilized a set of criteria (bi-allelic loss in HMCLs, within 13q14–q21 CDR, gene expression significantly correlated with copy number, and loss could explain molecular phenotype) to narrow down the potential candidates. Only RB1 and ITM2B fulfilled these criteria. Furthermore, RB protein levels correlated well with mRNA levels and DNA copy suggesting that even in absence of mutations resulting in bi-allelic loss, mono-allelic loss of RB1 could be tumorigenic through a haploinsufficiency mechanism.
45
Chitteti, Brahmananda Reddy, Bradley Poteat, Mu Wang, Yunlong Liu, and Edward F. Srour. "Genetic and Proteomic Analysis of Functionally Distinct Human Hematopoietic Stem Cells from Bone Marrow, Mobilized Peripheral Blood, and Cord Blood." Blood 112, no. 11 (2008): 1324. http://dx.doi.org/10.1182/blood.v112.11.1324.1324.
Full textAbstract:
Abstract The bone marrow (BM) repopulating potential of hematopoietic stem cells (HSCs) is directly related to the cell cycle status of these cells. In general, only mitotically quiescent HSCs retain the ability to engraft and sustain long-term multilineage reconstitution in conditioned recipients. In a series of studies, our laboratory previously examined the effect of cell cycle status on the engraftment potential of human HSC from three different hematopoietic tissues. Only CD34+ cells in G0 phase of cell cycle (G0CD34+) from adult human BM or mobilized peripheral blood (MPB) engrafted successfully in conditioned NOD/SCID mice whereas those in G1 phase of cell cycle (G1CD34+) failed to do so. In contrast, both G0CD34+ and G1CD34+ cells from cord blood (CB) engrafted effectively. In the present study, we used the distinct in vivo behavior of these groups of adult and neonatal cells as the basis for genotypic and proteomic analyses in which it was possible to align multiple profiles of functional and non-functional HSC and therefore derive a genetic and protein fingerprint that may be associated with Engraftment potential of human stem cells. Human CD34+ cells from BM, MPB, and CB were sorted into G0 and G1 phases of cell cycle and the cell cycle status of each isolated fraction was further confirmed by the expression or lack thereof of Ki67 by qRT-PCR. Agilent Whole Human Genome Oligo Microarrays were used for genotyping (three independent samples from each tissue for a total of 18 groups) and a Linear Mixed Effect Model was used to identify differentially expressed genes, with at least a two-fold increase in expression and false discovery rate &lt;0.05. An LC-MS/MS proteomic analysis of the same 18 groups of cells in addition to 6 others (total of four independent samples from each tissue) was also conducted in parallel. Differential expression of cellular proteins was calculated using a proprietary algorithm. A total of 190 genes were highly expressed in engrafting cells (all three groups of G0CD34+ cells and CB-derived G1CD34+ cells) whereas 1039 genes were highly expressed in non-engrafting cells (BM- and MPB-derived G1CD34+ cells). Out of the 190 differentially regulated genes in engrafting cells, 161 genes have a known function. Of these, 84 are present in the nucleus and 23 are transcription regulators including ARNTL, BCL6B, DMTF1, HES1, HLF, IFI16, and ZNF326. System Biology modeling indicated that the top four signaling pathways associated with these genes are Wnt signaling, PPARα/RXRα activation, Amyloid processing, and IGF1 signaling. Of the 1039 differentially regulated genes in non-engrafting cells, 273 are present in the nucleus and 69 are transcription regulators including CALR, CyclinE1, CEBPB, CIITA, MYC, MAPK1, and NOTCH4. System Biology modeling implicated these genes in multiple signaling pathways with the top four being the antigen presentation pathway, role of BRCA1 in DNA damage response, IL4 signaling, and the G1/S checkpoint regulation. However, proteomic analysis identified a total of 646 proteins that were detected in the lysates of all six groups of cells. Of these, 70 proteins had a significant differential expression with less than 5% false discovery rate between paired groups. The genes of only 9 proteins were differentially expressed in either the engrafting or non-engrafting cells including TPT1 (in the engrafting group) and ALDOA, MPO, TUBB, CALR, ACTB, ACTG1, PRTN3, ANXA1 (in the non-engrafting group). Functional studies aimed at discerning the roles of these proteins in stem cell function are underway. These studies demonstrate that the overlap between genomic and proteomic analysis of the same groups of engrafting and non-engrafting hematopoietic cells is rather limited but that simultaneous analysis with both protocols may identify unique modulators of stem cell function. Furthermore, protein expression analysis may be more useful in identifying pathways, the activation of which results in the loss of stem cell function since these pathways remain inactive in the mitotically and metabolically inactive engrafting cells.
46
"Microarray long oligo probe designing for Escherichia coli: an in-silico DNA marker extraction." Central European Journal of Urology 69, no. 1 (2016). http://dx.doi.org/10.5173/ceju.2016.654.
Full text