To see the other types of publications on this topic, follow the link: Oocystes.
Dissertations / Theses on the topic 'Oocystes'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 dissertations / theses for your research on the topic 'Oocystes.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse dissertations / theses on a wide variety of disciplines and organise your bibliography correctly.
1
Annan, Zeinab. "Structure génétique des populations de Plasmodium falciparum, agent de forme grave du paludisme, chez l'homme et les anophèles vecteurs en Afrique." Montpellier 2, 2007. http://www.theses.fr/2007MON20158.
Full text
2
Bonnin, Alain. "Cryptosporidium parvum : étude biologique en culture in vitro : caractérisation et immunolocalisation de déterminants antigéniques à l'aide d'anticorps monoclonaux." Dijon, 1991. http://www.theses.fr/1991DIJOMU02.
Full text
3
Dumètre, Aurélien. "Contribution à la détection de Toxoplasma gondii dans l'environnement et dans des réservoirs animaux." Limoges, 2005. http://aurore.unilim.fr/theses/nxfile/default/4ae3d59d-fa2a-4e87-9f28-d2b7c0f3b099/blobholder:0/2005LIMO310C.pdf.
Full textAbstract:
La toxoplasmose est une anthropozoonose d'importance médicale et vétérinaire, due au protozoaire Toxoplasma gondii. Les oocystes, émis par les félins, ont un rôle central dans la transmission du parasite en contaminant les animaux d'élevage, les végétaux et l'eau consommés par l'homme. Au cours de ce travail, nous avons développé deux approches pour préciser la circulation des oocystes dans l'environnement : (i) la détection des oocystes dans l'eau par une nouvelle méthode, la séparation immunomagnétique (IMS), et (ii) la recherche du parasite dans des réservoirs animaux soumis à une infection par les oocystes (animaux d'élevage et sauvages). Pour l'IMS, nous avons produit et caractérisé deux nouveaux anticorps monoclonaux (AcM 3G4 et 4B6) dirigés contre la paroi des oocystes. 3G4 reconnaît des antigènes de 58 et 67-69 kDa, et 4B6 un antigène >116 kDa spécifique de l'oocyste sporulé. Ces deux AcM ont une réactivité croisée avec d'autres coccidies autofluorescentes et phylogénétiquement proches de T. Gondii. Ils ont été intégrés dans une IMS expérimentale, mais seul 4B6, plus spécifique que 3G4, a été retenu pour une application en conditions naturelles. Cinquante prélèvements d'eaux de surface, prélevés dans des contextes épidémiologiques particuliers, ont été analysés par filtration, IMS-4B6, IFI, bioessai et PCR en temps réel. Aucun toxoplasme n'a été mis en évidence avec certitude. Parallèlement, l'analyse de 639 sérums d'animaux d'élevage et sauvages montre, chez quatre espèces potentiellement soumises à une infection par les oocystes en Limousin, une séroprévalence de 20,6% à 59,1% chez les ovins, de 27,5% chez les bovins, de 18,5% chez le poulet de plein air et de 20,4% chez le ragondin. Des toxoplasmes, de génotype II, ont pu être isolés. Ce travail contribue à préciser la séroprévalence de la toxoplasmose dans les réservoirs animaux et propose des améliorations techniques et stratégiques pour détecter les oocystes par IMS. Ces résultats préliminaires devront être poursuivis par des études épidémiologiques plus extensivesToxoplasmosis is an anthropozoonosis of medical and veterinary importance, due to the protozoan Toxoplasma gondii. Oocysts shed by felids play a key role in parasite transmission as they contaminate meat-producing animals, vegetables and water consumed later by humans. In this work, two approaches were developed to refine the oocyst prevalence in the environment (i) a new method to detect waterborne oocysts, the immunomagnetic separation (IMS), and (ii) a study of the toxoplasmosis prevalence in oocyst-infected animals (meat-producing and wild). For IMS development, two new monoclonal antibodies (mAb 3G4 and 4B6) directed against the oocyst wall were produced and characterised. 3G4 reacts with 58 and 67-69 kDa antigens while 4B6 is specific of >116 kDa antigen of the sporulated oocyst. These two mAb cross-react with autofluorescent coccidia phylogenetically closed to T. Gondii. Experimental IMSs were developed with these mAb, but only the more specific one, 4B6, was integrated for further IMS experiments in field conditions. Fifty surface water samples, recovered in particular epidemiological contexts, were analysed by filtration, IMS-4B6, IFI, bioassay and real-time PCR. We failed to detect Toxoplasma in these samples. In the same time, the analysis of 639 serums of meat-producing and wild animals showed in four oocyst-infected speciesfrom Limousin region, seroprevalence of 20,6% to 59,1% in sheep, 27,5% in bovines, 18,5% in free-ranging chickens and 20,4% in nutria. Some genotype II Toxoplasma isolateswere isolated. This work contributes to precise the toxoplasmosis prevalence in animal reservoirs, and proposes technical and strategic improvements to detect oocysts by IMS. These first results need to be followed by more extensive investigations
4
Razakandrainibe, Fabien Gaston. "Biologie et fonctionnement des populations naturelles de Plasmodium falciparum à l'Ouest de Kenya : stratégie de reproduction, dispersion et co-structuration génétique avec ses deux principaux vecteurs : Anopheles gambiae sensu lato et Anopheles funestus." Paris 6, 2007. http://www.theses.fr/2007PA066652.
Full textAbstract:
Un objectif important de la biologie évolutive est de comprendre comment les facteurs, comme les frontières des dèmes et le système de reproduction dans les populations naturelles, déterminent le profil et le niveau de la diversité génétique. Pour Plasmodium falciparum, l’agent pathogène le plus sévère du paludisme, la biologie et la structure génétique des populations sont mal comprises malgré la quantité considérable d’informations que nous avons sur ce parasite. Nos connaissances sur le système de reproduction dans les populations naturelles sont limitées. Plusieurs idées sont en conflits : La structure génétique des populations de P. Falciparum a été demontrée principalement “clonale” (c-à-d fortement autofécondante) dans les régions à faible transmission; par contraste, dans les régions où la transmission est forte, on pense que cette structure est panmictique bien qu’il y a très peu de preuves à l’appui. Cette contradiction reflète une confusion générale sur les approches méthodologiques et techniques utilisées pour avoir les résultats; ajoutant ainsi des sources directes de vues biaisées dans le débat. La question sur le système de reproduction est aussi liée à l’isolement du parasite dans les moustiques hôtes dans une localité géographique, à la taille des populations hôtes-parasites (qui détermine les niveaux de la dérive génétique et par conséquent l’efficacité de la sélection naturelle) et à leur connectivité (qui détermine la vitesse à laquelle une mutation favorable pourrait se propager dans des zones différentes). Le degré de différenciation des populations géographiquement séparées de P. Falciparum et sa distribution dans ses espèces vectrices majeures sont primordiaux pour appréhender l’épidémiologie de la maladie et son évolution c-à-d. , comment ces organismes évoluent, coévoluent et pourraient ainsi répondre aux futurs changements de leur environnement. Nous avons étudié les profils de la diversité génétique de P. Falciparum associé à ses deux principaux vecteurs Anopheles gambiae et Anopheles funestus à l’Ouest du Kenya. Avec des microsatellites, des marqueurs neutres et des oocystes - le stade diploïde – de P. Falciparum, nous avons determiné la nature “clonale” de P. Falciparum. Nous avons observé chez P. Falciparum un taux élevé d’autofécondation dans deux régions Africaines (Kenya et Cameroun) où la transmission palustre est pérenne et intense. La différenciation géographique aux loci microsatellites est faible dans ces régions. Nous avons aussi observé une faible différenciation génétique entre les populations des moustiques. Finalement, nos résultats ne montrent pas des variations génétiques de P. Falciparum entre les deux espèces vectrices. Ce travail est crucial à la compréhension actuelle de l’écologie et l’évolution de P. Falciparum. Les paramètres que nous avons rapportés sont pertinents parce qu’ils ont un impact sur le niveau de la diversité génétique, sur les opportunités d’adaptation locale et sur les processus évolutifs, et parce qu’ils ont également des conséquences épidémiologiques, concernant la propagation des médicaments à multi-locus et la résistance aux vaccinsVaccine An important goal in evolutionary biology is to understand how factors such as the boundaries of demes and the mating systems in natural populations shape patterns and levels of genetic diversity within populations. For Plasmodium falciparum, the most severe malaria agent, the biology and population genetic structure are poorly understood despite the large amount of knowledge we have about this parasite. We know very little about the actual mating system in wild populations. Many views are conflicting: The population genetic structure of P. Falciparum has been shown to be predominantly "clonal" (i. E. Highly inbred) in regions with low transmission; in contrast, in high-transmission regions it is thought to be panmictic, although there is little supporting evidence. The contradiction reflects a general confusion about the methodical approaches and techniques used to get the results and so add up to direct sources of biased view to the debate. The question about the mating system is also related to the isolation among mosquito hosts within a geographic location, to the sizes of the host-parasite populations (which determine the levels of genetic drift and thus the efficacy of natural selection) and to their connectivity (which determines the speed at which a favourable mutation may spread to different areas). The degree of differentiation among geographically separated populations of P. Falciparum and the distribution of P. Falciparum among the species of its major mosquito vectors are of primary relevance to understanding the disease's epidemiology and its evolution, i. E. How these organism evolve, co-evolve and may thus respond to future changes in their environments. We investigated patterns of genetic diversity of P. Falciparum associated with its two main African vectors Anopheles gambiae and A. Funestus in Western Kenya. Using neutral microsatellite markers and oocysts, the diploid stage of Plasmodium falciparum, we determine a 'clonal' nature to Plasmodium falciparum, i. E. Show that P. Falciparum has a high level of inbreeding in two African regions (Cameroun and Kenya) despite perennial and intense malarial transmission. The geographic differentiation among microsatellite loci is weak in these regions. We also observed little genetic differentiation among mosquito populations. Finally, our results do not show P. Falciparum genetic variability between the mosquito species. This work is crucial to a current understanding of the P. Falciparum's ecology and evolution. The parameters we report are relevant because they affect levels of genetic diversity, opportunities for local adaptation, and other evolutionary processes and because they have epidemiological consequences, concerning the spread of multi-locus drug and -resistance
5
Khaldi, Samira. "Apport d'un modèle de rat d'hypersensibilité intestinale induite par Cryptosporidium parvum à la physiopathologie du syndrome de l'intestin irritable post-infectieux ; et transfert des oocystes de Cryptosporidium spp. Dans l'aquifère de la craie." Rouen, 2010. http://www.theses.fr/2010ROUES047.
Full textAbstract:
Les parasites du genre Cryptosporidium sont des protozoaires ubiquistes à l'origine de nombreuses épidémies d'origine hydrique à travers le monde. La présence de Cryptosporidium a été rapportée dans les eaux de surfaces et les eaux souterraines. Les eaux souterraines provenant des aquifères karstiques constituent une ressource considérable d'eau potable. De par leurs structures géomorphologiques, ces aquifères sont vulnérables à des contaminations d'origine microbienne. Cryptosporidium a été retrouvé chez plus de 150 hôtes, et peut infecter le tractus gastro-intestinal ou respiratoire, et causer ainsi une cryptosporidiose, qui se traduit classiquement par une diarrhée hydrique accompagnée de douleurs abdominales. La cryptosporidiose est spontanément résolutive chez les individus immunocompétents, mais elle peut mettre en jeu le pronostic vital des personnes à compétences immunologiques limitées, en l'absence de traitement efficace. Les mécanismes physiopathologiques de l'infection par Cryptosporidium spp. Ne sont pas encore entièrement élucidés mais la cryptosporidiose peut entraîner des conséquences à long terme. Dans un modèle de rat nouveau-né immunocompétent, l'infection par Cryptosporidium parvum induit une hypersensibilité viscérale à la distension à plus de 100 jours après l'élimination de l'infection. Les objectifs de ce travail sont : (i) de documenter les altérations cyto-pathologiques causées par une infection par Cryptosporidium parvum (isolat Iowa ett isolat Nouzilly) durant l'infection et à distance de l'infection dans un modèle de raton immunocompétent ; (ii) de décrire les modalités de transfert des oocystes de Cryptosporidium spp. Dans un aquifère karstique de la craie. La première partie de ce travail a permis de mettre en évidence dans le modèle de raton que l'infection pa Cryptosporidium parvum isolat Nouzilly conduit à une cryptosporidiose plus sévère (par rapport à l'isolat Iowa), et qu'après clairance de l'infection, une infiltration de mastocytes sous-muqueux activés et observée au niveau du jéjunum. Cette infiltration est concomitante à la survenue d'une hypersensibilité jéjunale à la distension au jour 50 post-infectieux. Les anomalies observées sont similaires à celles rencontrées chez des patients souffrant d'un syndrome de l'intestin irritable post-infectieux. La seconde partie du travail a permis de suivre le tranfert des oocystes de Cryptosporidium au sein d'un système karstique de la craie bien défini, depuis les engouffrements (à la perte) jusqu'aux exutoires du système karstique (source et forage). Ce suivi a permis de mettre en évidence que les oocystes sont transportés dans les conduits karstiques en subissant des processus de transfert, dépôt et remise en suspension sous l'influence du gradient hydrodynamique de l'hydrosystème. Par ailleurs, nous avons pu mettre en évidence que l'exploitation de la ressource en eau pour l'adduction d'eau potable par des séquences de pompages continus favorisent la remise en suspension des oocystes sédimentés et contribue à la contamination de la ressource en eau par Cryptosporidium. Ce travail a permis d'apporter des éléments nouveaux dans la physiopathologie complexe de la cryptosporidiose, l'infection par certains isolats de Cryptosporidium parvum peut être à l'origine du développement d'un syndrome de l'intestin irritable post-infectieux. Par ailleurs, l'étude du transfert des oocystes de Cryptosporidium dans l'aquifère karstique de la craie a montré la vulnérabilité des ressources en eau souterraines vis-à-vis de Cryptosporidium. Une exploitation intensive peut contribuer à la contamination de la ressource en eauCryptosporidiosis, caused by Cryptosporidium spp. , is a self-limiting infection in immunocompetent individuals but may be life-threatening in immunocompromised individuals, in the absence of effective treatment. The pathophysiological mechanisms of cryptosporidiosis are not yet fully understood, but it has been shown that cryptosporidiosis can cause long-term sequelae. The first part of this work was aimed to highligt in a suckling rat model that infection with C. Parvum (isolate Nouzilly) leads to a more severe infection compared to rats that were infected with C. Parvum (isolate Iowa). Moreover, after clearance of infection, sub-mucosal infiltration of activated mast cells was observed in the jejunum. This infiltration is concomitant with the occurrence of a jejunal hypersensitivity to distention at day 50 post-infection. The anomalies observed are similar to those found in patients suffering from a post-infectious irritable bowel syndrome. The second part of the thesis was dedicated to the study of the transfer modalities of Cryptosporidium oocysts in a well-defined karst system, from the entry (swallow hole) to the exit of the system (spring and well-bore). It has been shown that the oocysts are transported in karst conduits, undergoing transfer, depostion and resuspention processes, under the influence of hydrodynamic gradient. Moreover, it was observed that the exploitation of the resource for the drinking water supply by sequences of continuous pumping promoted resuspension of sedimented oocysts and contributes to contamination of water resources
6
Pugh, Hedley James. "Deposition and adhesion of cryptosporidium oocysts on surfaces." Thesis, University College London (University of London), 1994. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.300120.
Full text
7
Hardy, Scott Andrew. "Effectiveness of static mixers for disinfection of cryptosporidium oocysts." Thesis, Georgia Institute of Technology, 1999. http://hdl.handle.net/1853/20925.
Full text
8
Liyanage, Lalith R. J. "Chlorine dioxide inactivation of Cryptosporidium parvum oocysts in water." Thesis, National Library of Canada = Bibliothèque nationale du Canada, 1998. http://www.collectionscanada.ca/obj/s4/f2/dsk2/tape17/PQDD_0007/NQ29064.pdf.
Full text
9
Lewin, Nicola. "Effects of sequential exposure of Cryptosporidium oocysts to chemical disinfectants." Thesis, National Library of Canada = Bibliothèque nationale du Canada, 2000. http://www.collectionscanada.ca/obj/s4/f2/dsk1/tape4/PQDD_0010/MQ60147.pdf.
Full text
10
Nazir, Mozamel. "Novel methods for the separation of Cryptosporidium parvum oocysts from water." Thesis, Imperial College London, 2002. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.252194.
Full text
11
Crockett, Christopher Scott Haas Charles N. "The significance of streambed sediments as a reservoir of Cryptosporidium oocysts /." Philadelphia, Pa. : Drexel University, 2004. http://dspace.library.drexel.edu/handle/1860/290.
Full text
12
Amburgey, James E. "Improving filtration for removal of cryptosporidium oocysts and particles from drinking water." Diss., Georgia Institute of Technology, 2002. http://hdl.handle.net/1853/20723.
Full text
13
Bukhari, Zia. "Cryptosporidium infections in livestock and the significance of environmental contamination with oocysts." Thesis, University of Strathclyde, 1995. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.309045.
Full text
14
Chen, Hong, Stefanie Wiedmer, Sacha Hanig, Rolf Entzeroth, and Michael Kurth. "Development of Eimeria nieschulzi (Coccidia, Apicomplexa) Gamonts and Oocysts in Primary Fetal Rat Cells." Saechsische Landesbibliothek- Staats- und Universitaetsbibliothek Dresden, 2014. http://nbn-resolving.de/urn:nbn:de:bsz:14-qucosa-127190.
Full textAbstract:
The in vitro production of gametocytes and oocysts of the apicomplexan parasite genus Eimeria is still a challenge in coccidiosis research. Until today, an in vitro development of gametocytes or oocysts had only been shown in some Eimeria species. For several mammalian Eimeria species, partial developments could be achieved in different cell types, but a development up to gametocytes or oocysts is still lacking. This study compares several permanent cell lines with primary fetal cells of the black rat (Rattus norvegicus) concerning the qualitative in vitro development of the rat parasite Eimeria nieschulzi. With the help of transgenic parasites, the developmental progress was documented. The selected Eimeria nieschulzi strain constitutively expresses the yellow fluorescent protein and a macrogamont specific upregulated red tandem dimer tomato. In the majority of all investigated host cells the development stopped at the second merozoite stage. In a mixed culture of cells derived from inner fetal organs the development of schizont generations I-IV, macrogamonts, and oocysts were observed in crypt-like organoid structures. Microgamonts and microgametes could not be observed and oocysts did not sporulate under air supply. By immunohistology, we could confirm that wild-type E. nieschulzi stages can be found in the crypts of the small intestine. The results of this study may be helpful for characterization of native host cells and for development of an in vitro cultivation system for Eimeria species.
15
Basak, Shibesh Chandra. "The identification of oocysts of chicken Eimeria species : biochemical, immunological and molecular biological approaches." Thesis, University of Liverpool, 1993. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.356983.
Full text
16
Jellison, Kristen L. (Kristen Leigh) 1975. "Molecular and genetic analysis of Cryptosporidium spp. oocysts : sources and genotypes in the environment." Thesis, Massachusetts Institute of Technology, 2003. http://hdl.handle.net/1721.1/29359.
Full textAbstract:
Thesis (Ph. D.)--Massachusetts Institute of Technology, Dept. of Civil and Environmental Engineering, 2003.Includes bibliographical references.
Cryptosporidium parvum is responsible for an acute gastrointestinal disease that is self-limiting in immunocompetent people but potentially life-threatening for the immunocompromised. Until recently, C. parvum was the only species of Cryptosporidium known to cause disease in people, however, reports of C. muris, C. felis, and C. meleagridis in immunocompetent adults have raised questions about the extent to which Cryptosporidium spp. are infectious for humans. Until more is known, presence of any Cryptosporidium oocysts in the environment should be considered a potential public health risk. Cryptosporidium spp. can infect a wide range of animal hosts, and environmental sources may include wildlife, agricultural animals, or human sewage. Transmission of Cryptosporidium spp. via fecally-contaminated food and water has been well-documented, and outbreaks of cryptosporidiosis have occurred around the world. The exogenous stage of the organism, the oocyst, is difficult to remove from drinking water supplies because it is resistant to chlorine disinfection and inefficiently filtered. Therefore, a better understanding of the sources, fate, and transport of oocysts in the environment is critical to protect source waters from oocyst contamination. In this work, a sensitive and specific molecular detection assay for Cryptosporidium spp. in environmental samples was developed and applied to surface water and fecal samples from the Wachusett Reservoir watershed, the drinking water source for metropolitan Boston, to establish links between oocyst sources and surface water contamination. Multiple species of Cryptosporidium were detected, and previously uncharacterized genetic diversity at the 18S rRNA locus was observed.
(cont.) Each surface water site had a hypothesized oocyst source, but results showed that the sources detected were often very different from those hypothesized to be most important. Cryptosporidium spp. from wildlife was detected in surface waters hypothesized to be contaminated by human sewage, and surface waters susceptible to agricultural runoff were observed to be more impacted by birds. In addition, Cryptosporidium spp. contamination occurred seasonally, with the seasonal pattern of detection distinct for surface waters with different oocyst sources. Results of this work contribute to a growing characterization of Cryptosporidium in the environment that will ultimately help minimize public exposure to this waterborne parasite.
by Kristen L. Jellison.
Ph.D.
17
Chen, Hong, Stefanie Wiedmer, Sacha Hanig, Rolf Entzeroth, and Michael Kurth. "Development of Eimeria nieschulzi (Coccidia, Apicomplexa) Gamonts and Oocysts in Primary Fetal Rat Cells." Hindawi, 2013. https://tud.qucosa.de/id/qucosa%3A27286.
Full textAbstract:
The in vitro production of gametocytes and oocysts of the apicomplexan parasite genus Eimeria is still a challenge in coccidiosis research. Until today, an in vitro development of gametocytes or oocysts had only been shown in some Eimeria species. For several mammalian Eimeria species, partial developments could be achieved in different cell types, but a development up to gametocytes or oocysts is still lacking. This study compares several permanent cell lines with primary fetal cells of the black rat (Rattus norvegicus) concerning the qualitative in vitro development of the rat parasite Eimeria nieschulzi. With the help of transgenic parasites, the developmental progress was documented. The selected Eimeria nieschulzi strain constitutively expresses the yellow fluorescent protein and a macrogamont specific upregulated red tandem dimer tomato. In the majority of all investigated host cells the development stopped at the second merozoite stage. In a mixed culture of cells derived from inner fetal organs the development of schizont generations I-IV, macrogamonts, and oocysts were observed in crypt-like organoid structures. Microgamonts and microgametes could not be observed and oocysts did not sporulate under air supply. By immunohistology, we could confirm that wild-type E. nieschulzi stages can be found in the crypts of the small intestine. The results of this study may be helpful for characterization of native host cells and for development of an in vitro cultivation system for Eimeria species.
18
Heisz, Marianne. "Studies on the survival and viability testing of Cryptosporidium parvum oocysts in the water environment." Thesis, National Library of Canada = Bibliothèque nationale du Canada, 1997. http://www.collectionscanada.ca/obj/s4/f2/dsk3/ftp05/mq21991.pdf.
Full text
19
Kayed, Dima 1960. "METHODS FOR THE ISOLATION OF OOCYSTS OF CRYPTOSPORIDIUM FROM SLUDGE AND GIARDIA CYSTS FROM STOOL." Thesis, The University of Arizona, 1986. http://hdl.handle.net/10150/276355.
Full text
20
Korich, Dick Gary. "Cryptosporidium oocyst viability: Assessment and correlation with infectivity." Diss., The University of Arizona, 1993. http://hdl.handle.net/10150/186125.
Full textAbstract:
Outbreaks of cryptosporidiosis have been traced to Cryptosporidium oocysts in finished drinking water. Indeed, water contaminated with oocysts may be judged perfectly safe by conventional coliform tests. Although oocysts can be specifically identified using immunofluorescence, it is not yet possible to determine their viability. The lack of a viability test means that each oocyst detected in finished water must be regarded as potentially infective even though water treatment may have killed them. The goal of this research was to develop a test for oocyst viability. In vitro excystation, oocyst morphology, vital dyes, and a monoclonal antibody were tested. In vitro excystation expressed as percent of theoretical sporozoite yield correlated best with neonatal mouse infectivity. Although not directly applicable to testing water samples, excystation provided a basis for screening other testing methods. None of the eight vital dyes tested showed any relationship between oocyst staining and viability. This was presumably due to inability of the dyes to penetrate the oocyst wall. Pretreatment strategies designed to increase oocyst wall permeability were either ineffective or damaged the oocysts in ways that rendered them nonviable. Initially, microscopic appearance appeared to be related to oocyst infectivity. However, regression analysis showed that phase contrast microscopic appearance had marginal utility for use as a viability test. Indeed, microscopic identification of internal structures of intact oocysts is not a reliable viability indicator because DAPI staining showed intact sporozoite nuclei within obviously dead oocysts that would not excyst. A monoclonal antibody (MAb OW64) was found which binds to internal sites along the oocyst suture. There was positive correlation between binding of this MAb and decreasing oocyst infectivity indicating that MAb OW64 bound preferentially to nonviable oocysts. Regression analysis showed that OW64 binding overestimated oocyst viability because many nonviable oocysts did not bind the MAb. Nevertheless, MAb OW64 is a candidate for producing an immunofluorescence based test in which oocysts that bind OW64 are nonviable whereas those that do not bind are not necessarily viable. Before such a test can be recommended, however, the nonviability of oocysts that bind OW64 must be demonstrated by neonatal mouse infectivity using oocysts sorted by a fluorescence activated cell sorter.
21
Kniel, Kalmia Elisabeth. "Evaluation of chemical treatments and ozone on the viability of Cryptosporidium parvum oocysts in fruit juices." Diss., Virginia Tech, 2002. http://hdl.handle.net/10919/27243.
Full textAbstract:
Cryptosporidium parvum is a protozoan parasite historically associated with waterborne and more recently foodborne outbreaks of diarrheal illness. Contamination of certain foods, such as unpasteurized apple cider, with infective oocysts may occur as oocysts are shed in the feces of common ruminants like cattle and deer that graze in and around orchards. Cryptosporidiosis can result in a severe illness for previously healthy individuals and a life-threatening illness in immunocompromised individuals. Disease occurs after the ingestion of small infective oocysts (4 to 5 mm in size). The relatively thick membrane of the oocysts allows them to be resistant to chlorine and many other environmental pressures, making oocysts difficult to inactivate.
In this study, alternative treatments to pasteurization were evaluated for their ability to inhibit C. parvum oocyst viability in fruit juices. Oocyst viability was analyzed with a cell culture infectivity assay, using a human illeocecal cell line (HCT-8) that is most similar to human infection. The percent inhibition of infection by each treatment was determined along with the corresponding log reduction for the treatments found to be most effective. Infection by treated oocysts was compared to that of control untreated oocysts. Cell monolayers were infected with 10⁶ treated oocysts or a series of 10-fold dilutions. Parasitic life stages were visualized using an immunohistochemistry system and 100 microscope fields counted per monolayer. Organic acids and H₂O₂ were added on a wt/vol basis to apple cider, orange juice, and grape juices. Malic, citric, and tartaric acids at concentrations from 1%-5% inhibited C. parvum infectivity of HCT-8 cells by up to 88%. Concentrations ranging from 0.025%-3% H₂O₂ were evaluated where addition of 0.025% H₂O₂ to each juice resulted in a >5 log reduction of C. parvum infectivity as determined with an MPN-based cell culture infectivity assay. Treating apple cider, orange juice, and grape juice with ozone for a time period of 30 seconds up to 15 minutes at 6° and 22°C (0.9 g/L flow rate) inhibited C. parvum viability to > 90% as monitored in the cell culture assay. It is hypothesized that oocyst wall proteins that are necessary for infection are oxidized by the reactive oxygen species generated from the decomposition of the ozone and hydrogen peroxide treatments. These treatments or combinations thereof may offer potential alternatives to traditional pasteurization for fruit juices to successfully inhibit C. parvum viability.Ph. D.
22
Radziminski, Christopher Zygmunt. "Inactivation of Cryptosporidium parvum oocysts and Bacillus subtilis spores by chlorine dioxide in laboratory reagent and natural waters." Thesis, National Library of Canada = Bibliothèque nationale du Canada, 2000. http://www.collectionscanada.ca/obj/s4/f2/dsk1/tape4/PQDD_0019/MQ53378.pdf.
Full text
23
Grimason, Anthony Martin. "The occurrence and removal of Cryptosporidium sp. oocysts and Giardia sp. cysts in surface, potable and waste-water." Thesis, University of Glasgow, 1992. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.284104.
Full text
24
Tomiak, Robert B., Jason L. Rennecker, Benito J. Marinas, Richard J. Miltner, and James H. Owens. "Modeling Cryptosporidium spp. Oocyst inactivation in bubble-diffuser ozone contactors." Thesis, Urbana, Illinois, Univeristy of Illinois at Urbana-Champaign, 1998. http://hdl.handle.net/10945/37776.
Full textAbstract:
CIVINSThe CT concept (product of disinfectant concentration and characteristic contact time) is currently used to demonstrate compliance with disinfection requirements for Giarda lamblia (G. lamblia) and viruses under the Surface Water Treatment Rule (SWTR). Minimum CT requirements include large safety factors to account for possible deviations from actual disinfection efficiencies achieved in full-scale contactors. The application of this conservative regulatory approach for Cryptosporidium parvum (C. parvum) might result in unrealistic disinfection requirements under the Enhanced SWTR due to the much stronger resistance of this protozoan parasite to inactivation by all chemical disinfectants used in drinking water applications. There is a need for the development of approaches that could provide a more accurate assessmant of actual inactivation efficiency achieved in disinfection contactors. The main objective of this study is to develop and apply a mathematical model predicting the inactivation of Cryptosporidium app. (C. parvum and C. muris) oocysts in ozone bubble-diffusers contactors. The model is calibrated with semi-batch kinetic data, verified with pilot-scale inactivation experiments, and used for predicting and optimizing full-scale disinfection efficiency.
25
Akinosoglou, Karolina-Anthoula. "Anopheles/Plasmodium interactions at the ookinete-to-oocyst developmental transition." Thesis, Imperial College London, 2011. http://hdl.handle.net/10044/1/14690.
Full textAbstract:
The ookinete to oocyst developmental transition of the Plasmodium parasite represents amajor population bottleneck in the malaria life cycle. This suggests that it could be a target forintervention strategies, such as transmission blocking vaccines, provided essential parasite targetmolecules can be identified. A recent microarray analysis has identified a large number of transcriptsdifferentially expressed during the parasite?s developmental transitions. Genes differentiallyregulated during the ookinete-to-oocyst transition may determine the development of the parasitewithin the mosquito host, as well as, participating directly in parasite/mosquito interactions. Yet, thefunction of the majority of such molecules is largely unknown.This PhD thesis aims to identify and functionally characterise genes putatively involved inookinete development and/or the interactions between the parasite and the mosquito host in the modelsystem Plasmodium berghei. Thirty three proteins likely to be implicated in the parasite?s interactionwith the mosquito immune system and local epithelial response were identified based on theirexpression pattern and predicted structural features. Generation of knock-out mutants throughtargeted gene disruption by homologous recombination was the first step towards functionalcharacterization of these candidates. Successful mutants were assessed for their ability to completetheir sexual sporogonic development, as well as, their impact on mosquito immunity followinginfection of Anopheline mosquitoes of various immune backgrounds. Interestingly, two of thesuccessful mutants were hampered in their ability to undergo normal differentiation during ookinetedevelopment while the third one?s ability to invade the mosquito midgut epithelium was impaired.The inability to invade implies a potential interaction of this gene product with mosquito midgutligands. Eventually malaria transmission through Anopheline mosquitoes was affected in all threemutants. Moreover, challenging of a mosquito protein LRIM1, a major parasite antagonist, alsorevealed potential involvement of the three mutants in mosquito/parasite immune response pathways.Genetic crosses with parasite lines deficient in the production of either male or female fertile gametesdemonstrated in the case of two mutants that, this defect in ookinete development is sex dependent,thus underlining the critical importance of maternal and/or paternal control during the first few hoursof parasite development in the mosquito.
26
Rahal, Natália Machado. "Ocorrência e efeito temporal das espécies do gênero Eimeria Schneider, 1875 em cordeiros confinados /." Araçatuba, 2018. http://hdl.handle.net/11449/166408.
Full textAbstract:
Orientador: Luiz Claudio Nogueira MendesCoorientador: Marcelo Vasconcelos Meireles
Banca: Alex Akira Nakamura
Banca: Fernanda Bovino
Resumo: A infecção patogênica por Eimeria spp., denominada eimeriose ou coccidiose, tem sido indicada como responsável por mortes, queda no desenvolvimento e baixa produtividade em criações animais, ocorrendo principalmente em indivíduos jovens devido à imaturidade do sistema imunológico. Quando são submetidos a um sistema intensivo de produção, como em situação de confinamento, cordeiros podem se tornar ainda mais susceptíveis às infecções por espécies de Eimeria, devido à alta concentração de indivíduos, que potencializa a dispersão do parasito, e ao estresse associado à criação. No estado de São Paulo, já foram identificadas dez espécies de Eimeria em estudos prévios e, dentre elas, E. ovinoidalis foi considerada a mais patogênica para ovinos. Dessa forma, o objetivo deste trabalho foi descrever as espécies do gênero Eimeria Schneider, 1875 que ocorreram em um confinamento de cordeiros, bem como as dinâmicas da eliminação de oocistos no ambiente e correlação com o ganho de peso médio diário (GMD) durante nove semanas. Cento e quatro cordeiros de diversas raças e cruzas, com aproximadamente 60 dias de vida, foram confinados e submetidos a pesagens, avaliações clínicas e coprológicas periódicas. Amostras de fezes que continham mais de 500 oocistos de Eimeria por gramas de fezes (OoPG) foram separadas para esporulação, posteriormente determinando-se as espécies às quais os oocistos pertenciam. Dentre os 677 oocistos avaliados, as seguintes espécies foram identificadas: E. parva Kotla... (Resumo completo, clicar acesso eletrônico abaixo)
Abstract: Pathogenic infection caused by Eimeria spp., denominated eimeriosis or coccidiosis, has been pointed out as responsible for deaths, decreased development and low productivity for livestock animals, affecting mainly young individuals due to immature immunological system. When submitted to an intensive breeding system, as a feedlot, lambs can become even more susceptible to Eimeria infections, due to high concentration of animals, which potentializes parasite dispersion, and to stress generated by farming conditions. In São Paulo State, ten Eimeria species were identified in previous studies and, among them, E. ovinoidalis, was considered the most pathogenic for ovine. So, this study aimed to describe species of the Eimeria Schneider, 1875 that occurred in a lamb feedlot, as well as the dynamics of oocyst output in the environment and its correlation with daily weight gain (DWG) during nine weeks. One hundred and four lambs of various breeds and crossbreeds, at approximately 60 days old, were placed in a feedlot and submitted to periodic weighing, clinical and coprological evaluations. Fecal samples that had more than 500 Eimeria spp. oocysts per gram (OPG) were separated for sporulation, and oocysts were identified at species level. Among the 677 evaluated oocysts, the following species were identified: E. parva Kotlan, Moscy & Vajda, 1929, E. crandallis Honess, 1942, E. ovinoidalis McDougald, 1979, E. weybridgensis Norton, Joyner & Catchpole 1974, E. bakuensis Musaev, 1970 (s... (Complete abstract click electronic access below)
Mestre
27
Esmerini, Patricia de Oliveira. "Isolamento e detecção molecular do Toxoplasma gondii (Nicolle e Manceaux, 1909) de moluscos bivalves marinhos comercializados no mercado de peixes do Município de Santos no Estado de São Paulo." Universidade de São Paulo, 2009. http://www.teses.usp.br/teses/disponiveis/10/10134/tde-23042009-145558/.
Full textAbstract:
A toxoplasmose é uma zoonose de distribuição mundial. O Toxoplasma gondii infecta o Homem e a maioria dos animais homeotérmicos. A ingestão de oocistos esporulados é uma das formas de transmissão desse protozoário. Oocistos de T. gondii podem esporular na água do mar e manter a infectividade por até seis meses. Moluscos bivalves podem filtrar e reter oocistos de T. gondii da água do mar em condições experimentais. O objetivo deste trabalho foi investigar a presença de T. gondii em ostras (Crassostrea rhizophorae) e mariscos (Mytella guayanensis) em condições naturais. Um total de 300 ostras e 300 mariscos foram adquiridos no Mercado de Peixes do município de Santos no estado de São Paulo no período de 05/03/2008 a 29/08/08 e divididos em 60 grupos de cinco ostras e 20 grupos de 15 mariscos. Para o isolamento do parasita, cinco camundongos foram inoculados oralmente com homogenados dos tecidos de cada grupo de ostras ou mariscos. Para a detecção molecular, o DNA dos tecidos dos mariscos foi extraído pelo método de fenol-clorofórmio e o das ostras, pelo método de isotiocianato de guanidina, Em seguida, foi realizada a nested-PCR (Reação em Cadeia pela Polimerase) baseada na amplificação de um fragmento de 155pb do gene B1 de T. gondii. A genotipagem das amostras de T. gondii detectadas foi feita usando a PCR-RFLP (Polimorfismo de Comprimento de Fragmentos de DNA gerados por Enzimas de Restrição) usando os marcadores SAG1, SAG2, SAG3, BTUB, GRA6, c22-8, c29-2, L358, PK1, CS3 e Apico. Não houve isolamento do parasita pelo bioensaio em camundongos. Nos grupos de mariscos, o T. gondii não foi detectado pela n-PCR e, nos grupos de ostras, houve detecção do T. gondii em dois grupos (3,3%). Não foi possível a genotipagem das amostras de T. gondii detectadas. O presente estudo permitiu concluir que ostras da espécie Crassostrea rhizophorae podem filtrar e reter oocistos de T. gondii e que o ambiente marinho do litoral do estado de São Paulo encontra-se contaminado com oocistos desse parasita. Assim, o consumo de ostras cruas pode representar uma potencial via de transmissão de T. gondii para o Homem e para os animais marinhos.Toxoplasmosis is a worldwide zoonosis. Toxoplasma gondii is widely prevalent in humans and other mammals. This protozoan parasite can be transmitted by ingestion of sporulated oocysts. T. gondiioocysts can sporulate in seawater and retain their infectivity for at least six months. Experimentally, bivalve mollusks can filter and retain T. gondii oocysts from the seawater. The aim of this study was to investigate the presence of T. gondii in oysters (Crassostrea rhizophorae) and mussels (Mytella guayanensis) in natural conditions. A total of 300 oysters and 300 mussels were acquired from the Fish Market in Santos city, São Paulo state, from March 2008 to August 2008, and divided in 60 groups of five oysters and 20 groups of 15 mussels. To isolate the parasite, five mice were orally inoculated with tissue homogenates from each group of oysters or mussels. For molecular detection of T. gondii, DNA from mussels was extracted using a standard phenol-chloroform method and DNA from oysters was extracted using the guanidine isothiocianate method. A nested-PCR (Polymerase Chain Reaction) based on the amplification of a 155bp fragment from B1 gene of T. gondii was then performed. Eleven PCR-RFLP (Restriction Fragment Length Polymorphism) markers including SAG1, SAG2, SAG3, BTUB, GRA6, c22-8, c29-2, L358, PK1, CS3 e Apico were used to genotype positive samples. There was no isolation of the parasite by bioassay in mice. T. gondii was not detected in the groups of mussels by n-PCR. There was detection of T. gondii by n-PCR in two groups of oysters (3.3%). Genotyping of these two positive samples was not successful. The results indicate that oysters of the species Crassostrea rhizophorae, the commonest species from the coast of São Paulo, can filter and retain T. gondii oocysts and that the marine environment of the coast of São Paulo state is contaminated with oocysts of this parasite. The ingestion of raw oysters can represent a potential transmission source of T. gondii to humans and marine mammals.
28
Neto, Aldo Francisco Alves. "Avaliação da viabilidade de oocistos esporulados de Neospora caninum a diferentes condições de temperatura e ação de desinfetantes." Universidade de São Paulo, 2009. http://www.teses.usp.br/teses/disponiveis/10/10134/tde-18012010-113445/.
Full textAbstract:
Neospora caninum é um parasita Apicomplexa que causa doença neuromuscular em cães e abortamento em bovinos. Cães e coiotes são as únicas espécies reconhecidas como hospedeiros definitivos, nas quais ocorre a fase sexuada do ciclo evolutivo do N. caninum, com eliminação de oocistos através das fezes, os quais esporulam no ambiente e tornam-se infectantes. Apesar da importância dos oocistos como fonte de infecção para várias espécies de hospedeiros, a viabilidade e resistência desses oocistos a tratamentos físicos e químicos ainda são desconhecidas. Este estudo teve por objetivo avaliar a viabilidade de oocistos esporulados de N. caninum após tratamentos com diferentes desinfetantes, temperaturas e tempos de exposição. Três cães foram alimentados com tecido cerebral de búfalos soropositivos para anticorpos anti-N.caninum pela reação de imunofluorescência indireta (RIFI 100) para a obtenção de oocistos. Desses, somente um cão eliminou oocistos tipo Neospora-Hammondia sendo confirmado serem de N. caninum por bioensaio em gerbilos e por métodos moleculares (PCR-RFLP). Os oocistos esporulados foram purificados e 11 alíquotas contendo aproximadamente 3000 oocistos por alíquota constituíram cada um dos tratamentos, sendo estes: Formol 10% por 1h; Amônia 10% por 1h; Álcool 70% por 1h; Álcool absoluto por 1h; Iodo 2% por 1h; Hipoclorito de sódio 10% por 1h; Temperatura ambiente, controle; -20ºC por 6h; 4ºC por 6h; 60ºC por 1m e 100ºC por 1m. Os tratamentos químicos foram todos realizados à temperatura ambiente. Após tratamento os oocistos foram divididos em alíquotas com 1000 oocistos cada e estas foram administradas, via oral, a gerbilos (1000 oocistos por gerbilo) sendo cada grupo experimental constituídos por três animais. Depois de 63 dias os gerbilos foram sacrificados e colheu-se sangue para a pesquisa de anticorpos anti-N. caninum (RIFI e western blotting) e tecidos para a pesquisa de cistos em esfregaço direto de cérebro e DNA do parasito (PCR em tempo real), além de pesquisa do agente por técnicas histopatológicas e imuno-histoquímica. Considerou-se eficaz o tratamento que confirmou a inviabilidade dos oocistos por resultados negativos em todas as cinco provas realizadas. Dos tratamentos realizados mostrou-se eficaz o uso de calor a 100ºC por 1 minuto e do hipoclorito de sódio a 10% por 1 hora, podendo ser estes indicados para o controle dessas formas no ambiente.Neospora caninum is an Apicomplexan parasite that causes neuromuscular disorders in dogs and abortion in cattle. Dogs and coyotes are the only species identified as definitive hosts. The sexual phase of the N. caninum life cycle occurs within the host, and results in the shedding of oocysts in the feces that will sporulate in the environment and become infective. Despite their relevance as a source of infection for a number of different hosts, the resistance and viability of such oocysts to physical and chemical treatments are yet to be known. The purpose of this study was to assess the viability of N. caninum sporulated oocysts after exposure to treatments using different disinfectants, temperatures and periods of time. For acquisition of the oocysts, three dogs were fed brain tissue from buffaloes positive for antibodies to N. caninum by an indirect fluorescent antibody test (IFAT 100). Only one of the dogs excreted Neospora-Hammondia type oocysts. Such oocysts were confirmed to be N. caninum by bioassay in gerbils and molecular methods (PCR-RFLP). The sporulated oocysts were purified and 11 doses with approximately 3,000 oocysts each were treated as follows: 10% formaldehyde (formol) for 1 h; 10% ammonia for 1 h; 70% alcohol for 1 h; absolute alcohol for 1 h; 2% iodine for 1 h; 10% sodium hypochlorite for 1 h; Room temperature, control; -20ºC for 6 h; 4ºC for 6 h; 60ºC for 1 min, and 100ºC for 1 min. All chemical treatments were performed at room temperature. After treatment, the oocysts were divided into doses of 1,000 oocysts each and administered into three gerbils (Meriones unguiculatus) orally (1,000 oocysts per gerbil) per treatment. The gerbils were euthanized after 63 days. Blood samples were taken to be tested for the presence of N. caninum antibodies (IFAT and Western blotting analysis), and tissues samples to be tested for the presence of cysts by brain smear technique and detection of the parasite DNA (real-time PCR), and the identification of the parasite by immunohistochemical and histopathological examinations. In order to be considered an effective treatment, negative results should be observed in the gerbils of all five evaluations conducted. Out of the treatments carried out in this study, exposures to a temperature of 100ºC for 1 min and to a 10% sodium hypochlorite solution for 1 h were effective.
29
Galvani, Ana Tereza. "Quantificação de oocistos de Toxoplasma gondii em amostras de águas superficiais no Estado de São Paulo." Universidade de São Paulo, 2016. http://www.teses.usp.br/teses/disponiveis/6/6134/tde-21122016-103103/.
Full textAbstract:
Introdução: A água tem sido considerada um importante veículo para a disseminação de surtos de toxoplasmose em vários países. Os oocistos de Toxoplasma gondii podem persistir no ambiente durante longos períodos, sendo altamente resistentes aos vários processos químicos de inativação, inclusive aos processos comuns de desinfecção utilizados pelos sistemas produtores de água. Pouco se tem registrado no país sobre a real extensão da contaminação dos recursos hídricos por Toxoplasma gondii, sendo que a sua detecção em amostras de águas é muito importante na implantação de ações preventivas. As metodologias existentes no momento para identificação e quantificação deste parasita nestes tipos de amostras não estão universalmente padronizadas e apresentam limitações. Objetivo: O presente estudo teve como objetivo verificar a possível presença do protozoário em águas superficiais de abastecimento público no Estado de São Paulo mediante a implantação de uma metodologia específica para a quantificação de oocistos de Toxoplasma gondii por reação quantitativa de PCR em tempo real nessas amostras. Método: Um total de 39 amostras de águas superficiais provenientes de 10 mananciais do Estado de São Paulo foram analisadas durante o período de maio a dezembro de 2015. Volumes de 20L da amostra foram concentrados por meio de filtração em cápsulas Envirocheck® HV (Pall Gelman Laboratory), sendo a cápsula filtrante tratada com uma solução dispersante, eluída e o eluato concentrado por centrifugação. O sedimento obtido após a centrifugação da amostra foi submetido à extração de DNA, sendo utilizado o kit de extração PowerSoil DNA isolation® (MO BIO Laboratories). A sequência alvo selecionada para detecção e quantificação de oocistos de Toxoplasma gondii através da reação quantitativa de PCR em tempo real foi um fragmento de 62 pares de bases do gene B1, sendo utilizado o seguinte conjunto de iniciadores: 5 CTAGTATCGTGCGGCAATGTG 3 (531-551) e 5GGCAGCGTCTCTTCCTCTTTT 3 (571-592). A sonda utilizada foi: 5 (6-FAM) CCACCTCGCCTCTTGG-(NFQ-MGB) 3. Resultados: Do total das amostras analisadas, 7,7 por cento (3/39) foram positivas para oocistos de Toxoplasma gondii e dentre os 10 mananciais estudados, detectou-se a ocorrência do protozoário em 30 por cento (3/10) dos mesmos. Conclusão: Os dados obtidos no presente estudo demonstram que o protozoário Toxoplasma gondii está circulando em águas superficiais de abastecimento público no Estado de São Paulo.Introduction: Water is an important vehicle for the spread of toxoplasmosis outbreaks in several countries. Toxoplasma gondii oocysts may remain for a long period in the environment and are highly resistant to chemical inactivation, including the routine classical disinfection procedures in water treatment facilities. Few reports have been published in Brazil about the real extent of the contamination of water resources by Toxoplasma gondii, which is of major importance to implement preventive actions. Methods for the identification and quantification of the parasite in water bodies are not standardized and have limitations. Objective: This study aimed to verify the presence of these protozoa in surface waters used as source for drinking water production in the State of São Paulo by implementing a specific methodology to quantify Toxoplasma gondii oocysts with quantitative real-time PCR. Method: Thirty nine samples of surface waters from 10 different sites in the State of São Paulo were analized from May to December 2015. Volumes of 20L of each sample were concentrated by filtration with capsule Envirocheck® HV (Pall Gelman Laboratory).The filter capsule was treated with a dispersant solution, eluted, and the eluate concentrated by centrifugation. DNA was extracted from the resulting pellet with PowerSoil DNA isolation® (MO BIO Laboratories) extraction kit. A fragment of 62 base pairs of the B1 gene was selected as target sequence for detection and quantitation the Toxoplasma gondii oocysts by the quantitative real-time PCR reaction, and the following primers: 5\' TAGTATCGTGCGGCAATGTG 3\' (531-551) and 5\'GGCAGCGTCTCTTCCTCTTTT 3\' (571-592) were used. The probe employed was 5 \'(6-FAM) CCACCTCGCCTCTTGG- (NFQ-MGB) 3\'. Results: Toxoplasma gondii oocysts were detected in 30 per cent (3/10) of the sites evaluated and 7.7 per cent (3/39) of all samples analyzed were positive. Conclusion: The results of the present study show that the protozoan Toxoplasma gondii is circulating in surface waters used as drinking water supply in the State of São Paulo.
30
Cameron, Melissa A. "Evaluation of TaqMan Real-Time PCR for the Detection of Viable Cryptosporidium parvum Oocysts in Environmental Water Samples." [Tampa, Fla.] : University of South Florida, 2007. http://purl.fcla.edu/usf/dc/et/SFE0002027.
Full text
31
Bushell, Ellen S. C. "Plasmodium genes responsible for oocyst development and interaction with its Anopheline vector." Thesis, Imperial College London, 2010. http://hdl.handle.net/10044/1/5542.
Full textAbstract:
The transmission of the malaria parasite Plasmodium is governed by a complex developmental cycle. This PhD thesis describes the transcriptional profiling of the rodent malaria parasite Plasmodium berghei developmental migration through its A. gambiae vector. The study was conducted in vivo, using a near complete P. berghei genome microarray platform. Emphasis was placed on the oocyst stage, as little is known about the genes implicated in the ookinete to oocyst transition, and oocyst maturation. The data presented here provide novel transcriptional information about Plasmodium transmission. The analysis revealed a large shift in gene utilisation as the parasite makes its transition from the motile ookinete to the sessile oocyst. Furthermore, this work has shown that different sets of co-regulated genes are important for early and late oocyst development. In addition, this PhD thesis outlines the characterisation of a novel Plasmodium formin-like protein essential for rodent malaria transmission named the male inherited sporulation factor important for transmission (misfit). MISFIT is expressed in the early mosquito stages, where the protein localises to the parasite nucleus. Misfit exhibits an absolute requirement for paternal inheritance, which is in accordance with an observed male-biased expression pattern. pbmisfitΔ ookinetes display significant ultrastructural and gene expression defects and fail to complete zygotic meiosis. However, pbmisfitΔ ookinetes retain functionality and can successfully cross the midgut epithelial barrier. In contrast, mosquito infections with pbmisfitΔ resulted in an arrest immediately upon ookinete-oocyst transformation, where defective oocysts fail to sporulate. An essential role in chromosome segregation during mitosis / meiosis is postulated for MISFIT. In conclusion, the work presented in this thesis has established the ookinete-oocyst transition as a major cell cycle check point during malaria transmission and identified misfit as the first male inherited Plasmodium gene known to affect development post-fertilisation.
32
Ganz, Kyle. "Developing Lab on a Chip Technology for the Detection and Characterisation of Giardia duodenalis cysts and Cryptosporidium spp. oocysts on Foods." Thesis, Université d'Ottawa / University of Ottawa, 2015. http://hdl.handle.net/10393/31959.
Full textAbstract:
In the present study methods which can be integrated into a complete lab on a chip system for the detection and characterisation of Giardia duodenalis cysts and Cryptosporidium spp. oocysts from foods were developed and tested. Microfluidic chips, which make use of inertial separation, were designed and fabricated for the concentration and separation of either cysts or oocysts from food particles. These chips were highly specific for their intended target and were shown to be effective when used for artificially contaminated lettuce samples. The quantification by real-time PCR of Cryptosporidium spp. hsp70 mRNA, expressed in response to a heat stress, was assessed as a potential lab on a chip method for the detection of viable oocysts from foods. This method proved to be effective in determining the viability of oocysts in apple cider and the effects of high hydrostatic pressures on the viability of oocysts.
33
Verissimo, Ana Carolina Ferreira. "Investigação sorológica de anticorpos anti-Neospora caninum e fatores de risco em bovídeos do Sítio Histórico e Patrimônio Cultural Kalunga." Universidade Federal de Goiás, 2018. http://repositorio.bc.ufg.br/tede/handle/tede/8279.
Full textAbstract:
Submitted by Erika Demachki (erikademachki@gmail.com) on 2018-03-29T18:11:26Z
No. of bitstreams: 2
Dissertação - Ana Carolina Ferreira Verissimo - 2018.pdf: 2383390 bytes, checksum: 7d7ef89eca06856f4f0bf76d5ef89e58 (MD5)
license_rdf: 0 bytes, checksum: d41d8cd98f00b204e9800998ecf8427e (MD5)Approved for entry into archive by Erika Demachki (erikademachki@gmail.com) on 2018-03-29T19:23:41Z (GMT) No. of bitstreams: 2 Dissertação - Ana Carolina Ferreira Verissimo - 2018.pdf: 2383390 bytes, checksum: 7d7ef89eca06856f4f0bf76d5ef89e58 (MD5) license_rdf: 0 bytes, checksum: d41d8cd98f00b204e9800998ecf8427e (MD5)
Made available in DSpace on 2018-03-29T19:23:41Z (GMT). No. of bitstreams: 2 Dissertação - Ana Carolina Ferreira Verissimo - 2018.pdf: 2383390 bytes, checksum: 7d7ef89eca06856f4f0bf76d5ef89e58 (MD5) license_rdf: 0 bytes, checksum: d41d8cd98f00b204e9800998ecf8427e (MD5) Previous issue date: 2018-02-14
Conselho Nacional de Pesquisa e Desenvolvimento Científico e Tecnológico - CNPq
The prevalence of anti-Neospora caninum antibodies in cattle from Kalunga Historical Heritage and Cultural Heritage (SHPKC) herds and associated risk factors were evaluated. A total of 141 SHPCK properties were studied and 4,810 bovine serum samples and 47 Murrah buffalo samples were collected, totaling 4,857 cattle, including animals of different races, different age groups, and male and female. The enzyme-linked immunosorbent assay (ELISA) was used to identify seroreagent animals for antibodies anti-N. caninum. A questionnaire was applied to obtain information on socioeconomic and zootechnical data of the owners and to verify the risk factors associated with the occurrence of neosporosis. The prevalence of anti-N. caninum in animals from the SHPCK region was 8.3%, represented by 405 positive animals and 75.2% at the herd level. The following factors were associated with the occurrence of antibodies anti-N. caninum: annual temperature, maximum temperature on the hottest day of the month, coldest minimum temperature of the month, vaccination against foot-and-mouth disease, vaccination against clostridiosis, contact with wild animals, high precipitation and presence of wetlands. Key words: Cattle, oocysts, protozoa, seroprevalence.
A prevalência de anticorpos anti-Neospora caninum em bovinos dos rebanhos do Sítio Histórico e Patrimônio Cultural Kalunga (SHPKC) e os fatores de risco associados foram avaliados. Foram estudadas 141 propriedades SHPCK e foram coletadas 4.810 amostras de soro bovino e 47 amostras de búfalos Murrah, totalizando 4.857 bovinos, incluindo animais de diferentes raças, diferentes grupos etários e macho e fêmeas. O ensaio de imunoabsorção enzimática (ELISA) foi utilizado para identificar os animais sororreagentes para anticorpos anti-N. caninum. Foi aplicado um questionário para obter informações sobre dados socioeconômicos e zootécnicos dos proprietários e para verificar os fatores de risco associados à ocorrência da neosporose. A prevalência de anticorpos anti-N. caninum nos animais da região SHPCK foi de 8,3%, representado por 405 animais positivos e 75,2% em nível do rebanho. Os seguintes fatores foram associados à ocorrência de anticorpos anti-N. caninum: temperatura anual, temperatura máxima no dia mais quente do mês, temperatura mínima mais fria do mês, vacinação contra a febre aftosa, vacinação contra clostridioses, contato com animais selvagens, alta precipitação e presença de áreas alagadiças.
34
Anthony, Renil J. "Solvent Extraction of Lipids from Microalgae." Ohio University / OhioLINK, 2010. http://rave.ohiolink.edu/etdc/view?acc_num=ohiou1280854965.
Full text
35
Ramirez, Norma E. "Cryptosporidium studies maintenance of stable populations through in vivo propagation and molecular detection strategies /." Connect to this title online, 2005. http://rave.ohiolink.edu/etdc/view?acc%5Fnum=osu1110293214.
Full textAbstract:
Thesis (Ph. D.)--Ohio State University, 2005.Document formatted into pages; contains 202 p. Includes bibliographical references. Abstract available online via OhioLINK's ETD Center; full text release delayed at author's request until 2006 March 9.
36
Berto, Bruno Pereira. "Morfologia e sistem?tica de cocc?dios (Apicomplexa: Eimeriidae) parasitas de aves Passeriformes da Ilha da Marambaia, Rio de janeiro, Brasil. 2010." Universidade Federal Rural do Rio de Janeiro, 2010. https://tede.ufrrj.br/jspui/handle/tede/798.
Full textAbstract:
Made available in DSpace on 2016-04-28T20:16:19Z (GMT). No. of bitstreams: 1
Bruno Pereira Berto1.pdf: 2100000 bytes, checksum: 7c975b30da67285bf2c8d87c9e105bc9 (MD5)
Previous issue date: 2010-03-02Coordena??o de Aperfei?oamento de Pessoal de N?vel Superior
Coccidiosis associated with the genera Eimeria Schneider, 1875 and Isospora Schneider, 1881 in the order Passeriformes are reported for more than two centuries. This study aimed to contribute to the morphology and systematic of coccidian parasites of the order Passeriformes, providing scientific basis for identification of parasite species of birds from North, South and Central America. The coccidia were organized and grouped according to the family of the host, following the concept widely recognized of family-specificity and the systematic of the class Aves updated. Isospora tiesangui, I. marambaiensis, I. sepetibensis, I. cadimi, I. navarroi, I. ramphoceli, I. mionectesi, I. feroxis, I. cagasebi, I. coerebae, I. piacobrai e Eimeria sicki were identified and characterized according to their respective hosts of the order Passeriformes, which inhabit the Atlantic forest of the Marambaia Island, Rio de Janeiro, Brazil. The main feature of differentiation and identification of these species was the Stieda and substieda bodies, since the morphometric parameters did not provide sufficient differentiation. The specificity of coccidia occurred at the family level, because Ramphocelus bresilius dorsalis and the new hosts Dacnis cayana and Thraupis palmarum, family Thraupidae, were described for the species I. tiesangui, I sepetibensis and I. navarroi, and, similarly, Myiarchus ferox and Leptopogon amaurocephalus, family Tyrannidae, were described for E. sicki. Finally, dichotomous keys for identification were effective for the families Thraupidae and Tyrannidae.
Coccidioses associadas aos g?neros Eimeria e Isospora na ordem Passeriformes s?o relatadas h? mais de dois s?culos. Este trabalho objetivou contribuir para a morfologia e sistem?tica de cocc?dios parasitos da ordem Passeriformes, fornecendo embasamento cient?fico para identifica??o de esp?cies parasitas de aves das Am?ricas do Norte, do Sul e Central. Os cocc?dios foram organizados e agrupados de acordo com a fam?lia do hospedeiro, seguindo o conceito fam?lia-espec?fico, amplamente reconhecido e a sistem?tica da classe Aves atualizada. Isospora tiesangui, I. marambaiensis, I. sepetibensis, I. cadimi, I. navarroi, I. ramphoceli, I. mionectesi, I. feroxis, I. cagasebi, I. coerebae, I. piacobrai e Eimeria sicki foram identificadas e caracterizadas de acordo com seus respectivos hospedeiros da ordem Passeriformes, os quais habitam o bi?topo de sub-bosque da Mata Atl?ntica, Ilha da Marambaia, Rio de Janeiro, Brasil. A principal caracter?stica de diferencia??o e identifica??o destas esp?cies foi o complexo corpo de Stieda e substieda, uma vez que o estudo morfom?trico n?o forneceu par?metros suficientes de diferencia??o. A especificidade ocorreu em n?vel de fam?lia, pelo fato de Ramphocelus bresilius dorsalis e os novos hospedeiros Dacnis cayana e Thraupis palmarum, da fam?lia Thraupidae, terem sido descritos para as esp?cies I. tiesangui, I. sepetibensis e I. navarroi, e, da mesma forma, Myiarchus ferox e Leptopogon amaurocephalus, da fam?lia Tyrannidae, foram descritos para E. sicki. Por fim, chaves dicot?micas de identifica??o de esp?cies de cocc?dios parasitas de aves Passeriformes foram efetivadas para as fam?lias Thraupidae e Tyrannidae.
37
Rodrigues, Mariana Bento. "Esp?cies de cocc?dios em Thraupidae (Aves: Passeriformes) do Parque Nacional do Itatiaia, RJ: morfologia e taxonomia." Universidade Federal Rural do Rio de Janeiro, 2016. https://tede.ufrrj.br/jspui/handle/jspui/1320.
Full textAbstract:
Submitted by Sandra Pereira (srpereira@ufrrj.br) on 2016-10-20T10:49:41Z
No. of bitstreams: 1
2016 - Mariana Borges Rodrigues.pdf: 10445208 bytes, checksum: 3b8788e9719ae12da12f01e329a82878 (MD5)Made available in DSpace on 2016-10-20T10:49:41Z (GMT). No. of bitstreams: 1 2016 - Mariana Borges Rodrigues.pdf: 10445208 bytes, checksum: 3b8788e9719ae12da12f01e329a82878 (MD5) Previous issue date: 2016-02-19
Coordena??o de Aperfei?oamento de Pessoal de N?vel Superior - CAPES
Coccidia are obligate intracellular parasites, classified in Subphylum Apicomplexa and order Eucoccidiorida, which has different stages in their life cycles. In Passeriformes, the coccidian species of Isospora Schneider, 1881 are the most common, being the family Thraupidae one of the major families, with 12 host species described. The aim of this study was to identify, characterize and quantify the coccidian parasites of Thraupidae in the Itatiaia National Park. Isospora ramphoceli Berto, Flausino, Luz, Ferreira, Lopes, 2010 was identified in ruby-crowned tanagers Tachyphonus coronatus (Vieillot, 1822), which became a new host, and the Itatiaia National Park a new location for this coccidian species. The intensity of infection in different hosts were high, which can be justified by frugivorous feeding habits that favoring the feco-oral transmission of coccidia and by the positive hosts inhabit in disturbed areas susciptible to the effects of forest edge. The oocysts were characterized as uniform in T. coronatus and morphologically and morphometrically similar to the original description in Ramphocelus bresilius dorsalis Sclater, 1855 on the island of Marambaia, RJ. The specificity of I. ramphoceli occurred at the family level, because T. coronatus and R. b. dorsalis are included in the Thraupidae family.
Os cocc?dios s?o parasitas intracelulares obrigat?rios, classificados no Subfilo Apicomplexa e ordem Eucoccidiorida, que tem fases diferentes em seus ciclos de vida. Em Passeriformes as esp?cies de Isospora Schneider, 1881 s?o as mais comuns, sendo a fam?lia Thraupidae uma das principais fam?lias-hospedeiras com 12 esp?cies descritas. O objetivo deste estudo foi identificar, caracterizar e quantificar os cocc?dios parasitos de Thraupidae do Parque Nacional do Itatiaia. Isospora ramphoceli Berto, Flausino, Luz, Ferreira, Lopes, 2010 foi identificada em ti?s-pretos Tachyphonus coronatus (Vieillot, 1822), o qual se tornou novo hospedeiro e o Parque Nacional do Itatiaia nova localidade para este cocc?dio. As intensidades de infec??o em diferentes hospedeiros positivos foram altas, o que pode ser justificado pelo h?bito alimentar frug?voro que favorece a transmiss?o feco-oral dos cocc?dios e por parte dos hospedeiros positivos habitarem em ?reas antropizadas submetidas aos efeitos de borda de mata. Os oocistos foram caracterizados como uniformes em T. coronatus e morfologicamente e morfometricamente semelhantes a descri??o original em Ramphocelus bresilius dorsalis Sclater, 1855 na Ilha da Marambaia, RJ. A especificidade de I. ramphoceli ocorreu em n?vel de fam?lia, pelo fato de T. coronatus e R. b. dorsalis estarem classificados entre os traup?deos.
38
Stingelin, Giovani Marco [UNESP]. "Protocolos de utilização de toltrazuril para o controle da coccidiose em leitões naturalmente infectados." Universidade Estadual Paulista (UNESP), 2017. http://hdl.handle.net/11449/150346.
Full textAbstract:
Submitted by GIOVANI MARCO STINGELIN null (giovani_44@hotmail.com) on 2017-04-19T04:16:09Z
No. of bitstreams: 1
Dissertação de Mestrado Giovani M. Stingelin.pdf: 1323487 bytes, checksum: 714dbbed6afc25d765018a23a47264a0 (MD5)Approved for entry into archive by Luiz Galeffi (luizgaleffi@gmail.com) on 2017-04-19T13:55:36Z (GMT) No. of bitstreams: 1 stingelin_gm_me_bot.pdf: 1323487 bytes, checksum: 714dbbed6afc25d765018a23a47264a0 (MD5)
Made available in DSpace on 2017-04-19T13:55:36Z (GMT). No. of bitstreams: 1 stingelin_gm_me_bot.pdf: 1323487 bytes, checksum: 714dbbed6afc25d765018a23a47264a0 (MD5) Previous issue date: 2017-03-09
A coccidiose é uma das doenças mais importantes que acometem leitões lactentes no Brasil. A administração de toltrazuril é usada no mundo todo para a prevenção de coccidiose em leitões, entretanto, não foram encontradas pesquisas sobre a correta profilaxia da doença no Brasil. Sendo assim, este estudo tem como objetivo investigar diferentes protocolos de administração de toltrazuril (FARMACOX® 5%, suspensão oral, Farmabase Saúde Animal, SP, Brasil) sob as condições de campo no estado de São Paulo. Para isso, 495 leitões foram aleatoriamente divididos em quatro diferentes grupos: 125 leitões (grupo controle) que não receberam toltrazuril; 127 leitões que receberam toltrazuril no terceiro dia de vida (grupo dois); 116 leitões que receberam toltrazuril no quinto dia de vida (grupo três), e 127 leitões que receberam duas doses de toltrazuril, uma com três e outra com sete dias de idade (grupo quatro). A excreção de oocistos foi avaliada por análises coproparasitológicas quando os animais tinham cinco, sete, 12, 21 e 63 dias de idade e as pesagens individuais foram realizadas aos três, 21 e 132 dias de idade. Os dados foram analisados usando o peso ao terceiro dia como uma covariável independente. Os resultados foram separados por médias e ajustados por Tukey (p ≤ 0,05). Os animais dos grupos dois e quatro não excretaram Cystoisospora suis, mas um animal do grupo controle e um do grupo três (aos 63 dias de idade) excretaram oocistos de C. suis. Os leitões do grupo controle apresentaram menor peso ao desmame quando comparado com os do grupo quatro. Quando os leitões do grupo controle tinham 132 dias de idade, o peso corporal foi significativamente menor quando comparado com os grupos dois e quatro. Os animais do grupo controle tiveram menor ganho de peso diário (GPD) que os do grupo quatro no período de três a 21 dias e menor GPD dos três aos 132 dias de idade que os animais dos grupos dois e quatro. Estes resultados sugeriram que a administração de toltrazuril ao terceiro dia de vida é o protocolo recomendado para controle da coccidiose e para melhoria do peso e GPD dos leitões.
Coccidiosis is one of the most important diseases affecting suckling piglets. It causes diarrhea, dehydration, weight loss, low performance and significant economic losses. Toltrazuril administration is used worldwide for coccidiosis prevention in piglets, however, no research was found on the correct prophylaxis of the disease in field conditions in Brazil. Thus, this study is aimed at evaluating different protocols of toltrazuril administration (FARMACOX® 5%, oral suspension, Farmabase Animal Health, SP, Brazil). These protocols were used for specific conditions of production in the state of São Paulo for controlling coccidiosis under field conditions. For that, 495 piglets were randomly allocated. The animals were divided into four different groups: 125 piglets (control group) which did not receive toltrazuril; 127 piglets that received toltrazuril on the third day of life (group two); 116 piglets which received toltrazuril on the fifth day (group three), and 127 piglets that received two dosages of toltrazuril when the animals were 3 and 7 days-old (group four). Excretion of oocysts was evaluated by coproparasitological analysis when the animals were 5, 7, 12, 21 and 63 days-old. They were individually weighed at 3, 21 and 132 days-old to evaluate the growth performance between treatments. Data was analyzed using the MIXED procedure of SAS, using the third day weight as an independent covariate. Results were separated with PDIFF adjusted by Tukey (P ≤ 0.05). Groups 2 and 4 did not excrete C. suis. One animal from the control group and group three (63 days-old) excreted C. suis oocysts. The control group demonstrated lower weight at weaning when compared to group 4. When the piglets from the control group were 132 days-old the body weight was significant lower when compared to groups 2 and 4. The control group also demonstrated significant lower average daily weight gain (ADG) then group 4 at weaning and lower significant ADG at 132 days-old then groups 2 and 4. These results suggested that the administration of toltrazuril by the third day of life is the recommended protocol to control coccidiosis and to improve the weight and ADG of piglets.
39
Chasser, Kaylin M. "Impact of necrotic enteritis on the growth curve and the evaluation of test parameters for measuring coccidial infection." The Ohio State University, 2018. http://rave.ohiolink.edu/etdc/view?acc_num=osu1523281345700585.
Full text
40
Longa, Mark Tikwasi. "Biology of transmission stages of Eimeria pragensis (Cerna and Senaud, 1969) with particular reference to the survival and viability of sporulated oocysts in soil." Thesis, University of Reading, 1996. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.309550.
Full text
41
Csavina, Janae L. "The Optimization of Growth Rate and Lipid Content from Select Algae Strains." Ohio University / OhioLINK, 2008. http://rave.ohiolink.edu/etdc/view?acc_num=ohiou1215529734.
Full text
42
Barkan, Katherine Jane. "Analysis of Variable Effects on Presence of Cryptosporidium Oocysts and Giardia Cysts in Effluent Water from Wastewater Treatment Utilities in Florida from 1998 to 2010." Scholar Commons, 2012. http://scholarcommons.usf.edu/etd/3969.
Full textAbstract:
The concern of a Cryptosporidium or Giardia waterborne outbreak due to treated wastewater has had water treatment utilities using some of the highest water cleansing technologies available. Cryptosporidiosis and Giardiasis are severe diarrheal diseases which can lead to death, thus it is important that appropriate steps are taken to assure these parasites are not present in the effluent of treated wastewater. This study examined the results of 863 assays for Giardia and Cryptosporidium on the effluent of wastewater treatment facilities and found that county of collection, watershed of collection, and laboratory analyzing the sample have the most significant impact on the detection of Cryptosporidium oocysts and Giardia cysts in wastewater effluent and that there were minimal but significant differences in method of treatment and method of filtration. To date no other comprehensive analysis of this data has been done.
43
Stingelin, Giovani Marco. "Protocolos de utilização de toltrazuril para o controle da coccidiose em leitões naturalmente infectados." Botucatu, 2017. http://hdl.handle.net/11449/150346.
Full textAbstract:
Orientador: Elizabeth Moreira dos Santos SchmidtResumo: A coccidiose é uma das doenças mais importantes que acometem leitões lactentes no Brasil. A administração de toltrazuril é usada no mundo todo para a prevenção de coccidiose em leitões, entretanto, não foram encontradas pesquisas sobre a correta profilaxia da doença no Brasil. Sendo assim, este estudo tem como objetivo investigar diferentes protocolos de administração de toltrazuril (FARMACOX® 5%, suspensão oral, Farmabase Saúde Animal, SP, Brasil) sob as condições de campo no estado de São Paulo. Para isso, 495 leitões foram aleatoriamente divididos em quatro diferentes grupos: 125 leitões (grupo controle) que não receberam toltrazuril; 127 leitões que receberam toltrazuril no terceiro dia de vida (grupo dois); 116 leitões que receberam toltrazuril no quinto dia de vida (grupo três), e 127 leitões que receberam duas doses de toltrazuril, uma com três e outra com sete dias de idade (grupo quatro). A excreção de oocistos foi avaliada por análises coproparasitológicas quando os animais tinham cinco, sete, 12, 21 e 63 dias de idade e as pesagens individuais foram realizadas aos três, 21 e 132 dias de idade. Os dados foram analisados usando o peso ao terceiro dia como uma covariável independente. Os resultados foram separados por médias e ajustados por Tukey (p ≤ 0,05). Os animais dos grupos dois e quatro não excretaram Cystoisospora suis, mas um animal do grupo controle e um do grupo três (aos 63 dias de idade) excretaram oocistos de C. suis. Os leitões do grupo controle apresen... (Resumo completo, clicar acesso eletrônico abaixo)
Mestre
44
Silva, Lidiane Maria da. "Esp?cies de cocc?dios em Thamnophilidae (Aves: Passeriformes) no Parque Nacional do Itatiaia, RJ: Morfologia e Taxonomia." Universidade Federal Rural do Rio de Janeiro, 2016. https://tede.ufrrj.br/jspui/handle/jspui/1696.
Full textAbstract:
Submitted by Celso Magalhaes (celsomagalhaes@ufrrj.br) on 2017-05-29T13:53:42Z
No. of bitstreams: 1
2016 - Lidiane Maria da Silva.pdf: 11158526 bytes, checksum: 92a272f4f09e476cee2262d286c61963 (MD5)Made available in DSpace on 2017-05-29T13:53:43Z (GMT). No. of bitstreams: 1 2016 - Lidiane Maria da Silva.pdf: 11158526 bytes, checksum: 92a272f4f09e476cee2262d286c61963 (MD5) Previous issue date: 2016-02-18
Coordena??o de Aperfei?oamento de Pessoal de N?vel Superior - CAPES
The thaminophilid passerines, just as other families of Passeriformes, can be parasitized by different species of coccidia, especially the genera Isospora Schneider, 1881 and Eimeria Schneider, 1875. In this context, this study aimed to identify, characterize and quantify coccidian species from Thamnophilidae in the Itatiaia National Park. Seven expeditions were performed at Itatiaia National Park, of which five were in conserved areas and two in areas around the park. A total of 184 species of birds were captured with mist nets, being 26 thaminophilid passerines. After fecal sampling and processing were observed coccidia of the genera Isospora and Eimeria. The species Isospora parnaitatiaiensis Silva, Rodrigues, Lopes, Berto, Luz, Ferreira, Lopes, 2015 was identified in two different hosts, Pyriglena leucoptera (Vieillot, 1818) and Dysithamnus mentalis (Temminck, 1823), and their oocysts were characterized as polymorphic, since the oocysts from P. leucoptera were more ellipsoidal and the oocysts from D. mentalis were more sub-spherical, which may be the result of speciation process/adaptation to these hosts. The intensities of infection in different hosts were relatively low, since that P. leucoptera and D. mentalis shed together an OoPD of 316 oocysts of I. parnaitatiaiensis, which can be explained by the conserved environment in the Itatiaia National Park and the insectivore feeding habit. Finally, the specificity occurred at the family level, because P. leucoptera and D. mentalis, both of Thamnophilidae family, have been reported as hosts of I. parnaitatiaiensis
Os taminofil?deos, da mesma forma que outras fam?lias de Passeriformes, podem ser parasitados por diversas esp?cies de cocc?dios, principalmente dos g?neros Isospora Schneider, 1881 e Eimeria Schneider, 1875. Neste contexto, este trabalho teve por objetivo identificar, caracterizar e quantificar esp?cies de cocc?dios parasitos de Thamnophilidae do PNI. Foram realizadas sete expedi??es no Parque Nacional do Itatiaia, das quais cinco foram em ?reas mais preservadas e duas em ?reas no entorno do parque, as aves foram capturadas com o auxilio de redes de neblina, ao todos foram capturados 184 esp?cimes de aves sendo 26 taminofil?deos, ap?s o processamento das amostras observou ser cocc?dios do g?nero Isospora e Eimeria. A esp?cie Isospora parnaitatiaiensis Silva, Rodrigues, Lopes, Berto, Luz, Ferreira, Lopes, 2015 foi identificada em dois diferentes hospedeiros da fam?lia Thamnophilidae, Pyriglena leucoptera (Vieillot, 1818) e Dysithamnus mentalis (Temminck, 1823), sendo que seus oocistos foram caracterizados como polim?rficos, j? que os oocistos de P. leucoptera s?o mais elips?ides em rela??o aos oocistos de D. mentalis que tendem ao ser mais sub-esf?ricos, o que pode ser consequ?ncia do processo de especia??o/adapta??o ao hospedeiro. A intensidade de infec??o nos diferentes hospedeiros taminofil?deos positivos foram relativamente baixas, P. leucoptera e D. mentalis tiveram juntos um OoPD de 316 para os oocistos de I. parnaitatiaiensis, o que pode ser justificado pelo ambiente conservado do PNI e pelo h?bito alimentar inset?voro. Finalmente, a especificidade ocorreu em n?vel de fam?lia, pelo fato de P. leucoptera e D. mentalis, ambos da fam?lia Thamnophilidae, ter sido relatados como hospedeiros de I. parnaitatiaiensis
45
Arrowood, Michael James. "Cryptosporidium: Oocyst production and hybridoma generation for examining colostrum and monoclonal antibody roles in cryptosporidial infections." Diss., The University of Arizona, 1988. http://hdl.handle.net/10150/184335.
Full textAbstract:
Techniques for the large-scale isolation of Cryptosporidium oocysts and sporozoites, obtained from the feces of experimentally infected Holstein calves, were developed employing discontinuous sucrose gradients and isopycnic Percoll gradients. The three step oocyst recovery method utilized two sequential discontinuous sucrose gradients followed by one Percoll gradient. Recovered oocysts were essentially free of debris and bacteria and represented 34% of the original oocyst suspension. Sporozoites were recovered from excystation mixtures on a single Percoll gradient. Sixty-three percent of the original sporozoites were recovered with 2.2% contamination by intact oocysts and virtually no oocyst walls. Eight anti-oocyst hybridomas were derived from oocyst-immunized mice: five from BALB/c mice and three from RBF/Dn mice. The monoclonal antibody (Mab) OW3 reacted specifically with C. parvum oocysts in immunofluorescent assays (IFA) and was shown to be superior to conventional stains for detecting oocysts in fecal smears from infected individuals. Sixteen anti-sporozoite hybridomas were derived from sporozoite-immunized BALB/c mice. The Mabs appeared to react with cell surface and cytoplasmic antigens by IFA. Two anti-sporozoite Mabs (C8C5, C6B6) reacted with a 20 kDa sporozoite antigen in western blots while the Mab C4A1 reacted with multiple antigens in western blots. These three Mabs (C8C5, C6B6, C4A1) were examined for potential modulation of cryptosporidial infections in vivo by oral Mab administration to oocyst-inoculated neonatal mice. The role for colostrum and breast milk in controlling cryptosporidial infections was examined by immunizing mouse dams and experimentally infecting their neonatal offspring. Colostrum and Mab-treated neonatal mice were sacrificed four days post infection. No difference in infection rates was observed among the treatment groups. Suckling mice treated daily with orally administered mixtures of Mabs (purified or ascitic fluid) showed significantly reduced parasite loads compared to control mice at four days post infection. In vitro cultivation of C. parvum was successful through asexual stages in human fetal lung, bovine turbinate and murine L929 cells. Parasite numbers that developed in the cell cultures varied from infection run to infection run.
46
Srinivasan, Prakash. "The Role of Rhomboid proteases and a Oocyst Capsule protein in Malaria Pathogenesis and Parasite Development." Case Western Reserve University School of Graduate Studies / OhioLINK, 2007. http://rave.ohiolink.edu/etdc/view?acc_num=case1181352186.
Full text
47
Cavalcante, Guacyara Tenorio. "Infecção experimental por Neospora caninum em cães (Canis familiaris) jovens, adultos e em cadelas gestantes." Universidade de São Paulo, 2010. http://www.teses.usp.br/teses/disponiveis/42/42135/tde-10082010-144403/.
Full textAbstract:
Os objetivos desse estudo foram avaliar a transmissão transplacentária por N. caninum em diferentes fases da gestação (Exp I) e avaliar diferentes tecidos de bovinos como meio de transmissão de N. caninum em cães jovens e adultos (Exp II). No Exp I, Três cadelas foram inoculadas com 108 taquizoítos de N. caninum na 3ª semana de gestação, três na 6ª semana e uma permaneceu como controle. Todas as cadelas infectadas, e pelo menos um de seus filhotes, apresentaram soroconversão a anticorpos anti-N. caninum pela Reação de Imunofluorescência Indireta. Verificou-se presença do parasita pela coloração de Hematoxilina-Eosina em Sistema Nervoso Central e pela PCR ITS-1 e RFLP em linfonodo, cérebro, coração e fígado. No Exp II, cães jovens e adultos receberam diferentes tecidos de bovinos naturalmente infectados com N. caninum, sendo coração, cérebro, masseter e fígado. Não houve soroconverteu. Apenas os cães jovens eliminaram oocistos de N. caninum ao ingerirem masseter (2 cães, 40%), coração (2 cães, 40%), fígado (1 cão, 33%) e cérebro (3 cães, 75%).The objectives of this study were to evaluate transplacental transmission of N. caninum in different stages of pregnancy (Exp I) and evaluate different bovine tis.sues as means of transmission of N. caninum in young dogs and adults (Exp II). In Exp I, Three dogs were inoculated with 108 tachyzoites of N. caninum in the third week of gestation, three at 6 sixth week and one remained as a control. All infected dogs, and at least one of their offspring, seroconverted to anti-N. caninum antibodies by Immunofluorescence Assay. There was presence of the parasite by Hematoxylin- Eosine exam in Central Nervous System and by PCR and RFLP ITS-1 in lymph node, brain, heart and liver. In Exp II, young and adult dogs received different tissues of cattle naturally infected with N. caninum: heart, brain, liver and masseter. None seroconverted. Only the young dogs shed oocysts of N. caninum by eating masseter (2 dogs, 40%), heart (2 dogs, 40%), liver (one dog, 33%) and brain (3 dogs, 75%).
48
Nichols, Rosely Angela Bergamin. "Development of methods for the concentration, recovery and molecular identification of small numbers of Cryptosporidium spp. oocysts in natural mineral waters and its application for drinking waters." Thesis, University of Strathclyde, 2002. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.248962.
Full text
49
Iuspa, Maria Aparecida Melo 1974. "Avaliação comparativa do desempenho e resistência de duas linhagens de frangos de corte inoculadas experimentalmente com Eimeria acervulina." [s.n.], 2014. http://repositorio.unicamp.br/jspui/handle/REPOSIP/316079.
Full textAbstract:
Orientadores: Urara Kawazoe, Elizabeth SantinDissertação (mestrado) - Universidade Estadual de Campinas, Instituto de Biologia
Made available in DSpace on 2018-08-26T10:12:03Z (GMT). No. of bitstreams: 1 Iuspa_MariaAparecidaMelo_M.pdf: 891258 bytes, checksum: 6e794e24b82f1c94278fc775155f9813 (MD5) Previous issue date: 2014
Resumo: Foi realizado experimento em frangos de corte machos de duas linhagens, com duração de 42 dias. Foram utilizados 800 frangos de corte machos de um dia de idade alojados em um galpão. O delineamento experimental foi realizado em blocos, num fatorial 2 x 2 (duas linhagens infectadas e não infectadas). Cada tratamento foi replicado oito vezes. Os tratamentos experimentais foram T1, aves da linhagem Cobb 500; T2, aves da linhagem Ross 308, ambos inoculados via oral, aos 14 dias de idade em dose única de 1 x 106 oocistos; T3, aves da linhagem Cobb 500; e T4, aves da linhagem Ross 308, não inoculados. Os critérios de avaliação mensurados foram peso médio das aves, consumo de ração, conversão alimentar ajustada, eficiência alimentar, ganho de peso, escore de lesão, contagem de oocistos e análise de células caliciformes. O escore de lesão das duas linhagens infectadas foi avaliado aos seis dias após a inoculação. O número de oocistos médio por grama de excretas foi obtido entre o quarto e 10º dias após a inoculação. Os resultados de desempenho não mostraram diferenças estatísticas significativas entre as duas linhagens infectadas e as linhagens não infectadas para todos os períodos avaliados, com exceção do peso médio, aos 21 dias de idade. A linhagem Cobb apresentou um peso médio superior ao da linhagem Ross (p<0,001) aos 21 dias de idade. O escore de lesão médio da linhagem Ross foi maior que o da linhagem Cobb (p=0,006). O mesmo foi verificado para o número de oocistos médio por grama de excretas, para o qual a linhagem Ross apresentou maior contagem do que a linhagem Cobb (p<0,0001). Não houve diferença significativa na contagem de células caliciformes de duodeno e jejuno entre os tratamentos. A diferença de desempenho e resistência entre as linhagens infectadas observadas através do peso médio aos 21 dias de idade (sete dias após a inoculação), escore de lesão e quantidade de oocistos por grama de excretas desapareceu conforme o crescimento dos animais até o final do experimento. As reduções relativas de peso médio foram menores na linhagem Cobb, quando comparado à linhagem Ross, e decresceram conforme os animais chegavam à idade final do experimento nas duas linhagens (42 dias). Os aumentos relativos de conversão alimentar foram maiores para a linhagem Cobb quando comparada a linhagem Ross e também decresceram conforme os animais chegavam à idade final do experimento nas duas linhagens (42 dias). A utilização de linhagens de curva de crescimento rápido e curva de crescimento lenta de acordo com o objetivo produtivo (abate precoce ¿ frangos "griller" e abate tardio ¿ frangos pesados) deve ser considerada uma vez que as respostas de desempenho e resistência ao desafio de E. acervulina destas linhagens são distintos, podendo extrair máximo benefício da resistência genética conforme a idade de abate e desafio
Abstract: Evaluation of susceptibility and resistance between two strains of male chicken inoculated with Eimeria acervulina was carried out during 42 days. A total of 800 male broiler chickens with one day of age was used and placed in a floor-pen unit within a typical broiler house. The experimental design was in a randomized block designed in a 2 x 2 factorial (two strains infected and not infected) with eight replications. The treatments were T1, Cobb 500 broiler chicken strain; T2, Ross 308 broiler chicken strain, both were orally inoculated at 14 days of age, with a single dosage of 1 x 106 oocysts; T3, Cobb 500 broiler chicken strain; and T4, Ross 308 broiler chicken, not inoculated. The following criteria were used: average weight, feed consumption, adjustment of feed conversion, feed efficiency, weight gain, lesion score, oocysts counting, caliciform cells analysis. The results of performance did not show statistical differences between infected strains and between non infected strains during all periods, with exception to the average weight of 21 days of age. The Cobb strain showed a higher average weight compared with Ross strain (p<0.001) at 21 days of age. Lesion score evaluated at 6 days after inoculation was higher for Ross strain compared with the Cobb strain (p=0.006). The same result was observed for oocysts counting. The Ross strain presented a higher number of oocysts than the Cobb strain (p<0.0001). There was no statistical difference between strains in caliciform cells of duodenum and jejunum in all treatments. The results showed performance and susceptibility differences between infected strains on the average weight at 21 days of age (seven days after inoculation), lesion score and number of oocysts per gram of excreta; this difference disappeared according the birds were growing up, until the end of trial. The relative average of the weight reduction of the Cobb strain was lower than the Ross, and the relative average weight reduction in both strains decreased according birds were growing up, until the end of trial (42 days of age).The relative feed conversion of the Cobb strain was higher than the Ross strain and the relative feed conversion in both strains decreased according birds were growing up until the end of trial (42 days of age). The use of strains of fast growth and slow growth curve according to the production goal (early-slaughter chickens "griller" and heavy chicken) should be considered once the responses of performance and resistance to E. acervulina challenge of these strains are distinct and it is possible to have the maximum benefit from genetic resistance according to slaughter age and challenge
Mestrado
Relações Antrópicas, Meio Ambiente e Parasitologia
Mestra em Biologia Animal
50
Camillo, Giovana. "Toxoplasma gondii Em galinhas domésticas: epidemiologia, isolamento e caracterização molecular." Universidade Federal de Santa Maria, 2015. http://repositorio.ufsm.br/handle/1/4114.
Full textAbstract:
Conselho Nacional de Desenvolvimento Científico e TecnológicoNeospora caninum and Toxoplasma gondii are two obligate intracellular protozoa and can infect a wide variety of hosts, including birds. Domestic chickens can be considered as sentinels of infection, since they have potential exposure to oocysts in the soil, serving as indicators of environmental contamination, also acting as an efficient source of T. gondii infection. In addition, chickens infected with T. gondii oocysts may contain virulent strains of this parasite in different tissues, without any clinical signs. Therefore, the objectives of this study were (1) to determine the presence of anti-T. gondii and anti-N. caninum in domestic chickens raised extensively in rural areas, (2) evaluate the association of risk factors for infection by T. gondii present in properties in one of the study regions (3) isolating of the parasite T. gondii from tissues of chickens antibody positive (4) genotypically characterize the T. gondii from rural area of the municipality of Santa Maria, Rio Grande do Sul State, Brazil. Firstly, in May 2011 were collected 137 blood samples in some farms in the state and were tested by indirect immunofluorescence (IFA) for antibodies anti-T. gondii and anti-N. caninum and were detected in 74.4% (102/137) and 36.5% (50/137) of chickens, respectively. Later in the period from March 2013 to February 2014 were collected 597 blood samples from 74 properties in the rural area of Santa Maria, RS. The samples were tested by IFA, where 49.2% (294/597) were positive for antibodies anti-T. gondii infection, with titers ranging from 16 to 4096. From bioassay of 12 positive tissues chickens were obtained nine isolates of the parasite. Genotypic characterization of isolates was performed by PCR-RFLP, using 12 genetic markers, SAG1, 5'-3'SAG2, alt. SAG2, SAG3, BTUB, GRA6, c22-8, c29-2, L358, PK1, apical. The result of analysis of the genotype of individual of this study revealed the presence of five genotypes according to ToxoDB (# 11, # 55, # 64, # 140 and # 163) plus two new ones, not previously described in literature. The high prevalence of antibodies found in this study suggests a major environmental contamination, and thus a potential risk to human and animal health .From the results in genotypic characterization, it can be observed that there is a wide genetic diversity of T. gondii in the study region, which confirms previous studies in Brazil.
Toxoplasma gondii e Neospora caninum são dois protozoários intracelulares obrigatórios e podem infectar uma grande variedade de hospedeiros, incluindo aves. Galinhas domésticas podem ser consideradas sentinelas da infecção, já que as mesmas têm potencial à exposição aos oocistos presente no solo, servindo como indicadores de contaminação ambiental, atuando também como eficiente fonte de infecção do T. gondii. Além disso, galinhas infectadas com oocistos de T. gondii podem albergar cepas virulentas deste parasito em diferentes tecidos, sem apresentar sinais clínicos. Diante disso, os objetivos deste estudo foram (1) determinar a presença de anticorpos anti-T. gondii e anti-Neospora caninum em galinhas domésticas criadas extensivamente em zona rural, (2) avaliar a associação dos fatores de risco para infecção por T. gondii presentes nas propriedades em uma das regiões de estudo (3) isolar o protozoário T. gondii a partir de tecidos de galinhas anticorpo positivas e (4) caracterizar genotipicamente os isolados de T. gondii de galinhas em área rural do município de Santa Maria, Rio Grande do Sul, Brasil. Primeiramente, em Maio de 2011 foram coletadas 137 amostras de sangue de galinhas em algumas propriedades rurais do estado e foram testadas por Imunofluorescência indireta (RIFI) para anticorpos anti-T. gondii e anti-N. caninum, sendo detectados 74.4% (102/137) e 36.5% (50/137) das galinhas, respetivamente. Posteriormente, no período de março de 2013 a fevereiro 2014 foram coletadas 597 amostras de sangue de galinhas em 74 propriedades da zona rural de Santa Maria, RS.. As amostras foram testadas por RIFI, onde 49,2% (294/597) foram positivas para anticorpos anti-T. gondii, com títulos variando de 16 a 4096. A partir do bioensaio de tecidos de 12 galinhas positivas, obteve-se nove isolados do protozoário. A caracterização genotípica dos isolados foi realizada através da técnica de PCR-RFLP, utilizando os 11 marcadores genéticos, SAG1, 5 -3 SAG2, alt. SAG2, SAG3, BTUB, GRA6, c22-8, c29-2, L358, PK1, Apico. O resultado da análise genotípica dos isolados de galinhas do presente estudo revelou a presença de cinco genótipos de acordo com o ToxoDB (#11, #55, #64, #140 e #163), além de dois outros novos, não descritos anteriormente na literatura. A elevada prevalência de anticorpos encontrada neste estudo, sugere uma grande contaminação ambiental, sendo assim um risco potencial para a saúde humana e animal. A partir dos resultados obtidos na caracterização genotípica, pode-se observar que há uma ampla diversidade genética do T. gondii na região de estudo, o que confirma os estudos já realizados no Brasil.