Journal articles: 'P.A.N. (Madrid, Spain)'

1

González, Estela, Ricardo Molina, Andrés Iriso, Sonia Ruiz, Irene Aldea, Ana Tello, Daniel Fernández, and Maribel Jiménez. "Opportunistic feeding behaviour and Leishmania infantum detection in Phlebotomus perniciosus females collected in the human leishmaniasis focus of Madrid, Spain (2012–2018)." PLOS Neglected Tropical Diseases 15, no. 3 (March 15, 2021): e0009240. http://dx.doi.org/10.1371/journal.pntd.0009240.

Full text

Abstract:

Background An outbreak of human leishmaniasis due to Leishmania infantum has been registered in an urban area of southwestern Madrid, Spain, since 2010. Entomological surveys carried out in the municipalities of Fuenlabrada, Leganés, Getafe and Humanes de Madrid showed that Phlebotomus perniciosus is the only potential vector. In this work, an intensive molecular surveillance was performed in P. perniciosus females captured in the region between 2012 and 2018. Methodology/Principal findings A total of 1805 P. perniciosus females were analyzed for Leishmania infection, and 1189 of them also for bloodmeal identification. Eleven different species of vertebrate were detected by amplification and subsequent sequencing of the 359 bp cytb fragment. The most prevalent blood source identified was hare (n = 553, 46.51%), followed by rabbit (n = 262, 21.95%). Less frequent were cat (n = 45, 3.80%), human (n = 34, 2.90%), pig (n = 14, 1.20%), horse (n = 11, 0.93%), sheep (n = 3, 0.25%), rhea (n = 3, 0.25%), partridge (n = 1, 0.09%) and chicken (n = 1, 0.09%). The distribution of the blood meal sources varied between the different locations. Regarding L. infantum detection, PCR amplification of a fragment of kDNA, cpb gene and ITS1 region showed 162 positive specimens (8.97%). The highest infection rate was found in the municipality of Leganés (15.17%). Conclusions The results of this molecular survey in P. perniciosus, the only leishmaniasis vector in the outbreak occurred in southwestern Madrid region, showed its opportunistic blood-feeding behaviour, high infection rates and the differences between the different points. This study was an essential part of the intensive surveillance plan in the area and the results obtained have supported the implementation of control measures in the outbreak.

APA, Harvard, Vancouver, ISO, and other styles

2

Fortuna, L., N. Noyola, B. Cook, and A. Amaris. "Sleep disturbances and substance use disorders: An international study of primary care and mental health specialty care patients." European Psychiatry 33, S1 (March 2016): S109—S110. http://dx.doi.org/10.1016/j.eurpsy.2016.01.101.

Full text

Abstract:

IntroductionThere is no comprehensive evidence on the influence of sleep disturbances (SD) on substance use disorders (SUD) or treatment use patterns of individuals with comorbid disturbances.Objective/aimTo better understand comorbidities and treatment use patterns of individuals with SD and SUD.MethodsWe combine 2010–2012 electronic health record (EHR) data from healthcare system in Boston (n = 131,966 person-years) and Madrid, Spain (n = 43,309 person-years). Patients with sleep disturbances (SD) were identified in the EHR through ICD-9 codes and medical records and substance use disorders (SUD) identified by documented treatment for drug or alcohol abuse or dependence. Rates of SUD are compared between individuals with and without SD. Among those with both, adequacy of mental health treatment (defined as eight or more outpatient visits or four or more outpatient visits with a psychotropic prescription) and ER use is compared.ResultsAmong the individuals, 21.1% with SD also report SUD, compared to only 10.6% of individuals without SD (P < .01). Those with comorbidities were more likely than their specialty care counterparts without comorbidities to be seen in the ER (57.1% vs. 36.6%, respectively, P < .05). Limiting the sample to only those with both SD and SUD in specialty mental health care (n = 268 in Boston and n = 28 in Madrid), 49.2% of Boston patients received adequate care compared to 38.5% of Madrid patients, and 57.8% of Boston patients had any ER use in the last year vs. 50% of Madrid patients.ConclusionsSD is correlated with SUD and comorbid patients are more likely to use emergency services.Disclosure of interestThe authors have not supplied their declaration of competing interest.

APA, Harvard, Vancouver, ISO, and other styles

3

Prieto-Recio, C., C. Romeralo, D. Bezos, J. Martín-García, P. Martínez-Álvarez, L. Botella, and J. J. Diez. "First Report of Heterobasidion annosum on Pinus pinaster in Spain." Plant Disease 96, no. 5 (May 2012): 770. http://dx.doi.org/10.1094/pdis-10-11-0890-pdn.

Full text

Abstract:

The basidiomycete Heterobasidion annosum (Fr.) Bref. (=Fomes annosus (Fr.) Cooke), one of the most important pathogens in coniferous forests in Europe, Asia, and North America, causes root and butt rot. H. annosum was first recorded on Pinus pinaster Ait. (commonly known as Maritime pine) in France and Great Britain in 1961 (4) and Portugal in 1986 (2). P. pinaster is the most widespread conifer in Spain, with more than 700,000 and 600,000 ha in pure and mixed stands, respectively. Over the last few years, P. pinaster decline was observed in several stands in the center of the Iberian Peninsula. Unusual crown transparency, small needles, foliage discoloration, and early tree death are characteristic decline symptoms associated with the high mortality rate on this species. In June of 2010, 11 trees (40 to 60 years old) with a different degree of decline were felled in two zones (42°2′41″N, 3°18′14″W, elevation 1,096 m and 41°55′40″N, 3°12′3″W, elevation 1,128 m) and cut into sections (stump height, breast height, and near the top). Wood slices were removed from each section and taken to the laboratory. Samples were placed in moist chambers with optimal conditions of humidity and temperature to enhance pathogen growth. After 20 days of incubation in darkness at 25°C, H. annosum (anamorph Spiniger meineckellum [A. Olson] Stalpers) occurred on most of these slices. Conidiophores with subglobose to pyriform conidia (5.8 × 4.2 μm) were observed with a compound microscope. The fungus was isolated to extract DNA by disruption of the mycelium followed by washes with phenol/chloroform/isoamyl alcohol solution (25:24:1). DNA was precipitated with 20% polyethylene glycol solution. PCR was carried out according to the instructions of the manufacturer of Dynazyme II DNA polymerase (Finnzymes Ltd, Espoo, Finland) with ITS primers, 1F (5′-CTTGGTCATTTAGAGGAAGTAA-3′) and 4 (5′-TCCTCCGCTTATTGATATGC-3′). After DNA purification, samples were sequenced (SECUGEN, Madrid, Spain) and aligned and corrected with Geneious Pro 5.3 to obtain the consensus sequences. Resulting DNA sequences of two isolates were deposited in GenBank (Nos. FR850494 and FR850495), and compared with a Blastn search at GenBank showing 100% identity and 100% coverage with H. annosum sensu stricto, former ISG-P (intersterility group of pines). For pathogenicity tests, 10 seedlings (2 year old) were inoculated with autoclaved P. pinaster wood chips colonized by H. annosum, and 10 control seedlings were inoculated with noncolonized wood chips. Inoculums were prepared by growing H. annosum on 4-mm-diameter wood chips placed on potato dextrose agar media for 3 weeks. The wood chips were put inside an oblique incision made at 6 cm above the soil line and wrapped with Parafilm. After 8 weeks in a growth chamber at 22.5°C with a 14-h photoperiod, the inoculated seedlings showed typical symptoms and 3 seedlings of 10 were dead. H. annosum was previously recorded on P. sylvestris in central Spain (1), causing needle drop, swelling at the stump height, and presence of dead trees by circular areas. This pathogen was also reported on P. nigra in northeastern Spain, associated with defoliation and mortality (3). To our knowledge, this is the first record of H. annosum on P. pinaster in Spain. References: (1) J. Benito-Martínez. An. Jardín Bot. Madrid 3:23, 1943. (2) N. Neves et al. EPPO Bull. 16:505, 1986. (3) J. Oliva et al. Bol. Sanidad Vegetal. Plagas. 34:415, 2008. (4) P. Spaulding. US Dep. Agric. Agric. Handb. 197:100, 1961.

APA, Harvard, Vancouver, ISO, and other styles

4

Salazar García, Aída, Elicet Cruz Jiménez, Joaquim Lloveras Macia, and Guillermo Manuel Urriolagoitia Calderón. "Proceder de la innovación en la industria farmacéutica. El caso de España Proceed to the innovation in the pharmaceutical industry. The case of Spain." Revista Colombiana de Biotecnología 17, no. 1 (May 22, 2015): 131–42. http://dx.doi.org/10.15446/rev.colomb.biote.v17n1.50691.

Full text

Abstract:

Título en ingles: Proceed to the innovation in the pharmaceutical industry. The case of Spain.Resumen: El presente artículo explora sectores que identifican la innovación en empresas farmacéuticas de España. Para ello se consideran firmas nacionales y filiales extranjeras establecidas en territorio nacional. El análisis realizado comprende el periodo de 2009 al 2011 para una población N=200 empresas afiliadas en ese momento a Farmaindustria y al Plan Profarma. El trabajo consistió en una búsqueda de información útil en las páginas web de las empresas farmacéuticas establecidas en España que pudieran describir de forma estática el perfil innovador del sector farmacéutico español a través del análisis estadístico descriptivo. De esta forma, se crea un cimiento para la documentación de los resultados en una base de datos con el propósito de obtener un panorama con determinación sobre el comportamiento del sector farmacéutico español, así como posibles tendencias.El alto contenido de aportación literaria sobre el sector farmacéutico, se expresa de forma globalizada a nivel nacional e internacional, desestimando datos e información que pudieran ofrecer señales de amenaza u oportunidad respecto al corto periodo de tiempo, ya que a su vez son equiparables a otros años puesto que la industria farmacéutica española se constituye por empresas de origen extranjero (50.5%) y de capital nacional (49.5%). De éstas últimas las pymes son las protagonistas de las pequeñas innovaciones de las firmas establecidas en Madrid y Barcelona principalmente.Abstract: This article explores sectors identified innovation in Spanish pharmaceutical companies. It also considers domestic firms and foreign subsidiaries in the country. The analysis covers the period 2009 to 2011 for a population N=200 affiliates at that time Farmaindustria and Plan Profarma. The work involved a search of useful information on the websites of pharmaceutical companies based in Spain statically describes the innovative profile of the Spanish pharmaceutical through descriptive statistical analysis. Thus a foundation for documenting the results in a database in order to get a picture with determination on the behavior of Spanish pharmaceutical sector and possible trends is created.The high content of literary contribution on the pharmaceutical sector is expressed in a globalized national and international level, rejecting data and information that could provide signals threat or opportunity regarding short period time, and which in turn are comparable to other years since the Spanish pharmaceutical industry is constituted by companies of foreign origin (50.5%) and domestic capital (49.5%). Of the latter SMEs are the protagonists of small innovations established in Madrid and Barcelona mainly.<div> </div>

APA, Harvard, Vancouver, ISO, and other styles

5

Marrodán, MD, JR Martínez Álvarez, M. González-Montero de Espinosa, MM Carmenate, N. López-Ejeda, MD Cabañas, JL Pacheco, et al. "Predicting percentage body fat through waist-to-height ratio (WtHR) in Spanish schoolchildren." Public Health Nutrition 17, no. 4 (March 28, 2013): 870–76. http://dx.doi.org/10.1017/s1368980013000888.

Full text

Abstract:

AbstractObjectiveTo analyse the association between waist-to-height ratio (WtHR) and body fat and to develop predictive adiposity equations that will simplify the diagnosis of obesity in the paediatric age group.DesignCross-sectional study conducted in Spain during 2007 and 2008. Anthropometric dimensions were taken according to the International Biology Program. The children were classified as underweight, normal weight, overweight or obese according to national standards of percentage body fat (%BF). WtHR differences among nutritional status categories were evaluated using ANOVA. Correlation analysis and regression analysis were carried out using WtHR as a predictor variable for %BF. A t test was applied to the results obtained by the regression model and by the Siri equation. The degree of agreement between both methods was evaluated by estimating the intra-class correlation coefficient.SettingElementary and secondary schools in Madrid (Spain).SubjectsGirls (n 1158) and boys (n 1161) from 6 to 14 years old.ResultsWtHR differed significantly (P < 0·001) depending on nutritional status category. This index was correlated (P < 0·001) with all adiposity indicators. The mean %BF values estimated by the regression model (boys: %BF = 106·50 × WtHR – 28·36; girls: %BF = 89·73 × WtHR – 15·40) did not differ from those obtained by the Siri equation. The intra-class correlation coefficient (0·85 in boys, 0·79 in girls) showed a high degree of concordance between both methods.ConclusionsWtHR proved to be an effective method for predicting relative adiposity in 6–14-year-olds. The developed equations can help to simplify the diagnosis of obesity in schoolchildren.

APA, Harvard, Vancouver, ISO, and other styles

6

Carrasco, Raphaël. "Carlos M. N. Eire, From Madrid to Purgatory. The Art & Craft of Dying in Sixteenth-Century Spain, Cambridge, Cambridge University Press, 1995, XIII- 571 p., index." Annales. Histoire, Sciences Sociales 52, no. 3 (June 1997): 518–19. http://dx.doi.org/10.1017/s0395264900051088.

Full text

APA, Harvard, Vancouver, ISO, and other styles

7

García-Hedrera, Fernando J., Fernanda Gil-Almagro, F. Javier Carmona-Monge, Cecilia Peñacoba-Puente, Patricia Catalá-Mesón, and Lilian Velasco-Furlong. "Intensive care unit professionals during the COVID-19 pandemic in Spain: social and work-related variables, COVID-19 symptoms, worries, and generalized anxiety levels." Acute and Critical Care 36, no. 3 (August 31, 2021): 232–41. http://dx.doi.org/10.4266/acc.2021.00213.

Full text

Abstract:

Background: The severe acute respiratory syndrome coronavirus 2 outbreak has been identified as a pandemic and global health emergency. It presents as a severe acute respiratory disease. The rapid dissemination of the disease created challenges for healthcare systems and forced healthcare workers (HCWs) to deal with many clinical and nonclinical stresses. The aim of our research is to describe work conditions, symptoms experienced by HCWs, worries about contagion, and generalized anxiety symptoms and compare those findings across regions in Spain. Methods: This cross-sectional study was conducted using an online survey. Critical care units throughout Spain were included. The sample comprised HCWs working in intensive care units from March to May 2020. We assessed work variables, physical symptoms, worries about contagion, and anxiety (generalized anxiety disorder-7 questionnaire). Results: The final sample comprised 448 surveys. Among the respondents, 86.9% (n=389) were nursing professionals, and 84.8% (n=380) were women. All participants cared for coronavirus disease 2019 (COVID-19) patients during the study period. Workload during the pandemic in Madrid was judged to be higher than in other regions (P<0.01). The availability of personal protective equipment was found to be higher in Cataluña. The most frequently experienced symptom was headaches (78.1%). Worries about self-infection and the possibility of infecting others received mean scores of 3.11 and 3.75, respectively. Mean scores for generalized anxiety levels were 11.02, with 58.7% of the professionals presenting with generalized anxiety syndrome during the assessment. Conclusions: In this study, we found high levels of anxiety among HCWs caring directly for COVID-19 patients, which could produce long-term psychological alterations that still need to be assessed.

APA, Harvard, Vancouver, ISO, and other styles

8

Marcos-Zambrano, Laura Judith, María Ángeles Bordallo-Cardona, Elisa Borghi, Monica Falleni, Delfina Tosi, Patricia Muñoz, Pilar Escribano, and Jesús Guinea. "Candida isolates causing candidemia show different degrees of virulence in Galleria mellonella." Medical Mycology 58, no. 1 (March 15, 2019): 83–92. http://dx.doi.org/10.1093/mmy/myz027.

Full text

Abstract:

Abstract We aim to assess intra- and interspecies differences in the virulence of Candida spp. strains causing candidemia using the invertebrate Galleria mellonella model. We studied 739 Candida spp. isolates (C. albicans [n = 373], C. parapsilosis [n = 203], C. glabrata [n = 92], C. tropicalis [n = 53], and C. krusei [n = 18]) collected from patients with candidemia admitted to Gregorio Marañon Hospital (Madrid, Spain). Species-specific infecting inocula (yeast cells/larva) were adjusted (5 × 105 [C. albicans, and C. tropicalis], 2 × 106–5 × 106 [C. parapsilosis, C. glabrata, and C. krusei]) and used to infect 10 larvae per isolate; percentage of survival and median survival per isolate were calculated. According to the interquartile range of the median survival, isolates with a median survival under P25 were classified as of high-virulence and isolates with a median survival over P75 as of low virulence. The median survival of larvae infected with different species was variable: C. albicans (n = 2 days, IQR <1−3 days), C. tropicalis (n = 2 days, IQR 1.5−4 days), C. parapsilosis (n = 2 days, IQR 2−3.5 days), C. glabrata (n = 3 days, IQR 2−3 days), and C. krusei (n = 7 days, 6.5−>8 days) (P < .001). Differences in virulence among species were validated by histological examination (day +1 post-infection) in the larvae infected by the isolates of each virulence category and species. Virulence-related gene expression in C. albicans isolates did not reach statistical significance. We report species-specific virulence patterns of Candida spp. and show that isolates within a given species have different degrees of virulence in the animal model.

APA, Harvard, Vancouver, ISO, and other styles

9

Herrera Duran, L., I. Falgas, B. Cook, N. Noyola, M. Toro, and M. Alegria. "Chronic non-malignant pain (CNMP) and substance use disorders." European Psychiatry 33, S1 (March 2016): S206. http://dx.doi.org/10.1016/j.eurpsy.2016.01.494.

Full text

Abstract:

IntroductionChronic non-malignant pain (CNMP) is defined as pain lasting a minimum of three months. In general, chronic pain affects 20% adult worldwide population. Moreover, pain is more common in patients with depression, anxiety, and substance-use disorders and with low socioeconomic status. We aimed to better understand the influence of pain on substance use and treatment use patterns of individuals who experienced clinically recognized pain and have substance use disorder.MethodsPatients with pain disturbances were identified in Electronic Health Records (EHR) through ICD-9 code 338*, medical written diagnoses, or diagnoses of fibromyalgia. A patient was considered to have a substance use disorder if he received treatment for illicit drug or alcohol abuse or dependence. We combined 2010–2012 (EHR) data from primary care and specialty mental health setting in a Boston healthcare system (n = 131,966 person-years) and a specialty mental health care setting in Madrid, Spain (n = 43,309 person-years).ResultsWe identified that 35.3% of individuals with clinically recognized pain also report substance use disorder, compared to only 10.6% of individuals without clinically recognized pain (P < 0.01). Those with co-morbid pain and substance use disorder were significantly more likely than their specialty care counterparts without co-morbid pain and substance disorders to be seen in the emergency room (56.5% vs. 36.6%, respectively, P < 0.01).ConclusionThe findings suggest that CNMP is associated with an increase risk of substance abuse disorder.Disclosure of interestThe authors have not supplied their declaration of competing interest.

APA, Harvard, Vancouver, ISO, and other styles

10

Garde, J. J., M. Gomendio, G. Espeso, and E. R. S. Roldan. "220 LIVE BIRTH OF A MOHOR GAZELLE (GAZELLA DAMA MHORR) CALF FOLLOWING INTRAUTERINE INSEMINATION OF MOTHER WITH FROZEN - THAWED SEMEN." Reproduction, Fertility and Development 18, no. 2 (2006): 218. http://dx.doi.org/10.1071/rdv18n2ab220.

Full text

Abstract:

Gazella dama mhorr is an endangered species, and no animals have been observed in the wild since 1968. Assisted reproductive techniques have been used to propagate endangered species. However, no live offspring has been produced after cryopreservation of semen from gazelle species. Therefore, the objective of this study was to evaluate whether cryopreserved Mohor gazelle spermatozoa can fertilize in vivo after artificial insemination. Semen was collected by electroejaculation from four males and centrifuged at 700g for 5 min at room temperature. The supernatant was discarded, and the semen pellet was resuspended with a TEST-1% egg yolk diluent containing 6% glycerol to provide 400 � 106 spermatozoa/mL. The extended semen was loaded into 0.25-mL plastic straws, cooled slowly to 5�C, and equilibrated at 5�C for 2 h. Straws were frozen in nitrogen vapors for 10 min and then plunged into liquid nitrogen. After thawing (37�C, 30 s), the effects of cryopreservation on sperm motility and acrosomal integrity were examined. Percentage of motile sperm in fresh samples was 88.7 � 3.8% (mean � SEM), decreased (P < 0.0001) to 58.7 � 3.8% after freezing and thawing, and then to 40.0 � 3.8% after 120 min incubation at 37�C. Spermatozoa with normal acrosomes decreased (P < 0.0001) after freezing and thawing (from 94.5 � 4.2% to 56.0 � 4.2%), but did not significantly decrease after sperm incubation. Frozen spermatozoa from two males were used in an intrauterine insemination trial. Estrus of females (n = 15) was synchronized with controlled internal drug release (CIDR, InterAg, Hamilton, New Zealand). Single CIDRs (type G, 330 mg progesterone/device) were inserted intravaginally for a total of 13 days. On Day 10, devices were replaced in each animal and all females received an injection of prostaglandin F2� (PGF2�; 125 mg/female). At CIDR withdrawal, females received 250-300 IU equine chorionic gonadotropin (eCG: Folligon; Intervet, Salamanca, Spain). After anesthesia with an intravenous injection of xylazine hydrochloride (Rompun; Bayer, Madrid, Spain; 0.8 mg/kg live weight) and ketamine hydrochloride (Imalgene; Leti & Merieux, Madrid, Spain; 2.0 mg/kg live weight), eight females were inseminated with 100 � 106 frozen-thawed spermatozoa 56-57 h after removal of the CIDRs, and seven were inseminated after 64-65 h. Females were inseminated directly into the uterus using laparoscopy. Anesthesia was reversed with yohimbine hydrochloride (0.3 mg/kg live weight). One female in the second group became pregnant. After a 202-day gestation, the female gave birth to one healthy Mohor gazelle male calf. These results demonstrate for the first time the successful use of frozen-thawed semen by means of artificial insemination for the rescue of endangered gazelle species. However, our results reveal that a number of unresolved technical problems remain to be addressed. This work was supported by the Spanish Ministry of Education and Science (REN2003-1587).

APA, Harvard, Vancouver, ISO, and other styles

11

Haque, M. M., P. Martínez-Álvarez, J. M. Lomba, J. Martín-García, and J. J. Diez. "First Report of Phytophthora plurivora Causing Collar Rot on Common Alder in Spain." Plant Disease 98, no. 3 (March 2014): 425. http://dx.doi.org/10.1094/pdis-07-13-0784-pdn.

Full text

Abstract:

Phytophthora decline of riparian alder (Alnus spp.) has been reported in several European countries (2). Death of common alder (Alnus glutinosa) due to Phytophthora alni has also been reported in Spain (4). During several surveys of alder trees in September 2012, typical dieback symptoms, including sparse small yellowish foliage and the presence of rusty exudates on the bark at the collar and lower stem were observed in A. glutinosa growing on the banks of the river Tera (Langa de Duero, Soria, 41°36′34″ N, 3°25′10″ W, elevation 851 m) and the river Tormes (La Maya, Salamanca, 40°41′42″ N, 5°35′36″ W, elevation 833 m). Bark samples plus cambium were taken from the active lesions at collar region, cut into small pieces, dried on filter paper, and plated on V8-PARPH agar (2). The samples were incubated for 4 days at 20°C in the dark before obtaining the Phytophthora isolates. Colonies developed on V8 juice agar (V8A) had limited aerial mycelium at the center and displayed radiate and slightly chrysanthemum-like growth pattern. Mycelial growth was optimal at 25°C (radial growth rate, 8.2 mm d–1), whereas no growth was observed at 32°C. Isolates were homothallic with paragynous antheridia, smooth-walled spherical (very rarely elongated) oogonia (22.8 to 30.6 μm diam.) and both plerotic and aplerotic golden brown oospores (21.3 to 28.5 μm diam.). In non-sterile soil extracts, the isolates produced abundant sporangia (31.5 to 57.2 × 21.3 to 38.4 μm; length:breadth ratio 1.2 to 1.6) borne terminally on unbranched or sympodial sporagiophores, occasionally attached laterally to the sporangiophores. Sporagia were non-caducous, semipapillate, mainly ovoid and obpyriform, obovoid to limoniform but sometimes distorted with two apices. On the basis of the morpho-physiological features, the isolates resembled P. plurivora (formerly identified as P. citricola) (3). To confirm this, genomic DNA was extracted and subjected to PCR. The internal transcribed spacer (ITS) region of the rDNA was amplified using the ITS-6 (5′ GAAGGTGAAGTCGTAACAAGG 3′) and ITS-4 (5′ TCCTCCGCTTATTGATATGC 3′) primers before sequencing (Secugen, Madrid, Spain). The sequences were deposited in the EMBL/GenBank database (Accession Nos. KF413074 and KF413075). In order to perform the pathogenicity test, 10 A. glutinosa seedlings (2 years old) per isolate were inoculated by using the under-bark inoculation technique (1) and 10 control seedlings were inoculated with V8A. Seedlings were incubated in a growth chamber at 22.5°C with a 14-h photoperiod. Three months after inoculation, all inoculated plants wilted and died, whereas the control plants showed no disease symptoms. To fulfill Koch's postulates, the pathogen was re-isolated from the necrotic lesions developed around inoculation points, thus confirming its pathogenicity. P. plurivora has been found to be present in rhizosphere soil beneath Alnus spp. and to cause aerial canker and collar rot on alder trees in Austria, Germany, and Romania (2,3). Further studies and surveys are essential to determine the distribution, extent of damage, and potential interactions with other alder pathogens (e.g., P. alni). To our knowledge, this is the first record of P. plurivora affecting A. glutinosa in Spain. References: (1) T. Jung et al. Eur. J. For. Pathol. 26:253, 1996. (2) T. Jung and M. Blaschke. Plant Pathol. 53:197, 2004. (3) T. Jung and T. I. Burgess. Persoonia 22:95, 2009. (4) A. Solla et al. Plant Pathol. 59:798, 2010.

APA, Harvard, Vancouver, ISO, and other styles

12

Touche, Roy La. "Influence of the Generation of Motor Mental Images on Physiotherapy Treatment in Patients with Chronic Low Back Pain." Pain Physician 4;23, no. 7;4 (July 14, 2020): E399—E408. http://dx.doi.org/10.36076/ppj.2020/23/e399.

Full text

Abstract:

generating kinesthetic and visual motor imagery. Objectives: The main aim of this study was to determine whether the ability to generate mental motor imagery (MIab) influences psychological, motor, and disability variables in patients with NCLBP. The secondary aim was to determine whether an approach based on therapeutic exercise (TE) and therapeutic education (TEd) could improve the MIab in those patients with less ability to perform it. Study Design: Cross-sectional and quasiexperimental study. Setting: Physical Therapy Unit of primary health care center in Madrid, Spain. Methods: A total of 68 patients were divided into 2 groups according to a greater (n = 34) or lesser (n = 34) MIab. Treatment was based on TEd and TE for the group with less ability to generate kinesthetic and visual motor imagery. The outcome measures were imagery requested time, self-efficacy, disability, pain intensity, lumbar strength, psychological variables, and MIab. Results: The group with lesser MIab showed lower levels of self-efficacy (P = 0.04; d, −0.47) and lower levels of lumbar strength and extension strength (P = 0.04; d, −0.46 and P = 0.02; d, −0.52, respectively). After the intervention with TE and TEd, MIab (both kinesthetic and visual) improved significantly, with a moderate to large effect size (P ≤ 0.01; d, −0.80 and P ≤ 0.01; d, −0.76, respectively), as did pain intensity, lumbar strength, disability, and psychological variables (P < 0.05), but not levels of self-efficacy (P > 0.05). Based on the results, the patients with NCLBP with lesser MIab achieved lower levels of self-efficacy and lower strength levels. Limitations: The results of this study should be interpreted with caution because of its quasiexperimental design and a bias selection. Conclusions: A clinical TE approach, coupled with a TEd program, resulted in significant improvement in MIab (both kinesthetic and visual), reduced pain intensity, increased lumbar strength, reduced disability, and improved psychological variables, but it did not significantly improve self-efficacy levels in the patients with NCLBP. Key words: Chronic low back pain, motor imagery, disability, lumbar strength

APA, Harvard, Vancouver, ISO, and other styles

13

Crespo, María, María Arinero, and Carmen Soberón. "Analysis of Effectiveness of Individual and Group Trauma-Focused Interventions for Female Victims of Intimate Partner Violence." International Journal of Environmental Research and Public Health 18, no. 4 (February 17, 2021): 1952. http://dx.doi.org/10.3390/ijerph18041952.

Full text

Abstract:

Group psychological programs for intimate partner violence (IPV) survivors would seem particularly useful since they contribute to interrupting women’s isolation and have cost-effectiveness advantage. This study aims to analyze whether the effectiveness of group interventions for female survivors of IPV is equivalent to that of the individual format. A cognitive-behavioral trauma-focused intervention program was applied in eight weekly sessions in Madrid (Spain) to IPV female survivors with significant posttraumatic symptoms that were randomly assigned to the individual (n = 25) or group (n = 28) intervention format. Measures of posttraumatic stress (Severity of Posttraumatic Stress Disorder Symptoms Scale), depression (Beck Depression Inventory), anxiety (Beck Anxiety Inventory), self-esteem (Rosenberg’s Scale) and social support were analyzed at pre-treatment, post-treatment, and 1-, 3-, 6- and 12-months follow-ups. A total of 28.3% of women dropped out, without significant format differences. Intervention (both formats) had significant improvements with large effect sizes in posttraumatic stress (η2p = 0.56), depression (η2p = 0.45), anxiety (η2p = 0.41) and self-esteem (η2p = 0.26) that maintained in follow-ups (p < 0.001), without significant differences between formats. Both intervention formats had different evolutions for depression and anxiety (p < 0.05), with better effects in the individual format at the first post-test measurements, but the differences tended to disappear over time. Intervention was effective in improving social support, with no significant differences between formats. All in all, both formats showed similar effectiveness. The group format could be an alternative when applying psychological interventions for female IPV survivors, since it would maintain good cost-effectiveness balance, mainly in the long-term.

APA, Harvard, Vancouver, ISO, and other styles

14

Pich Mitjana, Josep, and David Martínez Fiol. "Manuel Brabo Portillo. Policía, espía y pistolero (1876-1919)." Vínculos de Historia. Revista del Departamento de Historia de la Universidad de Castilla-La Mancha, no. 8 (June 20, 2019): 387. http://dx.doi.org/10.18239/vdh_2019.08.20.

Full text

Abstract:

RESUMEN:El objetivo del artículo es aproximarnos a la controvertida biografía del comisario Manuel Brabo Portillo. El trabajo está basado en fuentes primarias y secundarias. El método utilizado es empírico. En el imaginario del mundo sindicalista revolucionario, Brabo Portillo era el policía más odiado, la reencarnación de la cara más turbia del Estado. Fue, así mismo, un espía alemán relacionado con el hundimiento de barcos españoles, el asesinato del empresario e ingeniero Barret y el primer jefe de los terroristas vinculados a la patronal barcelonesa. La conflictividad que afectó a España en el período de la Primera Guerra Mundial es fundamental para entender los orígenes del terrorismo vinculado al pistolerismo, que marcó la historia político social española del primer tercio del siglo XX.PALABRAS CLAVE: Brabo Portillo, pistolerismo, espionaje, sindicalismo, Primera Guerra Mundial.ABSTRACT:The objective of the article is an approach to the controversial biography of Police Chief Manuel Brabo Portillo. The work is based on primary and secondary sources. The method used is empirical. In the imagery of the revolutionary syndicalist world, Brabo Portillo was the most hated policeman, the reincarnation of the murkiest face of the state. He was also a German spy connected with the sinking of Spanish ships, the murder of businessman and engineer Josep Barret and the first head of the terrorists linked to Barcelona employers. The conflict that affected Spain during the period of the First World War is fundamental in order to understand the origins of terrorism linked to pistolerismo, which marked Spanish social political history during the first third of the twentieth century.KEY WORDS: Brabo Portillo, pistolerismo, espionage, syndicalism, First World War. BIBLIOGRAFÍAAisa, M., La efervescencia social de los años 20. Barcelona 1917-1923, Barcelona, Descontrol, 2016.Aguirre de Cárcer, N., La neutralidad de España durante la Primera Guerra Mundial (1914-1918). I. Bélgica, Madrid, Ministerio de Asuntos Exteriores, 1995.Alonso, G., “’Afectos caprichosos’: Tradicionalismo y germanofilia en España durante la Gran Guerra”, Hispania Nova, 15, 2017, pp. 394-415.Amador, A., El Terror blanco en Barcelona. Las bombas y los atentados personales. Actuación infernal de una banda de asesinos al servicio de la burguesía. El asesinato como una industria, Tarragona, Talleres gráf. Gutenberg, [1920?].Anglés, C., “Contra los sindicatos. Los procesos de la organización obrera. La impostura nunca ha sido justicia”, Solidaridad Obrera, 836 (1/8/1918), p. 1.Balcells, A., El Pistolerisme. Barcelona (1917-1923), Barcelona, Pòrtic, 2009.Ben-Ami, S., La Dictadura de Primo de Rivera (1923-1930), Barcelona, Planeta, 1984.Bengoechea, S., Organització patronal i conflictivitat social a Catalunya. Tradició i corporativisme entre finals de segle i la dictadura de Primo de Rivera, Barcelona, PAM, 1994.Bengoechea, S., El locaut de Barcelona (1919-1920), Barcelona, Curial, 1998.Bengoechea, S., “1919: La Barcelona colpista. L’aliança de patrons i militars contra el sistema liberal”, Afers, 23/24 (1996), pp. 309-327.Brabo Portillo, M., Ensayo sobre policía científica, Barcelona, Gassó Hermanos, [190?].Bravo Portillo, M. y Samper, A., Programa para los exámenes de ingreso ó ascenso en plazas de oficiales de cuarta clase de la Hacienda Pública, Madrid, Mateu, 1906.Bueso, A., Recuerdos de un cenetista, Barcelona, Ariel, 1976.Burgos y Mazo, M. de, El verano de 1919 en Gobernación, Imprenta de E. Pinós-Cuenca, 1921.Calderón, F. de P. [Rico Ariza, E.] y Romero, I., Memorias de un terrorista. Novela episódica de la tragedia barcelonesa, Barcelona, [s.e.], [1924?].Carden, R. M., German Policy Toward Neutral Spain, 1914-1918, London, Routledge, 2014.Cardona, G., Los Milans del Bosch, una familia de armas tomar. Entre la revolución liberal y el franquismo, Barcelona, Edhasa, 2005.Casal Gómez, M., La Banda Negra. El origen y la actuación de los pistoleros en Barcelona (1918-1921), 2ª. Edición, Barcelona, Icaria, 1977.Calle Velasco, M. D. de la, “Sobre los orígenes del estado social en España”, Ayer, 25 (1997), pp. 127-150.D’Ors, E., “La unidad de Europa”, La Vanguardia, (1/12/1914), p. 7.Díaz Plaja, F., Francófilos y germanófilos. Los españoles en la guerra europea, Barcelona, Dopesa, 1973.Díez, P., Memorias de un anarcosindicalista de acción, Barcelona, Bellaterra, 2006.Domingo Méndez, R., “La Gran Guerra y la neutralidad española: entre la tradición historiográfica y las nuevas líneas de investigación”, Spagna Contemporanea, 34 (2008), pp. 27-44.Esculies, J., “España y la Gran Guerra. Nuevas aportaciones historiográficas”, Historia y Política, 32 (2014), pp. 47-70.Esdaile, Ch. J., La Quiebra del liberalismo, 1808-1939, Barcelona, Crítica, 2001.Foix, P., Los Archivos del terrorismo blanco. El fichero Lasarte (1910-1930), Madrid, Las Ediciones de la Piqueta, 1978.Forcadell, C., Parlamentarismo y bolchevización. El movimiento obrero español, 1914-1918, Barcelona, Crítica, 1978.Fuentes Codera, M., “El somni del retorn a l’Imperi: Eugeni d’Ors davant la Gran Guerra”, Recerques, 55 (2007), pp. 73-93.Fuentes Codera, M., “Germanófilos y neutralistas. Proyectos tradicionalistas y regeneracionistas para España (1914-1918)”, Ayer, 91/3 (2013), pp. 63-92.Fuentes Codera, M., España en la Primera Guerra Mundial. Una movilización cultural, Madrid, Akal, 2014.García Oliver, J., El Eco de los pasos, Paris/Barcelona, Ruedo Ibérico, 1978.García Sanz, F., España en la Gran Guerra, Madrid, Galaxia Gutenberg, 2014.Giráldez, E., “Brabo Portillo ¡Yo te acuso, Asesino!”, Solidaridad Obrera, 840 (5/8/1918), p. 1.Golden, L., “Les dones com avantguarda; El rebombori del pa del gener 1918”, L’Avenç (1981), pp. 45-52.Golden, L., “The women in command. The Barcelona women’s consumer war of 1918”, UCLA Historical Journal (1985), pp. 5-32.E. González Calleja y F. del Rey Reguillo, La Defensa armada contra la revolución. Una historia de las guardias cívicas en la España del siglo XX, Madrid, CSIC, 1995.González Calleja, E., La Razón de la fuerza. Orden público, subversión y violencia política en la España de la Restauración, 1875-1917, Madrid, CSIC, 1998.González Calleja, E., El Máuser y el sufragio. Orden público, subversión y violencia política en la crisis de la Restauración (1917-1931), Madrid, CSIC, 1999.González Calleja, E., (ed.), Políticas del miedo. Un balance del terrorismo en Europa, Madrid, Biblioteca Nueva, 2002.González Calleja, E., La España de Primo de Rivera. La modernización autoritaria 1923-1930, Madrid, Alianza Editorial, 2005.González Calleja, E., El laboratorio del miedo. Una historia general del terrorismo, Barcelona, Crítica, 2013.González Calleja, E. y Aubert, P., Nidos de espías. España, Francia y la Primera Guerra Mundial, Madrid, Alianza, 2014.González Calleja, E. (coord.), Anatomía de una crisis. 1917 y los españoles, Madrid, Alianza, 2017.Granados de Siles, J., “El escandaloso espionaje de Barcelona”, Solidaridad Obrera, 793 (19/6/1918), p. 1.Gual Villalbí, P., Memorias de un industrial de nuestro tiempo, Barcelona, Sociedad General de Publicaciones, [193?].León-Ignacio, J., Los años del pistolerismo. Ensayo para una guerra civil, Barcelona, Planeta, 1981.León-Ignacio, J., “Brabo Portillo, comisario y político”, Historia y vida, 181 (1983), pp. 68-73.Llates, R., 30 anys de vida catalana, Barcelona, Aedos, 1969.Madrid, F., Ocho meses y un día en el Gobierno Civil de Barcelona (confesiones y testimonios), Barcelona-Madrid, Las ediciones de la flecha, 1932.Manent, J., Records d’un sindicalista llibertari català, 1916-1943, París, Edicions Catalanes de París, 1976.Marquès, J., Història de l’organització sindical tèxtil “El Radium”, Barcelona, La Llar del Llibre, 1989.Márquez, B. y Capo, J. M., Las Juntas militares de defensa, Barcelona, Librería Sintes, 1923.Martínez Fiol, D., El catalanisme i la Gran Guerra (1914-1918). Antologia, Barcelona, La Magrana, 1988.Martínez Fiol, D. y Esculies Serrat, J., L’Assemblea de Parlamentaris de 1917 i la Catalunya rebel, Barcelona, Generalitat de Catalunya, 2017.Martínez Fiol, D. y Esculies Serrat, J., 1917. El año en que España pudo cambiar, Sevilla, Renacimiento, 2018.M.C.C., “El ‘affaire’ Brabo Portillo”, publicado en El Parlamentario y reproducido por Solidaridad Obrera, 926 (2/11/1918), p. 1.Mendoza, E., La verdad sobre el caso Savolta, Barcelona, Seix y Barral, 1975.Morales Lezcano, V., El colonialismo hispano-francés en Marruecos (1898-1927), Madrid, Siglo XXI, 1976.Navarra, A., 1914. Aliadófilos y germanófilos en la cultura española, Madrid, Cátedra, 2014.Navarra, A., Aliadòfils i germanòfils a Catalunya durant la Primera Guerra Mundial, Barcelona, Generalitat-CHCC, 2016.Nisk, “¡Inocente Brabo!”, Solidaridad Obrera, 789 (15/6/1918), p, 1.Pestaña, Á.,“A vuela pluma” y “En Libertad”, Solidaridad Obrera, 840-841 (5-6/8/1918), p. 1.Pestaña, Á., Terrorismo en Barcelona. Memorias inéditas, Barcelona, Planeta, [1979].Pradas Baena, M. A., L’anarquisme i les lluites socials a Barcelona 1918-1923. La repressió obrera i la violència, Barcelona, PAM, 2003.Pujadas, X., Marcel·lí Domingo i el marcel·linisme, [Barcelona], PAM, 1996.Roig, M., Rafael Vidiella. L’aventura de la revolució, Barcelona, Laia, 1976.Romero Salvadó, F. J., “Crisi, agonia i fi de la monarquía liberal (1914-1923)”, Segle XX. Revista catalana d’història, 1 (2008), pp. 57-82.Romero Salvadó, F. J. y Smith, A. (eds.), The Agony of Spanish Liberalism. FromRevolution to Dictatorship 1913-23, Houndmills, Basingstoke, Palgrave Macmillan, 2010.Rosenbusch, A., “Los servicios de información alemanes: sabotaje y actividad secreta”, Andalucía en la historia, 45 (2014), pp. 24-29.Rosenbusch, A., “Guerra Total en territorio neutral: Actividades alemanas en España durante la Primera Guerra Mundial”, Hispania Nova, 15 (2017), pp. 350-372.S. A., “Historia de un ‘bravo’ muy pillo”, La Campana de Gracia, 2569 (28/6/1918), p. 4.S.A., L’Esquella de la Torratxa, (12/7 y 30/8/ y 12/9/1918), pp. 447, 451, 456, 458, 568, 577 y 592.S. A., “A cada puerco le llega su San Martín” y “La muerte de Batet”, Solidaridad Obrera, 711 y 712 (9 y 10/1/1918), p. 1.S. A., Solidaridad Obrera, 713-716 (11-14/1/1918), p. 1.S. A., “Los conflictos del hambre”, Solidaridad Obrera, 717, 719-721 y 723-727 (15 y 17-19 y 21-25/1/1918), p. 1.S.A., Solidaridad Obrera, 783 y 784-786, (9-12/6/1918), p. 1.S.A., Solidaridad Obrera, 789-790, 794-795, 798 (15-16, 20-21 y 24/6/1918), p. 1.S. A., Solidaridad Obrera, 833 y 837 (28/7 y 2/8/1918), p. 1.S. A., Solidaridad Obrera, (3/7 y 12/12/1918), p. 2.S.A., “Veredicto popular”, Solidaridad Obrera, 790, 791, 793, 794, 795, 798, 799, 800, 802, 808, 809, 810, 811, 815, 816, 817, 818, 819, 820, 821, 822, 823, 825, 826, 827, 828, 829, 830, 832, 833, 834, 835, 836, 837, 838, 839 (16, 17, 19, 20, 21, 24, 25, 26, 28/6; 4, 5, 6, 7, 11, 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 24, 25, 26, 28, 29, 30, 31/7; 1, 2, 3, 4/8/1918), pp. 1-3.S.A., “Envío a doña Remedios Montero de Brabo Portillo”, 871 (7/9/1918), p. 1.S.A., Solidaridad Obrera, (24, 25, 26, 27, 28 y 30/6 y 3, 6, 8, 5, 10, 12, 13 y 19/7, 4, 5, 9, 23, 24 y 26/8, 21, 24, 25, 31/10, 1, 2/11/ y 1-6, 8, 10, 11, 12, 14, 15, 20, 30 y 31/12/1918), pp. 1-4.Safont, J., Per França i Anglaterra. La I Guerra Mundial dels aliadòfils catalans, Barcelona, Acontravent, 2012.Sánchez Marín, A. L., “El Instituto de Reformas Sociales: origen, evolución y funcionamiento”, Revista Crítica de Historia de las Relaciones Laborales y de la Política Social, 8 (mayo 2014), pp. 7-28.Smith, A., “The Catalan Counter-revolutionary Coalition and the Primo de Rivera Coup, 1917–23”, European History Quaterly 37:1 (2007), pp. 7-34.Smith, A., Anarchism, revolution and reaction. Catalan labor and the crisis of the Spanish State, 1898-1923, New York, Oxford, Berghahn, 2007.Soldevilla, F., El Año político 1920, Madrid, I. de Julio Cosano, 1921.Taibo II, P. I., Que sean fuego las estrellas. Barcelona (1917-1923), Barcelona, Crítica, 2016.Tamames, R. y Casals, X., Miguel Primo de Rivera, Barcelona, Ediciones B, 2004.Tusell, J., Radiografía de un golpe de estado. El ascenso al poder del general Primo de Rivera, Madrid, Alianza, 1987.Val, R. del y Río del Val, J. del, Solidaridad Obrera, 787-788, 790, 794, 801, 805, 807, 811, 814, 818, 828, 829, 836, 970 (13, 14, 16, 20 y 27/6/, 3, 7, 10, 14, 23, 24 y 31/7/ y 1/8/ y 10/121918), p. 1.Vandellós, P., “Contra los sindicatos. Los procesos de la sindicación obrera. De actualidad”, Solidaridad Obrera, 791 (17/6/1918), p. 1.Vidiella, R., Los de ayer. Novela, Madrid-Barcelona, Nuestro Pueblo, 1938.Winston, C. M., La Clase trabajadora y la derecha en España (1900-1936), Madrid, Cátedra, 1989.Winston, C. M., “Carlist workers groups in Catalonia, 1900-1923”, en S. G. Payne (dir.), Identidad y nacionalismo en la España contemporánea: el carlismo, 1833-1975, Madrid, Actas, 1996, pp. 85-101.Wosky, Solidaridad Obrera, 791, 801 y 820, (17 y 21/6/ 10/7/1918), pp. 1 y 3.

APA, Harvard, Vancouver, ISO, and other styles

15

García Fernández, A., P. Morán Álvarez, J. Bachiller-Corral, and M. Vázquez Díaz. "POS1204 LOW POSITIVITY RATE IN ANTIBODY SARS-COV2 TESTS IN PATIENTS WITH RHEUMATIC DISEASES TREATED WITH RITUXIMAB. A CASE CONTROL STUDY OF A HIGH IMPACT SARS-COV2 INFECTION AREA." Annals of the Rheumatic Diseases 80, Suppl 1 (May 19, 2021): 884.2–885. http://dx.doi.org/10.1136/annrheumdis-2021-eular.2082.

Full text

Abstract:

Background:Diagnosis of previous SARS-COV2 infection may be challenging in immunocompromised patients.Objectives:To analyze positivity rate to SARS-COV2 antibody tests (SC2AT) in patients diagnosed of rheumatic diseases (RMD) treated with Rituximab.Methods:We conducted a case-control study of patients diagnosed of RMD followed in a referral hospital in Madrid, Spain. Positivity rate to IgG-SC2AT were analyzed in Rituximab-treated patients (RTX) compared with patients treated with TNF inhibitors (TNFi) and/or conventional DMARDs (cDMARDs) (N-RTX).We included patients that received Rituximab in the previous year to a confirmed SARS-COV2 infection (defined as a positive polymerase chain reaction test (PCR) and/or compatible chest Xray), to a suspected SARS-COV2 infection (2 or more symptoms) or to SC2AT determination. Patients with RMD treated with other biological DMARDs (bDMARDs) rather than Rituximab or TNFi were excluded.Results:We included 152 patients with RMD who underwent a SC2AT. Main characteristics are reported in Table 1.Among RTX and N-RTX, 4/48 (8.3%) and 35/104 (33.7%) showed a positive IgG-SC2AT, respectively. Four out of 104 (38.5%) N-RTX tested positive without previous symptoms. No asymptomatic infection was diagnosed among RTX.Univariable analysis showed a lower rate of positivity to SC2AT in confirmed and suspected infection among RTX [Positive IgG-SC2AT in confirmed infection: RTX 4/10 (40%), N-RTX 16/20 (80%); p=0.045. Positive IgG-SC2AT in suspected infection: RTX 0/3 (0%), N-RTX 15/18 (83.3%); p=0.015].A logistic binary regression identified previous symptoms [OR 61.2, 95CI(13.3-280.6) p=0.0001], male sex [OR 4.8, 95CI(1.3-17.8) p=0.02], non-rituximab treatment [OR 19.7, 95CI(3.6-106.3) p=0.001] as independent factors associated with a higher probability of positive IgG-SC2AT. Age, previous PCR status, corticosteroid and cDMARD use showed no statistical significance. This model accounted for 47.6% of positive cases.Table 1.Main characteristics. AS, axial spondylitis; bDMARDs, biological disease-modifying anti-rheumatic drugs; cDMARDs, conventional DMARDs; COPD, Chronic obstructive pulmonary disease; CVD, Cardiovascular disease; IMM, immune-mediated myositis; JIA, Juvenile Idiopathic arthritis; PsoA, Psoriatic Arthritis; RA, Rheumatoid Arthrtis; SLE, Systemic Lupus Erythematosus; SSc, Systemic Sclerosis; SSj, Sjogren Syndrome.Rituximab (RTX)Non-Rituximab (N-RTX)p valuePatients, n (%)48 (31.6)104 (68.4)Age, years, median (IQR)65 (54-72)60 (47-71.8)p= 0.190Female, n (%)38 (79.2)74 (71.2)p=0.297Diagnosis, n (%)p=0.2- RA20 (41.7)42 (40.4)- SSj4 (8.3)6 (5.8)- RA SSj3 (6.3)0 (0)- SLE4 (8.3)8 (7.7)- Vasculitis7 (14.6)13 (12.5)- IMM1 (2.1)4 (3.8)- JIA2 (4.2)3 (2.9)- SSc7 (14.6)15 (14.4)- AS0 (0)4 (3.8)- PSoA0 (0)5 (4.8)- Othersa0 (0)4 (3.8)Comorbidities, n (%)- Hypertension18 (37.5)34 (32.7)p=0.561- Diabetes5 (10.4)10 (9.6)p=0.878- Dyslipidemia18 (37.5)30 (28.8)p=0.286- COPD/asthma6 (12.5)4 (3.8)p=0.049*- CVD11 (35.4)25 (24)p=0.831Interstitial lung disease, n (%)17 (35.4)8 (7.7)p<0.0001*Corticosteroids use, n (%)26 (54.2)33 (31.7)p=0.008*cDMARDs use, n (%)27 (56.3)73 (70.2)p=0.092bDMARDs, n (%)-- None0 (0)83 (79.8)- TNF inhibitors0 (0)21 (20.2)- Rituximab48 (100)0 (0)Previous positive PCR, n (%)- Time from positive PCR to SC2AT, days, mean ±SD8 (16.7)47.4 (38.7)20 (19.2)65.1 (49)p=0.191p=0.368Previous symptoms, n (%)- Time from symptom onset to SC2AT, days, mean ±SD13 (27.1)130.3 ±91.136 (34.6)93.5 ±72.6p=0.356p=0.15COVID, n (%)p=0.183- Non suspected35 (72.9)66 (63.5)- Suspected3 (6.3)18 (17.3)- Confirmed10 (20.8)b20 (19.2)aIncluding gout, polymyalgia rheumatica.bTwo patients had negative PCR but compatible symptoms and chest X-Ray.Conclusion:RTX had a lower rate of positivity to IgG-SC2AT compared to N-RTX. Previous symptoms, male sex and non-RTX treatment were independently associated with higher probability of positive IgG-SC2AT.Disclosure of Interests:None declared.

APA, Harvard, Vancouver, ISO, and other styles

16

Herrera-Sánchez, Javier, Julia Aznar, Leire Izaguirre, and Santiago Ovejero. "Different onset patterns of monthly paliperidone palmitate in hospitalised patient diagnosed with schizophrenia." BJPsych Open 7, S1 (June 2021): S166. http://dx.doi.org/10.1192/bjo.2021.459.

Full text

Abstract:

AimsPaliperidone palmitate long-acting injectable (PPLAI) initially requires two loading doses of 150 and 100 mg on days 1 and 8 (± 4 days) intramuscularly. In clinical practice, different PPLAI initiation patterns have been observed. The aim of this study is to describe different PPLAI onset patterns in hospitalised patients diagnosed with schizophrenia.MethodA naturalistic, transversal, retrospective, descriptive study was carried out. Patients were recruited in the adult inpatient unit of Hospital Universitario Jiménez Díaz (Madrid, Spain) from November 2012 to February 2021. During this period, a total of 357 patients were treated with PPLAI, 172 of them were diagnosed with schizophrenia and, among these, 24 received an atypical onset pattern during hospitalization. Different PPLAI onset patterns, PPLAI dose at discharge and number of days hospitalised were analysed. This study followed the Declaration of Helsinki principles and was approved by the Local Ethics Committee. All participants gave written informed consent.ResultThe sample presents 24 patients (17 men, 7 women) that represents 6.72% of a global sample, with an average age of 40.21 years (men 35.59 years vs. women 51.43 years). In this study, different PPLAI onset patterns were described: those receiving 150-150 mg represent 25% of the sample (n = 6), as do those receiving 100-75 mg, also representing 25% of the sample (n = 6). The rest of the onset patterns were: 150-75 mg (20.83%, n = 5), 100-100 mg (12.5%, n = 3), 150-75 mg (4.16%, n = 1), 100-50 mg (4.16%, n = 1), 75-100 mg (4.16%, n = 1), and 75-75 mg (4.16%, n = 1). The average hospital stay is 17.88 days. The PPLAI maintenance dose at discharge was 104.17 mg/month. The group of patients who received two doses of 150 mg (150-150 mg) had an average length of stay of 27.67 days compared to the rest of the patients who had an average length of stay of 15.12 days, this difference being statistically significant (p = 0.010). The 150-150 mg group was discharged with a mean maintenance dose of 141.67 mg versus the other patients who needed a mean maintenance dose of 91.18 mg, which was also statistically significant (p = 0.001).ConclusionThe most used pattern of atypical onset of PPLAI in this sample is 150-150 mg and 100-75 mg. Patients treated with 150-150 mg loading pattern are hospitalized for a longer period and needed higher maintenance dose at discharge. Further studies are needed.

APA, Harvard, Vancouver, ISO, and other styles

17

Torres-Lacomba, María, Beatriz Navarro-Brazález, Virginia Prieto-Gómez, Jean Claude Ferrandez, Jean Yves Bouchet, and Helena Romay-Barrero. "Effectiveness of four types of bandages and kinesio-tape for treating breast-cancer-related lymphoedema: a randomized, single-blind, clinical trial." Clinical Rehabilitation 34, no. 9 (June 24, 2020): 1230–41. http://dx.doi.org/10.1177/0269215520935943.

Full text

Abstract:

Objective: To compare the effects of four types of bandages and kinesio-tape and determine which one is the most effective in women with unilateral breast cancer-related lymphoedema. Design: Randomized, single-blind, clinical trial. Setting: Physiotherapy department in the Women’s Health Research Group at the University of Alcalá, Madrid, Spain. Subjects: A total of 150 women presenting breast-cancer-related lymphoedema. Interventions: Participants were randomized into five groups ( n = 30). All women received an intensive phase of complex decongestive physiotherapy including manual lymphatic drainage, pneumatic compression therapy, therapeutic education, active therapeutic exercise and bandaging. The only difference between the groups was the bandage or tape applied (multilayer; simplified multilayer; cohesive; adhesive; kinesio-tape). Main measurements: The main outcome was percentage excess volume change. Other outcomes measured were heaviness and tightness symptoms, and bandage or tape perceived comfort. Data were collected at baseline and finishing interventions. Results: This study showed significant differences between the bandage groups in absolute value of excess volume ( P < 0.001). The most effective were the simplified multilayer (59.5%, IQR = 28.7) and the cohesive bandages (46.3%, IQR = 39). The bandages/tape with the least difference were kinesio-tape (4.9%, IQR = 17.7) and adhesive bandage (21.7%, IQR = 17.9). The five groups exhibited a significant decrease in symptoms after interventions, with no differences between groups. In addition, kinesio-tape was perceived as the most comfortable by women and multilayer as the most uncomfortable ( P < 0.001). Conclusion: Simplified multilayer seems more effective and more comfortable than multilayer bandage. Cohesive bandage seems as effective as simplified multilayer and multilayer bandage. Kinesio taping seems the least effective.

APA, Harvard, Vancouver, ISO, and other styles

18

Sandoval-Insausti, Helena, Carolina Donat-Vargas, Belen Moreno-Franco, Martin Laclaustra, E. Jarauta, and Pilar Guallar-Castillon Q2818013A. "Exposure to Dietary Polychlorinated Biphenyls and Dioxins, and Its Relationship with Subclinical Coronary Atherosclerosis: The Aragon Workers' Health Study." Current Developments in Nutrition 4, Supplement_2 (May 29, 2020): 146. http://dx.doi.org/10.1093/cdn/nzaa042_011.

Full text

Abstract:

Abstract Objectives Experimental evidence has revealed that exposure to polychlorinated biphenyls (PCBs) and dioxins directly impairs endothelial function and induces atherosclerosis progression. In the general population, despite a small number of recent studies finding a link between PCBs, and stroke and myocardial infraction, the association with early coronary atherosclerosis has not been examined yet. To examine whether dietary exposure to PCBs and dioxins is associated with subclinical coronary atherosclerosis in a middle-aged men. Methods Cross-sectional analysis comprising 1844 men in their 50 s and free of cardiovascular disease, who participated in the Aragon Workers' Health Study (AWHS). Individual dietary exposures to PCBs and dioxins were estimated by the contaminant's concentration in food coupled with the corresponding consumption and then participants were classified into quartiles of consumption. Coronary artery calcium score (CACS) was assessed by computerized tomography. We conducted ordered logistic regressions to estimate the odds ratio (OR) and 95% confidence intervals (CIs) for progression to the categories of more coronary artery calcium, adjusting for potential confounders. Results Among the participants, coronary calcium was not shown in 60.1% (n = 1108), 29.8% had a CACS > 0 and < 100 (n = 550), and the remaining 10.1% (n = 186) had a CACS ≥ 100. Compared with those in the first quartile of PCBs exposure, those in the fourth one had an increased odds for having coronary calcium (OR 2.02, 95% CI [1.18, 3.47], p trend 0.019) and for having progressed to categories of more intense calcification (OR 2.03, 95% CI [1.21, 3.40], p trend 0.012). However, no association was found between dietary dioxins exposure and prevalent coronary artery calcium. Conclusions In this general male population, dietary exposure to PCBs, but not to dioxins, was associated with a higher prevalence of coronary calcium and to more intense subclinical coronary atherosclerosis. PCBs exposure seems to increase the risk of coronary disease in men from the very early stages. Funding Sources State Secretary of R + D and FEDER/FSE and Excellence Integrated Projects in Health Research Institutes. The ATHLOS project (EU H2020). CIBERCV and CIBERESP from the Instituto de Salud Carlos III. Madrid, Spain.

APA, Harvard, Vancouver, ISO, and other styles

19

Lopez-Morinigo, Javier-David, Adela Sánchez Escribano-Martínez, Verónica González Ruiz-Ruano, Laura Mata-Iturralde, Sergio Sánchez-Alonso, Laura Muñoz-Lorenzo, Enrique Baca-García, and Anthony David. "S41. RANDOMISED CONTROLLED TRIAL OF METACOGNITIVE TRAINING COMPARED WITH PSYCHOEDUCATION IN PATIENTS WITH SCHIZOPHRENIA SPECTRUM DISORDERS: EFFECTS ON INSIGHT." Schizophrenia Bulletin 46, Supplement_1 (April 2020): S47—S48. http://dx.doi.org/10.1093/schbul/sbaa031.107.

Full text

Abstract:

Abstract Background Insight in schizophrenia spectrum disorders (SSD) has been linked with positive outcomes. However, the effect size of previous treatments on insight has been relatively small to date. The metacognitive basis of insight in SSD has led to speculation that metacognitive training (MCT) may improve insight and clinical outcomes in SSD. Methods Design: Single-center, assessor-blind, parallel-group, randomised controlled trial (RCT). Sample: Participants are recruited from the outpatient clinic of Hospital Universitario Fundación Jiménez Díaz (Madrid, Spain) over June-December 2019. Inclusion criteria: i) age: 18–64 years, both inclusive, at the study inception; ii) diagnosis: SSD based on the Mini International Neuropsychiatric Interview (Sheehan et al., 1998) and iii) IQ>70 according to the Wechsler Adults Intelligence Scale-IV (Wechsler, 1981). Those with organic and drugs-induced psychosis, poor level of Spanish and/or lack of cooperativeness are excluded. Intervention: Participants are randomised to receive eight weekly group sessions of MCT or group psychoeducation (PSE) and they will be assessed at: T0) at baseline; T1) after treatment and T2) at 1-year follow-up, although follow-up data are not available yet. Co-primary outcome measures: clinical and cognitive insight dimensions, which will be measured by the Schedule for Assessment of Insight (Expanded version) (SAI-E) (Kemp & David, 1997), and the Beck Cognitive Insight Scale (BCIS) (Beck et al., 2004), respectively. Secondary outcome measures: i)Symptom severity-Positive and Negative Syndrome Scale (Kay et al., 1987); ii)Functioning-General Assessment of Functioning (Endicott et al., 1976), World Health Organization Disability Scale (WHO, 2012) and Satisfaction Life Domains Scale (Carlson et al., 2009), and only at follow-up (T2) iii)Suicidal Behaviour and iv) Hospitalizations. Power calculations: To reach a power of β=80% and detect a between-group difference of two points on the SAI-E total scores, which is considered to be clinically meaningful -effect size of 0.33-, the estimated sample size at the end of the study is n=126. Statistics: Student’s T-test and Mann-Whitney U tests were used as appropriate to compare between-group differences before- and after-treatment, i.e., the changes from baseline to post-treatment scores. The protocol of the study is registered at ClinicalTrials.gov (NCT04104347). Results n=49 subjects have been assessed at baseline so far (26 males, age: 47.0±10.2 years, diagnosis of schizophrenia -F20-ICD10-, n=36, 73.5%). Fifteen individuals (MCT: n=8; controls: n=7) have completed the treatment and the post-treatment assessment (T1). ‘After-treatment-T1 - baseline-T0’ scores difference means/medians between-group differences (MCT vs. PSE) were: SAI-E total insight 1.00 vs. -2.00, p=0.050; SAI-E illness awareness 0.62±2.20 vs. -0.43±1.62, p=0.316; SAI-E symptom relabelling 0.37±3.38 vs. -1.86±2.34, p=0.167; SAI-E treatment compliance 0.00 vs. 0.00, p>0.05,ns; BCIS self-reflectiveness 0.50±3.78 vs. -1.43±2.22, p=0.259, BCIS self-certainty 1.62±2.97 vs. 0.00±2.44, p=0.298 and BCIS Composite Index -1.13±5.62 vs. -2.17±3.49, p=0.698. Discussion This is the first RCT testing the effect of group MCT on insight (as primary outcome) in a sample of unselected patients with SSD in comparison with psychoeducation. Two main findings emerged from the results. First, MCT appears to improve clinical and cognitive insight in SSD. Second, MCT was shown to be superior to PSE in changing insight. Whether the above MCT-related insight improvement is maintained at longer-term and whether this has an impact on clinical and social outcomes are yet to be established, which will be properly looked at in this trial.

APA, Harvard, Vancouver, ISO, and other styles

20

Sanz-Cuesta, Teresa, Esperanza Escortell-Mayor, Isabel Cura-Gonzalez, Jesus Martin-Fernandez, Rosario Riesgo-Fuertes, Sofía Garrido-Elustondo, Jose Enrique Mariño-Suárez, et al. "Oral versus intramuscular administration of vitamin B12 for vitamin B12 deficiency in primary care: a pragmatic, randomised, non-inferiority clinical trial (OB12)." BMJ Open 10, no. 8 (August 2020): e033687. http://dx.doi.org/10.1136/bmjopen-2019-033687.

Full text

Abstract:

ObjectivesTo compare the effectiveness of oral versus intramuscular (IM) vitamin B12 (VB12) in patients aged ≥65 years with VB12 deficiency.DesignPragmatic, randomised, non-inferiority, multicentre trial in 22 primary healthcare centres in Madrid (Spain).Participants283 patients ≥65 years with VB12 deficiency were randomly assigned to oral (n=140) or IM (n=143) treatment arm.InterventionsThe IM arm received 1 mg VB12 on alternate days in weeks 1–2, 1 mg/week in weeks 3–8 and 1 mg/month in weeks 9–52. The oral arm received 1 mg/day in weeks 1–8 and 1 mg/week in weeks 9–52.Main outcomesSerum VB12 concentration normalisation (≥211 pg/mL) at 8, 26 and 52 weeks. Non-inferiority would be declared if the difference between arms is 10% or less. Secondary outcomes included symptoms, adverse events, adherence to treatment, quality of life, patient preferences and satisfaction.ResultsThe follow-up period (52 weeks) was completed by 229 patients (80.9%). At week 8, the percentage of patients in each arm who achieved normal B12 levels was well above 90%; the differences in this percentage between the oral and IM arm were −0.7% (133 out of 135 vs 129 out of 130; 95% CI: −3.2 to 1.8; p>0.999) by per-protocol (PPT) analysis and 4.8% (133 out of 140 vs 129 out of 143; 95% CI: −1.3 to 10.9; p=0.124) by intention-to-treat (ITT) analysis. At week 52, the percentage of patients who achieved normal B12 levels was 73.6% in the oral arm and 80.4% in the IM arm; these differences were −6.3% (103 out of 112 vs 115 out of 117; 95% CI: −11.9 to −0.1; p=0.025) and −6.8% (103 out of 140 vs 115 out of 143; 95% CI: −16.6 to 2.9; p=0.171), respectively. Factors affecting the success rate at week 52 were age, OR=0.95 (95% CI: 0.91 to 0.99) and having reached VB12 levels ≥281 pg/mL at week 8, OR=8.1 (95% CI: 2.4 to 27.3). Under a Bayesian framework, non-inferiority probabilities (Δ>−10%) at week 52 were 0.036 (PPT) and 0.060 (ITT). Quality of life and adverse effects were comparable across groups. 83.4% of patients preferred the oral route.ConclusionsOral administration was no less effective than IM administration at 8 weeks. Although differences were found between administration routes at week 52, the probability that the differences were below the non-inferiority threshold was very low.Trial registration numbersNCT 01476007; EUDRACT (2010-024129-20).

APA, Harvard, Vancouver, ISO, and other styles

21

Kjelland, M. E., C. González-Marín, J. Gosálvez, C. López-Fernández, R. W. Lenz, K. M. Evans, and J. F. Moreno. "283 DNA FRAGMENTATION DYNAMICS AND POST-THAW MOTILITY OF WHITE-TAILED DEER SPERM." Reproduction, Fertility and Development 23, no. 1 (2011): 239. http://dx.doi.org/10.1071/rdv23n1ab283.

Full text

Abstract:

The main objective herein was to study the level of DNA damage and post-thaw motility of White-tailed deer sperm before (neat sample) and after sex-sorting and conventional-sorting using a MoFlo® SX flow cytometer (SX, Dako, Fort Collins, CO, USA). For assessing DNA damage, a comparison of frozen–thawed (F-T) neat sperm (control) was made with F-T sex-sorted, F-T conventional-sorted, and F-T conventional sperm samples. Sperm motility was assessed by bright field microscopy using a Nikon Eclipse 80i microscope and slide-coverslips (25.4 × 76.2 mm slides, 22 × 22 #1.5 coverslips). A direct comparison of all 4 aforementioned sperm groups could not be made for some bucks. Live/dead sorting of the sperm (i.e. conventional-sorted sperm) can remove membrane compromised sperm and nonaligned live sperm, which may result, in part, from abnormal morphologies. White-tailed deer (Odocoileus virginianus; n = 13) from 1 to 7 years old were used for the experiments. The White-tailed deer were selected based on a genetic predisposition for producing large antlers (i.e. Boone and Crockett antler scores ≥200 points). Sperm DNA fragmentation levels were assessed using the Sperm-Halomax® kit (Halotech DNA, Madrid, Spain), counting 300 sperm per sample. The level of baseline DNA fragmentation was similar for conventional F-T sperm samples (<5%), but even lower after sex-sorting and conventional-sorting (2.39 and 1.69%, respectively). The conventional sperm samples had lower post-thaw motilities compared with sex-sorted samples from the same individual bucks (n = 6), with average post-thaw motilities of 43 ± 26% and 56.5 ± 20%, respectively. The statistical comparison of the dynamic loss of DNA quality (i.e. DNA fragmentation of samples incubated in a 34°C water bath for 96 h) was assessed using the nonparametric maximum likelihood Kaplan-Meier estimator and a Breslow (Generalized Wilcoxon) test. When comparing sperm samples taken from the same bucks (n = 6), the conventional samples had significantly greater (P < 0.05) DNA fragmentation levels over time than the sex-sorted sperm. Conventional-sorted White-tailed deer (n = 8) sperm samples did not have significantly greater (P > 0.05) DNA fragmentation levels when compared with the sex–sorted sperm. When comparing X-chromosome sorted sperm to Y-chromosome sorted sperm, the DNA fragmentation levels were not significantly different (n = 10; P > 0.05), averaging 2.59 ± 3.61% and 2.18 ± 0.53% after 96 h. Based on the sperm DNA fragmentation and post-thaw motility results in the present study, the sex-sorting of White-tailed deer sperm may be a viable technique for the White-tailed deer industry and perhaps serve as a model for the conservation of endangered species such as the Eld’s deer (Cervus eldithamin). Future work should be implemented for examining the fertilizing potential of sex-sorted White-tailed deer sperm. The authors thank Maurice Rosenstein, Laura Belluzzo, Jared Templeton, Mike Bringans, Pat Cooper, Suzanne Menges, Miguel Ramirez, Altea Gosálbez, and Sexing Technologies staff for technical assistance. This research was funded by Sexing Technologies.

APA, Harvard, Vancouver, ISO, and other styles

22

Ruiz-Moreno, José M., Mariluz Puertas, Ignacio Flores-Moreno, Jorge Ruiz-Medrano, Elena Almazán-Alonso, and Maria Garcia-Zamora. "Evolution of Macular Bruch Membrane Defects of Patchy Chorioretinal Atrophy in Pathologic Myopia Based on a Recent Classification System." Ophthalmologica 244, no. 4 (2021): 309–14. http://dx.doi.org/10.1159/000516526.

Full text

Abstract:

Purpose: The purpose of this study was to analyze the progression of macular Bruch membrane defects (BMD) in highly myopic patients with patchy atrophy (PA); and study its correlation with the enlargement of PA and ATN grading. Setting/Venue: Puerta de Hierro-Majadahonda University Hospital, Madrid, Spain. Patients and Methods: This was a cross-sectional, noninterventional study. A series of 451 highly myopic eyes with spherical equivalent > −6.0 D and/or >26 mm of axial length (AL) were included. All patients underwent a complete ophthalmological examination and swept-source optical coherence tomography (SS-OCT), and were graded using the ATN system by 2 masked retina experts that assessed the atrophic (A), tractional (T), and neovascular (N) components. SS-OCT b-scans were employed to study PA and macular BMD at baseline and at a 1-year follow-up, in patients with good foveal fixation. Results: Out of total 451 eyes, 126 eyes (27.9%) had PA (53 patients; 75.4% women). Mean T and N in eyes with PA were 1.1 ± 1.3 and 0.08 ± 0.2, respectively. Sixty-eight of them had >1-year follow-up with a good foveal fixation and enough image quality. From them, BMD were found in 44 eyes (64.7%) at baseline and increased to 59 eyes (86.7%) at a 1-year follow-up. The mean great linear dimension of PA and macular BMD increased with a median of 384.5 ± 462.5 μm (IR 68.0–660.2) and 265.6 ± 418.1 μm (IR 0–331.7), respectively. At 1-year, PA and BMD sizes increase, and were statistically significant (p < 0.001). There was a positive correlation between the growth of macular BMD and the growth of PA (r = 0.490, p < 0.00). T grading correlated significantly with PA growth (p < 0.05). Conclusions: Macular BMD increase its prevalence and its size over time in highly myopic patients with PA. There is a positive correlation between BMD and PA area growth. New studies with a larger sample size, longer follow-up, and AL elongation correlation are necessary to corroborate our findings.

APA, Harvard, Vancouver, ISO, and other styles

23

Navarro Alonso, P., Á. García Martos, A. Castilla, L. González, M. D. C. Ortega, C. Arconada, A. Prada-Ojeda, et al. "AB0643 DRUG SURVIVAL OF SECUKINUMAB IN A SPONDYLOARTHRITIS COHORT. A 24 MONTHS MULTICENTRIC STUDY." Annals of the Rheumatic Diseases 79, Suppl 1 (June 2020): 1616.1–1616. http://dx.doi.org/10.1136/annrheumdis-2020-eular.3666.

Full text

Abstract:

Background:Secukinumab inhibits the interaction between Interleukin 17A (IL-17A) and its receptor. Clinical trials have demonstrated good data in efficacy and safety in patients with spondyloarthritis (SpA) as first biological choice or inadecuate response to other biological in SpA. However there is few evidence in real clinical practice.Objectives:Evaluate the drug survival in a real clínical practice, as an indirect way to show the efficacy and security of Secukinumab at 24 monthsMethods:A multicentric observational, longitudinal, retrospective study of 24 months conducted in five Madrid hospitals (Spain). Patients older than 18 years treated with Secukinumab which fullfilled ASAS criteria for SpA and/or modified New York criteria for ankylosing spondylitis (AS) and/or CASPAR criteria for psoriatic arthritis (PsA) were included. For evaluation of the drug survival, dates from starting until closing date or definite withdrawal of the treatment were determined. Kaplan-Meier function was used to estimate the drug survival and Wilcoxon test for the comparison of the survival rate between the different diagnoses, because of the survival curves did not reach the medianResults:A total of 71 patients were included. The mean age was 50.26 ys (SD 11.01), 57.75% women. 35 patients fullfilled classification criteria for PsA ant 36 fullfilled classification criteria for axSpA. 22 patients were naïve for biologic therapies and 49 patients had an inadecuate response to TNFi. 13 patients discontinued Secukinumab before the closing date, the main reason for the interruption was secondary failure (n= 6), and primary failure (n=2). Secukinumab survival rate was 81.95% up to 24 months in this cohort. The median of survival was 2.36 years (IC: 1.79-2.84). There were no significant differences about the drug survival related to diagnosis (p=0.976). The safety data were similar to those described in clinical trials.Conclusion:Secukinumab is an effective and safe treatment for the management of espondiloarthritis regardless of the subtypes, with a high survival rate. In this study naive patients show similar data obtained in clinical trials. In this cohort of patients, those who initiated secukinumab after failure to TNFi, showed a greater secukinumab survival than the data provided in clinical trialsDisclosure of Interests:None declared

APA, Harvard, Vancouver, ISO, and other styles

24

Ryu, Jihan, Emese Sükei, Agnes Norbury, Shelley H Liu, Juan José Campaña-Montes, Enrique Baca-Garcia, Antonio Artés, and M. Mercedes Perez-Rodriguez. "Shift in Social Media App Usage During COVID-19 Lockdown and Clinical Anxiety Symptoms: Machine Learning–Based Ecological Momentary Assessment Study." JMIR Mental Health 8, no. 9 (September 15, 2021): e30833. http://dx.doi.org/10.2196/30833.

Full text

Abstract:

Background Anxiety symptoms during public health crises are associated with adverse psychiatric outcomes and impaired health decision-making. The interaction between real-time social media use patterns and clinical anxiety during infectious disease outbreaks is underexplored. Objective We aimed to evaluate the usage pattern of 2 types of social media apps (communication and social networking) among patients in outpatient psychiatric treatment during the COVID-19 surge and lockdown in Madrid, Spain and their short-term anxiety symptoms (7-item General Anxiety Disorder scale) at clinical follow-up. Methods The individual-level shifts in median social media usage behavior from February 1 through May 3, 2020 were summarized using repeated measures analysis of variance that accounted for the fixed effects of the lockdown (prelockdown versus postlockdown), group (clinical anxiety group versus nonclinical anxiety group), the interaction of lockdown and group, and random effects of users. A machine learning–based approach that combined a hidden Markov model and logistic regression was applied to predict clinical anxiety (n=44) and nonclinical anxiety (n=51), based on longitudinal time-series data that comprised communication and social networking app usage (in seconds) as well as anxiety-associated clinical survey variables, including the presence of an essential worker in the household, worries about life instability, changes in social interaction frequency during the lockdown, cohabitation status, and health status. Results Individual-level analysis of daily social media usage showed that the increase in communication app usage from prelockdown to lockdown period was significantly smaller in the clinical anxiety group than that in the nonclinical anxiety group (F1,72=3.84, P=.05). The machine learning model achieved a mean accuracy of 62.30% (SD 16%) and area under the receiver operating curve 0.70 (SD 0.19) in 10-fold cross-validation in identifying the clinical anxiety group. Conclusions Patients who reported severe anxiety symptoms were less active in communication apps after the mandated lockdown and more engaged in social networking apps in the overall period, which suggested that there was a different pattern of digital social behavior for adapting to the crisis. Predictive modeling using digital biomarkers—passive-sensing of shifts in category-based social media app usage during the lockdown—can identify individuals at risk for psychiatric sequelae.

APA, Harvard, Vancouver, ISO, and other styles

25

Bravo López, Fernando. "El conocimiento de la religiosidad islámica en la España Moderna: los cinco pilares del islam." Vínculos de Historia. Revista del Departamento de Historia de la Universidad de Castilla-La Mancha, no. 8 (June 20, 2019): 92. http://dx.doi.org/10.18239/vdh_2019.08.05.

Full text

Abstract:

RESUMENEl estudio histórico de la religiosidad islámica se ha encontrado tradicionalmente con el problema de la escasez de fuentes. Además, siempre se ha estudiado a partir de las fuentes islámicas, obviando las cristianas. Si es cierto que para la Edad Media las fuentes cristianas no ofrecen demasiada información y están además viciadas por su carácter polémico, también lo es que para la Edad Moderna, con el surgimiento de un tipo de literatura sobre el islam que está alejado de la tradición polémica, disponemos de un buen número de importantes fuentes cristianas que merecen ser tenidas en cuenta en cualquier análisis histórico de la religiosidad islámica. Es el caso especialmente de la Topographía e Historia general de Argel (1612), cuyas descripciones y observaciones resultan de una riqueza sin precedentes.PALABRAS CLAVE: Edad Moderna, cinco pilares del islam, religiosidad, España, Argel.ABSTRACTTraditionally, the historical study of Islamic religiosity has been faced with the problem of the scant amount of sources. Moreover, it has always been approached on the basis of Islamic sources, disregarding the Christian ones. If for the Middle Ages Christian sources do not present much information about the subject and this is tainted by its polemical character, for the Early Modern Age, with the emergence of a new kind of literature about Islam that does not belong to the polemical tradition, we have at our disposal a good number of sources of information. This is particularly thecase of the Topographía e Historia general de Argel (1612), with descriptions and observations of an unprecedented quality. It is an evident indication that, from the sixteenth century onwards, there are Christian sources that must be taken into account in any historical analysis of Islamic religiosity.KEY WORDS: Image of Islam, early modern Spain, five pillars of Islam, religiosity. BIBLIOGRAFÍAAfricanus, L., Descripción general del África y de las cosas peregrinas que allí hay, traducción y edición de S. Fanjul, Barcelona, Lunwerg, 1995.Alfonso, P., Diálogo contra los judíos, traducción de E. Ducay, Zaragoza, Instituto de Estudios Altoaragoneses, 1996.Berkey, J. P., The formation of islam: religion and society in the Near East, 600-1800, Cambridge, Cambridge University Press, 2003.Berque, J., Al-Yousi: problémes de la culture marocaine au XVIIème siècle, Paris, Moutin & Co., 1958.Bunes Ibarra, M. Á. de, La imagen de los musulmanes y del norte de África en la España de los siglos XVI y XVII: los caracteres de una hostilidad, Madrid, CSIC, 1989.Camamis, G., Estudios sobre el cautiverio en el Siglo de Oro, Madrid, Gredos, 1977.Cardaillac, L., Moriscos y cristianos: un enfrentamiento polémico (1442-1560), 2ª ed., Madrid, Fondo de Cultura Económica, 2016.Constable, O. R., “Regulating religious noise: the Council of Vienne, the mosque call and Muslim pilgrimage in the late medieval Mediterranean world”, Medieval Encounters, vol. 16, núm. 1 (2010), pp. 64–95.Cruz Hernández, M., El islam de al-Andalus: historia y estructura de su realidad social, 2ª ed., Madrid, AECI, 1996.Cruz Palma, Ó. de la, “Las cinco oraciones islámicas diarias (Salawat) en las fuentes latinas medievales”, en Martínez Gázquez, J. y Tolan, J. V. (eds.), Ritus infidelium. Miradas interconfesionales sobre las prácticas religiosas en la Edad Media, Madrid, Casa de Velázquez, 2013, pp. 133-149.— Machometus: la invención del profeta Mahoma en las fuentes medievales, Bellaterra, Institut d’Estudis Medievals, 2017.Daniel, N., Islam and the West: the making of an image, Oxford, Oneworld Pub., 1993.Eckhart, A., “Le cercueil flottant de Mahomet”, en Mélanges de philologie romane et de littérature offerts à Ernest Hoepffener, París, Les Belles Lettres, 1949, pp. 77-88.Eisenberg, D., “Cervantes, autor de la Topografía e historia general de Argel publicada por Diego de Haedo”, Cervantes: Bulletin of the Cervantes Society of America, vol. 16, núm. 1 (1996), pp. 32-53.Evans, R. J. W. y Marr, A. (eds.), Curiosity and wonder from the Renaissance to the Enlightenment, Abingdon y Nueva York, Routledge, 2016.Fierro, M., “Prácticas y creencias religiosas en al-Andalus”, Al-Qantara, vol. 13, núm. 2 (1992), pp. 463-474.Garcés, M. A., Cervantes en Argel: historia de un cautivo, Madrid, Gredos, 2005.— “Introduction”, en Sosa, A. de, An early modern dialogue with Islam: Antonio de Sosa’s Topography of Algiers (1612), Notre Dame, Ind., University of Notre Dame Press, 2011, pp. 1-78.García-Arenal, M., Inquisición y moriscos: los procesos del Tribunal de Cuenca, 3ª ed., Madrid, Siglo XXI, 1987.García Sanjuán, A., “La celebración de la navidad en al-Andalus y la convivencia entre cristianos y musulmanes”, en Miura, J. M. (ed.), Te cuento la navidad: visiones y miradas sobre las fiestas de invierno, Sevilla, Aconcagua, 2011, pp. 43-49.Gonzalbes, C., “Un ensayo para la catalogación de los amuletos de plomo andalusíes”, Boletín Arqueológico Medieval, 12 (2005), pp. 7-17.González de Clavijo, R., Embajada a Tamorlán, edición de F. López Estrada, Barcelona, Castalia, 2017, pp. 188-189.Halevi, L., Muhammad’s grave: death rites and the making of Islamic society, Nueva York, Columbia University Press, 2007.Hammoudi, A., The victim and its masks: an essay on sacrifice and masquerade in the Maghreb, Chicago, Chicago University Press, 1993.Höfert, A., “The order of things and the discourse of the Turkish threat: the conceptualisation of Islam in the rise of Occidental anthropology in the fifteenth and sixteenth centuries”, en Höfert, A. y Salvatore, A. (eds.), Between Europe and Islam: shaping modernity in a transcultural space, Bruselas, PIE-Peter Lang, 2000, pp. 39-70.Ibn Battuta, A través del islam, traducción, introducción y notas de S. Fanjul y F. Arbós, Madrid, Alianza Ed., 2005.Ibn Yubayr, A través del oriente (Rihla), estudio, traducción, notas e índices de F. Maíllo, Madrid, Alianza Ed., 2007.Irwin, R., For lust of knowing: the orientalists and their enemies, Londres y Nueva York, Penguin, 2007.Jiménez de Rada, R., Historiae minores. Dialogvs libri vite, edición y estudio de J. Fernández Valverde y J. A. Estévez Sola, Turnhout, Brepols, 1999.Kaptein, N. J. G., Muhammad’s birthday festival: early history in the central Muslim lands and development in the Muslim west until the 10th/16th century, Leiden, Nueva York y Colonia, Brill, 1993.Maliki, S., “Religiosidad y alteridad: una aproximación a la imagen del musulmán en la Topografía e Historia general de Argel de Antonio de Sosa”, ‘Ossour al-Jadida, 19-20 (2015), pp. 66-82.Montecroce, R., Reprobación del Alcorán, Sevilla, por dos alemanes compañeros, 1501.Parreño, J. M., “Experiencia y literatura en la obra de Antonio de Sosa”, en Sosa, A. de, Diálogo de los mártires de Argel, Madrid, Hiperión, 1990, pp. 9-23.Pascual, P., Sobre la se[c]ta mahometana, edición y estudio de F. González Muñoz, Valencia, Publicacions de la Universitat de València, 2011.Rodríguez Mediano, F., “Santos arrebatados: algunos ejemplos de maydub en la Salwat al-anfas de Muhammad al-Kattani”, Al-Qantara, vol. 13, núm. (1992), pp. 237-256.— “Religiosidad en al-Andalus: el hombre santo en el islam occidental”, Revista de Dialectología y Tradiciones Populares, 54 (1999), pp. 145-168.Sahin, K., “Staging an Empire: an Ottoman circumcision ceremony as cultural performance”, American Historical Review, vol. 123, núm. 2 (2018), pp. 463-492.Said, E. W., Orientalismo, 2ª ed., Barcelona, Debolsillo, 2003.Salah, M. M., El doctor Sosa y la Topografía e historia general de Argel, tesis doctoral, Departamento de Filología Española, Universidad Autónoma de Barcelona, Barcelona, 1991.Salicrú, R., “Entre la praxis y el estereotipo: vivencias y percepciones de lo islámico ibérico en las fuentes archivísticas y narrativas bajomedievales”, en MartínezGázquez, J. y Tolan, J. V. (eds.), Ritus infidelium. Miradas interconfesionales sobre las prácticas religiosas en la Edad Media, Madrid, Casa de Velázquez, 2013, pp. 99-111.Shoshan, B., Popular culture in medieval Cairo, Cambridge, Cambridge University Press, 1993.Sola, E., “Renacimiento, Contrarreforma y problema morisco en la obra de Antonio de Sosa”, en Sosa, A. de, Diálogo de los mártires de Argel, Madrid, Hiperión, 1990, pp. 27-52.— “Antonio de Sosa: un clásico inédito amigo de Cervantes (Historia y Literatura)”, en Actas del I Coloquio Internacional de la Asociación de Cervantistas, Barcelona, Anthropos, 1990, pp. 409-412.Southern, R. W., Western views of Islam in the Middle Ages, Cambridge, Mass., Harvard University Press, 1962.Tolan, J. V., Saracens: Islam in the medieval European imagination, Nueva York, Columbia University Press, 2002.Tóth, J., “Topography of a society: Muslims, dwellers, and customs of Algiers in Antonio de Sosa’s Topographia, e Historia general de Argel”, en Birnbaum, M. D. y Sebok, M. (eds.), Practices of coexistence: constructions of the other in early modern perceptions, Budapest, Central European University Press, 2017, pp. 103-142.Touati, H., Entre Dieu et les hommes: lettrés, saints et sorciers au Maghreb (17e siècle), París, École des Hautes Études en Sciences Sociales, 1994.Tuy, L. de, Crónica de España, edición de J. Puyol, Madrid, Tip. de la RABM, 1926.Varthema, L., Itinerario del venerable varon micer Luis patricio romano en el qual cuenta mucha parte de la Ethiopia, Egipto, y entrambas Arabias, Siria y la India, Sevilla, Jacobo Cromberger, 1520.Viaje de Turquía (la odisea de Pedro Urdemalas), 6ª ed., a cargo de F. García Salinero, Madrid, Cátedra, 2010.Waardenburg, J. J., “Official and popular religion in Islam”, Social Compass, vol. 25, núms. 3-4 (1978), pp. 315-341.Wiegers, G., “Ibadat”, en Martin, R. C. (ed.), Encyclopedia of Islam and the Muslim world, 2 vols., Nueva York, Macmillan Reference USA, Thomson/Gale, 2004, vol. 1, pp. 327-333.Zaragoza, E., “Abadologio del monasterio de Ntra. Sra. de la Misericordia de Frómista (1437-1835)”, Publicaciones de la Institución Tello Téllez de Meneses, 71 (2000), pp. 135-158.

APA, Harvard, Vancouver, ISO, and other styles

26

Loarce-Martos, J., C. Rita, R. Ballester Gonzalez, L. Calvo Sanz, S. Garrote Corral, A. García-Soidan, C. García-Hoz, I. Iturrieta-Zuazo, J. Bachiller-Corral, and G. Roy. "FRI0250 “ARE MYOSITIS ANTIBODIES SPECIFIC FOR IDIOPATHIC INFLAMMATORY MYOPATHY DIAGNOSIS?” CLINICAL CORRELATION OF A COHORT OF PATIENTS POSITIVE FOR MYOSITIS ANTIBODIES." Annals of the Rheumatic Diseases 79, Suppl 1 (June 2020): 709.2–709. http://dx.doi.org/10.1136/annrheumdis-2020-eular.5990.

Full text

Abstract:

Background:Idiopathic inflammatory myopathies (IIM) are a group of immune-mediated diseases characterized my muscle weakness, skin rash and systemic involvement. Myositis-specific antibodies (MSA) and myositis-associated antibodies (MAA) play a major role in IIM diagnosis, classification and prognosis. Nevertheless, MSA/MAA testing is not standardized and there very few studies addressing their relationship with other diseases.Objectives:To describe a cohort of patients tested positive for MSA/MAA, and to explore it´s relationship with IIM and other autoimmune diseases.Methods:We retrospectively review all the serum samples obtained from patients tested for MSA/MAA during 2019 in the Immunology department of Ramón y Cajal University Hospital (Madrid, Spain). These antibodies were tested by specific immunoblot (EUROLINE: Autoimmune Inflammatory Myopathies 16 Ag) with highly purified MSA/MAA. Positivity was stablished according to absorbance titer and adjusted by positive control of each test (arbitrary units, AU). Patients were diagnosed with IIM according to their clinician diagnosis. Diagnosis and classification were confirmed by an independent rheumatologist (JL) according to current understanding of IIM classification.Results:Three-hundred-seventy-five samples were tested for MSA during the study period. Two-hundred-seventy-nine were negative for all antibodies tested. Ninety-six samples were positive for one or more MSA/MAA, corresponding to 74 patients (11 patients had 2 different samples). Forty-nine (66.2%) of the patients who tested positive were female and 25 (33.8%) were male. Mean age was 58.65 years. Only 22 patients (29.7%) had a confirmed diagnosis of IIM, 24 (32.4%) had a diagnosis of other autoimmune disease, and 11 (14.9%) were diagnosed with interstitial lung disease (ILD) (Figure 1). Six ILD patients had anti-PM-Scl or anti-Ku antibodies, which are associated with scleroderma or overlap-CTD myositis, nevertheless, they remained classified as ILD as no other features were described in this group.Seventeen patients were positive for more than 1 MAA or MSA, including 14 patients positive for anti Ro-52. Antibody titer was higher in the IIM group compared to non-myositis group (59.59 vs 44.16, p=0.015). Anti Mi-2 was positive in 4 ILD without any other myositis features, and high titer anti-SRP (n=4, mean 59.75 AU) was found in primary biliary cirrhosis (PBC) patients. Additionally, 5 patients positive for antiJo-1 using ELIA (Thermo Fisher) were diagnosed with antisynthetase syndrome. IIM diagnosis and its relationship with antibody titer is represented in table 1.Table 1.Autoantibody titer according to diagnosis.Antibody (Number of patients)Number of samplesIIMIIM antibody titer (AU)Non-IIMNon-IIM antibody titer (AU)Other AI diseasesAnti Ro-52Anti Jo-1 (n=1)11 (100%)92.70-01 (100%)Anti PL-7 (n=8)113 (37.5%)29.595 (62.5%)25.595 (62.5%)2 (25%)Anti PL-12 (n=3)21 (33.3%)53.952 (66.6%)69.971 (33.3%)2 (50%)Anti EJ (n=1)11 (100%)99.460-01 (100%)Anti OJ (n=2)40-2 (100%)23.041 (50%)0Anti Ku (n=14)193 (21.4%)107.2511 (78.6%)31.855 (35.7%)0Anti Tif1gamma (n=5)63 (60%)40.122 (40%)23.841 (20%)0Anti NXP2 (n=2)30-2 (100%)13.991 (50%)1 (50%)Anti Mi2 (n=12)173 (25%)48.659 (75%)26.674 (33.3%)0Anti SAE (n=1)10-1 (100%)1800Anti MDA5 (n=2)32 (100%)30.5401 (50%)1 (50%)Anti SRP (n=9)124 (44.4%)42.695 (55.6%)68.165 (55.5%)2 (22.2%)Anti PM-Scl75 and PM-Scl100 (n=2)21 (50%)68.61 (50%)36.6700Anti PM-Scl75 (n=8)10016.268 (100%)22.723 (37.5%)1 (12.5%)Anti PM-Scl100 (n=4)50-4 (100%)23.622 (50%)0Conclusion:Only 28.7% of the patients that were MAA/MSA positive had a diagnosis of IIM. Other autoimmune diseases and ILD were commonly found in this group of MSA/MAA positive patients.References:[1]Damoiseaux J, Vulsteke JB, Tseng CW, Platteel ACM, Piette Y, Shovman O, et al. Autoantibodies in idiopathic inflammatory myopathies: Clinical associations and laboratory evaluation by mono- and multispecific immunoassays. Vol. 18, Autoimmunity Reviews. Elsevier B.V.; 2019. p. 293–305.Disclosure of Interests:None declared

APA, Harvard, Vancouver, ISO, and other styles

27

Martínez, A., J. Gosálvez, C. López-Fernández, J. A. G. González, C. G. Artiga, Y. D. L. Ortega, M. E. Kjelland, and A. García-Contreras. "145 Effect of Dietary Organic Zinc Levels on Boar (Sus scrofa domesticus) Sperm DNA Fragmentation Dynamics." Reproduction, Fertility and Development 30, no. 1 (2018): 212. http://dx.doi.org/10.1071/rdv30n1ab145.

Full text

Abstract:

Zinc (Zn) is essential for the development and activity of sperm, although its cytotoxic effect on sperm has been little studied. This study evaluated the effect of organic Zn; that is, Zn-methionate (Zn-Met), on the DNA fragmentation of boar sperm. Domestic boars (York × Landrace, Sus scrofa domesticus; n = 15) were randomly allocated into 3 levels of Zn dietary concentrations: 25 (Control), 150, or 200 ppm. Sperm DNA fragmentation dynamics were evaluated over an 8-wk period after Zn-Met supplementation. The Sperm-Sus-Halomax® Kit (Halosperm SL, Madrid, Spain), a 1:1 mixture of SYBR I (10×; Invitrogen Molecular Probes, Thermo Fisher Scientific, Waltham, MA, USA) in Vectashield Mounting Medium (Vector Laboratories Inc., Burlingame, CA, USA) for DNA staining, and fluorescence microscopy (Nikon Eclipse 80i; Nikon, Tokyo, Japan) were used to analyse DNA fragmentation dynamics; that is, sperm chromatin dispersion (SCD) test, of the boar sperm. Samples were diluted 2:10 (v:v) in either (a) Beltsville Thawing Solution (BTS) extender, or (b) PBS, to determine the effects, if any, of extender. Extended sperm were stored at 15°C for 8 days for daily SCD testing. Data were analysed as a completely randomised design with repeated-measures serially in time (SAS Institute Inc., Cary, NC, USA). Main effects of the variables (i.e. dietary Zn and extender) and their interaction were studied. Means were compared using Tukey´s test, with significance set at the <0.05 α-level. Supplementation of the diet with 200 ppm of Zn-Met had an adverse effect on the integrity of pig sperm DNA from the beginning of supplementation to the last day of the experiment (i.e. fresh ejaculate 0 h = 9.44% fragmented, motility = 79.6%). However, Control and 150 ppm Zn-Met dietary levels did not significantly affect sperm DNA integrity (i.e. fresh ejaculate 0 h = 1.43% and 1.73% fragmented and motility = 84.1% and 84.5%, respectively). With regard to the semen extenders BTS and PBS, there was no difference (P > 0.05) in sperm DNA fragmentation dynamics for the first 3 days in extender: Day 3 = 4.09 and 6.45%, respectively. However, the sperm DNA fragmentation index was different (P < 0.05) between extenders BTS and PBS based on extended sperm for Day 4: 4.28 and 7.28%, respectively, through Day 8 (5.52 and 10.02%). These results demonstrated the importance of providing the correct amount of organic Zn in boar diets and potential impacts on reproduction.

APA, Harvard, Vancouver, ISO, and other styles

28

Viñal, David, Laura Gutierrez, Julia Villamayor, Oliver Higuera, Dario Sanchez Cabrero, and Javier De Castro. "482 COVID-19 in patients with lung cancer receiving immunotherapy. A report from an spanish academic center." Journal for ImmunoTherapy of Cancer 8, Suppl 3 (November 2020): A517—A518. http://dx.doi.org/10.1136/jitc-2020-sitc2020.0482.

Full text

Abstract:

BackgroundCOVID-19, caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was declared pandemic in March 2020. We know that patients with cancer represent a high risk population. Lung cancer have an already damage lung that may affect the evolution and outcomes of these patients.1–3 The aim of this study is to report the characteristics and outcomes of patients with lung cancer receiving immunotherapy and SARS-CoV-2 infection.MethodsWe retrospectively collected sociodemographic and clinical data from patients with lung cancer and COVID-19 diagnosis who were admitted to La Paz University Hospital (Madrid, Spain) from March 1 to May 7, 2020. Survival analysis was performed using the Kaplan-Meier method and log-rank test. Hazard ratios and corresponding 95% confidence intervals were estimated with the use of Cox proportional-hazards regression models.ResultsA total of 29 patients were included. Baseline characteristics are depicted in table 1. Non-small-cell lung cancer (NSCLC) was reported in 93% of the patients and 69% were at advanced stage at the time of COVID-19 diagnosis. Eighty-two percent of the patients were admitted to the hospital and 75% received experimental therapy for COVID-19, including hydroxychloroquine (HCQ) (N=9), HCQ plus azithromycin (N=11) or lopinavir/ritonavir (N=2). A total of 12 patients developed acute distress respiratory syndrome (ADRS) at a median time of 7 days from COVID-19 diagnosis. ADRS was managed with steroids in 75% of the patients. Thirteen (44.8%) deaths were reported, 11 of them were considered to be COVID-19 related. Death occurred at a median time of 8 days. In the univariate analysis, diabetes mellitus, respiratory failure at the time of admission, presence of multilobar infiltrates and SDRA were associated with death.Twenty-two patients were on systemic treatment, of whom 10 patients were receiving immunotherapy alone (N=7) or in combination with chemotherapy (N=3) at the time of COVID-19 diagnosis. No significant association with the development of ADRS (P=0.38) or death (P=0.41) was found between patients on immunotherapy versus other systemic therapies. Overall survival was not reached in the immunotherapy group vs 14 days in patients on other systemic therapies (P=0.25), see figure 1.Abstract 482 Table 1Clinical characteristicsECOG PS, Eastern Cooperative Oncology Group Performance Status; NSCLC, Non-Small-Cell Lung Cancer; SCLC, Small-Cell Lung Cancer; CT, chemotherapy; ICI, immune checkpoint inhibitors; TKI, tyrosine-kinase inhibitorsAbstract 482 Figure 1Overall survival. Overall survival in patients with lung cancer treated with immunotherapy vs other therapiesConclusionsWe found that patients with lung cancer represent an extremely vulnerable population, with a poor prognosis after COVID-19 diagnosis. Treatment with immunotherapy may also be considered a risk factor. Emphasis on prevention and treatment based on evidence-based medicine is crucial in our daily practice.AcknowledgementsThis work has not been supported by public grants or financial support. No sources of funding were used to assist in the preparation of this manuscriptEthics ApprovalThe study was approved by Hospital Universitario La Paz Institution’s Ethics Board, approval number PI-4147ReferencesChen N, Zhou M, Dong X, et al. Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: a descriptive study. Lancet 2020;395(10223):507–513. doi:10.1016/S0140-6736(20)30211-7Giannakoulis VG, Papoutsi E, Siempos II. Effect of Cancer on Clinical Outcomes of Patients With COVID-19: a meta-analysis of patient data. JCO Glob Oncol 2020;6:799–808. doi:10.1200/GO.20.00225Lee LYW, Cazier JB, Starkey T, et al. COVID-19 mortality in patients with cancer on chemotherapy or other anticancer treatments: a prospective cohort study. Lancet 2020;395(10241):1919–1926. doi:10.1016/S0140-6736(20)31173-9

APA, Harvard, Vancouver, ISO, and other styles

29

Trallero-Araguás, E., F. Romero, I. Castellví, V. Ortiz-Santamaria, S. Castañeda, O. Sanchez Pernaute, X. Solanich, et al. "POS0888 EPIDEMIOLOGICAL AND CLINICAL DIFFERENCES BETWEEN ANTI-MDA5 PHENOTYPES: DATA FROM A LARGE COHORT (MEDRA5) STUDY." Annals of the Rheumatic Diseases 80, Suppl 1 (May 19, 2021): 700.1–700. http://dx.doi.org/10.1136/annrheumdis-2021-eular.3837.

Full text

Abstract:

Background:Idiopathic inflammatory myopathies are a heterogenous group of systemic autoimmune diseases. Several phenotypes have been linked to specific autoantibodies. Clinically amyopathic dermatomyositis with rapidly progressive interstitial lung disease, the most severe form of ILD, is associated with the anti-MDA5 antibodies. However not all the patients with dermatomyositis and anti-MDA5 positive antibodies develop this severe condition.Objectives:We aim to define different phenotypes from a large cohort of patients diagnosed with dermatomyositis who were positive to anti-MDA5 antibodies.Methods:We retrospective analyzed the clinical and immunological data of 90 anti-MDA5 patients [50 female, 55.6%, mean (SD) age at diagnosis 47 (15.4) yrs.] with dermatomyositis recruited from a multicenter register in Spain (MEDRA5) including 30 hospitals. All the patients fulfill de International Myositis Classification Criteria (EULAR/ACR) for dermatomyositis (score >90%). Anti-MDA5 were detected by means of commercial immunoblot (EUROIMMUN©). The chi-square test was used to assess the relationships between qualitative variables. The Kruskal-Wallis test was used to compared medians between groups.Results:Sixty-six patients (73.3%) were diagnosed with clinically amyopathic dermatomyositis. Three different phenotypes linked with the anti-MDA5 antibody were identified. Group 1: patients with rapidly-ILD phenotype (28 patients, 31.1%), group 2: antisynthetase-like phenotype (23 patients, 25.5%), and group 3: non-ILD phenotype (39 patients, 43.3%). Clinical and immunological comparison between the groups disclosed that age at disease onset was higher (median, IQR) in patients from group 1 [53 (43-60)] vs. group 2 [46 (40-56)] or group 3 [42(41-51)] (p=0.01); disease onset was more frequent in spring in patients from group 1 (46.5%) than in the rest of the groups (21.7% and 28.9%) (p<0.01). Cancer was detected in 7 patients, only associated with myositis in 3 cases (3 years interval between cancer and dermatomyositis) without significant differences between phenotypes. Vasculitis (one case ANCA positive) was detected in 9 cases (6 limited to skin, 1 renal and 1 intestinal), 6 of them in the group 3 (statistical significance, in comparison with group 1 and 2, p<0.01). Mortality rate was higher in group 1 (51.9%, 16 out of 17 due to refractory respiratory failure) vs group 2 (12.5%) or 3 (0%) (p<0.001). Anti Ro52 positivity was more frequent in group 1 (65.4%) vs. group 2 (25%) or 3 (35.5%) (p<0.017), although it did not reach statistical significance in terms of mortality (p=0.173) or patients admitted in the intensive care unit (p=0.173). Mechanic hands were more frequent in group 2 (40.6%) than in groups 1 (25%) and 3 (34.4%) (p=0.05). Fever was significantly most frequent in group 1(52.6%) than in group 2 (21.1%) and 3 (26.3%) (p=0.001). Other clinical or immunological features such as arthritis, myositis, or the number of characteristic skin lesions among others were not more frequent in one group or another.Conclusion:Three different phenotypes of patients positive to anti-MDA5 were identified. The presence or not of ILD, or the different type (rapidly progressive or not) of ILD were the main feature that allow to differentiate these phenotypes, which are relevant in clinical practice.References:[1]Allenbach Y, Uzunhan Y, Toquet S, et al; French Myositis Network. Different phenotypes in dermatomyositis associated with anti-MDA5 antibody: Study of 121 cases. Neurology. 2020;95: e70-e78.Acknowledgements:List of contributors of MEDRA5 group: Aguilar-García J (Internal Medicine, Hospital Costa del Sol, Marbella), Carrión-Barberá I (Rheumatology, Hospital del Mar, Barcelona), Cobo-Ibañez T (Rheumatology, Hospital Infanta Sofía, San Sebastián de los Reyes), de Escalante-Yangüela B (Internal Medicine, Hospital Clínico Lozano Blesa, Zaragoza), Fonseca-Aizpuru EM (Internal Medicine, Hospital de Cabueñes, Gijón), González-Cubillo L (Intensive Medicine, Hospital Universitario de Cruces, Barakaldo), González-Gay MA (Rheumatology, Hospital Marqués de Valdecilla, Santander), Prieto-González S (Internal Medicine, Hospital Clinic, Barcelona), Ruiz-Román A (Rheumatology, Hospital Universitario Virgen del Rocío, Sevilla), Calero-Paniagua I (Internal Medicine, Hospital Virgen de la Luz, Cuenca), Callejas-Rubio JL (Internal Medicine, Hospital Clínico San Cecilio, Granada), Gil-Vila A (Internal Medicine, Hospital Vall d’Hebron, Barcelona), de Miguel-Campo B (Internal Medicine, Hospital Doce de Octubre, Madrid), García-Sevilla R (Pneumology, Hospital General Universitario de Alicante, Alicante), Iriarte-Fuster A (Internal Medicine, Hospital de Bellvitge, Hospitalet de Llobregat), Jovani-Casano V (Rheumatology, Hospital General Universitario de Alicante, Alicante), Lozano-Rivas N (Rheumatology, Hospital Virgen de la Arritxaca, Murcia), Martín-Gascón M (Internal Medicine, Hospital Morales Meseguer, Murcia), Martinez-González O (Rheumatology, Hospital Universitario de Salamanca, Salamanca), Monteagudo-Jiménez M (Internal Medicine, Hospital Parc Taulí, Sabadell), Mora-Ortega GM (Pneumology, Hospital Universitario Infanta Sofía, San Sebastián de los Reyes), Moral-Moral Pedro (Internal Medicine, Hospital Universitari i Politecnic La Fe, Valencia), Pérez-De Pedro I (Interna Medicine, Hospital Regional Universitario de Málaga, Málaga), Picazo-Talavera MR (Rheumatology, Hospital del Sureste, Madrid), Rubio-Rivas M (Internal Medicine, Hospital de Bellvitge, Hospitalet de Llobregat)Disclosure of Interests:None declared

APA, Harvard, Vancouver, ISO, and other styles

30

Urbano, M., J. Dorado, I. Ortiz, M. J. Galvez, S. Demyda-Peyras, M. Moreno, L. Alcaraz, et al. "84 EFFECT OF A STRESSOR ON CANINE SPERM DNA FRAGMENTATION USING THE SPERM CHROMATIN DISPERSION TEST." Reproduction, Fertility and Development 25, no. 1 (2013): 189. http://dx.doi.org/10.1071/rdv25n1ab84.

Full text

Abstract:

Recently, a new procedure for the analysis of sperm DNA fragmentation has been developed for human and different mammalian species (Sperm-Halomax®), based on the sperm chromatin dispersion test (SCDt); however, no studies has been performed specifically on canine frozen–thawed-stressed semen but is there for cooled semen. The aim of this work was to assess the effect of a stressor (24 h in an oven at 38°C) on canine frozen–thawed semen using the SCDt to resemble what happens in the female reproductive tract. For this purpose, ejaculates were collected by digital manipulation from 4 healthy beagle dogs and the sperm-rich fraction of the ejaculates from 3 different dogs was pooled each time. All the pooled semen samples (n = 4) used presented physiological values concerning to routine semen parameters (motility, morphology, and sperm concentration). After evaluation, semen samples were centrifuged and the sperm pellet resuspended to a final concentration of 100 × 106 sperm mL–1 in 2 steps with CaniPRO Freeze (Minitub, Tiefenbach, Germany). Sperm were slowly cooled to 5°C and then loaded into 0.5-mL plastic straws. After that, straws were frozen in liquid-nitrogen vapours for 10 min and stored into a nitrogen tank. Straws were thawed in a water bath (30 s/37°C) and incubated for 24 hours at 38°C before analysis. The sperm DNA fragmentation was assessed in fresh semen and frozen–thawed-stressed samples using the Sperm-Halomax® commercial kit specifically developed for canine semen (Halotech DNA SL, Madrid, Spain) following the manufacturer’s instructions. Slides were stained for green fluorescence staining and 500 sperm per slide were counted using fluorescence microscopy. The sperm DNA fragmentation index (%) was compared between fresh and frozen–thawed-stressed semen samples by ANOVA. Results were expressed as mean ± standard error of the mean. The results obtained showed that subjecting thawed semen to 24 h in an oven at 38°C significantly increased (P < 0.05) DNA fragmentation compared with fresh semen (2.7% ± 0.2 v. 1.4 ± 0.1%). The stress factor was performed to simulate the viability of canine thawed sperm (12–24 h) when a bitch is inseminated with frozen semen. It would be interesting to perform further studies to relate sperm DNA fragmentation and fertility of frozen–thawed canine semen. In conclusion, frozen–thawed-stressed semen samples increased the sperm DNA fragmentation index measured using a SCDt. Further studies are needed to relate sperm DNA fragmentation with fertility rates or cryopreservation success.

APA, Harvard, Vancouver, ISO, and other styles

31

Illera, J. C., L. Martinez-Fernandez, L. Camacho, M. J. Illera, and G. Silvan. "314 FECAL STEROID HORMONES IN 3 × TG-AD AND WILD-TYPE MICE AND THEIR RELATION WITH FERTILITY." Reproduction, Fertility and Development 22, no. 1 (2010): 313. http://dx.doi.org/10.1071/rdv22n1ab314.

Full text

Abstract:

Extracellular deposition of amyloid peptides in plaques and neurofibrillary tangles are 2 characteristic pathological features of Alzheimer’s disease (AD). These models show the neuropathological symptoms and the hormonal changes. It has been observed that the pathology appears with age and gets worse progressively. Several studies have proved the neuroprotective action of the androgens and estrogens related to age. The aim of this study was reveal if aging in 3 × TG-AD transgenic mice produces a change in the androgen and estrogen levels, compared with the wild type (WT), and if these changes could influence fertility. In this experiment, we have used male and female WT (n = 40) and 3 × TG-AD transgenic (n = 40) mice for gene PS1 (involved in the acceleration of the amyloid plaque formation), tau (involved in neurodegeneration), and APP (involved in the extracellular accumulation of fi-amyloid protein). We have studied mice of different ages: 3, 4, 7, and 8 months old. Fecal samples were collected 5 days every week (between 0900-1000 h). The technique used for the hormone quantification was ELISA. Results were calculated in ngg-1 of feces. The statistical analysis was done with the Origin 8 program (Software Cientifico, Castellana, Madrid, Spain), through a 1-way ANOVA. Results were represented with the mean ± standard error (P < 0.05 values were considered statistically significant). The pregnancy rate in transgenic mice before 4 months old was 0%, whereas in WT mice, the fertility rate was 82%. At 8 months, the pregnancy rate in transgenic mice was 65% and in WT 88%. In males, although androstenedione (A4) concentrations were not significant through age, testosterone levels increased significantly in transgenic mice, but not in WT mice. Estrogens presented the biggest differences between groups. The 3-month-old transgenic mice showed significantly higher values, and this elevation of the estrogens could be the cause of infertility in transgenic mice. At 8 months, the values decreased significantly in WT mice, whereas in transgenic mice, the concentrations were higher, and this could be the reason for the differences in the fertility rate. In females, A4 concentrations were higher in WT mice, showing a significant increase with age in both groups. Testosterone concentrations were significantly higher with age in transgenic mice. These mice showed the higher estrogen concentrations, showing a decrease with age in both groups that was significant in transgenic mice. Increase of testosterone in 3-month-old transgenic mice could be the reason for the infertility in the females. In conclusion, the fecal analysis is a noninvasive method, appropriate for androgen and estrogen determination in the different types of mice. There are several differences in the androgen and estrogen levels between the 2 groups of studied mice; the levels are generally more elevated in transgenic mice. Gene modification in 3 × TG-AD transgenic mice could cause a delay in the onset of puberty.

APA, Harvard, Vancouver, ISO, and other styles

32

Aramburu, M. P., and R. Escribano. "Golf: A conflicting recreational activity in the Madrid autonomous area (Spain)." Landscape and Urban Planning 23, no. 3-4 (June 1993): 209–20. http://dx.doi.org/10.1016/0169-2046(93)90069-p.

Full text

APA, Harvard, Vancouver, ISO, and other styles

33

GUIL, NOEMÍ, and ROBERTO GUIDETTI. "A new species of Tardigrada (Eutardigrada: Macrobiotidae) from Iberian Peninsula and Canary Islands (Spain)." Zootaxa 889, no. 1 (March 7, 2005): 1. http://dx.doi.org/10.11646/zootaxa.889.1.1.

Full text

Abstract:

Minibiotus gumersindoi n. sp. is described. This species was collected on a granite mountain range in Sierra de Guadarrama (Bustarviejo valley, Embalse de la Jarosa and Cercedilla, Madrid, Spain) and on a volcanic island in Parque Natural Caldera de Taburiente (La Palma, Canary Islands, Spain). This new species is characterized by a unique set of characters in the genus: the presence of large round pores in the body and a larger round pore at the distal part of each leg. New records of several known species, for Madrid, Canary Islands and/or the Iberian Peninsula are given.

APA, Harvard, Vancouver, ISO, and other styles

34

Lopez-Morinigo, Javier-David, Maura Boldrini, Valdo Ricca, Maria A. Oquendo, and Enrique Baca-García. "Aggression, Impulsivity and Suicidal Behavior in Depressive Disorders: A Comparison Study between New York City (US), Madrid (Spain) and Florence (Italy)." Journal of Clinical Medicine 10, no. 14 (July 9, 2021): 3057. http://dx.doi.org/10.3390/jcm10143057.

Full text

Abstract:

The association of aggression and impulsivity with suicidal behavior (SB) in depression may vary across countries. This study aimed (i) to compare aggression and impulsivity levels, measured with the Brown-Goodwin Scale (BGS) and the Barratt Impulsivity Scale (BIS), respectively, between New York City (NYC) (US), Madrid (Spain) and Florence (Italy) (ANOVA); and (ii) to investigate between-site differences in the association of aggression and impulsivity with previous SB (binary logistic regression). Aggression scores were higher in NYC, followed by Florence and Madrid. Impulsivity levels were higher in Florence than in Madrid or NYC. Aggression and impulsivity scores were higher in suicide attempters than in non-attempters in NYC and in Madrid. SB was associated with aggression in NYC (OR 1.12, 95% CI 1.07–1.16; p < 0.001) and in Florence (OR 1.11, 95% CI 1.01–1.22; p = 0.032). Impulsivity was linked with SB in NYC (OR 1.01, 95% CI 1.00–1.02; p < 0.001) and in Madrid (OR 1.03, 95% CI 1.02–1.05; p < 0.001). The higher suicide rates in NYC, compared to Madrid or Florence, may be, in part, explained by these cross-cultural differences in the contribution of aggression-impulsivity to SB, which should be considered by future research on SB prevention.

APA, Harvard, Vancouver, ISO, and other styles

35

Carrasco, Víctor M. S., Enric Aragonès, Jorge Ordaz, and José M. Vaquero. "The Great Aurora of January 1770 observed in Spain." History of Geo- and Space Sciences 9, no. 2 (October 12, 2018): 133–39. http://dx.doi.org/10.5194/hgss-9-133-2018.

Full text

Abstract:

Abstract. An analysis is made of the records made by Spanish observers of a notable aurora on 18 January 1770 in order to study the characteristics of this event. The records indicate that the phenomenon was observed in both continental and insular territories of Spain, in particular at San Cristóbal de la Laguna, Cádiz, Córdoba, Badajoz, Valencia, Castellón, Madrid, Barcelona, and Gerri de la Sal. The most equatorward observational site was San Cristóbal de la Laguna (28.48∘ N, 16.32∘ W) in the Canary Islands. In general, the descriptions put its duration from sunset to midnight, but the observers from Córdoba and Madrid report the aurora as being visible during the last hours of the night, and it was even observed the following day at Castellón. All the observers described the aurora as red in colour, while white and ash colours were also reported at Córdoba and Gerri de la Sal. The brightness and shape of auroral display changed over time. Calculations of the geomagnetic latitudes of the observation locations gave San Cristóbal de la Laguna as the southernmost (26∘ N) and Gerri de la Sal the northernmost (35∘ N) and indicate this aurora was observed over a wide range of abnormally low latitudes for such a phenomenon. Solar activity around the event was high, with the astronomer Horrebow registering 10 sunspot groups on that date (18 January 1770).

APA, Harvard, Vancouver, ISO, and other styles

36

Enghoff, Henrik, and Jean-Paul Mauriès. "The genus Acipes in Spain, with the description of a new cavernicolous species (Diplopoda, Julida, Blaniulidae)." Insect Systematics & Evolution 30, no. 1 (1999): 31–33. http://dx.doi.org/10.1163/187631200x00183.

Full text

APA, Harvard, Vancouver, ISO, and other styles

37

Rodríguez-Avial, Iciar, Belén Ramos, Esther Ríos, Emilia Cercenado, María Ordobás, and Juan Carlos Sanz. "Clonal Spread of Levofloxacin-Resistant Streptococcus pneumoniae Invasive Isolates in Madrid, Spain, 2007 to 2009." Antimicrobial Agents and Chemotherapy 55, no. 5 (March 7, 2011): 2469–71. http://dx.doi.org/10.1128/aac.01380-10.

Full text

Abstract:

ABSTRACTAmong 1,349Streptococcus pneumoniaeinvasive isolates, 45 (3.3%) were levofloxacin resistant. Serotype distribution was as follows: 8 (n= 32 isolates), 19A (n= 4 isolates), 7F (n= 3 isolates), 9V (n= 2 isolates), 10A (n= 1 isolate), 19F (n= 1 isolate), 6B (n= 1 isolate), and nontypeable (n= 1 isolate). Levofloxacin-resistant isolates had dual mutations in thegyrAandparCgenes. Serotype 8 strains corresponded to a capsular switching of the Sweden15A-25 clone. Levofloxacin resistance was also detected among multiresistant (ST27619A, Spain9V-ST156, ST8819F, and ST15426B) and among usually antibiotic-susceptible (Netherlands7F-ST191, ST120119A, and ST263910A) clones.

APA, Harvard, Vancouver, ISO, and other styles

38

Hernando, David, and Manuel G. Romana. "Estimating the rainfall erosivity factor from monthly precipitation data in the Madrid Region (Spain)." Journal of Hydrology and Hydromechanics 63, no. 1 (March 1, 2015): 55–62. http://dx.doi.org/10.1515/johh-2015-0003.

Full text

Abstract:

Abstract The need for continuous recording rain gauges makes it difficult to determine the rainfall erosivity factor (Rfactor) of the Universal Soil Loss Equation in regions without good spatial and temporal data coverage. In particular, the R-factor is only known at 16 rain gauge stations in the Madrid Region (Spain). The objectives of this study were to identify a readily available estimate of the R-factor for the Madrid Region and to evaluate the effect of rainfall record length on estimate precision and accuracy. Five estimators based on monthly precipitation were considered: total annual rainfall (P), Fournier index (F), modified Fournier index (MFI), precipitation concentration index (PCI) and a regression equation provided by the Spanish Nature Conservation Institute (RICONA). Regression results from 8 calibration stations showed that MFI was the best estimator in terms of coefficient of determination and root mean squared error, closely followed by P. Analysis of the effect of record length indicated that little improvement was obtained for MFI and P over 5- year intervals. Finally, validation in 8 additional stations supported that the equation R = 1.05·MFI computed for a record length of 5 years provided a simple, precise and accurate estimate of the R-factor in the Madrid Region.

APA, Harvard, Vancouver, ISO, and other styles

39

ARBEA, JAVIER I., and RAFAEL JORDANA. "The genus Folsomides Stach of the Ibero-balearic fauna, with description of a new species (Collembola, Isotomidae)." Zootaxa 55, no. 1 (July 25, 2002): 1. http://dx.doi.org/10.11646/zootaxa.55.1.1.

Full text

Abstract:

The genus Folsomides Stach, 1922 is represented by nine species in the Ibero-balearic fauna, one of which is new to the science. Folsomides mediterraneus n. sp. is found in Northern Spain (Navarra and Zaragoza) and Central Spain (Madrid). The new species is related to the Folsomides angularis (Axelson, 1905) group and it is easily distinguishable from other species by the chaetotaxy of microsensilla. A key for the identification of Ibero-balearic species of Folsomides is given.

APA, Harvard, Vancouver, ISO, and other styles

40

Gravina, Leyre, Amets Jauregi, Irrintzi Fernández-Aedo, Julia Díez, Joel Gittelsohn, Uriyoan Colón-Ramos, and Manuel Franco. "Residents’ Insights on Their Local Food Environment and Dietary Behaviors: A Cross-City Comparison Using Photovoice in Spain." International Journal of Environmental Research and Public Health 18, no. 19 (September 27, 2021): 10134. http://dx.doi.org/10.3390/ijerph181910134.

Full text

Abstract:

Perceptions of local food environments and the ability of citizens to engage in participatory research may vary, even if participants share similar cultural and socioeconomic contexts. In this study, we aimed to describe participants’ narratives about their local food environment in two cities in Spain. We used the participatory methodology of Photovoice to engage participants in Madrid (n = 24) and Bilbao (n = 17) who took and discussed photographs about their local food environment (Madrid; n = 163 and Bilbao; n = 70). Common themes emerged across both cities (food insecurity, poverty, use of public spaces for eating and social gathering, cultural diversity and overconsumption of unhealthy foods); however, in Bilbao citizens perceived that there was sufficient availability of healthy foods despite that living in impoverished communities. Photovoice was a useful tool to engage participating citizens to improve their local food environments in both cities. This new approach allowed for a photovoice cross-city comparison that could be useful to fully understand the complexity and diversity of residents’ perceptions regardless of their place of residence.

APA, Harvard, Vancouver, ISO, and other styles

41

González, Rocío, Luisa Barea, Ana Arruga, Alberto Richart, and Vicente Soriano. "Overt and occult hepatitis B among immigrants and native blood donors in Madrid, Spain." Therapeutic Advances in Infectious Disease 7 (January 2020): 204993612098212. http://dx.doi.org/10.1177/2049936120982122.

Full text

Abstract:

Background: The risk of transfusion-transmitted viral infections is very low in developed countries. Recent massive migration flows from highly hepatitis B virus (HBV), hepatitis C virus (HCV) and/or HIV endemic regions to Europe may have changed this scenario. Methods: During 2017 and 2018, a total of 491,753 blood donations (291,762 donors) were evaluated at the Madrid Regional Transfusion Center. All were tested for hepatitis B surface antigen (HBsAg), anti-HCV and anti-HIV, as well as for HBV-DNA, HCV-RNA and HIV-RNA. Results: Overall, 35 donors were positive for HIV-RNA and 26 for HCV-RNA. HBV markers were found in 111 (0.022%) donors, split out into three categories: HBsAg+ ( n = 93; 0.019%), occult B infection (OBI) ( n = 17; 0.003%), and acute HBV window period ( n = 1; 0.0002%). All 17 OBI donors were positive for anti-HBc and confirmed as viremic in repeated testing. Viral load amounts were uniformly below 100 IU/mL. Ten OBI donors were repeated donors and look-back studies could be completed for eight of them. Fortunately, none of all prior recipients experienced transfusion transmitted hepatitis B. Compared with HBsAg+ donors, OBI donors were more frequently native Spaniards (76% versus 40%) and older (median age 52 versus 42 years old). Conclusion: Active HBV infection is currently found in 0.022% of blood donations (0.038% of donors) in Madrid. This rate is 3-fold greater than for HIV and/or HCV. On the other hand, HBsAg+ donors are 3-fold more frequent than OBI donors and more often immigrants than native Spaniards. No transfusion-transmitted HBV infections were identified during the study period, including retrospective checking of former recipients of OBI donors.

APA, Harvard, Vancouver, ISO, and other styles

42

Ruud, Lise Camilla. "‘There is not one single thing that resembles this one.’ Writing human monsters in late eighteenth-century Spain." Nordic Journal of Science and Technology Studies 2, no. 1 (December 1, 2016): 62. http://dx.doi.org/10.5324/njsts.v2i1.2138.

Full text

Abstract:

<div>The article discusses how a malformed set of twins turned into a museum object at the late eighteenth-century el Real Gabinete de Historia Natural in Madrid. Foregrounding the practices through which the twins transformed, it is made clear how museum objects result from de-centered processes. Two different enactments are discussed. The first encompasses the process by which the malformed set of twins transformed into a specimen of interest to the learned. The second enactment addresses how the twins were transported to Madrid through practices of charity. These two versions differed radically, yet they were intimately intertwined, and dependent upon one another.<div> </div></div>

APA, Harvard, Vancouver, ISO, and other styles

43

Cruz Maceín, José Luis, Maite Iriondo DeHond, and Eugenio Miguel. "Cheese consumption culture in Central Spain (Madrid Region): drivers and consumer profile." British Food Journal 122, no. 2 (December 6, 2019): 561–73. http://dx.doi.org/10.1108/bfj-08-2019-0578.

Full text

Abstract:

Purpose The artisanal cheese industry in the Community of Madrid (CM) in Spain has recently experienced an increased development despite its traditionally limited cheese and milk production. The purpose of this paper is to explain this phenomenon by identifying the determinants of consumer attitudes towards cheese consumption in relation to the offer provided by recent artisan cheese producers. Design/methodology/approach A phone survey (n = 1,111 consumers) consisting of 17 questions was carried out to analyse cheese consumption culture in the CM. Principal component analysis was used to identify the factors that determine cheese-purchasing variance. Findings The first component was explained by hedonic (38 per cent of variance), followed by health aspects (24 per cent of variance) and price (15 per cent of variance). Price was identified as the most important criterion when purchasing cheese (67 per cent of consumers), followed by fat (57 per cent) and salt content (56 per cent). Results indicate a low cheese consumption culture in Madrid, as 48 per cent of consumers did not know exactly what kind of cheese they normally consumed. The type of milk used in cheese production was used to identify consumer profiles for market segmentation. Sheep and goat cheese consumers valued local production food quality and may be the driving force behind the expansion of artisanal cheese industry in Madrid. Research limitations/implications Madrid Region is one of the most important markets in Spain and Europe; however, local cheeses are not a traditional product in the market. Practical implications This paper offers a very interesting approach about how consumers’ culture can support a new local agricultural industry. Social implications Rural entrepreneurs can innovate focussing on new consumers demands. Local and handcrafted products are an opportunity in rural and periurban areas. Originality/value This paper shows consumer preferences and attitudes towards the novel artisan cheese sector that has expanded in the CM.

APA, Harvard, Vancouver, ISO, and other styles

44

MEDEROS, JORGE, DANIEL MARTÍN-VEGA, and ARTURO BAZ. "When unexpected guests come to eat: two new species of Phyllolabis Osten Sacken (Diptera: Limoniidae) collected with carrion-baited traps in the centre of the Iberian Peninsula." Zootaxa 5039, no. 2 (September 15, 2021): 222–40. http://dx.doi.org/10.11646/zootaxa.5039.2.4.

Full text

Abstract:

Phyllolabis eiroae sp. nov. and P. martinhalli sp. nov. are described from the centre of the Iberian Peninsula. These two remarkable species were collected using carrion-baited traps, running during winter, in several localities of Madrid province (Spain). The two new species are well differentiated from the other Phyllolabis Osten Sacken species recorded from the Iberian Peninsula, P. savtshenkoi Theowald, and those from the west Palaearctic. An identification key to differentiate the three Phyllolabis species occurring in the Iberian Peninsula is provided. The first images of P. savtshenkoi, based on the holotype and a male specimen recorded from a cave located in Jaén (Spain), are also provided.

APA, Harvard, Vancouver, ISO, and other styles

45

JORDANA, RAFAEL, and ENRIQUE BAQUERO. "Two new species of Entomobrya (Collembola, Entomobryomorpha) from the cave collembolan collection of Bonet from Asturias and Cantabria (north of Spain)." Zootaxa 1153, no. 1 (March 17, 2006): 17. http://dx.doi.org/10.11646/zootaxa.1153.1.2.

Full text

Abstract:

Two new species of Entomobrya are described from two caves of Asturias and Cantabria (north of Spain). The specimens were found in the Bonet collembolan collection at the “Museo Nacional de Ciencias Naturales” of Madrid (Spain). Entomomobrya boneti n. sp. was found in three slides containing 11, 4 and 1 specimens respectively, from the “Cueva del Castillo”, Puente el Viesgo (Santander). Entomobrya luquei n. sp. was found in a slide with 11 specimens from “Cueva de Cuetu-Lledías”, Llanes (Asturias). The species are described considering a set of 39 morphological and chaetotaxy characters. Both species appear to be troglophiles by the pigment reduction, although there are no other troglomorphic characters present. The gut content is composed of organic matter and fungus spores.

APA, Harvard, Vancouver, ISO, and other styles

46

Ramil, E., AJ Sánchez, P. González-Pérez, A. Rodríguez-Antigüedad, N. Gómez-Lozano, P. Ortiz, R. Arroyo, V. De las Heras, C. Vilches, and A. García-Merino. "The cannabinoid receptor 1 gene (CNR1) and multiple sclerosis: an association study in two case-control groups from Spain." Multiple Sclerosis Journal 16, no. 2 (December 9, 2009): 139–46. http://dx.doi.org/10.1177/1352458509355071.

Full text

Abstract:

Different studies point to the implication of the endocannabinoid system in multiple sclerosis (MS) and animal models of MS. The purpose of this study was to evaluate a possible association of MS with polymorphic markers at the CNR1 gene, encoding the cannabinoid 1 (CB1) receptor. We have performed a genetic analysis of an AAT repeat microsatellite localized in the downstream region of the CNR1 gene, in two case—control groups of MS patients and healthy controls (HC) from Spain (Madrid and Bilbao). MS patients with primary progressive MS (PPMS) had more commonly long ((AAT) ≥13) alleles and genotypes with a significant difference for genotype 7/8 in Madrid (p = 0.043) and in the sum of both groups (p = 0.016); short alleles were less frequently found in PPMS with a significant difference for allele 5 in the analysis of both groups together (p = 0.039). In patients with relapsing MS, no consistent differences in allele and genotype distribution were found. Disease severity and progression was unrelated to AAT repeat variations. In conclusion, long (AAT) ≥13 CNR1 genotypes could behave as risk factors for PPMS.

APA, Harvard, Vancouver, ISO, and other styles

47

Bermejo, Jesús. "Roman peasant habitats and settlement in central Spain (1st c. B.C.–4th c. A.D.)." Journal of Roman Archaeology 30 (2017): 351–71. http://dx.doi.org/10.1017/s1047759400074158.

Full text

Abstract:

The area under study comprises the Autonomous Community of Madrid, a highly urbanized modern region which coincides grosso modo with the N part of what used to be Carpetania. During the Early and Later Empire, it fell within the province of Hispania Citerior Tarraconensis, embracing the N part of the conventus Carthaginensis and the SW part of the conventus Caesaraugustanus. From the early days of municipalisation of the Hispanic provinces rural sites in this region belonged to the ager of three Latin municipia: Complutum, Titulcia, and Mantua Carpetanorum (fig. 1). While it is difficult to identify the precise limits of their agri, it seems probable that Complutum, as the most important urban centre in the region, would have had the largest territorium.

APA, Harvard, Vancouver, ISO, and other styles

48

Cuesta-Lozano, Daniel, Leticia Carmen Simón-López, Rubén Mirón-González, Montserrat García-Sastre, Daniel Bonito-Samino, and Ángel L. Asenjo-Esteve. "Prevalence Rates of Loneliness and Its Impact on Lifestyle in the Healthy Population of Madrid, Spain." International Journal of Environmental Research and Public Health 17, no. 14 (July 15, 2020): 5121. http://dx.doi.org/10.3390/ijerph17145121.

Full text

Abstract:

Background: The Spanish population presents higher levels of loneliness than citizens of countries in Northern Europe. Numerous studies have linked loneliness to increased morbidity and mortality, but very few studies have associated loneliness with healthy lifestyles. The objectives of this research are to identify the feeling of unwanted loneliness in various age and gender groups in the city of Alcalá de Henares (Madrid, Spain), to determine lifestyle habits in the areas of diet and physical exercise, and to examine the association between lifestyle habits and perceived loneliness. Methods: A cross-sectional, observational and analytical study on the perception of loneliness among men (59.06%) and women (60.06%) in a sample (n = 611) of the general population (N = 198,945), by means of random assignment of a health survey, was conducted. The data were collected using an ad hoc questionnaire. The data were stratified and analyzed with the IBM SSPS® v.25 software package. Results: The frequency of loneliness is stratified by sex and age, and healthy lifestyle habits in terms of diet and physical exercise are analyzed. Conclusions: People with perceived loneliness do not have worse lifestyle habits. However, women living with other people have a higher perception of loneliness than those living alone. Specifically, the perception of loneliness in young adult women could suggest a low level of moderate physical exercise.

APA, Harvard, Vancouver, ISO, and other styles

49

Slade, Carole. "From Madrid to Purgatory: The Art and Craft of Dying in Sixteenth-Century Spain. Carlos M. N. Eire." Journal of Religion 77, no. 3 (July 1997): 466–68. http://dx.doi.org/10.1086/490033.

Full text

APA, Harvard, Vancouver, ISO, and other styles

50

Montero, M. Del Pilar, Ana Isabel Mora-Urda, Karim Anzid, Mohamed Cherkaoui, and M. Dolores Marrodan. "DIET QUALITY OF MOROCCAN ADOLESCENTS LIVING IN MOROCCO AND IN SPAIN." Journal of Biosocial Science 49, no. 2 (May 12, 2016): 173–86. http://dx.doi.org/10.1017/s0021932016000183.

Full text

Abstract:

SummaryIntra-population socioeconomic changes and migration are powerful factors in changing eating habits. Changes in eating habits could affect the nutritional status, growth, development and health of adolescents. The aim of this study was to compare the diet of adolescents of Moroccan origin living in Spain with that of adolescents living in Morocco. The sample comprised 428 Moroccan adolescents aged from 12 to 19 recruited in high schools: 327 living in Ouarzazate (Morocco) and 101 living in Madrid (Spain). The variables studied were energy intake (kcal/day), diet quality indicators (adherence to the Mediterranean Adequacy Index (MAI); cholesterol intake (mg/day); fibre intake (g/day) and energy profile)); and indicators of keeping traditional customs (halalmeat consumption, bread made at home). Teenagers from Morocco living in Madrid consumed more calories, proteins, saturated fats and simple sugars (p<0.001) than those living in Morocco. Their diet was of lower quality than that of their peers in Morocco. This difference was more marked in boys than in girls. Changes in eating habits associated with migration from the south to the north Mediterranean basin can benefit young migrants in an immediate way (through greater availability of energy and nutrients), but later in life it could have negative consequences for their health, increasing the risk of overweight, obesity and cardiovascular and metabolic problems.

APA, Harvard, Vancouver, ISO, and other styles

Journal articles on the topic 'P.A.N. (Madrid, Spain)'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles