Log in

Relevant bibliographies by topics / PCR detekce / Journal articles

To see the other types of publications on this topic, follow the link: PCR detekce.

Journal articles on the topic 'PCR detekce'

Author: Grafiati

Published: 4 June 2021

Last updated: 3 February 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic 'PCR detekce.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Lee, Si Won, Yong-Gil Shin, Jin-Young Lee, Young-Suk Kim, Mi Hee Yang, and In-Cheol Choi. "Development of a diagnostic system to detect potato virus T using RT-PCR and nested PCR." CNU Journal of Agricultural Science 42, no. 2 (June 30, 2015): 99–103. http://dx.doi.org/10.7744/cnujas.2015.42.2.099.

Full text

APA, Harvard, Vancouver, ISO, and other styles

2

Li, Xiaoying, Lu Fu, Changlong Chen, Wangwang Sun, Yu Tian, and Hua Xie. "Characteristics and Rapid Diagnosis of Pectobacterium carotovorum ssp. Associated With Bacterial Soft Rot of Vegetables in China." Plant Disease 104, no. 4 (April 2020): 1158–66. http://dx.doi.org/10.1094/pdis-05-19-1033-re.

Full text

Abstract:

Pectobacterium carotovorum, a causal agent of vegetable soft rot, contains three valid subspecies: P. carotovorum subsp. carotovorum (Pcc), P. carotovorum subsp. brasiliensis (Pcb), and P. carotovorum subsp. odoriferum (Pco). Using 16S rDNA sequencing and genus-specific PCR, we identified 72 P. carotovorum strains from Chinese cabbage, bok choy, and celery and assessed their pathogenicity on Chinese cabbage petioles and potato tubers. Based on phylogenetic analysis of pmrA sequences and confirmation by subspecies-specific PCR, the strains were divided into 18 Pcc, 29 Pco, and 25 Pcb. Several characteristic features were also assessed and supported the distinctiveness of the Pco strains. All P. carotovorum strains caused soft rot symptoms on Chinese cabbage and potato, but the Pco strains exhibited the greatest severity. We developed a conventional PCR and a quantitative PCR (qPCR) assay for the identification of Pco based on its specific srlE gene encoding sorbitol-specific phosphotransferase. These two methods could specifically amplify the expected products of 674 and 108 bp, respectively, from all of the Pco strains. The assays demonstrated high sensitivity and could detect as little as 1 and 100 pg/µl of bacterial genomic DNA, respectively. Both assays could also detect the pathogens directly from plant tissues infected with as little as 2.5 × 10−2 CFU/mg of Pco, even before external symptoms appeared. These assays constitute effective tools for disease diagnosis and the rapid identification of soft rot pathogens.

APA, Harvard, Vancouver, ISO, and other styles

3

Wąsowicz, Barbara, and Marianna Soroka. "Technika LAMP jako potencjalne narzędzie w analizach kryminalistycznych." Kosmos 67, no. 3 (October 24, 2018): 565–73. http://dx.doi.org/10.36921/kos.2018_2442.

Full text

Abstract:

Amplifikacja w warunkach izotermicznych (technika LAMP) jest idealną odpowiedzią na rosnące zapotrzebowanie ze strony laboratoriów molekularnych, diagnostycznych, a także kryminalistycznych. Technika LAMP jest atrakcyjną alternatywą dla klasycznej reakcji PCR, a jej użycie pozwala na skrócenie czasu analizy nawet trzykrotnie. Polimerazy wykorzystywane do tego typu amplifikacji mają zdolność wypierania nici DNA, co eliminuje konieczność denaturacji matrycy. Dzięki użyciu kilku par starterów w reakcji LAMP, przeprowadzona amplifikacja jest bardziej specyficzna, a także w porównaniu do reakcji PCR pozwala na otrzymanie większej ilości produktu i jego detekcję bez użycia dodatkowychprocedur i sprzętu. Technika LAMP zyskuje znaczenie w takich dziedzinach jak: przestępstwa gospodarcze, diagnostyka ludzkich i zwierzęcych chorób zakaźnych, detekcja patogenów roślinnych o szerokim znaczeniu gospodarczym czy identyfikacja roślin GMO.

APA, Harvard, Vancouver, ISO, and other styles

4

Savva, D., and R. E. Holliman. "PCR to detect toxoplasma." Lancet 336, no. 8726 (November 1990): 1325. http://dx.doi.org/10.1016/0140-6736(90)93013-f.

Full text

APA, Harvard, Vancouver, ISO, and other styles

5

Sumíková, T., and A. Hanzalová. "Multiplex PCR assay to detect rust resistance genes Lr26 and Lr37 in wheat." Czech Journal of Genetics and Plant Breeding 46, No. 2 (June 29, 2010): 85–89. http://dx.doi.org/10.17221/32/2010-cjgpb.

Full text

Abstract:

Multiplex PCR was developed and optimized for simultaneous detection of wheat leaf rust resistance genes Lr26 and Lr37. The presence of the genes was analyzed in 21 winter wheat cultivars registered in the Czech Republic. Gene Lr37 was detected in four tested cultivars (Bakfis, Biscay, Nicol, Mulan), gene Lr26 occurred only in one cultivar (Etela) and three cultivars (Clarus, Orlando and Rapsodia) were found to carry both these genes. Data obtained by PCR markers were compared with results of greenhouse and field tests. Seedling reactions of cultivars possessing Lr26 to seven different leaf rust isolates conformed to the results obtained by the marker analysis, however, there were found some discrepancies in the detections of Lr37, which could be detected in greenhouse seedling tests only with difficulties.

APA, Harvard, Vancouver, ISO, and other styles

6

Pulogu, Siska Irhamnawati, Kikin Hamzah Mutaqin, and Giyanto Giyanto. "Cara Preservasi Fitoplasma dari Jaringan Kacang Tanah Bergejala Sapu untuk Deteksi DNA dengan Teknik PCR." Jurnal Fitopatologi Indonesia 13, no. 2 (March 30, 2017): 43–50. http://dx.doi.org/10.14692/jfi.13.2.43.

Full text

APA, Harvard, Vancouver, ISO, and other styles

7

Yuliantini, Anne. "DETEKSI TESPONG (Oenanthe javanica) PADA BAHAN BAKU DAUN ASHITABA (Angelica keiskei) MENGGUNAKAN METODE FTIR YANG DIKOMBINASIKAN DENGAN PCA." INDONESIA NATURAL RESEARCH PHARMACEUTICAL JOURNAL 5, no. 2 (October 30, 2020): 114–23. http://dx.doi.org/10.52447/inspj.v5i2.4230.

Full text

Abstract:

Ashitaba (Angelica keiskei) merupakan salah satu tanaman yang digunakan sebagai bahan baku obat tradisional dan tespong (Oenanthe javanica) diketahui sebagai tanaman yang satu famili dengan ashitaba. Karena ketersediaan ashitaba yang sedikit ditambah dengan harganya yang relative mahal, dapat menjadi alasan ditambahkannya bahan lain dalam bahan baku ashitaba. Tujuan dari penelitian ini adalah untuk mengidentifikasi adanya tespong pada serbuk daun ashitaba menggunakan metode FTIR yang dikombinasikan dengan PCA. Penelitian ini terdiri dari 4 tahapan utama, yaitu determinasi tanaman, maserasi dengan etanol, pengukuran spectrum IR, dan analisis PCA. Hasil analisis PCA menunjukkan nilai PC1 dan PC2 berturut-turut sebesar 71 dan 22% dengan nilai eigen value lebih dari 1 dan plot PCA menggambarkan keterpisahan daerah antara ashitaba dan tespong. Dari ketiga sampel yang diproyeksikan terhadap plot PCA, terdapat sampel yang diduga mengandung tespong dan bahan campuran lain. Dari hasil penelitian ini disimpulkan bahwa metode FTIR yang dikombinasikan dengan PCA dapat menjadi metode alternative dalam mendeteksi tespong dalam bahan baku ashitaba.Kata kunci: Ashitaba; FTIR; PCA; tespong

APA, Harvard, Vancouver, ISO, and other styles

8

Jolobe, O. M. "PCR to detect M tuberculosis." Journal of Clinical Pathology 52, no. 5 (May 1, 1999): 399. http://dx.doi.org/10.1136/jcp.52.5.399.

Full text

APA, Harvard, Vancouver, ISO, and other styles

9

&NA;. "PCR can detect poor debrisoquine metabolism." Inpharma Weekly &NA;, no. 754 (September 1990): 16. http://dx.doi.org/10.2165/00128413-199007540-00041.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

Kontanis, Elias J., and Floyd A. Reed. "Evaluation of Real-Time PCR Amplification Efficiencies to Detect PCR Inhibitors." Journal of Forensic Sciences 51, no. 4 (July 2006): 795–804. http://dx.doi.org/10.1111/j.1556-4029.2006.00182.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

11

Bryxiová, M., and V. Kůdela. "Detection of bacterial wilt pathogen of lucerne by PCR." Plant Protection Science 38, SI 2 - 6th Conf EFPP 2002 (December 31, 2017): 294–96. http://dx.doi.org/10.17221/10472-pps.

Full text

Abstract:

A polymerase chain reaction (PCR) based assay was compared with assay involving traditional microbiological tests to detect and identify Clavibacter michiganensis subsp. insidiosus (Cmi) inside plant tissues following artificial inoculations. Primers for Cmi detection were selected from the Cmi insertion sequence IS 1122. External disease symptoms on the tops and histological symptoms on the cross-sections of the roots were evaluated visually and microscopically during two years after inoculation. Extracts were prepared from samples collected from the tops and roots of lucerne plants for both PCR and microbiological analyses. Colonies which morphologically resemble to be Cmi were tested using PCR. Cmi bacteria were detected in stem and root tissues using both methods. The PCR can rapidly detect Cmi in lucerne plants showing histological disease symptoms on the cross-sections of the roots. Further work is needed to detect reliably Cmi in lucerne plants with latent infections and in infected seeds or contaminated seed lots.

APA, Harvard, Vancouver, ISO, and other styles

12

Novita, Hessy, Desy Sugiani, Taukhid Taukhid, and Tuti Sumiati. "DUPLEX POLYMERASE CHAIN REACTION UNTUK DETEKSI SIMULTAN KOI HERPESVIRUS DAN Aeromonas hydrophila PADA IKAN MAS (Cyprinus carpio)." Jurnal Riset Akuakultur 15, no. 1 (February 20, 2020): 59. http://dx.doi.org/10.15578/jra.15.1.2020.59-67.

Full text

Abstract:

Koi herpesvirus (KHV) dan Aeromonas hydrophila adalah patogen yang dapat mengkoinfeksi ikan mas secara bersamaan. Penelitian ini bertujuan untuk mengembangkan metode duplex polymerase chain reaction (dPCR), deteksi simultan untuk diagnosis KHV dan bakteri Aeromonas hydrophila pada ikan mas. Dua pasang primer yang menargetkan sekuen spesifik SphI dan gen aerolisin, yang sering digunakan untuk mendeteksi KHV dan A. hydrophila dalam uji reaksi tunggal PCR dan menghasilkan target pita PCR 290 bp dan 417 bp. Hasil penelitian menunjukkan bahwa metode duplex PCR dapat mendeteksi ganda infeksi KHV dan A. hydrophila pada ikan mas dan metode ini lebih efektif mendeteksi dua patogen secara bersamaan dalam satu reaksi PCR pada suhu pradenaturasi, 94°C selama dua menit, denaturasi pada suhu 95°C selama satu menit, annealing pada suhu, 55°C selama satu menit, dan 72°C selama satu menit, dengan 30 siklus amplifikasi dan final extention pada suhu 72°C selama lima menit. Metode dPCR untuk deteksi simultan kedua patogen adalah salah satu metode yang dapat diaplikasikan untuk deteksi koinfeksi virus dan bakteri dalam satu reaksi PCR.Koi herpesvirus (KHV) and Aeromonas hydrophila are pathogens that can co-infect common carp. This study aimed to develop a duplex polymerase chain reaction (dPCR) method to detect KHV and Aeromonas hydrophila in common carp simultaneously. Two pairs of primers targeted the specific sequences of SphI and aerolysin genes, often used in detecting KHV and A. hydrophila, in a single PCR reaction test and produced target bands of PCR 290 bp and 417 bp. This proposed method was more effective in simultaneously detecting the two pathogens in one PCR reaction at pre-naturation temperature of 94°C for two minutes, denaturation at 95°C for one minute, annealing at temperature, 55°C for one minute, and 72°C for one minute, with 30 cycles of amplification and final extension at 72°C for five minutes. The findings showed that the duplex PCR method could be used to double detect KHV and A. hydrophila infection in common carp. The duplex PCR method for simultaneous detection of both pathogens is one method that can be applied for the detection of co-infection of viruses and bacteria in a PCR reaction.

APA, Harvard, Vancouver, ISO, and other styles

13

Cao, Yi, Kathrin Kopplow, and Guang-Yaw Liu. "In-situ immuno-PCR to detect antigens." Lancet 356, no. 9234 (September 2000): 1002–3. http://dx.doi.org/10.1016/s0140-6736(00)02696-9.

Full text

APA, Harvard, Vancouver, ISO, and other styles

14

Cho, Jung-Hee, Min-Jung Jeong, Min-Ji Song, Kyu-Ock Yim, Hyok-In Lee, Jung-Hee Kim, Ji-Hyun Baeg, and Jae-Soon Cha. "Development of PCR Primers to Detect Pseudomonas savastanoi pv. phaseolicola from the Bean Seeds." Research in Plant Disease 16, no. 2 (August 1, 2010): 129–35. http://dx.doi.org/10.5423/rpd.2010.16.2.129.

Full text

APA, Harvard, Vancouver, ISO, and other styles

15

Lubis, Dini Sahfitri, and Diah Artati. "DETEKSI KOI HERPES VIRUS DENGAN METODE POLYMERASE CHAIN REACTION." Buletin Teknik Litkayasa Akuakultur 14, no. 2 (November 15, 2016): 115. http://dx.doi.org/10.15578/blta.14.2.2016.115-118.

Full text

Abstract:

Polymerase chain reaction (PCR) merupakan salah satu metode deteksi cepat koi herpes vrus (KHV). Metode PCR ini sangat sensitif. Sensitivitas tersebut membuatnya dapat digunakan untuk melipatgandakan satu molekul DNA. Konsentrasi dan kualitas DNA dipengaruhi oleh keberhasilan pada saat melakukan ekstraksi DNA. Kegiatan percobaan ini bertujuan untuk mengetahui hasil deteksi virus KHV dengan metode PCR. Keberhasilan analisis PCR sangat dipengaruhi karakteristik DNA genom yang meliputi kemurnian, konsentrasi dan ukuran template. Virus KHV dideteksi menggunakan metode PCR sesuai dengan SNI 7547:2009. Hasil kegiatan deteksi virus KHV menggunakan PCR dari sampel kode I.230–I.286 dapat memvisualisasikan hasil PCR dengan positif KHV dengan ukuran fragmen DNA 290 bp dengan baik. Dapat dilihat dari 57 sampel yang telah diuji memiliki hasil yang berbeda-beda. Hasil uji yang diperoleh yaitu 32 sampel ikan positif terinfeksi KHV dan 25 sampel negatif KHV

APA, Harvard, Vancouver, ISO, and other styles

16

Acosta Soto, Lucrecia, Ana Belén Santísima-Trinidad, Fernando Jorge Bornay-Llinares, Marcos Martín González, José Antonio Pascual Valero, and Margarita Ros Muñoz. "Quantitative PCR and Digital PCR for Detection ofAscaris lumbricoidesEggs in Reclaimed Water." BioMed Research International 2017 (2017): 1–9. http://dx.doi.org/10.1155/2017/7515409.

Full text

Abstract:

The reuse of reclaimed water from wastewater depuration is a widespread and necessary practice in many areas around the world and must be accompanied by adequate and continuous quality control.Ascaris lumbricoidesis one of the soil-transmitted helminths (STH) with risk for humans due to its high infectivity and an important determinant of transmission is the inadequacy of water supplies and sanitation. The World Health Organization (WHO) recommends a limit equal to or lower than one parasitic helminth egg per liter, to reuse reclaimed water for unrestricted irrigation. We present two new protocols of DNA extraction from large volumes of reclaimed water. Quantitative PCR (qPCR) and digital PCR (dPCR) were able to detect low amounts ofA. lumbricoideseggs. By using the first extraction protocol, which processes 500 mL of reclaimed water, qPCR can detect DNA concentrations as low as oneA. lumbricoidesegg equivalent, while dPCR can detect DNA concentrations as low as fiveA. lumbricoidesegg equivalents. By using the second protocol, which processes 10 L of reclaimed water, qPCR was able to detect DNA concentrations equivalent to 20A. lumbricoideseggs. This fact indicated the importance of developing new methodologies to detect helminth eggs with higher sensitivity and precision avoiding possible human infection risks.

APA, Harvard, Vancouver, ISO, and other styles

17

Stadelmeyer, Elke, Ellen Heitzer, Peter Wolf, Nadia Dandachi, and Claudio Orlando. "COLD-HRM PCR versus Conventional HRM PCR to Detect the BRAF V600E Mutation." Journal of Molecular Diagnostics 13, no. 2 (March 2011): 243–44. http://dx.doi.org/10.1016/j.jmoldx.2010.09.005.

Full text

APA, Harvard, Vancouver, ISO, and other styles

18

Kordalewska, Milena, Anna Brillowska-Dąbrowska, Tomasz Jagielski, and Bożena Dworecka-Kaszak. "PCR and real-time PCR assays to detect fungi of Alternaria alternata species." Acta Biochimica Polonica 62, no. 4 (2015): 707–12. http://dx.doi.org/10.18388/abp.2015_1112.

Full text

APA, Harvard, Vancouver, ISO, and other styles

19

Whiteman, S. A., M. V. Jaspers, A. Stewart, and H. J. Ridgway. "Detection of Phaeomoniella chlamydospora in soil using speciesspecific PCR." New Zealand Plant Protection 55 (August 1, 2002): 139–45. http://dx.doi.org/10.30843/nzpp.2002.55.3943.

Full text

Abstract:

Phaeomoniella chlamydospora is a fungal pathogen of woody grapevine tissue that causes Petri disease As one potential source of inoculum is infested soil a SDS/phenol/chloroform DNA extraction method and PCR assay utilising speciesspecific primers were evaluated for the ability to detect P chlamydospora in grapevine nursery soil Using a nested PCR approach the assay was able to detect 102 conidia/ml when a spore suspension was added to sterilised soil samples and 50 fg when P chlamydospora genomic DNA was added directly to the reaction In this process preamplification of a 600 bp region of the ribosomal DNA was followed by amplification with primers Pch 1 and Pch 2 to produce a 360 bp speciesspecific product This highly sensitive diagnostic tool will be used in future studies to determine if pathogen propagules are present in soils collected from New Zealand grapevine nurseries

APA, Harvard, Vancouver, ISO, and other styles

20

Magro, Cátia, Margarida Sardinha, Paulo A. Ribeiro, Maria Raposo, and Susana Sério. "Magnetron Sputtering Thin Films as Tool to Detect Triclosan in Infant Formula Powder: Electronic Tongue Approach." Coatings 11, no. 3 (March 15, 2021): 336. http://dx.doi.org/10.3390/coatings11030336.

Full text

Abstract:

Triclosan (TCS) is being detected in breast milk and in infants of puerperal women. The harmful effects caused by this compound on living beings are now critical and thus it is pivotal find new tools to TCS monitoring. In the present study, an electronic tongue (e-tongue) device comprising an array of sputtered thin films based on Multi-Walled Carbon Nanotubes and titanium dioxide was developed to identify TCS concentrations, from 10−15 to 10−5 M, in both water and milk-based solutions. Impedance spectroscopy was used for device signal transducing and data was analyzed by principal component analysis (PCA). The e-tongue revealed to be able to distinguish water from milk-based matrices through the two Principal Components (PC1 and PC2), which represented 67.3% of the total variance. The PC1 values of infant formula milk powder prepared with tap water (MT) or mineral water (MMW) follows a similar exponential decay curve when plotted with the logarithm of concentration. Therefore, considering the TCS concentration range between 10−15 and 10−9 M, the PC1 values are fitted by a straight line and values of −1.9 ± 0.2 and of 7.6 × 10−16 M were calculated for the sensor sensitivity and sensor resolution, respectively. Additionally, a strong correlation (R = 0.96) between MT and MMW PC1 data was found. These results have shown that the proposed device corresponds to a promisor method for the detection of TCS in milk-based solutions.

APA, Harvard, Vancouver, ISO, and other styles

21

Muhsinin, Soni, Maria Martina Sulastri, and Dadih Supriadi. "Deteksi Cepat Gen InvA pada Salmonella spp. Dengan Metode PCR." Jurnal Sains Farmasi & Klinis 5, no. 3 (February 8, 2019): 191. http://dx.doi.org/10.25077/jsfk.5.3.191-200.2018.

Full text

Abstract:

Salmonella spp. merupakan penyebab infeksi utama pada manusia melalui rute oral dengan cara mengkontaminasi makanan dan minuman. Penyakit yang disebabkan oleh Salmonella spp. disebut salmonellosis. Salmonella spp. memiliki gen invA yang menyebabkan patogen pada manusia. Deteksi gen InvA dapat dilakukan dengan metode PCR. Tujuan penelitian ini adalah untuk pengembangan metode deteksi cepat Gen InvA pada Salmonella spp. dengan metode PCR. Tahapan metode penelitian dimulai dari kultur Salmonella ATCC, Isolasi DNA Salmonella ATCC, Analisis Kuantitatif DNA Salmonella ATCC, Desain primer spesifik untuk deteksi gen InvA, Karakterisasi primer, Optimasi komponen PCR. Hasil isolasi DNA Salmonella ATCC yang didapat dengan konsentrasi DNA sebesar 4,5 ng/ul dengan kemurnian DNA 1,66. Primer PCR yang telah didesain untuk deteksi gen InvA terdiri dari satu pasang primer, yaitu InvA-F: 5’ TCGTCATTCCATTACCTACC 3’dan InvA-R: 5’ AAACGTTGAAAAACTGAGGA 3’ yang menghasilkan produk PCR gen InvA sepanjang 119 bp. Gen InvA dapat dideteksi dengan cepat menggunakan metode PCR yang telah dioptimasi komponen PCR.

APA, Harvard, Vancouver, ISO, and other styles

22

Kastawa, Ni Wayan Eka Putri Gayatri, Yan Ramona, and N. N. Dwi Fatmawati. "Metode Deteksi Carbapenem Resistant Enterobacteriaceae." Metamorfosa: Journal of Biological Sciences 7, no. 1 (March 27, 2020): 48. http://dx.doi.org/10.24843/metamorfosa.2020.v07.i01.p07.

Full text

Abstract:

Carbapenem Resistant Enterobacteriaceae (CRE) merupakan kelompok bakteri Enterobacteriaceae yang resisten terhadap antibiotik golongan Carbapenem (Imipenem, Ertapenem, Meropenem, Doripenem). Salah satu spesies Enterobacteriaceae yang sering menunjukkan sifat resisten terhadap Carbapenem adalah Klebsiella pneumoniae. Untuk mendeteksi keberadaan CRE perlu dilakukan deteksi dini menggunakan uji fenotip dan genotip. Uji fenotip yang dapat dilakukan adalah Modified Hodge Test (MHT), Carba Nordmann-Poirel (Carba NP), dan Modified Carbapenem Inactivation Method (MCIM). Untuk mengetahui keberadaan gen penyandi enzim carbapememase, metoda yang dapat dipakai dalam uji genotip adalah metoda Polymerase Chain Reaction (PCR) Kata kunci : Carbapenem Resistant Enterobacteriaceae (CRE), Fenotip, Genotip, Modified Carbapenem Inactivation Method (MCIM), Modified Hodge Test (MHT), Carba NP, Polymerase Chain Reaction (PCR).

APA, Harvard, Vancouver, ISO, and other styles

23

Akbari, Rizal Arifin, Risa Tiuria, April Hari Wardhana, and Dyah Haryuningtyas Savitri. "Deteksi Parasit Darah pada Sapi Perah Berdasarkan Analisis Pcr Duplex." Acta VETERINARIA Indonesiana 6, no. 2 (December 31, 2018): 48–55. http://dx.doi.org/10.29244/avi.6.2.48-55.

Full text

Abstract:

Penelitian ini bertujuan untuk mendeteksi parasit darah pada sapi (Babesia spp., Theileria spp., dan Trypanosoma spp.) secara molekular berdasarkan analisis duplex PCR. Seratus sampel darah sapi perah Friesian Holstein diambil secara acak untuk deteksi parasit darah dengan pemeriksaan ulas darah. Sebanyak tiga puluh dari seratus sampel diseleksi untuk analisis PCR single berdasarkan jenis parasit dan tingkat parasitemia yang terdiri dari 5 sampel positif Babesia spp, 15 sampel positif Theileria spp., dan 10 sampel negatif parasit darah untuk dilanjutkan pada tahap PCR single. Optimasi PCR single dilakukan menggunakan tiga primer spesifik untuk B. bovis (Bover2A), T. annulata (Cytob 1) dan T. evansi (ITS 1). Hasil optimasi PCR single menunjukan bahwa suhu anneling 56 °C merupakan suhu optimal untuk deteksi Babesia bovis dan T. evansi sedangkan T. annulata tidak menunjukan hasil positif pada kondisi tersebut. Hasil analisis PCR single menunjukan 28 sampel positif B. bovis, 1 sampel positif T. evansi, 1 sampel negatif semua parasit darah dan 0 sampel positif T. annulata sehingga hanya B. bovis dan T. evansi yang dilanjutkan ke tahap analisis duplex PCR duplex. Teknik duplex PCR berhasil dioptimasi dengan dilakukannya modifikasi penambahan MgCl2 (25 μM) sebanyak 0.5 L/tube sehingga dapat diaplikasikan untuk mendeteksi parasit darah B. bovis dan T. evansi pada sampel di lapang

APA, Harvard, Vancouver, ISO, and other styles

24

Nguyen, Nhien Huu, Tram Thi Mai Nguyen, and Hue Thi Nguyen. "Developing a PCR assay to detect Aspergillus parasiticus." Science and Technology Development Journal 18, no. 1 (March 31, 2015): 43–51. http://dx.doi.org/10.32508/stdj.v18i1.1033.

Full text

Abstract:

Aspergillus parasiticus is one of the producers of aflatoxins in food. They may produce aflatoxin B and G which can lead to serious diseases in human. Aflatoxin is known as a type of carcinogens. People ingesting infected food even in a very low level for a long time can get cancer because of aflatoxin accumulation. Detection of aflatoxin or aflatoxin producers in foods is necessary to improve the life quality by decreasing the risk of getting diseases. Recently, the contemporary method to detect A. parasiticus is a morphological method but it still retains many limitations. In this study, a PCR based method was developed to provide a basic for develop a new method to detect A. parasiticus in food that overcame the disadvantages of the conventional morphological method. A specific set of primers was designed based on norB-cypA genes and successfully optimized for best amplification results at 62 ˚C. The sensitivity of the test was identified to be 0.005 ng/µL of target fungi DNA. A DNA isolation protocol was also optimized to ensure the success of the PCR assay, using SDS lysis, sand and thermal shock. The protocol from DNA isolation to PCR was successfully developed and provided a useful tool to improve the diagnosis of aflatoxins at an early stage and control all stages of food production. The success of this study is designing a pair of primers and a PCR assay which is specific for detection of A. parasiticus among other aspergilus species. This PCR assay can be used in the future for further development a PCR method for detection of A. parasiticus in food.

APA, Harvard, Vancouver, ISO, and other styles

25

Aguado, JoséM, MariaJ Rebollo, Elia Palenque, and Lola Folgueria. "Blood-based PCR assay to detect pulmonary tuberculosis." Lancet 347, no. 9018 (June 1996): 1836–37. http://dx.doi.org/10.1016/s0140-6736(96)91656-6.

Full text

APA, Harvard, Vancouver, ISO, and other styles

26

&NA;. "PCR fails to detect HIV in seronegative haemophiliacs." Inpharma Weekly &NA;, no. 767 (December 1990): 19. http://dx.doi.org/10.2165/00128413-199007670-00059.

Full text

APA, Harvard, Vancouver, ISO, and other styles

27

&NA;. "PCR can detect HIV-1 DNA in urine." Inpharma Weekly &NA;, no. 745 (July 1990): 16. http://dx.doi.org/10.2165/00128413-199007450-00035.

Full text

APA, Harvard, Vancouver, ISO, and other styles

28

Sofi Ibrahim, M., D. A. Kulesh, S. S. Saleh, I. K. Damon, J. J. Esposito, A. L. Schmaljohn, and P. B. Jahrling. "Real-Time PCR Assay To Detect Smallpox Virus." Journal of Clinical Microbiology 41, no. 8 (August 1, 2003): 3835–39. http://dx.doi.org/10.1128/jcm.41.8.3835-3839.2003.

Full text

APA, Harvard, Vancouver, ISO, and other styles

29

SEKIGUCHI, Yoshiko, Junsuke SHIRAI, Takahide TANIGUCHI, and Eiichi HONDA. "Development of Reverse Transcriptase PCR and Nested PCR to Detect Porcine Hemagglutinating Encephalomyelitis Virus." Journal of Veterinary Medical Science 66, no. 4 (2004): 367–72. http://dx.doi.org/10.1292/jvms.66.367.

Full text

APA, Harvard, Vancouver, ISO, and other styles

30

Christensen, Peter, Zbynek Bozdech, Wanitda Watthanaworawit, Laurent Renia, Benoit Malleret, Clare Ling, and Francois Nosten. "Reverse transcription PCR to detect low density malaria infections." Wellcome Open Research 6 (February 22, 2021): 39. http://dx.doi.org/10.12688/wellcomeopenres.16564.1.

Full text

Abstract:

Background: Targeted malaria elimination strategies require highly sensitive tests to detect low density malaria infections (LDMI). Commonly used methods for malaria diagnosis such as light microscopy and antigen-based rapid diagnostic tests (RDTs) are not sensitive enough for reliable identification of infections with parasitaemia below 200 parasites per milliliter of blood. While targeted malaria elimination efforts on the Thailand-Myanmar border have successfully used high sample volume ultrasensitive quantitative PCR (uPCR) to determine malaria prevalence, the necessity for venous collection and processing of large quantities of patient blood limits the widespread tractability of this method. Methods: Here we evaluated a real-time reverse transcription PCR (RT-PCR) method that reduces the required sample volume compared to uPCR. To do this, 304 samples collected from an active case detection program in Kayin state, Myanmar were compared using uPCR and RT-PCR. Results: Plasmodium spp. RT-PCR confirmed 18 of 21 uPCR Plasmodium falciparum positives, while P. falciparum specific RT-PCR confirmed 17 of the 21 uPCR P. falciparum positives. Combining both RT-PCR results increased the sensitivity to 100% and specificity was 95.1%. Conclusion: Malaria detection in areas of low transmission and LDMI can benefit from the increased sensitivity of ribosomal RNA detection by RT-PCR, especially where sample volume is limited. Isolation of high quality RNA also allows for downstream analysis of malaria transcripts.

APA, Harvard, Vancouver, ISO, and other styles

31

Gomes, Glauce M., Patrícia S. Cisalpino, Carlos P. Taborda, and Zoilo P. de Camargo. "PCR for Diagnosis of Paracoccidioidomycosis." Journal of Clinical Microbiology 38, no. 9 (2000): 3478–80. http://dx.doi.org/10.1128/jcm.38.9.3478-3480.2000.

Full text

Abstract:

A PCR assay based on oligonucleotide primers derived from the sequence of the gene coding for the 43,000-Da (gp43) antigen was developed to detect Paracoccidioides brasiliensis DNA in sputa. In the standardized conditions, it could detect 10 cells/ml of sputum, providing sufficient accuracy to be useful for diagnosis of paracoccidioidomycosis.

APA, Harvard, Vancouver, ISO, and other styles

32

Kim, Young-Tak, Kyoung-Soo Park, Hye-Seong Kim, Hyok-In Lee, and Jae-Soon Cha. "Development of Nested-PCR Assay to Detect Acidovorax citrulli, a Causal Agent of Bacterial Fruit Blotch at Cucurbitaceae." Research in Plant Disease 21, no. 2 (June 30, 2015): 74–81. http://dx.doi.org/10.5423/rpd.2015.21.2.074.

Full text

APA, Harvard, Vancouver, ISO, and other styles

33

Johan, Calvin Wijaya, Sulistyo Emantoko Dwi Putra, and Ernest Suryadjaja. "Deteksi Vibrio harveyi dengan Metode Amplifikasi DNA pada Gen toxR." KELUWIH: Jurnal Sains dan Teknologi 1, no. 1 (February 28, 2020): 29–37. http://dx.doi.org/10.24123/saintek.v1i1.2775.

Full text

Abstract:

Abstrak -Infeksi hewan akuakultur oleh Vibrio harveyi dapat menyebabkan kematian serta kerugian ekonomi. Kemampuan untuk mendeteksi bakteri tersebut secara dini dapat mencegah penyebarannya dalam akuakultur. Penelitian ini bertujuan untuk mengembangkan metode untuk mendeteksi Vibrio harveyi melalui amplifikasi gen toxR. Amplifikasi DNA dilakukan dengan dua metode, yakni amplifikasi isotermal termediasi loop (loop-mediated isothermal amplification, LAMP) dan reaksi berantai polimerase (PCR). Amplifikasi menggunakan metode LAMP menunjukan perlu dilakukan optimasi protokol maupun desain primer untuk mencegah perolehan hasil false positive. Amplifikasi menggunakan metode PCR menghasilkan produk berukuran 229 pasang basa yang spesifik pada Vibrio harveyi dengan batas deteksi hingga 0,526 ng.µL-1 (setara 2,09 × 106 CFU.mL-1). Kata kunci: Akuakultur, LAMP, PCR, toxR, Vibrio harveyi Abstract -Vibrio harveyi infection in aquacultures may cause death and economical loss. Rapid detection of this bacteria may prevent its dispersal in aquacultures. The goal of this research was to develop method in detection of Vibrio harveyi via amplification of toxR gene. DNA amplification was carried out with two methods, loop-mediated isothermal amplification (LAMP) and polymerase chain reaction (PCR). Amplification with LAMP suggest optimization of either protocol or primer design was needed to prevents false positive results. Amplification with PCR yields 229 bp-length product specific to Vibrio harveyi with detection limit up to 0.526 ng.µL-1 (equals to 2.09 × 106 CFU.mL-1). Keywords: Aquaculture, LAMP, PCR, toxR, Vibrio harveyi

APA, Harvard, Vancouver, ISO, and other styles

34

Adamska, M., A. Leonska-Duniec, M. Sawczuk, A. Maciejewska, and B. Skotarczak. " Recovery of Cryptosporidium from spiked water and stool samples measured by PCR and real time PCR." Veterinární Medicína 57, No. 5 (June 1, 2012): 224–32. http://dx.doi.org/10.17221/5952-vetmed.

Full text

Abstract:

Cryptosporidium parvum is a common intestinal protozoan parasite infecting humans and a wide range of animals, whose diagnostics present considerable difficulties. These arise from the exceptionally robust nature of the oocyst’s walls, which necessitates more stringent treatments for disruption and recovery of DNA for analysis using molecular methods. In the case of water, which is the major source of Cryptosporidium oocysts, investigations concern the detection of the presence of the oocysts. Their concentration in water is very low, and moreover, many substances that may have significance as inhibitors of DNA amplification, are present in environmental water and stool. We have carried out trials in order to assess the effectiveness of recovery of C. parvum oocysts, from spiked environmental and distilled water samples, filtrated and concentrated with the use of special laboratory equipment. Inactivation of inhibitors was carried out with use of bovine serum albumin (BSA) in PCR mixes at ten different concentrations. DNA extraction was carried out from stool samples spiked with C. parvum oocysts, concentrated using two methods, and unconcentrated. Nested PCR and a TaqMan nested real time PCR assay, targeting the 18S rRNA gene, was used to detect C. parvum DNA in spiked water and additionally in spiked stool samples. The obtained results showed that losses of C. parvum oocysts occur during the filtration and concentration of spiked water samples. The addition of small amounts of BSA (5–20 ng/µl) to PCR and TaqMan PCR mixes increases the sensitivity of both methods, but a high concentration of BSA (100 ng/µl and above) has an inhibiting effect on the polymerase reaction. The extraction of DNA from C. parvum oocysts from spiked stool samples preceded by concentration with PBS, ether and Percoll resulted in a higher copy number of the 18S rRNA gene.  

APA, Harvard, Vancouver, ISO, and other styles

35

Oliveira, Trícia Maria Ferreira de Sousa, Vanessa Figueredo Pereira, Graziella Ulbricht Benvenga, Maria Fernanda Alves Martin, Julia Cristina Benassi, Diogo Tiago da Silva, and Wilma Aparecida Starke-Buzetti. "Conjunctival swab PCR to detect Leishmania spp. in cats." Revista Brasileira de Parasitologia Veterinária 24, no. 2 (June 2015): 220–22. http://dx.doi.org/10.1590/s1984-29612015016.

Full text

Abstract:

The relevance of the dog as a source of visceral leishmaniasis infection is known, but the role of cats as reservoir hosts for leishmaniasis is not yet fully clear. This study assessed the efficacy of conjunctival swab PCR (CS-PCR) in the detection of cats infected by Leishmania spp. The results were seven (13.5%) cats positive for Leishmania spp. in the PCR, in 52 cats tested from Pirassunuga-SP and Ilha Solteira-SP. From the city of Pirassununga – SP 28.6% (2/7) were positive and from the city of Ilha Solteira – SP 11.1% (5/45) were positive. The results showed that CS-PCR was capable of detecting cats infected by this protozoan. Conjunctival swab samples proved easier to perform in cats, which might facilitate studies on the frequency and distribution of feline leishmaniasis.

APA, Harvard, Vancouver, ISO, and other styles

36

MORALES-RAYAS, ROCÍO, PETRA F. G. WOLFFS, and MANSEL W. GRIFFITHS. "Immunocapture and Real-Time PCR To Detect Campylobacter spp." Journal of Food Protection 71, no. 12 (December 1, 2008): 2543–47. http://dx.doi.org/10.4315/0362-028x-71.12.2543.

Full text

Abstract:

In this work, the feasibility of using a large-volume immunocapture system as a sample pretreatment before detection of Campylobacter was studied. Real-time PCR was used for detection of captured cells after immunocapture. This immunocapture system is able to process high-volume samples by recirculation, increasing the possibility of capturing cells in low numbers. After 30 min of recirculation, the sample is concentrated from 250 ml to 200 μl. In this study, different parameters were compared in order to improve cell capture. The analysis of inoculated chicken skin showed that detection of Campylobacter at levels of 103 CFU/25 g was possible after 8 h of enrichment. The low recovery of Campylobacter cells (<1%) makes this separation method qualitative rather than quantitative. The detection limit of the entire protocol was increased due to the low cell recovery of the sample pretreatment. Therefore, this immunoseparation is able to recover cells present in high concentration after enrichment but not cells present in low concentration. Isolation of Campylobacter cells is achievable using this separation method rather than rapid detection.

APA, Harvard, Vancouver, ISO, and other styles

37

Brass, Nicole, Dirk Heckel, and Eckart Meese. "Comparative PCR: An Improved Method to Detect Gene Amplification." BioTechniques 24, no. 1 (January 1998): 22–26. http://dx.doi.org/10.2144/98241bm02.

Full text

APA, Harvard, Vancouver, ISO, and other styles

38

Batov, Y. V., D. A. Puzko, A. I. Petrov, V. V. Davydov, and A. P. Glinushkin. "Using wavelet transform to detect peaks in PCR signals." Journal of Physics: Conference Series 1695 (December 2020): 012066. http://dx.doi.org/10.1088/1742-6596/1695/1/012066.

Full text

APA, Harvard, Vancouver, ISO, and other styles

39

Gilgen, M., B. Wegmüller, P. Burkhalter, H. P. Bühler, U. Müller, J. Lüthy, and U. Candrian. "Reverse transcription PCR to detect enteroviruses in surface water." Applied and environmental microbiology 61, no. 4 (1995): 1226–31. http://dx.doi.org/10.1128/aem.61.4.1226-1231.1995.

Full text

APA, Harvard, Vancouver, ISO, and other styles

40

Soejima, T., K. i. Iida, T. Qin, H. Taniai, M. Seki, and S. i. Yoshida. "Method To Detect Only Live Bacteria during PCR Amplification." Journal of Clinical Microbiology 46, no. 7 (April 30, 2008): 2305–13. http://dx.doi.org/10.1128/jcm.02171-07.

Full text

APA, Harvard, Vancouver, ISO, and other styles

41

Hussain, Zafar, and Michael A. John. "Failure of a PCR Screening Method to Detect MRSA." Infection Control & Hospital Epidemiology 21, no. 10 (October 2000): 627–28. http://dx.doi.org/10.1086/503240.

Full text

APA, Harvard, Vancouver, ISO, and other styles

42

&NA;. "PCR can detect hepatitis C when antibodies are absent." Inpharma Weekly &NA;, no. 751 (August 1990): 19. http://dx.doi.org/10.2165/00128413-199007510-00055.

Full text

APA, Harvard, Vancouver, ISO, and other styles

43

Isabel Luque, M., Alicia Rodríguez, María J. Andrade, Ruben Gordillo, Mar Rodríguez, and Juan J. Córdoba. "PCR to detect patulin producing moulds validated in foods." Food Control 25, no. 1 (May 2012): 422. http://dx.doi.org/10.1016/j.foodcont.2011.10.014.

Full text

APA, Harvard, Vancouver, ISO, and other styles

44

Mullins, C. B., K. L. Giles, C. M. Ye, and M. W. Phoofolo. "Using PCR to Detect Intraguild Predation ofLysiphlebus testaceipesby Coccinellids." Southwestern Entomologist 36, no. 3 (September 2011): 295–304. http://dx.doi.org/10.3958/059.036.0307.

Full text

APA, Harvard, Vancouver, ISO, and other styles

45

Quintero-Vásquez, Gabriela Alejandra, María Luisa Bazán-Tejeda, Eva Martínez-Peñafiel, Luis Kameyama-Kawabe, and Rosa María Bermúdez-Cruz. "Multiplex PCR to detect four different tomato-infecting pathogens." Folia Microbiologica 58, no. 4 (November 8, 2012): 269–76. http://dx.doi.org/10.1007/s12223-012-0206-6.

Full text

APA, Harvard, Vancouver, ISO, and other styles

46

Ulrich, Melanie P., David A. Norwood, Deanna R. Christensen, and Ricky L. Ulrich. "Using real-time PCR to specifically detect Burkholderia mallei." Journal of Medical Microbiology 55, no. 5 (May 1, 2006): 551–59. http://dx.doi.org/10.1099/jmm.0.46350-0.

Full text

APA, Harvard, Vancouver, ISO, and other styles

47

Ge, Qinyu, Zhaobin Liu, Yunfei Bai, Dingdong Zhang, Pinfei Yu, and Zuhong Lu. "Emulsion PCR-based method to detect Y chromosome microdeletions." Analytical Biochemistry 367, no. 2 (August 2007): 173–78. http://dx.doi.org/10.1016/j.ab.2007.05.008.

Full text

APA, Harvard, Vancouver, ISO, and other styles

48

Christensen, Peter, Zbynek Bozdech, Wanitda Watthanaworawit, Laurent Rénia, Benoît Malleret, Clare Ling, and François Nosten. "Reverse transcription PCR to detect low density malaria infections." Wellcome Open Research 6 (August 4, 2021): 39. http://dx.doi.org/10.12688/wellcomeopenres.16564.2.

Full text

Abstract:

Background: Targeted malaria elimination strategies require highly sensitive tests to detect low density malaria infections (LDMI). Commonly used methods for malaria diagnosis such as light microscopy and antigen-based rapid diagnostic tests (RDTs) are not sensitive enough for reliable identification of infections with parasitaemia below 200 parasites per milliliter of blood. While targeted malaria elimination efforts on the Thailand-Myanmar border have successfully used high sample volume ultrasensitive quantitative PCR (uPCR) to determine malaria prevalence, the necessity for venous collection and processing of large quantities of patient blood limits the widespread tractability of this method. Methods: Here we evaluated a real-time reverse transcription PCR (RT-qPCR) method that reduces the required sample volume compared to uPCR. To do this, 304 samples collected from an active case detection program in Kayin state, Myanmar were compared using uPCR and RT-qPCR. Results: Plasmodium spp. RT-qPCR confirmed 18 of 21 uPCR Plasmodium falciparum positives, while P. falciparum specific RT-qPCR confirmed 17 of the 21 uPCR P. falciparum positives. Combining both RT-qPCR results increased the sensitivity to 100% and specificity was 95.1%. Conclusion: Malaria detection in areas of low transmission and LDMI can benefit from the increased sensitivity of ribosomal RNA detection by RT-PCR, especially where sample volume is limited. Isolation of high quality RNA also allows for downstream analysis of malaria transcripts.

APA, Harvard, Vancouver, ISO, and other styles

49

Maze, Maria Gladis Bupu, Didik Handijatno, Wiwik Tyasningsih, Suwarno Suwarno, Agnes Theresia Soelih Estoepangestie, and Rahaju Ernawati. "MOLECULAR DETECTION OF PROTEIN ENCODING GENES Virb11 ON BRUCELLA ABORTUS LOCAL ISOLATES ORIGIN OF PINRANG, NTT AND VACCINE STRAINS." Jurnal Veteriner 21, no. 4 (December 30, 2020): 503–11. http://dx.doi.org/10.19087/jveteriner.2020.21.4.503.

Full text

Abstract:

Brucellosis in cattle is a disease caused by Brucella abortus due to the reduction in livestock population caused by abortion, stillbirth, weak birth, infertility and sterility. Brucella abortus has several potential virulence factors, i.e. virB11 gene that encodes VirB11 protein is an important virulence factor acts as an ATPase for assembling organelles when the bacteria replicate, helping to complete the bacterial cycle and agress to another cells. The aim of this study are to re-identification Brucella abortus and detect virB11 gene as encoding of B. abortus VirB11 protein in local isolates from Pinrang, NTT, strain vaccines S19 and RB51. The isolates Brucella abortus were re-cultured in Brucella agar base and re-identification is followed by microscopic with Gram staining and biochemical tested with urease, citrat, indol and TSIA test. virB11gene was detected with PCR method. The PCR result showed virB11 gene have DNA band 720 bp. virB11 gene are present in local isolates from Pinrang, NTT, strain vaccines S19 and RB51.

APA, Harvard, Vancouver, ISO, and other styles

50

Sultan, Makkulau, Stenly Wullur, and Reiny A. Tumbol. "IDENTIFIKASI KOI HERVES VIRUS PADA IKAN MAS Cyprinus carpio DI SULAWESI UTARA TAHUN 2017 DENGAN MENGGUNAKAN TEKNIK PCR DAN qPCR." JURNAL PESISIR DAN LAUT TROPIS 6, no. 2 (November 1, 2018): 31. http://dx.doi.org/10.35800/jplt.6.2.2018.21521.

Full text

Abstract:

This research aimed to detect the distribution of KHV disease in cultured common carps using conventional PCR and Real Time Quantitative PCR methods in North Sulawesi. The samples were taken from 6 aqua culture centres in North Sulawesi. The results of KHV detection by PCR method showed negative KHV infection because visualization does not form a specific band with the KHV gene that is at 409 bp. Detection of KHV of Ct (Quantification cycle) was greater than the LOD with a confidence level of 95% where Ct LOD is 8.71 for the smallest standard of 1.0x102 copies. Ct sample that was read based on qPCR amplification result which was 14,69-18,80 and the value of Ct NTC (Non Template Control) used as a negative control was 17.52.Penelitian ini bertujuan untuk mengidentifikasi keberadaan penyakit Koi Herves Virus pada ikan mas dengan menggunakan metode PCR dan qPCR di Sulawesi Utara. Sampel uji diambil dari 6 sentral budidaya di Provinsi Sulawesi Utara. Hasil penelitian menunjukkan bahwa dengan metode PCR diperoleh hasil deteksi yang negatif, karena visualisasi tidak terbentuk band spesifik dengan KHV, yaitu di 409 bp. Deteksi KHV dengan metode qPCR didapat hasil infeksi KHV yang negatif dilihat dari nilai rata-rata Ct (Quantification cycle) lebih besar dari LOD dengan tingkat kepercayaan (confident level) 95%. Nilai Ct LOD adalah 8,71 untuk standar terkecil 1,0x102 copies, sedangkan Ct sampel hasil amplifikasi qPCR adalah 14,69-18,80 dan nilai Ct NTC (Non Template Control) yang digunakan sebagai kontrol negatif adalah 17,52.

APA, Harvard, Vancouver, ISO, and other styles

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!