Log in

Relevant bibliographies by topics / Philippines Quezon / Journal articles

To see the other types of publications on this topic, follow the link: Philippines Quezon.

Journal articles on the topic 'Philippines Quezon'

Author: Grafiati

Published: 4 June 2021

Last updated: 14 February 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic 'Philippines Quezon.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Pante, Michael D. "Quezon's City: Corruption and contradiction in Manila's prewar suburbia, 1935–1941." Journal of Southeast Asian Studies 48, no. 1 (January 26, 2017): 91–112. http://dx.doi.org/10.1017/s0022463416000497.

Full text

Abstract:

Quezon City was founded in 1939 as a planned city and envisioned as the future capital of the Philippines, which was anticipating its independence in a few years. Led by President Manuel Quezon, Philippine politicians conferred upon the city narratives of nationhood and social justice to make it the best spatial representation of a nation-in-waiting. However, underneath these state-centric ideologies was the authoritarianism of the Quezon regime, which used urban politics to centralise power. But far from being a symbol of the President's undisputed dominance, Quezon City's inherent contradictions became weak points in the city's official narrative.

APA, Harvard, Vancouver, ISO, and other styles

2

Avelino, Ferchito L., G. B. Abad-Viola, F. P. Magboo, T. J. Badoy, M. C. R. Races, and M. M. Dayrit. "HIV prevention indicators in Quezon city, Philippines." Journal of Clinical Epidemiology 50 (January 1997): S27. http://dx.doi.org/10.1016/s0895-4356(97)87250-2.

Full text

APA, Harvard, Vancouver, ISO, and other styles

3

Del Mundo, Paulina Francesca, Angela Feliciano, Katrina Erika Habaluyas, Alvin Lirio, Dianne Kristine Santiago, and Aaron Young. "Predictors of Newborn Screening Utilization in Quezon City, Philippines." International Journal of Health, Wellness, and Society 10, no. 4 (2020): 61–76. http://dx.doi.org/10.18848/2156-8960/cgp/v10i04/61-76.

Full text

APA, Harvard, Vancouver, ISO, and other styles

4

Su, Glenn Sia, Janet Macawile, Annabella Villarino, Josephine Agapito, and Norma Gomez. "Recognizing Local People’s Perceptions Towards Deforestation in Quezon Province, Philippines." Environmental Research Journal 5, no. 3 (March 1, 2011): 131–35. http://dx.doi.org/10.3923/erj.2011.131.135.

Full text

APA, Harvard, Vancouver, ISO, and other styles

5

Lim, Ma Bernadeth B., Hector R. Lim, Mongkut Piantanakulchai, and Francis Aldrine Uy. "A household-level flood evacuation decision model in Quezon City, Philippines." Natural Hazards 80, no. 3 (October 17, 2015): 1539–61. http://dx.doi.org/10.1007/s11069-015-2038-6.

Full text

APA, Harvard, Vancouver, ISO, and other styles

6

Collado, Zaldy C., and Noella May-i. G. Orozco. "From displacement to resettlement: how current policies shape eviction narratives among urban poor in the Philippines." Housing, Care and Support 23, no. 2 (June 29, 2020): 49–63. http://dx.doi.org/10.1108/hcs-01-2019-0001.

Full text

Abstract:

Purpose This study aims to examine the experiences of urban poor relocatees in their resettlement communities, specifically those who were relocated from the Caloocan, Malabon, Navotas, Valenzuela and Quezon City areas to the province of Bulacan, Philippines. This study hopes to convey the importance of revisiting the law on socialized housing in the Philippines. Design/methodology/approach This study gathered qualitative data through 2 focus group discussions among 28 participants who came from 3 resettlement sites in San Jose del Monte City, Bulacan Province, Philippines. The resettlement areas are owned and managed by the National Housing Authority of the Philippine Government. Findings Results show that resettlement experiences are stories of survival under impoverished conditions. Lack of housing facilities or poorly built units characterize their relocation experience aside from having no immediate access to basic utilities such as electricity and water, despite a law that supposedly secures these rights to relocatees. The expensive cost of transportation and the lack of livelihood also heavily strain the lives of the relocated population. Originality/value This study illustrates that involuntary displacement predicts poor living conditions upon resettlement. This study is an inquiry not only of existing conditions of socialized housing in resettlement areas but also past realities of these housing communities at the onset of the displacees’ relocation.

APA, Harvard, Vancouver, ISO, and other styles

7

Alojado, Rosanna, Benette Custodio, Klarissa Mai Lasala, and Paco Lorenzo Marigomen. "Designing an Ergonomic Chair for Pedicurists and Manicurists in Quezon City, Philippines." Procedia Manufacturing 3 (2015): 1812–16. http://dx.doi.org/10.1016/j.promfg.2015.07.220.

Full text

APA, Harvard, Vancouver, ISO, and other styles

8

Orense, Rolando P., Samuel E. Sapuay, Elmer B. Billedo, and Kiyokata Matsuoka. "The 2004 Sediment Disasters in Quezon Province, Philippines Triggered by Heavy Rainfall." Soils and Foundations 46, no. 6 (December 2006): 701–11. http://dx.doi.org/10.3208/sandf.46.701.

Full text

APA, Harvard, Vancouver, ISO, and other styles

9

Rendon, Rhoshela Vi C., Bea Clarise B. Garcia, and Pierangeli G. Vital. "Assessment of airborne bacteria in selected occupational environments in Quezon City, Philippines." Archives of Environmental & Occupational Health 72, no. 3 (May 24, 2016): 178–83. http://dx.doi.org/10.1080/19338244.2016.1192981.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

Goodman, Grant K. "Bonner Fellers in the Philippines: American Colonial Prototype." Journal of American-East Asian Relations 19, no. 1 (2012): 93–102. http://dx.doi.org/10.1163/187656112x640715.

Full text

Abstract:

Bonner Fellers (1896-1973), later prominent in the American occupation of Japan, in 1936 was assigned as captain in the U.S. Army to the staff of General Douglas MacArthur in Manila. His first assignment was to organize and develop a Reserve Officers’ Service School for the newly founded Philippine Army. Fellers's letters to his wife give a private view of how he gained the confidence of both General MacArthur and Philippine Commonwealth President Manuel L. Quezon when from 1937 to 1940 he served both men as principal aide and supported them on a trip to Washington in 1937. Fellers multitasked remarkably well and was privy to the highest level of both the American and Philippine governments.

APA, Harvard, Vancouver, ISO, and other styles

11

Keim, A. P., and C. C. Tan. "A new species of Freycinetia (Pandanaceae; Freycinetoideae) from Luzon Island, the Philippines." Blumea - Biodiversity, Evolution and Biogeography of Plants 65, no. 2 (November 30, 2020): 102–3. http://dx.doi.org/10.3767/blumea.2020.65.02.02.

Full text

Abstract:

A new species of Freycinetia (Pandanaceae; Freycinetoideae) from Llavac, Quezon Province in Luzon Island, the Philippines, is proposed here, namely Freycinetia nonatoi. Freycinetia nonatoi is characterized by a lobed auricle of the sheath with conspicuous spines on the margins and bright yellow bracts. These three morphological features distinguish it from the nearest species, F. sumatrana. The discovery of F. nonatoi also marks the first record of a member of the section Auriculifoliae with spiny margins.

APA, Harvard, Vancouver, ISO, and other styles

12

Dagamac, Nikki Heherson A., Maria Angelica D. Rea-Maminta, and Thomas Edison E. dela Cruz. "Plasmodial Slime Molds of a Tropical Karst Forest, Quezon National Park, the Philippines." Pacific Science 69, no. 3 (July 2015): 411–22. http://dx.doi.org/10.2984/69.3.9.

Full text

APA, Harvard, Vancouver, ISO, and other styles

13

Ocampo, F., J. Navarro, and J. Cuanang. "A profile of stroke mimics in a tertiary hospital in Quezon City, Philippines." Journal of the Neurological Sciences 405 (October 2019): 5. http://dx.doi.org/10.1016/j.jns.2019.10.422.

Full text

APA, Harvard, Vancouver, ISO, and other styles

14

Viray, Alexandra, Doxa Dave Rotap, Louise Migraso, Nicole Cezra Sibbaluca, Emilio Christian Escobar, Anthony Buaya, and Thomas Edison dela Cruz. "Occurrence and diversity of myxomycetes (slime molds) in Polillo Island, Quezon Province, Philippines." Acta Manilana 62 (October 1, 2014): 9–17. http://dx.doi.org/10.53603/actamanil.62.2014.rjbh7786.

Full text

APA, Harvard, Vancouver, ISO, and other styles

15

Syjuco, Ma Felisa A. "Philippines - Manuel L. Quezon: The Tutelary Democrat. By Aruna Gopinath. Quezon City: New Day Publishers, 1987. Pp. xvi, 243. Footnotes, Bibliography, Index." Journal of Southeast Asian Studies 21, no. 1 (March 1990): 261–63. http://dx.doi.org/10.1017/s0022463400002484.

Full text

APA, Harvard, Vancouver, ISO, and other styles

16

Kerkvliet, Benedict J. Tria. "Randolf S. David. Reflections on Sociology and Philippine Society. Quezon City: University of the Philippines Press, 2001. 256 pages." Philippine Political Science Journal 23, no. 1 (December 16, 2002): 178–80. http://dx.doi.org/10.1163/2165025x-02301010.

Full text

APA, Harvard, Vancouver, ISO, and other styles

17

Hadsall, Annalee S., Michelle D. R. Alejado, Ariel R. Larona, and Ivy Amor F. Lambio. "Strongylodon juangonzalezii, a remarkable new species of Strongylodon (Fabaceae) from Mulanay, Quezon Province, Philippines." PhytoKeys 73 (October 18, 2016): 1–12. http://dx.doi.org/10.3897/phytokeys.73.10055.

Full text

APA, Harvard, Vancouver, ISO, and other styles

18

Banta, Vanessa. "Empathic Projections: Performance and Countermapping ofSitioSan Roque, Quezon City, and University of the Philippines." GeoHumanities 3, no. 2 (July 3, 2017): 328–50. http://dx.doi.org/10.1080/2373566x.2017.1377096.

Full text

APA, Harvard, Vancouver, ISO, and other styles

19

ALMASE, Veronica. "Microfinance Institutions (MFIs) Intervention in Poverty Alleviation of Households in Lopez, Quezon Province, Philippines." Psychology and Education Journal 58, no. 1 (January 15, 2021): 3625–31. http://dx.doi.org/10.17762/pae.v58i1.1350.

Full text

Abstract:

This paper investigates Microfinance Institutions (MFIs) Intervention in poverty alleviation of households in the locality of Lopez, Quezon province, Philippines. It focuses on five specific objectives to: Determine the personal profile of MFIs household members, their membership profile, examine the goal congruence between MFIs and households, investigate the circumstances during MFIs intervention and, finally find out threats in availing loans from MFIs. This paper adopts quantitative type of research primarily the descriptive questions survey where 117 were considered as the representative sample of MFIs in the municipality. Likewise, purposive sampling was used in the determination of samples and survey form for data collection. This study utilized the SPSS to generate the frequency distribution and weighted mean. It was revealed in the analysis that microfinance interventions that offer both savings and loans contributed to a higher standard of living of households. More so, the results show that microfinance institutions provide supplemental income for families which may adhere to basic family needs, health, education, and lessen debts to specific persons. Therefore, It was found out that both microfinance savings and microfinance credit appreciably and undoubtedly changed the conditions of every household after availing the MFIs services. The study recommends that MFIs should continuously pay closer attention on their interventions that will provide assistance that are favorable to the welfare of every member and the society as well.

APA, Harvard, Vancouver, ISO, and other styles

20

Tsai, W. S., S. L. Shih, L. M. Lee, L. M. Dolores, and L. Kenyon. "First Report of a Novel Begomovirus Associated with Yellow Vein Disease of Browne's Blechum (Blechum pyramidatum)." Plant Disease 98, no. 5 (May 2014): 701. http://dx.doi.org/10.1094/pdis-10-13-1025-pdn.

Full text

Abstract:

Browne's Blechum (Blechum pyramidatum) is a common weed found in fields and waste grounds in the Philippines. A disease was observed causing begomovirus-like yellow/chlorotic leaf veins and shortened internodes of Browne's Blechum plants on the island of Luzon, Philippines; disease incidence ranged from 10 to 50% in fields in 2012. Samples were collected from two plants with symptoms from each of Laguna and Quezon provinces and one plant without symptoms from Laguna Province. All four samples from plants with symptoms tested positive for begomovirus by PCR using primer pair PAL1v1978B/PAR1c715H (2), but the symptomless plant sample did not. However, no virus DNA-B component was detected in any of the samples using either general detection primer pair DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (1). Using abutting primers AFPH12W1-R2F (TCTGGATCCATTGTTGAACGAGT) and AFPH12W1-R2R (CCGGGATCCCACATTGTTAAACA), a complete DNA-A component sequence was obtained for a Laguna isolate (GenBank Accession No. KF446659) and for a Quezon isolate (KF446660). The Laguna and Quezon isolate sequences were 2,764 and 2,756 nucleotides, respectively, and shared 90.6% nucleotide sequence identity. Both had six open reading frames (ORFs)—two in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4)—and the geminivirus conserved sequence (TAATATTAC). Based on BLASTn searching of GenBank and sequence analysis using MEGALIGN (DNASTAR), both isolates should be considered as a new begomovirus (tentatively named Blechum yellow vein virus, BlYVV) since their DNA-A sequences share less than 89% nucleotide identity with any other begomovirus. Both DNA sequences had the highest nucleotide identity (84.8 to 87.6%) with Papaya leaf curl Guangdong virus isolates (AJ558122, AY650283, FJ495184, FJ869907, and JN703795). To our knowledge, this is the first report of a previously unidentified begomovirus associated with yellow vein disease of this species. References: (1) S. K. Green et al. Plant Dis. 85:1286, 2001. (2) W. S. Tsai et al. Plant Pathol. 60:787, 2011.

APA, Harvard, Vancouver, ISO, and other styles

21

Kiefer, Thomas M. "Filipino Muslims: Their Social Institutions and Cultural Achievements. Edited by F. Landa Jocano. Quezon City: University of the Philippines, Asian Center, 1983. viii, 202 pp. Bibliography, Index. N.p. (Distributed by Asian Center, University of the Philippines, Diliman, Quezon City, Philippines.)." Journal of Asian Studies 45, no. 4 (August 1986): 907–8. http://dx.doi.org/10.2307/2056154.

Full text

APA, Harvard, Vancouver, ISO, and other styles

22

Pagkalinawan, Homer. "Measuring the Street Layout Orientation Entropy of Cities in the Philippines." Abstracts of the ICA 1 (July 15, 2019): 1–2. http://dx.doi.org/10.5194/ica-abs-1-285-2019.

Full text

Abstract:

<p><strong>Abstract.</strong> Selected cities in the Philippines follow, to a certain extent, an organized street layout and orientation based on a designed plan including major cities like Manila and Quezon City. However, others cities developed organically on a less organized manner, expanding haphazardly. Being the spatial backbone of these cities, street patterns controls and limits the flow of people, goods, and activities. Measuring entropy, or the state of orderliness or disorderliness, of a street network can assess the difference between a planned and an unplanned city development. Possibly, it can be correlated to the various socioeconomic variables e.g. population, density, income level, poverty level, etc. or environmental variables e.g. night time light data, urban heat, vegetation cover, etc., that characterizes a city.</p>

APA, Harvard, Vancouver, ISO, and other styles

23

UIBLEIN, FRANZ, and MARK MCGROUTHER. "A new deep-water goatfish of the genus Upeneus (Mullidae) from northern Australia and the Philippines, with a taxonomic account of U. subvittatus and remarks on U. mascareinsis." Zootaxa 3550, no. 1 (November 15, 2012): 61. http://dx.doi.org/10.11646/zootaxa.3550.1.4.

Full text

Abstract:

Upeneus stenopsis n. sp. is described based on four specimens collected off northern Australia and Quezon Island,Philippines, at depths between 165 to 275 m and compared with four closely related species: the deep-water dwellingUpeneus davidaromi (Red Sea) and U. mascareinsis (Western Indian Ocean) and the shallow Indo-West Pacific species,U. subvittatus and U. vittatus. The new species can be distinguished from all other Upeneus species by a narrow caudalpeduncle and a combination of morphometric and meristic characters. This is the first record of a deep-water goatfish ofthe genus Upeneus from the Pacific. A juvenile Upeneus collected off Quezon at 127–142 m depth was also assigned tothe new species and compared to four similar-sized (69–79 mm SL) specimens of U. mascareinsis. A diagnosis is providedfor U. subvittatus, along with evidence of its occurrence in the Eastern Indian Ocean and interspecific comparisons. Thecontinued need to screen scientific fish collections for the occurrence of undescribed species that have successfully colonized and adapted to the depth zone surrounding the ocean margin is outlined.

APA, Harvard, Vancouver, ISO, and other styles

24

Yektiningtyastuti, Yektiningtyastuti, Roberto C. Sombillo, and Annabelle R. Borromeo. "Sikap dan Keterampilan Perawat tentang Pijat Bayi di St. Luke’s Medical Center, Quezon City, Philippines." Jurnal Kesehatan 8, no. 1 (April 30, 2017): 139. http://dx.doi.org/10.26630/jk.v8i1.398.

Full text

APA, Harvard, Vancouver, ISO, and other styles

25

Brillo, Bing Baltazar C. "Status, Governance and Development of Gunao Lake: The Little-Known Lake of Dolores, Quezon, Philippines." Asian Journal of Water, Environment and Pollution 17, no. 1 (January 25, 2020): 27–33. http://dx.doi.org/10.3233/ajw200003.

Full text

APA, Harvard, Vancouver, ISO, and other styles

26

Su, Glenn. "Larval Mosquito Diversity and Distribution in Rice Field Agro-Ecosystems in Sariaya, Quezon Province, Philippines." Annual Research & Review in Biology 4, no. 18 (January 10, 2014): 2884–91. http://dx.doi.org/10.9734/arrb/2014/10128.

Full text

APA, Harvard, Vancouver, ISO, and other styles

27

Obdianela, Maria Camila N., Ma Patricia Venice V. Guanlao, Essex Vladimer E. Samaniego, and Kathleen O. Pornobi. "Prevalence and Host Specificity of Bat Flies (Streblidae) from Selected Caves in Unisan, Quezon, Philippines." Acta Parasitologica 66, no. 3 (March 26, 2021): 983–88. http://dx.doi.org/10.1007/s11686-021-00373-9.

Full text

APA, Harvard, Vancouver, ISO, and other styles

28

Del Rosario, Peter Jerome B. "Hermeneutic analysis of the San Isidro Pahiyas Festival as a development communication medium in Lucban, Quezon, Philippines." Journal of Hospitality and Tourism Insights 2, no. 2 (June 3, 2019): 203–20. http://dx.doi.org/10.1108/jhti-01-2019-0002.

Full text

Abstract:

Purpose Only few festival studies in the Philippines attempted to examine the capability of festivals as folk media to communicate development. The purpose of this paper is to analyze the development-oriented activities and messages in the San Isidro Pahiyas Festival in Lucban, Quezon. Design/methodology/approach The researcher conducted participant observation, ethnographic photography, key informant interview and record review. A historical analysis of the festival’s background, thematic analysis of its list of programs, visual analysis of the photographs guided by Barthes’ (1964) semiology and hermeneutics were employed. Findings Formerly a native ritual before the Hispanic rule in the country, the San Isidro Pahiyas Festival is currently held by the Local Government of Lucban, Quezon, primarily for touristic purposes. The festival’s activities in 2015 reflected the municipality’s dependence on agriculture and the residents’ religiosity, skills and creativity. The adornments during the said celebration likewise gave a glimpse of the residents’ social status, livelihood sources and reverence to Saint Isidore. Through hermeneutics, the researcher also found issues on the residents’ idolatry and their motivation to display their produce during the festival. Research limitations/implications The findings of this study can only hold true for the 2015 celebration of the San Isidro Pahiyas Festival. Despite this, the study finds hermeneutics and Barthes’ (1964) semiology useful for festival studies. It also appeals to folk media studies and postcolonial theories. Originality/value This research provides an unconventional methodology for festival studies, which contributes to the very limited hermeneutic tourism studies abroad and folk media studies in the Philippines.

APA, Harvard, Vancouver, ISO, and other styles

29

Valles, J. J., C. Perez, and A. C. Blanco. "GEOSPATIAL AND CLUSTERING ANALYSIS OF DENGUE CASES USING SELF-ORGANIZING MAPS: CASE OF QUEZON CITY, 2010–2015." ISPRS - International Archives of the Photogrammetry, Remote Sensing and Spatial Information Sciences XLII-4/W19 (December 23, 2019): 455–62. http://dx.doi.org/10.5194/isprs-archives-xlii-4-w19-455-2019.

Full text

Abstract:

Abstract. Dengue is the most rapidly spreading disease in the world with more than 30% of the world’s population at risk of contracting dengue. In 2016, more than 375,000 suspected cases of dengue were reported from the Western Pacific Region, and more than half of these were reported by the Philippines. Dengue virus inflicts significant health and economic burden to the Philippines. Thus, it is important to improve the country’s current schemes for dengue surveillance and response thru better understanding and knowledge on the development of dengue. In this research, geospatial and clustering analyses of dengue cases in Quezon City through GIS and self-organizing maps (SOM) were performed. Two clusters were generated for each clustering method. After clustering the barangays, the coefficient of determination increased for most scenarios compared to the OLS regression of the ungrouped data. The R2 values for the regression of whole Quezon City dataset ranged from 0.364 to 0.671, while it ranged from 0.468 to 0.839 for the SOM-clustered dataset. On the other hand, for the k-means-clustered dataset, R2 values ranged from 0.395 to 0.945. Moreover, GWR models’ adjusted R2 values ranged from 0.675 to 0.876. Common predictors among the different regression models are the informal settlements and very low residential areas. Based on the significant predictors identified and the trend of the dengue cases, SOM produced more logical classification than the GIS Grouping Analysis. Although SOM takes a longer time compared to the GIS Grouping Analysis, SOM is easier and simpler to implement.

APA, Harvard, Vancouver, ISO, and other styles

30

Raza, Tabassam, Frederika C. Rentoy, Nisar Ahmed, Andrea Valentine L. Andres Thess Khas S. Raza, Karl Michael E. Marasigan, and Ramon Iñigo M. Espinosa. "Water challenges and Urban Sustainable Development in Changing Climate: Economic Growth Agenda for Global South." European Journal of Sustainable Development 8, no. 4 (October 1, 2019): 421. http://dx.doi.org/10.14207/ejsd.2019.v8n4p421.

Full text

Abstract:

Access to safe clean water and sanitation were pressing concerns for survivors after super Typhoon Haiyan devastated central Philippines in November 2013. Essentially, water problems in the cities of Global South especially in Southeast Asian Archipelagos (Philippines, Indonesia, and Malaysia) plus Myanmar and Thailand are viewed as the consequence of uncontrolled rapid urban development and Climate Change (CC) variations. These facts emphasized the link between water insecurity and its negative economic impact. Thus, an equal and inclusive agenda is developed without which universal access to drinking water, sanitation, and hygiene is not possible. It comprises of conducting gender-sensitive strategic planning workshops and strategic spatial analysis using Geographic Information Systems. It was implemented to Quezon City (QC), Philippines as pilot. The output is an action plan defining 15 Programs, Projects and Activities (PPAs) as solutions for water challenges across five development sectors (Social, Economic, Environmental, Land Use/Infrastructure, and Institutional) in the Philippines context. The appropriate implementation of these PPAs will ensure QC‟s sustainable development, CC-resiliency, and its contribution to the country‟s economic growth. The framework used is flexible and can be fashioned for the other cities in Global South countries and other regions.Keywords: Sustainable Development, Climate Change, Inclusive, Economic, Action Plan

APA, Harvard, Vancouver, ISO, and other styles

31

Labaria, Elirozz Carlie, Charlotte Kendra Gotangco, and Mary Jean Caleda. "Framing the Role of and Defining Criteria for Usefulness of Citizen Satisfaction Surveys in Local Urban Environmental Management." Environment and Urbanization ASIA 8, no. 2 (August 28, 2017): 214–29. http://dx.doi.org/10.1177/0975425317716608.

Full text

Abstract:

The delivery of urban environmental services is among the functions devolved to local governments. As public services, they are routinely evaluated typically using ‘hard’ performance measures. The current trend of local governance incorporates citizens’ perspectives in assessing service performance. In this study, the importance and ‘usefulness’ of citizen satisfaction surveys in local urban environmental management are explored using the case of the local government of unit (LGU) of Quezon City, Philippines and its experience with the Citizen Satisfaction Index System (CSIS). For Quezon City, citizen satisfaction ratings are an important indication of city performance. For the Environmental Protection and Waste Management Department (EPWMD), data and information is considered ‘useful’ if it is (1) able to help craft the future directions of the Department, (2) able to help identify the services that can be removed, (3) able to reflect actionable community feedback, (4) presented in the form of disaggregated data and evidence and (5) easy to interpret by the users. In applying the criteria to evaluate the data and information generated from the CSIS 2014 and 2016, the study demonstrates the merits of using ‘soft’ performance measures in appraising and improving local urban environmental services.

APA, Harvard, Vancouver, ISO, and other styles

32

Adornado, Henry A., Masao Yoshida, and Henry A. Apolinares. "Erosion Vulnerability Assessment in REINA, Quezon Province, Philippines with Raster-based Tool Built within GIS Environment." Agricultural Information Research 18, no. 1 (2009): 24–31. http://dx.doi.org/10.3173/air.18.24.

Full text

APA, Harvard, Vancouver, ISO, and other styles

33

GALON, Eloiza May S., Rochelle Haidee D. YBAÑEZ, Paul Franck ADJOU MOUMOUNI, Maria Agnes TUMWEBAZE, Ralph Joselle A. FABON, Mary Ruth R. CALLANTA, Kim Joseph E. LABUTONG, et al. "Molecular survey of tick-borne pathogens infecting backyard cattle and water buffaloes in Quezon province, Philippines." Journal of Veterinary Medical Science 82, no. 7 (2020): 886–90. http://dx.doi.org/10.1292/jvms.19-0636.

Full text

APA, Harvard, Vancouver, ISO, and other styles

34

Che Man, W. K. "The Philippines - Understanding Islam and Muslims in the Philippines. Edited by Peter Gowing. Quezon City: New Day Publishers, 1988. Pp. x, 176. Notes." Journal of Southeast Asian Studies 22, no. 1 (March 1991): 214–15. http://dx.doi.org/10.1017/s0022463400005944.

Full text

APA, Harvard, Vancouver, ISO, and other styles

35

Lambert, Frank R. "Some key sites and significant records of birds in the Philippines and Sabah." Bird Conservation International 3, no. 4 (December 1993): 281–97. http://dx.doi.org/10.1017/s0959270900002562.

Full text

Abstract:

SummaryBetween June 1989 and October 1990 casual records of rare birds were made in Sabah and on Sipadan Island, Malaysia, and on Luzon, Negros, Bohol and Mindanao, Philippines, with additional observations on Palawan and Tawitawi, Philippines, in August and September 1991. Key sites for bird conservation profiled here are the Angat watershed, Quezon National Park and Candaba Marsh (all on Luzon), Mt Canlaon (Negros), Rajah Sukituna National Park (Bohol), Mt Katanglad (Mindanao), remaining forest on both Tawitawi and Sipadan, and the Danum Valley in Sabah. Notes are provided on 31 species of bird, 17 already considered threatened, three near-threatened. While one threatened species (Nicobar Pigeon Caloenas nicobarica) should be downlisted, at least six species (Spotted Imperial-pigeon Ducula carola, Blue-winged Racquet-tail Prioniturus verticalis, Blue-naped Parrot Tanygnathus lucionensis, McGregor's Cuckoo-shrike Coracina mcgregori, Falcated Wren-babbler Ptilocichla falcata and Palawan Flycatcher Ficedula platenae) should be elevated to threatened status. Records for other species supplement and reinforce current assessments of threat or indicate new distributional or taxonomic information on non-threatened forms.

APA, Harvard, Vancouver, ISO, and other styles

36

Kraft, Herman Joseph S. "Patricio N. Abinales. Images of State Power: Essays on Philippine Politics from the Margins. Quezon City: University of the Philippines Press, 1998.191 pages." Philippine Political Science Journal 20, no. 1 (December 8, 1999): 163–68. http://dx.doi.org/10.1163/2165025x-02001006.

Full text

APA, Harvard, Vancouver, ISO, and other styles

37

Alvarez, A. M. J. "Focal Nodes Identification Using Habitat Availability Concept for Simulation of Ecological Connectivity Network of Quezon City, Philippines." IOP Conference Series: Earth and Environmental Science 501 (June 11, 2020): 012013. http://dx.doi.org/10.1088/1755-1315/501/1/012013.

Full text

APA, Harvard, Vancouver, ISO, and other styles

38

Manegdeg, F., L. O. Coronado, and R. Paña. "Medical waste treatment and electricity generation using pyrolyzer-rankine cycle for specialty hospitals in Quezon City, Philippines." IOP Conference Series: Earth and Environmental Science 463 (April 7, 2020): 012180. http://dx.doi.org/10.1088/1755-1315/463/1/012180.

Full text

APA, Harvard, Vancouver, ISO, and other styles

39

Principe, Fritz Jerald V., Jeanette Angeline B. Madamba, James Roldan S. Reyes, Loida E. Mojica, and Mar B. Cruz. "Factors Influencing Farmers’ Decisions in Farm Machineries Usage: The Case of Vegetable Farmers in Quezon Province, Philippines." Asian Trade Association 7, no. 2 (December 31, 2020): 59–82. http://dx.doi.org/10.22447/jatb.7.2.202012.59.

Full text

APA, Harvard, Vancouver, ISO, and other styles

40

Regilme, Salvador Santino F. "Wiegele, Katherine. 2007. Investing in Miracles: El Shaddai and the Transformation of Popular Catholicism in the Philippines. Quezon City, Philippines: Ateneo de Manila University Press." Philippine Political Science Journal 31, no. 1 (December 21, 2010): 158–62. http://dx.doi.org/10.1163/2165025x-03101008.

Full text

APA, Harvard, Vancouver, ISO, and other styles

41

Gutierrez, Kathleen Cruz. "Traditional Medicine in the Colonial Philippines: 16th to the 19th Century. By Ma. Mercedes G. Planta. Quezon City, Philippines: University of the Philippines Press, 2017. xxx, 249 pp. ISBN: 9789715428255 (paper)." Journal of Asian Studies 78, no. 4 (November 2019): 988–90. http://dx.doi.org/10.1017/s0021911819001748.

Full text

APA, Harvard, Vancouver, ISO, and other styles

42

PRANADA, MC ANDREW K., CHRISTINE JOY S. LUNA, NOE P. MENDEZ, and MA ELEANOR CALAPATIA-SALVADOR. "Begonia depressinerva (sect. Baryandra, Begoniaceae), a new species from Luzon Island, the Philippines." Phytotaxa 425, no. 3 (December 5, 2019): 154–62. http://dx.doi.org/10.11646/phytotaxa.425.3.5.

Full text

Abstract:

A new peltate species of Begonia sect. Baryandra from Kidadayaig Falls, General Nakar, Quezon is described and illustrated here. The new species, B. depressinerva, is diagnosed against the morphologically similar B. tayabensis. The two species are similar by having rhizomatous stem, peltate, ovate leaf, and 5-tepalled pistillate flower, but the new species is remarkably different by having densely pilose, asymmetric leaf blade, densely pilose petiole that is inserted much closer to the basal margin, obtuse to subobtuse staminate flower outer tepal apex, and glandularly hairy ovary. B. depressinerva is proposed to be Vulnerable (VU) D1, following the guidelines of the IUCN.

APA, Harvard, Vancouver, ISO, and other styles

43

Alcantara, C. A., J. D. Escoto, A. C. Blanco, A. B. Baloloy, J. A. Santos, and R. R. Sta. Ana. "GEOSPATIAL ASSESSMENT AND MODELING OF URBAN HEAT ISLANDS IN QUEZON CITY, PHILIPPINES USING OLS AND GEOGRAPHICALLY WEIGHTED REGRESSION." ISPRS - International Archives of the Photogrammetry, Remote Sensing and Spatial Information Sciences XLII-4/W16 (October 1, 2019): 85–92. http://dx.doi.org/10.5194/isprs-archives-xlii-4-w16-85-2019.

Full text

Abstract:

Abstract. Urbanization has played an important part in the development of the society, yet it is accompanied by environmental concerns including the increase of local temperature compared to its immediate surroundings. The latter is known as Urban Heat Islands (UHI). This research aims to model UHI in Quezon City based on Land Surface Temperature (LST) estimated from Landsat 8 data. Geospatial processing and analyses were performed using Google Earth Engine, ArcGIS, GeoDa, and SAGA GIS. Based on Urban Thermal Field Variance Index (UTFVI) and the normalized mean per barangay (village), areas with strong UHI intensities were mapped and characterized. high intensity UHIs are observed mostly in areas with high Normalized Difference Built-up Index (NDBI) like the residential regions while the weak intensity UHIs are noticed in areas with high Normalized Difference Vegetation Index (NDVI) near the La Mesa Reservoir. In the OLS regression model, around 69% of LST variability is explained by Surface Albedo (SA), Sky View Factor (SVF), Surface Area to Volume Ratio (SVR), Solar Radiation (SR), NDBI and NDVI. OLS yield relatively high residuals (RMSE = 1.67) and the residuals are not normally distributed. Since LST is non-stationary, Geographically Weighted Regression (GWR) regression was conducted, proving normally and randomly distributed residuals (average RMSE = 0.26).

APA, Harvard, Vancouver, ISO, and other styles

44

Manlapaz, Jerry V., Gianna Victoria H. Ganotisi, Maria Kristen L. Ferrer, Jmi C. Dela Cruz, Kristine Nicole L. Eclevia, Airine A. Diquino, Samantha Ysabelle L. Gimenez, Christine Joy V. Enderez, and Armand Sebastian III D. Del Rosario. "Level of Knowledge, Attitude, and Practices on Leptospirosis among Residents in a Selected Community in Quezon City, Philippines." Annals of Tropical Medicine and Public Health 22, no. 11 (2019): 368–73. http://dx.doi.org/10.36295/asro.2019.221148.

Full text

APA, Harvard, Vancouver, ISO, and other styles

45

Abasolo, A., and O. Zamora. "Life cycle analysis of monocrop and multicrop in conventional and organic vegetable production systems in Tayabas, Quezon, Philippines." IOP Conference Series: Earth and Environmental Science 230 (February 19, 2019): 012007. http://dx.doi.org/10.1088/1755-1315/230/1/012007.

Full text

APA, Harvard, Vancouver, ISO, and other styles

46

Samonte, Genesis May J., Jessica Raphaela G. Mirano, John Edgar S. Tiu, Natasha Denise S. Montevirgen, Lyka Eunice F. Trinidad, Aiza F. Baldonado, Jay Arian Caparida, et al. "Together We Can Get There: Participatory Assessment of the Needs of Young M/TSM in Quezon City, Philippines." Annals of Epidemiology 27, no. 8 (August 2017): 515–16. http://dx.doi.org/10.1016/j.annepidem.2017.07.059.

Full text

APA, Harvard, Vancouver, ISO, and other styles

47

Villegas, Edberto M. "Dante C. Simbulan. 2005. The Modern Principalia: The Historical Evolution of the Philippine Ruling Oligarchy. Diliman, Quezon City: University of the Philippines Press. 350 pages." Philippine Political Science Journal 30, no. 1 (December 16, 2009): 123–26. http://dx.doi.org/10.1163/2165025x-03001005.

Full text

APA, Harvard, Vancouver, ISO, and other styles

48

Lagahit, M. L. R., and A. C. Blanco. "USING OPENLY SOURCED 3D GEOGRAPHIC INFORMATION SYSTEMS (GIS) IN DETERMINING THE PHOTOVOLTAIC POTENTIAL OF QUEZON CITY HALL IN TERMS OF RECEIVED DIRECT SOLAR RADIATION." ISPRS - International Archives of the Photogrammetry, Remote Sensing and Spatial Information Sciences XLII-4/W19 (December 23, 2019): 263–70. http://dx.doi.org/10.5194/isprs-archives-xlii-4-w19-263-2019.

Full text

Abstract:

Abstract. For the past few years the United Nations have been standing strong in advocating the 17 sustainable development goals. One of those goals focuses on affordable and clean energy, which includes renewable energy. This study focuses on the application of geomatics on renewable energy, more specifically solar energy. The research aims to determine the photovoltaic potential of Quezon City Hall in the Philippines by calculating the amount of direct solar radiation it receives through a process that uses only openly sourced 3D GIS (Geographic Information Systems). The methodology mainly consists of (1) generating a building model composed of points that contains heights derived from a LiDAR (Light Detection and Ranging) based NDSM (Normalized Digital Surface Model) through the combined use of Python and QGIS, (2) determining the intersections between the building model and the sun’s light rays, incorporating shadow factors and integrating solar irradiation values using Python, and (3) visualizing and gridding for analysis through the combined use of Blender, QGIS and a Spreadsheet software. Results have shown that Quezon City Hall has good photovoltaic potential since: solar irradiation values in 2017 has shown that the city hall receives 800 W/m2 to 1000 W/m2 on average from 08:00 to 16:00, and all faces of the building receive solar radiation. This means that all sides of the building can be proper candidates for solar panel or for Building Integrated Photovoltaics (BIPV) installations.

APA, Harvard, Vancouver, ISO, and other styles

49

Sali, Abdul Haiy Abdul, and Arlyne Canales Marasigan. "Madrasah Education Program implementation in the Philippines: an exploratory case study." International Journal of Comparative Education and Development 22, no. 3 (June 29, 2020): 201–17. http://dx.doi.org/10.1108/ijced-06-2019-0034.

Full text

Abstract:

PurposeThe purpose of the paper is to explore the implementation of Madrasah Education Program (MEP) in selected Arabic Language and Islamic Values Education (ALIVE) schools in Quezon City, Philippines and identify some challenges faced in their implementation practice.Design/methodology/approachThis study utilized qualitative method of research using exploratory study, employing in-depth interviews, document analysis, and observation. The authors used purposive sampling with eight research participants: one Administrator, three ALIVE Coordinators, and four Madrasah Teachers or Asatidz.FindingsThe main findings in the MEP implementation, generally, the schools delivered some program goals through institutional support, pedagogical and instructional development, and enrichment of cultural diversity in the school community. However, the study identified some major challenges affecting the program implementation in selected ALIVE schools such as: lack of permanent infrastructure, limited instructional resources, learners' absenteeism, low and delayed Asatidz allowances, and cultural variances among Muslim Filipinos.Research limitations/implicationsThe results of the study provide a general overview of MEP implementation and the major challenges experienced by program implementers. However, the study is limited to three selected ALIVE schools in the Philippines.Practical implicationsThese results are useful in guiding education stakeholders in evidence-based policymaking to further improve the implementation of Madrasah Education.Originality/valueThis study provides enrichment of evidence-based research especially on the lived experiences of grassroots implementers. Fewer studies on Madrasah Education were conducted outside the Bangsamoro Autonomous Region (BARMM) particularly in the context of a non-Muslim dominated locale.

APA, Harvard, Vancouver, ISO, and other styles

50

Siler, Cameron D., Luke J. Welton, Jessi M. Siler, Joseph Brown, Abner Bucol, Arvin C. Diesmos, and Rafe M. Brown. "Amphibians and Reptiles, Luzon Island, Aurora Province and Aurora Memorial National Park, northern Philippines: new island distribution records." Check List 7, no. 2 (March 1, 2011): 182. http://dx.doi.org/10.15560/7.2.182.

Full text

Abstract:

We report 35 new amphibian and reptile distribution records for two regions within the southern Sierra Madre Mountain Range, Aurora Province, central Luzon Island, Philippines. Together with results of our previous survey work in Aurora, our new data result in a total of 82 amphibian and reptile species for the area. These results highlight the degree to which the island’s biodiversity continues to be underestimated and poorly understood. We report on observations of rarely encountered species including the skink Sphenomorphus leucospilos, the forest gecko Luperosaurus cf. cumingii, and a sensational new species of monitor lizard, Varanus bitatawa. Our recent collections clarify the conservation status of the “critically endangered” Polillo Island forest frog Platymantis polillensis, now known to be widespread, abundant, and common throughout Camarines Norte, Quezon, and Aurora Provinces on the adjacent mainland of Luzon Island. These results add to our growing understanding of many species’ distributions in the region.

APA, Harvard, Vancouver, ISO, and other styles

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!