Journal articles: 'Phytophthora alni'

1

Pintos Varela, C., C. Rial Martínez, J. P. Mansilla Vázquez, and O. Aguín Casal. "First Report of Phytophthora Rot on Alders Caused by Phytophthora alni subsp. alni in Spain." Plant Disease 94, no. 2 (February 2010): 273. http://dx.doi.org/10.1094/pdis-94-2-0273a.

Full text

Abstract:

Phytophthora alni, a soil- and waterborne pathogen, causes aggressive root and collar rot on riparian alder populations (1,2,4). The disease has been described from several European countries with a destructive impact in Great Britain (1,2). All European alder species and the red alder (Alnus rubra) are highly susceptible. P. alni has multiple variants that have been placed in three subspecies: P. alni subsp. alni, P. alni subsp. uniformis, and P. alni subsp. multiformis (1). In July 2009, a survey of symptoms of Phytophthora rot from A. glutinosa at 20 riparian stands along the Avia River in Galicia (northwest Spain) was conducted. Affected trees showed symptoms of Phytophthora rot including abnormally small, sparse, and yellowish foliage, dieback in the canopy, necroses of the inner bark and cambium, and bleeding cankers on the trunks (2,4). Phytophthora spp. were baited from saturated rhizosphere soil and watercourses using oak leaflets (4). Roots and tissue from fresh active inner bark lesions were transferred to selective medium V8-PARPH agar (4) and incubated for 7 days at 22°C in the dark. A Phytophthora sp. was isolated, transferred to carrot agar (CA), and incubated in the dark. Colonies were appressed, often irregular in outline, and with limited aerial mycelium (1). Growth on CA occurred from 4 to 31°C with optimum growth at 23 to 25°C. Chlamydospores were not observed. Ellipsoid, nonpapillate, noncaducous sporangia had a length/breadth average ratio of 1.4. Nesting and extended internal proliferation occurred. Oogonia, antheridia, and oospores were abundantly produced in a single culture. Oogonia with tapered stalks were spherical (mature oogonia 38 to 50 μm in diameter) and some had ornamented walls or bullate protuberances (1,2). Antheridia were large, amphigynous, and predominantly two-celled (23 to 37 × 16 to 23 μm). Oospores were plerotic. Distorted comma-shaped or smaller oogonia and aborted oospores were observed (1). Amplification of DNA was accomplished by using sequence-characterized amplification region-PCR primers (3). The amplicon sizes obtained were identical to P. alni subsp. alni (3). Internal transcribed spacer (ITS)-DNA and nadh1 mitochondrial gene were also amplified. DNA sequences of ITS and mt-DNA regions were deposited in GenBank (Nos. GU108602 and GU108603). Comparison of the sequences showed 100% homology with P. alni subsp. alni (GenBank Nos. FJ746679 and DQ202490). P. alni subsp. alni was recovered from trees at 3 of 20 riparian alder stands with symptoms. Pathogenicity of one representative isolate was confirmed by inoculating 10 3-year-old A. glutinosa seedlings grown in pots. One shallow cut was made into the bark at the collar level. A colonized agar plug, from the margin of an actively growing colony of P. alni subsp. alni, was inserted beneath the flap that was sealed with Parafilm. Five controls seedlings received only sterile CA agar plugs. Plants were incubated at 24°C and 95% humidity for 30 days. On inoculated plants, necroses progressed bidirectionally from the wound, and dead leaves and wilting of shoots were observed. P. alni subsp. alni was recovered from inoculated seedlings, but not from controls. To our knowledge, this is the first report of Phytophthora rot on alder caused by P. alni subsp. alni in Spain. References: (1) C. M. Brasier et al. Mycol. Res. 108:1172, 2004. (2) J. Gibbs et al. For. Comm. Bull. 126, 2003 (3) R. Ioos et al. Eur. J. Plant Pathol. 112:323, 2005. (4) T. Jung et al. Plant Pathol. 53:197, 2004.

APA, Harvard, Vancouver, ISO, and other styles

2

Štěpánková, P., K. Černý, V. Strnadová, P. Hanáček, and M. Tomšovský. "Identification of Phytophthora alni subspecies in riparian stands in the Czech Republic." Plant Protection Science 49, Special Issue (November 19, 2013): S3—S10. http://dx.doi.org/10.17221/41/2013-pps.

Full text

Abstract:

In the Czech Republic, Phytophthora alni was first confirmed in 2001 and the pathogen has been quickly spreading and occupying almost the whole area of the country. The pathogen attacks Alnus glutinosa or A. incana to a lesser extent and causes considerable losses of alder trees along hundreds of kilometres of riverbanks. The aim of our work was to perform the identification of P. alni isolates at the subspecific level using PCR and to determine the frequencies and distribution of particular subspecies. The allele-specific PCR primers focused on allele diversity of orthologs of ASF-like, TRP1, RAS-Ypt, and GPA1 genes were selected for identification. Eighty-eight per cent of the 59 analysed isolates belonged to P. alni ssp. alni while 12% were P. alni ssp. uniformis. P. alni ssp. multiformis has not been recorded in the country till now. The two subspecies differed in distribution. P. alni ssp. alni dominated in riparian stands along broader rivers in lowlands and the results confirmed the more effective spreading of P. alni ssp. alni based on its higher aggressiveness and ecological advantage. P. alni ssp. uniformis was acquired rather from riparian stands of small watercourses at higher altitudes. The insular distribution of P. alni ssp. uniformis may represent the remains of its former occurrence. Therefore, P. alni ssp. uniformis may be an indigenous subspecies suppressed by the more aggressive related taxon.

APA, Harvard, Vancouver, ISO, and other styles

3

Ioos, Renaud, Franck Panabières, Benoît Industri, Axelle Andrieux, and Pascal Frey. "Distribution and Expression of Elicitin Genes in the Interspecific Hybrid Oomycete Phytophthora alni." Applied and Environmental Microbiology 73, no. 17 (June 29, 2007): 5587–97. http://dx.doi.org/10.1128/aem.00721-07.

Full text

Abstract:

ABSTRACT Phytophthora alni subsp. alni, P. alni subsp. multiformis, and P. alni subsp. uniformis are responsible for alder disease in Europe. Class I and II elicitin gene patterns of P. alni subsp. alni, P. alni subsp. multiformis, P. alni subsp. uniformis, and the phylogenetically close species P. cambivora and P. fragariae were studied through mRNA sequencing and 3′ untranslated region (3′UTR)-specific PCRs and sequencing. The occurrence of multiple 3′UTR sequences in association with identical elicitin-encoding sequences in P. alni subsp. alni indicated duplication/recombination events. The mRNA pattern displayed by P. alni subsp. alni demonstrated that elicitin genes from all the parental genomes are actually expressed in this allopolyploid taxon. The complementary elicitin patterns resolved confirmed the possible involvement of P. alni subsp. multiformis and P. alni subsp. uniformis in the genesis of the hybrid species P. alni subsp. alni. The occurrence of multiple and common elicitin gene sequences throughout P. cambivora, P. fragariae, and P. alni sensu lato, not observed in other Phytophthora species, suggests that duplication of these genes occurred before the radiation of these species.

APA, Harvard, Vancouver, ISO, and other styles

4

Redondo, Miguel A., Johanna Boberg, Christer H. B. Olsson, and Jonàs Oliva. "Winter Conditions Correlate with Phytophthora alni Subspecies Distribution in Southern Sweden." Phytopathology® 105, no. 9 (September 2015): 1191–97. http://dx.doi.org/10.1094/phyto-01-15-0020-r.

Full text

Abstract:

During the last century, the number of forest pathogen invasions has increased substantially. Environmental variables can play a crucial role in determining the establishment of invasive species. The objective of the present work was to determine the correlation between winter climatic conditions and distribution of two subspecies of the invasive forest pathogen Phytophthora alni: P. alni subspp. alni and uniformis killing black alder (Alnus glutinosa) in southern Sweden. It is known from laboratory experiments that P. alni subsp. alni is more pathogenic than P. alni subsp. uniformis, and that P. alni subsp. alni is sensitive to low temperatures and long frost periods. By studying the distribution of these two subspecies at the northern limit of the host species, we could investigate whether winter conditions can affect the geographical distribution of P. alni subsp. alni spreading northward. Sixteen major river systems of southern Sweden were systematically surveyed and isolations were performed from active cankers. The distribution of the two studied subspecies was highly correlated with winter temperature and duration of periods with heavy frost. While P. alni subsp. uniformis covered the whole range of temperatures of the host, P. alni subsp. alni was recovered in areas subjected to milder winter temperatures and shorter frost periods. Our observations suggest that winter conditions can play an important role in limiting P. alni subsp. alni establishment in cold locations, thus affecting the distribution of the different subspecies of P. alni in boreal regions.

APA, Harvard, Vancouver, ISO, and other styles

5

Nave, Corina, Juliette Schwan, Sabine Werres, and Janett Riebesehl. "Alnus glutinosa Threatened by Alder Phytophthora: A Histological Study of Roots." Pathogens 10, no. 8 (August 3, 2021): 977. http://dx.doi.org/10.3390/pathogens10080977.

Full text

Abstract:

Alder dieback remains a major problem in European alder stands and its spread continues to threaten their existence. The causal agent of this disease is the so-called alder Phytophthora species complex, which includes the hybrid Phytophthora ×alni and its parental species P. uniformis and P. ×multiformis. Little is known about the survival of these Phytophthora species in alder. The aim of our investigations was to find out whether, and if so where, the pathogen survives. The subject of these studies was alder roots. Therefore, artificial infection studies and histological studies with P. ×alni and P. uniformis were carried out on seedlings of black alder (Alnus glutinosa). These histological studies revealed oogonia and oospores of P. ×alni and P. uniformis in different parts of the root tissue.

APA, Harvard, Vancouver, ISO, and other styles

6

Aguayo, Jaime, Gerard C. Adams, Fabien Halkett, Mursel Catal, Claude Husson, Zoltán Á. Nagy, Everett M. Hansen, Benoît Marçais, and Pascal Frey. "Strong Genetic Differentiation Between North American and European Populations of Phytophthora alni subsp. uniformis." Phytopathology® 103, no. 2 (February 2013): 190–99. http://dx.doi.org/10.1094/phyto-05-12-0116-r.

Full text

Abstract:

Alder decline caused by Phytophthora alni has been one of the most important diseases of natural ecosystems in Europe during the last 20 years. The emergence of P. alni subsp. alni —the pathogen responsible for the epidemic—is linked to an interspecific hybridization event between two parental species: P. alni subsp. multiformis and P. alni subsp. uniformis. One of the parental species, P. alni subsp. uniformis, has been isolated in several European countries and, recently, in North America. The objective of this work was to assess the level of genetic diversity, the population genetic structure, and the putative reproduction mode and mating system of P. alni subsp. uniformis. Five new polymorphic microsatellite markers were used to contrast both geographical populations. The study comprised 71 isolates of P. alni subsp. uniformis collected from eight European countries and 10 locations in North America. Our results revealed strong differences between continental populations (Fst = 0.88; Rst = 0.74), with no evidence for gene flow. European isolates showed extremely low genetic diversity compared with the North American collection. Selfing appears to be the predominant mating system in both continental collections. The results suggest that the European P. alni subsp. uniformis population is most likely alien and derives from the introduction of a few individuals, whereas the North American population probably is an indigenous population.

APA, Harvard, Vancouver, ISO, and other styles

7

Varela, C. Pintos, C. Rial Martínez, O. Aguín Casal, J. P. Mansilla Vázquez, and A. Ares Yebra. "First Report of Phytophthora alni subsp. uniformis on Black Alder in Spain." Plant Disease 96, no. 4 (April 2012): 589. http://dx.doi.org/10.1094/pdis-10-11-0891-pdn.

Full text

Abstract:

Phytophthora alni is the causal organism responsible for devastating losses occurring on riparian alders stands in Europe. This emergent hybrid pathogen has multiple variants that have been placed in three subspecies (1). P. alni subsp. uniformis and P. alni subsp. multiformis are reported to be less aggressive than P. alni subsp. alni, though all are considered pathogenic. In Spain, P. alni subsp. alni was detected for the first time in 2009 in Galicia (northwestern Spain) causing root and collar rot on riparian alder populations (3,4), but other subspecies had not been identified. In April 2011, a survey along the Deza River in Galicia was carried out to clarify the Phytophthora sp. associated with the alder decline. Thirty riparian Alnus glutinosa stands, from both sides of the river, were surveyed. Samples of bark and roots of 18 alder stands that showed symptoms of Phytophthora rot and soil from all 30 stands were collected. Roots and tissue from fresh, active, inner bark lesions from 54 trees were transferred to selective medium V8-PARPH agar and incubated for 7 days at 22°C in the dark. P. alni subsp. alni (1) was isolated from roots, bark, or soil in five alder stands. Another Phytophthora sp. was isolated from the bark of one symptomatic tree located in Silleda (Pontevedra), transferred to carrot agar (CA), and incubated in the dark. On CA, the isolate produced irregular and appressed colonies with an optimum growth temperature of 22 to 23°C. The isolate was homothallic with smooth-walled oogonia with a diameter ranging from 36 to 50 μm and two-celled, amphigynous antheridia (1). In soil extract, noncaducous, nonpapillate, ellipsoid-to-ovoid sporangia were produced. Average sporangium were 43.4 × 30.1 μm with a length/breadth ratio of 1.43. Internal proliferation occurred. Amplification of DNA was accomplished by sequence characterized amplified region (SCAR)-PCR primers (2). The amplicon sizes obtained were identical to P. alni subsp. uniformis. Internal transcribed spacer (ITS) (DC6-ITS6/ITS4) and nadh1 (NADHF1/NADHR1) mitochondrial gene regions were also amplified and deposited in GenBank (Nos. JN880411 and JN880410). Comparison of the sequences showed 100% homology with P. alni subsp. uniformis (GenBank Nos. GU259293 and DQ202489). Pathogenicity was tested on 10 3-year-old black alder plants grown in pots. A shallow wound was made with a scalpel at the root collar level of each plant. A 5-mm-diameter mycelia plug, taken from the margin of a 7-day-old culture grown on CA, was inserted in every wound and sealed with Parafilm. Five black alder control plants received only sterile CA agar plugs. Plants were kept at 24°C and 80% humidity. After 3 months, wilting of shoots, dead leaves, and dark stained necroses of the bark tissue varying in length from 0.8 to 5 cm were observed on inoculated plants. Control plants remained healthy. P. alni subsp. uniformis was recovered from inoculated plants, but not from controls. To our knowledge, this is the first time that P. alni subsp. uniformis has been reported in Spain. The presence of a new subspecies in a new region can result in hybridization between individuals of different species or subspecies. This process may allow the rapid evolution and adaptation of these species to new hosts or environmental conditions. References: (1) C. M. Brasier et al. Mycol. Res. 108:1172, 2004. (2) R. Ioos et al. Eur. J. Plant Pathol. 112:323, 2005. (3) C. Pintos et al. Plant Dis. 94:273, 2010. (4) A. Solla et al. Plant Pathol.59:78, 2010.

APA, Harvard, Vancouver, ISO, and other styles

8

Strnadová, V., K. Černý, V. Holub, and B. Gregorová. "The effects of flooding and Phytophthora alni infection on black alder." Journal of Forest Science 56, No. 1 (January 28, 2010): 41–46. http://dx.doi.org/10.17221/67/2009-jfs.

Full text

Abstract:

The influences of long-term flooding and Phytophthora alni subsp. alni infection on the growth and development of 4-year-old Alnus glutinosa (black alder) saplings were investigated. The black alder saplings were divided into four groups and then subjected to combinations of both factors – flooded and inoculated with pathogen, flooded non-inoculated, non-flooded inoculated, and control. The biomass of the living roots and actinorrhizae, increase in stem length, length of leaves, rate of chlorotic foliage, amount of foliage biomass and length of stem necrosis were assessed after seven weeks. Both factors, flooding and P. alni infection significantly affected the black alder. In addition, a significant effect of interaction was observed. The inoculated flooded group had a substantially lower biomass weight of living roots, actinorrhiza and leaves than the other groups. The necroses caused by the pathogen in the flooded group were more extensive than those in the non-flooded one. These findings demonstrate that the simultaneous incidence of stress caused by flooding and P. alni infection is highly dangerous for black alder.

APA, Harvard, Vancouver, ISO, and other styles

9

Štochlová, P., K. Novotná, and K. Černý. " Factors affecting the development of Phytophthora alni ssp. alni infections in Alnus glutinosa L." Journal of Forest Science 58, No. 3 (March 27, 2012): 123–30. http://dx.doi.org/10.17221/26/2011-jfs.

Full text

Abstract:

 Phytophthora alni is responsible for a devastating disease in alder and changes in the environment of riparian and alder carr ecosystems. One of the main approaches to solve this problem is to find naturally resistant genotypes using a series of artificial inoculation experiments, to preserve and use them in programmes for resistance breeding. However, the results of artificial inoculation experiments (screening for natural resistance) can be affected by several factors. The potential effect of the social status of the host, the presence of naturally occurring P. alni infections, the season and the size of the sections of branches used were studied in a series of infection experiments. It was found out that the development of lesions was significantly affected by the year season (the largest lesions were found in summer) and by the presence of naturally occurring P. alni infections in the sampled trees (the lesions were five times larger in healthy trees and trees recovered from natural P. alni infections compared to trees with active disease development).  

APA, Harvard, Vancouver, ISO, and other styles

10

Sárándi-Kovács, Judit, Ferenc Lakatos, and Ilona Szabó. "Post-epidemic Situation of a Previously Phytophthora alni-infected Common Alder Stand/ Egy korábban Phytophthora alni által fertőzött mézgáséger-állomány járvány utáni állapota." Acta Silvatica et Lignaria Hungarica 11, no. 1 (June 1, 2015): 27–38. http://dx.doi.org/10.1515/aslh-2015-0002.

Full text

Abstract:

Abstract This paper reports on the current situation of the Phytophthora species occurring in a declining common alder (Alnus glutinosa) stand in North-West Hungary. The stand was affected by a severe epidemic caused by Phytophthora alni in the late 1990s. The authors evaluated the health condition of the forest stand and collected soil samples from the rhizosphere of twenty selected trees two times per year in 2011 and in 2012 in order to isolate Phytophthora species. A diverse Phytophthora community was found in the soil consisting of eight species with different aggressiveness and with different ecological demands. Pathogenicity tests confirmed the role of the collected strains in the decline of the alder stand.

APA, Harvard, Vancouver, ISO, and other styles

11

Zaspel, I., G. Naujoks, L. Krüger, and L. H. Pham. "Promotion of resistance of black alder clones (Alnus glutinosa (L.) Gaertn.) against Phytophthora alni ssp. alni by cyclolipopeptide producing bacteria." Silvae Genetica 63, no. 1-6 (December 1, 2014): 222–29. http://dx.doi.org/10.1515/sg-2014-0028.

Full text

Abstract:

Summary This study demonstrated the promotion of the ability of black alder clones to resist to Phytophthora alni ssp. alni with the cyclolipopeptide (CLP)-producing Pseudomonas veronii isolate PAZ1. The bacterial strain, isolated from an association with P. alni ssp. alni, and characterised by its production of the secondary metabolites viscosin and massetolides, possessed inhibitory ability against isolates of the oomycete tree pathogen in vitro. In plant experiments with alder clones in vitro, the treatment with living bacteria showed an earlier start of the rooting process and a promoted root and shoot growth. Compared to non-treated plants, the root system was improved by longer primary roots with abundant secondary roots. The treatment with a methanol extract prepared from strain PAZ1 had no comparable effect. After protective application of strain PAZ1 14 days before the pathogen, the disease incidence was lower and biomass production was higher than in the pathogen control. These results were completed by a greenhouse experiment for a period of 13 months. Bacteria application prior to the pathogen led to reduced Phytophthora incidence at two of five clones in the combined treatment.

APA, Harvard, Vancouver, ISO, and other styles

12

Adams, Gerard C., Mursel Catal, Lori Trummer, Everett M. Hansen, Paul Reeser, and James J. Worrall. "Phytophthora alni subsp. uniformis Found in Alaska Beneath Thinleaf Alders." Plant Health Progress 9, no. 1 (January 2008): 38. http://dx.doi.org/10.1094/php-2008-1212-02-br.

Full text

Abstract:

Phytophthora alni Brasier & S. A. Kirk 2004 is an emergent pathogen causing a lethal root and collar disease of alder species in Europe. The species has not been previously found in North America, although an isolate tentatively referred to as P. alni was reported in a survey of nurseries in Minnesota. The potential establishment and spread of this complex of pathogens is perceived to represent a threat to all species of Alnus in the western hemisphere. Accepted for publication 2 October 2008. Published 12 December 2008.

APA, Harvard, Vancouver, ISO, and other styles

13

Mizeriene, Goda, Karel Cerny, Vladimir Zyka, József Bakonyi, Zoltán Árpád Nagy, Jonas Oliva, Miguel Angel Redondo, Tamara Corcobado, Jorge Martín-García, and Simone Prospero. "Patterns of Genetic Diversification in the Invasive Hybrid Plant Pathogen Phytophthora × alni and Its Parental Species P. uniformis." Phytopathology® 110, no. 12 (December 2020): 1959–69. http://dx.doi.org/10.1094/phyto-12-19-0475-r.

Full text

Abstract:

In pathogenic fungi and oomycetes, interspecific hybridization may lead to the formation of new species having a greater impact on natural ecosystems than the parental species. From the early 1990s, a severe alder (Alnus spp.) decline due to an unknown Phytophthora species was observed in several European countries. Genetic analyses revealed that the disease was caused by the triploid hybrid P. × alni, which originated in Europe from the hybridization of P. uniformis and P. × multiformis. Here, we investigated the population structure of P. × alni (158 isolates) and P. uniformis (85 isolates) in several European countries using microsatellite markers. Our analyses confirmed the genetic structure previously observed in other European populations, with P. uniformis populations consisting of at most two multilocus genotypes (MLGs) and P. × alni populations dominated by MLG Pxa-1. The genetic structure of P. × alni populations in the Czech Republic, Hungary and Sweden seemed to reflect the physical isolation of river systems. Most rare P. × alni MLGs showed a loss of heterozygosity (LOH) at one or a few microsatellite loci compared with other MLGs. This LOH may allow a stabilization within the P. × alni genome or a rapid adaptation to stress situations. Alternatively, alleles may be lost because of random genetic drift in small, isolated populations, with no effect on fitness of P. × alni. Additional studies would be necessary to confirm these patterns of population diversification and to better understand the factors driving it.

APA, Harvard, Vancouver, ISO, and other styles

14

Schwingle, B. W., J. A. Smith, and R. A. Blanchette. "Phytophthora Species Associated with Diseased Woody Ornamentals in Minnesota Nurseries." Plant Disease 91, no. 1 (January 2007): 97–102. http://dx.doi.org/10.1094/pd-91-0097.

Full text

Abstract:

Phytophthora species are responsible for causing extensive losses of ornamental plants worldwide. Recent international and national surveys for the detection of P. ramorum have led to the finding of previously undescribed Phytophthora species. Since no previous Phytophthora surveys have been carried out in Minnesota, surveys of ornamental nurseries were performed over 4 years to isolate and identify the Phytophthora species causing diseases of woody plants in Minnesota. Species were identified by direct sequencing of internal transcribed spacer (ITS) rDNA, β-tub, and mitochondrial coxI genes. Species associated with diseased ornamental plants include P. cactorum, P. cambivora, P. citricola, P. citrophthora, P. hedraiandra, P. megasperma, P. nicotianae, and the previously identified but undescribed taxon P. Pgchlamydo. The most common species encountered were P. cactorum, P. citricola, and P. citrophthora. Two additional isolates obtained did not match known species. One was similar to P. alni subsp. alni, and the other appeared to be a new species and is referred to as P. sp. MN1. In addition, species are reported for the first time from several hosts. Results indicated that several Phytophthora species were more widespread in the nursery industry than previously thought, and undescribed species were causing disease in Minnesota ornamental nurseries.

APA, Harvard, Vancouver, ISO, and other styles

15

Kanoun-Boulé, M., T. Vasconcelos, J. Gaspar, S. Vieira, C. Dias-Ferreira, and C. Husson. "Phytophthora ×alni and Phytophthora lacustris associated with common alder decline in Central Portugal." Forest Pathology 46, no. 2 (March 9, 2016): 174–76. http://dx.doi.org/10.1111/efp.12273.

Full text

APA, Harvard, Vancouver, ISO, and other styles

16

Weißhoff, Hardy, Sarah Hentschel, Irmtraut Zaspel, René Jarling, Eberhard Krause, and Thi Lam Huong Pham. "PPZPMs - a Novel Group of Cyclic Lipodepsipeptides Produced by the Phytophthora alni Associated Strain Pseudomonas sp. JX090307 -the Missing Link between the Viscosin and Amphisin Group." Natural Product Communications 9, no. 7 (July 2014): 1934578X1400900. http://dx.doi.org/10.1177/1934578x1400900727.

Full text

Abstract:

The closely related to the Pseudomonas orientalis strain Pseudomonas sp. acc. no. JX090307 was isolated from hyphae of the phytopathogenic oomycete Phytophthora alni spp. alni. In in-vitro antagonistic tests, the living bacterium JX090307 and its cell extract showed antibiosis activity against different fungal pathogens of forest tree species, particularly against Verticillium dahliae and some strains of P. alni ssp. alni. Investigating the cell extract of JX090307 by means of LC-ESI-Q-TOF-MS and -MS/MS techniques, more than 30 cyclic lipodepsipeptids (CLPs) were found. 24 of them belong to a novel group of CLPs named PPZPM. The cyclic lipodepsidecapeptides PPZPMs are composed of a β-hydroxy fatty acid linked to a peptide part comprising 10 amino acids, where 8 of them are organized in a cyclic structure. PPZPMs differ from members of the Viscosin and Amphisin group by the number of amino acids forming the cyclic structure. The two main components, PPZPM-1a and PPZPM-2a, were investigated additionally by means of NMR spectroscopy.

APA, Harvard, Vancouver, ISO, and other styles

17

Thoirain, B., C. Husson, and B. Marçais. "Risk Factors for the Phytophthora-Induced Decline of Alder in Northeastern France." Phytopathology® 97, no. 1 (January 2007): 99–105. http://dx.doi.org/10.1094/phyto-97-0099.

Full text

Abstract:

A lethal disease of common alder caused by Phytophthora alni, a new hybrid pathogen, has been spreading in Europe since the early 1990s. In 2004, we conducted an epidemiological survey in northeastern France to determine disease frequency and to investigate the impact of environmental factors on disease prevalence. Seventy-eight plots in the Rhin-Meuse basin were investigated. The survey was structured to enable critical examination of the possible impact of nitrogen pollution of the river water on disease prevalence. P. alni-induced alder decline was common throughout northeastern France. Altogether, disease was found in 80% of the plots containing alder, with 16% of all the alders affected. Striking differences existed between watercourse types. Lower proportions of diseased alders were found in watercourse types with rapid water flow, such as mountain streams of the Vosges and piedmont or watercourses on steep calcareous slopes, than in the slow watercourses of the low-lying valleys of the calcareous plateaus and of the clayey plains. Disease prevalence was not related to the total oxidized nitrogen concentration of the water. However, prevalence increased with the mean summer temperature of the river water and where clayey soils were found in the river banks. The results of this work can be used for the assessment of P. alni-induced alder decline risks in affected European countries and in areas where the disease could be introduced.

APA, Harvard, Vancouver, ISO, and other styles

18

Bakonyi, J., Z. A. Nagy, and T. Ersek. "PCR-based DNA Markers for Identifying Hybrids within Phytophthora alni." Journal of Phytopathology 154, no. 3 (March 2006): 168–77. http://dx.doi.org/10.1111/j.1439-0434.2006.01079.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

19

Glawe, Dean A., and Steven T. Koike. "Phytophthora alni subsp. uniformis Found in Alaska Beneath Thinleaf Alders." Plant Health Progress 9, no. 1 (January 2008): 37. http://dx.doi.org/10.1094/php-2008-1212-03-br.

Full text

Abstract:

Periwinkle is a trailing, spreading evergreen plant used in landscapes as a groundcover. Beginning in 2005, a powdery mildew was observed on periwinkle in coastal (Monterey Co.) California. As reported herein, the causal agent was determined to be Golovinomyces orontii (Castagne) V.P. Heluta. This appears to be the first record of a powdery mildew species on Vinca spp. in North America. Accepted for publication 16 October 2008. Published 12 December 2008.

APA, Harvard, Vancouver, ISO, and other styles

20

Kong, Ping, John D. Lea-Cox, Gary W. Moorman, and Chuanxue Hong. "Survival of Phytophthora alni,Phytophthora kernoviae, and Phytophthora ramorum in a simulated aquatic environment at different levels of pH." FEMS Microbiology Letters 332, no. 1 (May 3, 2012): 54–60. http://dx.doi.org/10.1111/j.1574-6968.2012.02574.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

21

IOOS, RENAUD, BENOÎT BARRÈS, AXELLE ANDRIEUX, and PASCAL FREY. "Characterization of microsatellite markers in the interspecific hybrid Phytophthora alni ssp. alni, and cross-amplification with related taxa." Molecular Ecology Notes 7, no. 1 (November 9, 2006): 133–37. http://dx.doi.org/10.1111/j.1471-8286.2006.01554.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

22

Érsek, Tibor, and Zoltán Á. Nagy. "Species hybrids in the genus Phytophthora with emphasis on the alder pathogen Phytophthora alni: a review." European Journal of Plant Pathology 122, no. 1 (July 31, 2008): 31–39. http://dx.doi.org/10.1007/s10658-008-9296-z.

Full text

APA, Harvard, Vancouver, ISO, and other styles

23

Schwingle, B. W., and R. A. Blanchette. "Host Range Investigations of New, Undescribed, and Common Phytophthora spp. Isolated from Ornamental Nurseries in Minnesota." Plant Disease 92, no. 4 (April 2008): 642–47. http://dx.doi.org/10.1094/pdis-92-4-0642.

Full text

Abstract:

Eleven woody landscape plants commonly grown in the upper Midwestern United States were inoculated with up to three unnamed Phytophthora taxa (Phytophthora taxon Pgchlamydo, a Phytophthora alni-like isolate [Phytophthora MN14d], and Phytophthora sp. MN1) to explore their host ranges. In addition, P. cactorum, P. citricola, P. citrophthora, P. hedraiandra, and P. nicotianae were used to inoculate plants to further investigate the susceptibilities of plant genera previously found associated with these pathogens, to explore the susceptibility of important landscape plants (i.e., oak) to common ornamental Phytophthora spp., and to prove Koch's postulates. Koch's postulates were completed on fragrant sumac with P. citricola and P. nicotianae and on common lilac with P. citrophthora. A nonwound or wound inoculation technique were used to determine host susceptibility. Phytophthora sp. MN1 caused symptoms on American cranberrybush, bur and red oak, common lilac, fragrant sumac, Norway maple, and ‘P.J.M.’ rhododendron. The newly described organism P. hedraiandra caused disease on American cranberrybush, common lilac, red oak, and ‘Snowdrift’ crabapple. Fragrant sumac and common lilac generally were the most susceptible hosts to all Phytophthora spp. This study demonstrated that many ornamental Phytophthora pathogens have larger potential host ranges than previously known. The biology and ecology of P. hedraiandra and Phytophthora sp. MN1 must be further investigated, and methods for rapid identification should be developed.

APA, Harvard, Vancouver, ISO, and other styles

24

Černý, K., and V. Strnadová. "Phytophthora alder decline: disease symptoms, causal agent and its distribution in the Czech Republic." Plant Protection Science 46, No. 1 (March 3, 2010): 12–18. http://dx.doi.org/10.17221/43/2009-pps.

Full text

Abstract:

Phytophthora decline of riparian alder populations has recently become an important problem in many European countries, including the Czech Republic. The causal agent, Phytophthora alni, has spread quickly in the Czech Republic. Hundreds of kilometres of riparian alder stands, especially in the western part of the country, have been severely affected to date. Diseased trees show symptoms characteristic of Phytophthora root and collar rot; these include small, sparse and yellowing foliage, crown dieback, presence of exudates on the bark and necroses of collar and root tissues. Infected trees usually die within a few years, or they become irreversibly damaged, and their function in bank reinforcement declines. The ecological and mechanical functioning of severely affected alder stands may be seriously disrupted.

APA, Harvard, Vancouver, ISO, and other styles

25

Clemenz, C., F. Fleischmann, K. H. Haberle, R. Matyssek, and W. Osswald. "Photosynthetic and leaf water potential responses of Alnus glutinosa saplings to stem-base inoculaton with Phytophthora alni subsp. alni." Tree Physiology 28, no. 11 (September 2, 2008): 1703–11. http://dx.doi.org/10.1093/treephys/28.11.1703.

Full text

APA, Harvard, Vancouver, ISO, and other styles

26

Černý, K., and V. Strnadová. " Winter survival of Phytophthora alni subsp. alni in aerial tissues of black alder ." Journal of Forest Science 58, No. 7 (July 27, 2012): 328–36. http://dx.doi.org/10.17221/11/2012-jfs.

Full text

Abstract:

The winter survival of the invasive pathogen Phytophthora alni subsp. alni in black alder stems was studied in the bankside alder stand of the Moravská Dyje River in southern Bohemia after two very different winter seasons: cold in 2008/2009, with the average temperature of –1.96°C, and extremely mild in 2006/2007, with the average temperature of 2.54°C. The difference in these two winters resembles the expected potential climate change in Central Europe in this century. After the cold winter of 2008/2009, the pathogen survived in only 13.91% of the samples, with the average survival rate of 2.70%. The pathogen survived the mild winter much better and was successfully isolated from 86.09% of the samples, with the average survival rate of 25.52%. Moreover, the total thickness of the covering tissues (outer + inner bark) and exposure to the most heated southwestern quadrant of stem girth positively affected the pathogen survival. Winter freezing seems to be an important environmental factor regulating the pathogen survival in alder stems and disease severity.    

APA, Harvard, Vancouver, ISO, and other styles

27

Solla, A., A. Pérez-Sierra, T. Corcobado, M. M. Haque, J. J. Diez, and T. Jung. "Phytophthora alni on Alnus glutinosa reported for the first time in Spain." Plant Pathology 59, no. 4 (July 1, 2010): 798. http://dx.doi.org/10.1111/j.1365-3059.2009.02254.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

28

Haque, Mohammed Masum Ul, Elena Hidalgo, Jorge Martín-García, Ana Isabel De-Lucas, and Julio Javier Diez. "Morphological, physiological and molecular characterization of Phytophthora alni isolates from Western Spain." European Journal of Plant Pathology 142, no. 4 (April 4, 2015): 731–45. http://dx.doi.org/10.1007/s10658-015-0647-2.

Full text

APA, Harvard, Vancouver, ISO, and other styles

29

Sieber, Thomas N. "Neomyzeten – eine anhaltende Bedrohung für den Schweizer Wald." Schweizerische Zeitschrift fur Forstwesen 165, no. 6 (June 1, 2014): 173–82. http://dx.doi.org/10.3188/szf.2014.0173.

Full text

Abstract:

Neomycetes – persistent threats to Swiss forests More than 40 neomycetes pathogenic to woody plant species were introduced to Switzerland during the last 100 years, and the number is increasing exponentially. A few neomycetes are invasive and cause serious diseases on forest and ornamental trees: Cryphonectria parasitica, causal agent of chestnut blight, Hymenoscyphus pseudoalbidus causing ash dieback, Ophiostoma novo-ulmi causing Dutch elm disease and Ceratocystis platani causing canker stain of plane. The causal agents of sudden oak death (Phytophthora ramorum) and collar and root rot of alder (P. alni ssp. alni) have been detected in Switzerland but have not reached epidemic levels. Ceratocystis fagacearum, causal agent of oak wilt, or Leptographium wageneri causing black stain root disease of conifers are absent from Switzerland, but are threats to Swiss forests and measures have been implemented to prevent their introduction. Prevention of threats by fungi which are harmless symbionts in their native range, e.g. endophytic fungi, is more challenging. The only way to avoid the endophyte problem is to grow trees from aseptic seed, saplings or meristem cultures. Additionally, setup of sentinel plantings in as many regions as possible all over the world could serve as early warning systems. To prevent the introduction of wilt and root diseases, only treated wood and treated potting media should be allowed for import. Natural regeneration prevents contamination of forest soils by Phytophthora species originating from nursery plants.

APA, Harvard, Vancouver, ISO, and other styles

30

Cerny, K., B. Gregorova, V. Strnadova, V. Holub, M. Tomsovsky, and M. Cervenka. "Phytophthora alni causing decline of black and grey alders in the Czech Republic." Plant Pathology 57, no. 2 (April 2008): 370. http://dx.doi.org/10.1111/j.1365-3059.2007.01718.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

31

Romportl, Dušan, Eva Chumanová, Ludmila Havrdová, Vítězslava Pešková, and Karel Černý. "Potential risk of occurrence of Phytophthora alni in forests of the Czech Republic." Journal of Maps 12, sup1 (June 30, 2016): 280–84. http://dx.doi.org/10.1080/17445647.2016.1198996.

Full text

APA, Harvard, Vancouver, ISO, and other styles

32

Husson, C., J. Aguayo, C. Revellin, P. Frey, R. Ioos, and B. Marçais. "Evidence for homoploid speciation in Phytophthora alni supports taxonomic reclassification in this species complex." Fungal Genetics and Biology 77 (April 2015): 12–21. http://dx.doi.org/10.1016/j.fgb.2015.02.013.

Full text

APA, Harvard, Vancouver, ISO, and other styles

33

Martin, Frank N., Z. Gloria Abad, Yilmaz Balci, and Kelly Ivors. "Identification and Detection of Phytophthora: Reviewing Our Progress, Identifying Our Needs." Plant Disease 96, no. 8 (August 2012): 1080–103. http://dx.doi.org/10.1094/pdis-12-11-1036-fe.

Full text

Abstract:

With the increased attention given to the genus Phytophthora in the last decade in response to the ecological and economic impact of several invasive species (such as P. ramorum, P. kernoviae, and P. alni), there has been a significant increase in the number of described species. In part, this is due to the extensive surveys in historically underexplored ecosystems (e.g., forest and stream ecosystems) undertaken to determine the spread of invasive species and the involvement of Phytophthora species in forest decline worldwide (e.g., oak decline). The past decade has seen an approximate doubling in the number of described species within the genus Phytophthora, and the number will likely continue to increase as more surveys are completed and greater attention is devoted to clarifying phylogenetic relationships and delineating boundaries in species complexes. The development of molecular resources, the availability of credible sequence databases to simplify identification of new species, and the sequencing of several genomes have provided a solid framework to gain a better understanding of the biology, diversity, and taxonomic relationships within the genus. This information is much needed considering the impact invasive or exotic Phytophthora species have had on natural ecosystems and the regulatory issues associated with their management. While this work is improving our ability to identify species based on phylogenetic grouping, it has also revealed that the genus has a much greater diversity than previously appreciated.

APA, Harvard, Vancouver, ISO, and other styles

34

Aguayo, Jaime, Fabien Halkett, Claude Husson, Zoltán Á. Nagy, András Szigethy, József Bakonyi, Pascal Frey, and Benoit Marçais. "Genetic Diversity and Origins of the Homoploid-Type HybridPhytophthora ×alni." Applied and Environmental Microbiology 82, no. 24 (October 7, 2016): 7142–53. http://dx.doi.org/10.1128/aem.02221-16.

Full text

Abstract:

ABSTRACTAssessing the process that gives rise to hybrid pathogens is central to understanding the evolution of emerging plant diseases.Phytophthora ×alni, a pathogen of alder, results from the homoploid hybridization of two related species,Phytophthora uniformisandPhytophthora×multiformis. Describing the genetic characteristics ofP. ×alnishould help us understand how reproductive mechanisms and historical processes shaped the population structure of this emerging hybrid pathogen. The population genetic structure ofP. ×alniand the relationship with its parental species were investigated using 12 microsatellites and one mitochondrial DNA (mtDNA) marker on a European collection of 379 isolates. Populations ofP. ×alniwere dominated by one multilocus genotype (MLG). The frequency of this dominant MLG increased after the disease emergence together with a decline in diversity, suggesting that it was favored by a genetic mechanism such as drift or selection. Combined microsatellite and mtDNA results confirmed thatP. ×alnioriginated from multiple hybridization events that involved different genotypes of the progenitors. Our detailed analyses point to a geographic structure that mirrors that observed forP. uniformisin Europe. The study provides more insights on the contribution ofP. uniformis, an invasive species in Europe, to the emergence ofPhytophthora-induced alder decline.IMPORTANCEOur study describes an original approach to assess the population genetics of polyploid organisms using microsatellite markers. By studying the parental subgenomes present in the interspecific hybridP. ×alni, we were able to assess the geographical and temporal structure of European populations of the hybrid, shedding new light on the evolution of an emerging plant pathogen. In turn, the study of the parental subgenomes permitted us to assess some genetic characteristics of the parental species ofP. ×alni,P. uniformis, andP. ×multiformis, which are seldom sampled in nature. The subgenomes found inP. ×alnirepresent a picture of the “fossilized” diversity of the parental species.

APA, Harvard, Vancouver, ISO, and other styles

35

Worrall, James J. "Dieback and Mortality of Alnus in the Southern Rocky Mountains, USA." Plant Disease 93, no. 3 (March 2009): 293–98. http://dx.doi.org/10.1094/pdis-93-3-0293.

Full text

Abstract:

Dieback and mortality of Alnus incana subsp. tenuifolia in the Southern Rocky Mountains apparently began by the late 1980s and have become a concern to land managers. A survey of alder including 68 transects from southern Wyoming to northern New Mexico indicated that, of 6,503 standing stems, 37% were dead, 29% had dieback, and 34% were healthy. Transects intercepted 1,479 m of live and 1,177 m of dead alder canopy. A second, more localized survey with 32 transects in the upper Gunnison River watershed of Colorado yielded similar results. Abundance of live sprouts was inversely related to amount of dieback and mortality in a genet, suggesting that affected genets are dying and not replacing themselves. Damage did not vary substantially by geographic area and was not related to elevation, animal browsing, or distance to nearest road. Distance to nearest stream was weakly, inversely related to severity of dieback and mortality. Symptoms were not consistent with disease of alder caused by Phytophthora alni in Europe, and isolations for Phytophthora species were negative. Cytospora canker, caused by Valsa melanodiscus (anamorph Cytospora umbrina), is the proximate cause of the dieback and mortality.

APA, Harvard, Vancouver, ISO, and other styles

36

Redondo, Miguel A., Jan Stenlid, and Jonàs Oliva. "Genetic Variation Explains Changes in Susceptibility in a Naïve Host Against an Invasive Forest Pathogen: The Case of Alder and the Phytophthora alni Complex." Phytopathology® 110, no. 2 (February 2020): 517–25. http://dx.doi.org/10.1094/phyto-07-19-0272-r.

Full text

Abstract:

Predicting whether naïve tree populations have the potential to adapt to exotic pathogens is necessary owing to the increasing rate of invasions. Adaptation may occur as a result of natural selection when heritable variation in terms of susceptibility exists in the naïve population. We searched for signs of selection on black alder (Alnus glutinosa) stands growing on riverbanks invaded by two pathogens differing in aggressiveness, namely, Phytophthora uniformis (PU) and Phytophthora × alni (PA). We compared the survival and heritability measures from 72 families originating from six invaded and uninvaded (naïve) sites by performing in vitro inoculations. The results from the inoculations were used to assess the relative contribution of host genetic variation on natural selection. We found putative signs of natural selection on alder exerted by PU but not by PA. For PU, we found a higher survival in families originating from invaded sites compared with uninvaded sites. The narrow sense heritability of susceptibility to PU of uninvaded populations was significantly higher than to PA. Simulated data supported the role of heritable genetic variation on natural selection and discarded a high aggressiveness of PA decreasing the transmission rate as an alternative hypothesis for a slow natural selection. Our findings expand on previous attempts of using heritability as a predictor for the likelihood of natural adaptation of naïve tree populations to invasive pathogens. Measures of genetic variation can be useful for risk assessment purposes or when managing Phytophthora invasions.

APA, Harvard, Vancouver, ISO, and other styles

37

Kodrík, J., M. Kodrík, and P. Hlaváč. "The occurrence of fungal and insect pests in riparian stands of the central Hron and Slatina rivers." Journal of Forest Science 52, No. 1 (January 8, 2012): 22–29. http://dx.doi.org/10.17221/4483-jfs.

Full text

Abstract:

The paper deals with the occurrence of fungi and rusts, viruses and insects on main woody species in riparian stands along the middle courses of the Slatina and Hron rivers in Slovakiain 2002–2004. Forty fungal species, rusts and viruses and 79 insect species were found. The highest number of fungi occurred on the branches and twigs of poplar where Cryptodiaporthe populea (Sacc.) Butin and Phellinus igniarius (L.) Quél. had the highest representation and so the influence on the health condition. Melampsora alliipopulina Kleb., Poplar mosaic carlavirus, Venturia po-pulina (Vuill.) Fabr. and Venturia tremulae Aderh dominated on the leaves. The most frequently present fungus on the aspen was Armillaria sp., Phellinus igniarius (L.) Quél., on the alder a new hybrid from the genus Phytophthora – alder Phytophthora, Valsa oxystoma Rehm., Inonotus radiatus (Sowerby) P. Karst. and Inonotus obliquus (Fr.) Pilát. From the insect species Melasoma vigintipunctata Scop. and Phyllodecta vitellinae L. caused total defoliation on willows. The highest occurrence on the black poplar was on the leaf stalks represented by Pemphigus spirothecae Pass. species, on the alder it was Cryptorrhinchidius lapathi L. on the twigs and Agelastica alni L. on the leaves.

APA, Harvard, Vancouver, ISO, and other styles

38

Brasier, Clive M., Susan A. Kirk, Jose Delcan, David E. L. Cooke, Thomas Jung, and Willem A. Man In't Veld. "Phytophthora alni sp. nov. and its variants: designation of emerging heteroploid hybrid pathogens spreading on Alnus trees." Mycological Research 108, no. 10 (October 2004): 1172–84. http://dx.doi.org/10.1017/s0953756204001005.

Full text

APA, Harvard, Vancouver, ISO, and other styles

39

Ioos, Renaud, Axelle Andrieux, Benoît Marçais, and Pascal Frey. "Genetic characterization of the natural hybrid species Phytophthora alni as inferred from nuclear and mitochondrial DNA analyses." Fungal Genetics and Biology 43, no. 7 (July 2006): 511–29. http://dx.doi.org/10.1016/j.fgb.2006.02.006.

Full text

APA, Harvard, Vancouver, ISO, and other styles

40

Malewski, Tadeusz, Robert Topor, Justyna Anna Nowakowska, and Tomasz Oszako. "Decline of Black Alder Alnus glutinosa (L.) Gaertn. along the Narewka River in the Białowieża Forest District." Forest Research Papers 81, no. 4 (December 1, 2020): 147–52. http://dx.doi.org/10.2478/frp-2020-0017.

Full text

Abstract:

Abstract Black Alder Alnus glutinosa (L.) Gaertn. is an important tree commonly growing in Poland. Alders are actinorhizal plants that play an important ecological role in riparian ecosystems through atmospheric nitrogen fixation, filtration and purification of waterlogged soils as well as providing a refuge for terrestrial and aquatic organisms thus helping to stabilize stream banks. Black alder used to be considered a very pest and disease resistant species but, the situation changed in 2000, when an unprecedented decline of Alders was observed in Poland. In the Białowieża Forest District, this decline has been observed on wet meadow habitats and along rivers or watercourses. Currently, there are several hypotheses explaining Alder dieback, among them climatic changes and Phytophthora infections. In terms of climate, Black Alder requires a high atmospheric humidity during all phases of its reproductive cycle. It tolerates neither long-term summer flooding nor a significant decrease in the groundwater level. In terms of pests, oomycete pathogens of the genus Phytophthora are the most destructive plant pathogens known and many of them are present in forests and nurseries all over Europe. The aim of this study was to evaluate the health of Black Alder along the Narewka River in the Białowieża Forest District. Selected areas were monitored in 2012 and 2018, but no relationship between drought and alder health was found. A preliminary analysis of soil and water samples by real time PCR revealed the presence of two Phytophthora species: P. alni and P. cactorum. Further and more detailed research is required to elucidate the role of these pathogens in Alder dieback.

APA, Harvard, Vancouver, ISO, and other styles

41

Elegbede, Chabi Fabrice, Jean-Claude Pierrat, Jaime Aguayo, Claude Husson, Fabien Halkett, and Benoît Marçais. "A Statistical Model to Detect Asymptomatic Infectious Individuals with an Application in the Phytophthora alni-Induced Alder Decline." Phytopathology® 100, no. 11 (November 2010): 1262–69. http://dx.doi.org/10.1094/phyto-05-10-0140.

Full text

Abstract:

In some diseases—in particular, tree root infection—stages of infection and inoculum production level and timing are not readily observable because of uncertainty or time lags in symptom appearance. Here, we pose a criterion, based on relative hazard of disease symptoms, to discriminate between healthy and asymptomatic infected individuals. We design a statistical procedure to estimate the criterion for a 6-year survey of alder decline along a northeastern French river. Individual tree symptom hazard was modeled with Cox's regression model, taking estimation of local infection pressure as a risk factor. From an inoculum production experiment, we thereafter assessed the inoculum production level of target trees, including symptomatic and asymptomatic trees ranked according to their symptoms hazard. Using receiver operating characteristic methods, we first evaluated the criterion performance and determined the discrimination threshold to sort out asymptomatic individuals into healthy and infected. Then, we highlighted the fact that the infected asymptomatic trees were among the major inoculum producers whereas severely declining and dead trees were found to be poor inoculum sources.

APA, Harvard, Vancouver, ISO, and other styles

42

Novotná, Kateřina, and Petra Štochlová. "Selection of the best method for vegetative propagation of mature Alnus glutinosa (L.) Gaertn. trees resistant to Phytophthora alni." Acta Universitatis Agriculturae et Silviculturae Mendelianae Brunensis 60, no. 1 (2012): 105–10. http://dx.doi.org/10.11118/actaun201260010105.

Full text

Abstract:

Although alder is readily propagated by seeds our objective was to examine the feasibility of propagating matureAlnus glutinosa(L.) trees by vegetative means that could be used to propagate trees resistant toPhytophthora alni. Both softwood and hardwood cuttings were taken. In the case of hardwood cuttings, two different treatments, based on differences in temperature, two growth stimulators (NAA, IBA) and rooting conditions, were tested. Rooting success rate was low, with only 1.3 to 5 % of treated cuttings rooting, in comparison with 0 to 1.3 % of the untreated control cuttings. In the case of softwood cuttings, two treatments were used which differed in their use of growth stimulators (NAA, IBA) and the dates when material was collected. In contrast to the hardwood cuttings, the softwood cuttings rooted better in both treatments. The cuttings collected at the later date rooted better; 30 to 42.5 % of the treated cuttings rooted when compared to 15 % in the control treatment. Softwood cuttings collected in the middle of July and then treated with 1% IBA rooted the best of all, with 42.5 % of cuttings rooting successfully.

APA, Harvard, Vancouver, ISO, and other styles

43

Haque, M. M., P. Martínez-Álvarez, J. M. Lomba, J. Martín-García, and J. J. Diez. "First Report of Phytophthora plurivora Causing Collar Rot on Common Alder in Spain." Plant Disease 98, no. 3 (March 2014): 425. http://dx.doi.org/10.1094/pdis-07-13-0784-pdn.

Full text

Abstract:

Phytophthora decline of riparian alder (Alnus spp.) has been reported in several European countries (2). Death of common alder (Alnus glutinosa) due to Phytophthora alni has also been reported in Spain (4). During several surveys of alder trees in September 2012, typical dieback symptoms, including sparse small yellowish foliage and the presence of rusty exudates on the bark at the collar and lower stem were observed in A. glutinosa growing on the banks of the river Tera (Langa de Duero, Soria, 41°36′34″ N, 3°25′10″ W, elevation 851 m) and the river Tormes (La Maya, Salamanca, 40°41′42″ N, 5°35′36″ W, elevation 833 m). Bark samples plus cambium were taken from the active lesions at collar region, cut into small pieces, dried on filter paper, and plated on V8-PARPH agar (2). The samples were incubated for 4 days at 20°C in the dark before obtaining the Phytophthora isolates. Colonies developed on V8 juice agar (V8A) had limited aerial mycelium at the center and displayed radiate and slightly chrysanthemum-like growth pattern. Mycelial growth was optimal at 25°C (radial growth rate, 8.2 mm d–1), whereas no growth was observed at 32°C. Isolates were homothallic with paragynous antheridia, smooth-walled spherical (very rarely elongated) oogonia (22.8 to 30.6 μm diam.) and both plerotic and aplerotic golden brown oospores (21.3 to 28.5 μm diam.). In non-sterile soil extracts, the isolates produced abundant sporangia (31.5 to 57.2 × 21.3 to 38.4 μm; length:breadth ratio 1.2 to 1.6) borne terminally on unbranched or sympodial sporagiophores, occasionally attached laterally to the sporangiophores. Sporagia were non-caducous, semipapillate, mainly ovoid and obpyriform, obovoid to limoniform but sometimes distorted with two apices. On the basis of the morpho-physiological features, the isolates resembled P. plurivora (formerly identified as P. citricola) (3). To confirm this, genomic DNA was extracted and subjected to PCR. The internal transcribed spacer (ITS) region of the rDNA was amplified using the ITS-6 (5′ GAAGGTGAAGTCGTAACAAGG 3′) and ITS-4 (5′ TCCTCCGCTTATTGATATGC 3′) primers before sequencing (Secugen, Madrid, Spain). The sequences were deposited in the EMBL/GenBank database (Accession Nos. KF413074 and KF413075). In order to perform the pathogenicity test, 10 A. glutinosa seedlings (2 years old) per isolate were inoculated by using the under-bark inoculation technique (1) and 10 control seedlings were inoculated with V8A. Seedlings were incubated in a growth chamber at 22.5°C with a 14-h photoperiod. Three months after inoculation, all inoculated plants wilted and died, whereas the control plants showed no disease symptoms. To fulfill Koch's postulates, the pathogen was re-isolated from the necrotic lesions developed around inoculation points, thus confirming its pathogenicity. P. plurivora has been found to be present in rhizosphere soil beneath Alnus spp. and to cause aerial canker and collar rot on alder trees in Austria, Germany, and Romania (2,3). Further studies and surveys are essential to determine the distribution, extent of damage, and potential interactions with other alder pathogens (e.g., P. alni). To our knowledge, this is the first record of P. plurivora affecting A. glutinosa in Spain. References: (1) T. Jung et al. Eur. J. For. Pathol. 26:253, 1996. (2) T. Jung and M. Blaschke. Plant Pathol. 53:197, 2004. (3) T. Jung and T. I. Burgess. Persoonia 22:95, 2009. (4) A. Solla et al. Plant Pathol. 59:798, 2010.

APA, Harvard, Vancouver, ISO, and other styles

44

Ioos, Renaud, Claude Husson, Axelle Andrieux, and Pascal Frey. "SCAR–based PCR primers to detect the hybrid pathogen Phytophthora alni and its subspecies causing alder disease in Europe." European Journal of Plant Pathology 112, no. 4 (August 2005): 323–35. http://dx.doi.org/10.1007/s10658-005-6233-2.

Full text

APA, Harvard, Vancouver, ISO, and other styles

45

Tulik, Mirela, Adam Grochowina, Joanna Jura-Morawiec, and Szymon Bijak. "Groundwater Level Fluctuations Affect the Mortality of Black Alder (Alnus glutinosa Gaertn.)." Forests 11, no. 2 (January 22, 2020): 134. http://dx.doi.org/10.3390/f11020134.

Full text

Abstract:

Since the 1990s, a decline of riparian black alder (Alnus glutinosa Gaertn.) has been observed over Europe. The fungus-like eukaryotic pathogen Phytophthora alni subsp. alni is thought to be a causal agent of this process; however, abiotic factors may also be involved. Previous studies suggest that climate conditions and, especially, depletion of groundwater level may be among the most important factors that trigger this phenomenon. We investigated the radial growth and wood vessel diameter of black alder trees of various vigour classes as well as their response to groundwater level changes to search for the link between soil water resources availability and mortality related to alder dieback. Samples were collected in the natural stand located near Sieraków village in the Kampinoski National Park, central Poland, in the area where alder dieback has been recently observed. Based on the crown defoliation level, three vigour classes (healthy, weakened, and dead trees) were distinguished. Cross sections were prepared with a sliding microtome, and Cell P image analysis software was used for the measurements. Tree-ring width (TRW) and vessel diameter (VD) were determined and correlated with the monthly values of precipitation and groundwater level. Alders of the analysed vigour classes exhibited similar patterns of TRW and VD changes over the analysis time. The narrowest tree rings were observed in weakened alders, while the largest vessels were noted in healthy trees. In the case of TRW and VD chronologies, the weakest, and hence insignificant, resemblance was found for healthy and dead trees. TRW and VD of the analysed alders were not correlated with the monthly sum of precipitation, but a negative influence of rainfall in April was observed. In turn, groundwater level had an impact on the radial growth and wood anatomical features of the analysed trees. A negative effect of the highest water table level was found for TRW of weakened and dead trees as well as for VD of healthy and weakened alders. The lowest groundwater level and the amplitude of the water table positively affected VD of the dead trees. Alder decline has a polyetiological nature, and groundwater level fluctuations are one of many factors contributing to disease development.

APA, Harvard, Vancouver, ISO, and other styles

46

le Roux, H. F., A. B. Ware, M. C. Pretorius, and F. C. Wehner. "Comparative Efficacy of Preplant Fumigation and Postplant Chemical Treatment of Replant Citrus Trees in an Orchard Infested with Tylenchulus semipenetrans." Plant Disease 82, no. 12 (December 1998): 1323–27. http://dx.doi.org/10.1094/pdis.1998.82.12.1323.

Full text

Abstract:

Preplant soil fumigation with methyl bromide at 49 and 98 g/m2 was compared with various postplant nematicide and fungicide programs in a replant citrus orchard infested with the citrus nematode Tylenchulus semipenetrans and the fungal pathogens Phytophthora nicotianae, Fusarium solani, and F. oxysporum. Postplant treatments comprised multiple applications of fenamiphos at 4.0 g a.i./m2 soil, aldicarb at 4.5 g a.i./m2 soil, metalaxyl at 4 g a.i./m2 soil, fose-tyl-Al stem painting at 400 g a.i./liter, and combinations of fenamiphos + fosetyl-Al and aldi-carb + fosetyl-Al at the same rates as for single treatments. P. nicotianae could not be detected in the entire experimental site after replanting, but populations of F. solani and F. oxysporum showed only a temporary decline following site preparation. T. semipenetrans did not re-establish in any of the treatments within the first 2 years. Numbers of juveniles remained low in most treatments during the third year, but thereafter both juveniles and females increased significantly in all except the fumigated plots. Female populations on roots of citrus trees planted in fumigated soil remained suppressed for 8 years and the trees developed more vigorously and produced higher yields and larger fruit than those in non-fumigated soil. Compared with the control, net income for the period 4 to 8 years after planting increased by 101 and 46% in plots fumigated with 49 and 98 g/m2, respectively. With the exception of aldicarb, all other treatments showed net losses.

APA, Harvard, Vancouver, ISO, and other styles

47

Hansen, E. M. "Phytophthora alni." Forest Phytophthoras 2, no. 1 (December 28, 2012). http://dx.doi.org/10.5399/osu/fp.2.1.3031.

Full text

APA, Harvard, Vancouver, ISO, and other styles

48

"Phytophthora alni. [Distribution map]." Distribution Maps of Plant Diseases, no. 1) (August 1, 2008). http://dx.doi.org/10.1079/dmpd/20083245629.

Full text

Abstract:

Abstract A new distribution map is provided for Phytophthora alni Brasier & S.A. Kirk. Fungi: Oomycota: Peronosporales. Hosts: common alder (Alnus glutinosa), grey alder (Alnus incana), Italian alder (Alnus cordata) and green alder (Alnus viridis). Information is given on the geographical distribution in Europe (Austria, Belgium, Czech Republic, France, Germany, Hungary, Ireland, Italy, Lithuania, Netherlands, Poland, Slovakia, Slovenia, Sweden, UK, England and Wales, Scotland), North America (USA, Alaska).

APA, Harvard, Vancouver, ISO, and other styles

49

Černý, K., N. Filipová, and V. Strnadová. "Influence of low temperature and frost duration on Phytophthora alni subsp. alni viability." Forest Systems 21, no. 2 (July 20, 2012). http://dx.doi.org/10.5424/fs/2012212-02250.

Full text

APA, Harvard, Vancouver, ISO, and other styles

50

Haque, M. M. U., and J. J. Díez Casero. "Susceptibility of common alder (Alnus glutinosa) seeds and seedlings to Phytophthora alni and other Phytophthora species." Forest Systems 21, no. 2 (July 20, 2012). http://dx.doi.org/10.5424/fs/2012212-02267.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Journal articles on the topic 'Phytophthora alni'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles