Relevant bibliographies by topics / Plant hybridization. Potatoes

Contents

  1. Journal articles
  2. Book chapters

Academic literature on the topic 'Plant hybridization. Potatoes'

Author: Grafiati
Published: 4 June 2021
Last updated: 1 February 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Plant hybridization. Potatoes.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Journal articles on the topic "Plant hybridization. Potatoes"

1

Biryukova, V. A., I. V. Shmiglya, V. A. Zharova, M. P. Beketova, E. V. Rogozina, A. V. Mityushkin, and A. A. Meleshin. "Molecular markers of genes for extreme resistance to potato virus Y in varieties and hybrids Solanum tuberosum L." Rossiiskaia selskokhoziaistvennaia nauka, no. 5 (October 23, 2019): 17–22. http://dx.doi.org/10.31857/s2500-26272019517-22.

Full text
Abstract:
Potato virus Y (PVY) are among the most harmful viral pathogens that reduce the yield and quality of potatoes. The number of modern varieties resistant to a wide range of PVY strains is very limited, therefore, the selection of potatoes in this direction does not become irrelevant. Molecular markers of the Ry genes are universal tools for identifying new sources of resistance among existing biodiversity of potato genotypes. Since potato varieties and hybrids containing Rysto tend to exhibit cytoplasmic male sterility associated with mitochondrial DNA, the definition of cytoplasmic types is important. In the article, molecular markers of the Ry genes YES3-3A, YES3-3B, RYSC3, Ry186 were used for screening foreign and Russian varieties and hybrids potatoes from the collections of Lorch Potato Research Institute and N.I.Vavilov Institute of Plant Genetic Resources. Molecular screening and analysis of рedigree revealed that russian varieties and hybrids of potatoes characterized by extreme resistance to PVY were obtained on the basis of foreign varieties Alwara, Arosa, Bison, Bobr, Roko, as well as backcrosses of the Hungarian selection donors of the Rysto gene linked to cytoplasmic male sterility, and forms 128/6 a donor of the Ryadg gene, derived from S. stoloniferum. The marker RYSC3 coupled to Ryadg was found in interspecies hybrids of N.I.Vavilov Institute of Plant Genetic Resources 8-1-2004, 8-3-2004, 8-5-2004, 135-5-2005, 135-3-2005, having the same origin with the participation of S. okadae species K-20921 Hawkes et Hjerting and S. chacoense K-19759 Bitt. The marker Ry186 of the gene Rychc is rare. It is present in 5% of the potato genotypes. Molecular screening revealed samples of potatoes with markers of the Ry genes. They are of particular interest for further breeding. Data on the presence of Ry markers of genes in potato varieties and hybrids, serve as valuable information in the selection of initial forms for hybridization.
APA, Harvard, Vancouver, ISO, and other styles
2

Brown, Charles R. "Russet Burbank: No Ordinary Potato." HortScience 50, no. 2 (February 2015): 157–60. http://dx.doi.org/10.21273/hortsci.50.2.157.

Full text
Abstract:
The ‘Russet Burbank’ potato cultivar currently occupies first place in acreage planted in North America and is worth in the United States $1.4 billion annually. It is a sport of ‘Burbank's Seedling’, which was selected by Luther Burbank in 1873. The ancestry of Burbank stems from a plant introduction brought to the United States by the Rev. Chauncey Goodrich of New York State in 1853. The priorities of potato breeding had been transformed by repetitive crop failures caused by the emergence of the plant pathogen Phytophthora infestans. Modern testing suggests that derivatives of Goodrich’s potatoes were slightly more resistant to Phytophthora. Burbank discovered a single fruit on one of these derivatives, ‘Early Rose’, in his mother’s garden. Taking the 23 true seeds, he nursed them to full-sized plants and selected ultimately No. 15. It produced an unusually high yield of large, very oblong tubers, stored well, and was a good eating potato. Burbank’s life was destined for a long career in California and he attempted to sell the clone to J.H.J. Gregory of Gregory’s Honest Seeds, a successful businessman. Ultimately Gregory agreed to buy it for $150, far less than Burbank wanted, but enough to propel him to California. Gregory named the potato ‘Burbank's Seedling’, which no doubt engendered fame for the entrepreneur. Luther Burbank had been allowed by Gregory to keep 10 tubers, which became the seed source for the ‘Burbank's Seedling’ to spread north and south along the West Coast of North America with a crop value, stated by Burbank, of $14 million in 1914. It is not clear that Luther Burbank prospered from ‘Burbank's Seedling’ in the West. A skin sport with a russet skin was found in Colorado in 1902 and was advertised by a seed company under the name ‘Netted Gem’. ‘Burbank's Seedling’ per se disappeared from commerce and ‘Netted Gem’ slowly increased, finding a special niche in production of French fry potatoes. It is clear that Luther Burbank gained tremendous insight into the dynamics of hybridization in revealing genetic variation from clonally propagated species. During the rest of his career he would use this technique to produce new and amazing forms of numerous food and ornamental species. ‘Burbank's Seedling’ was his entrez into the world of plant breeding.
APA, Harvard, Vancouver, ISO, and other styles
3

Chen, Qin, H. Y. Li, Y. Z. Shi, D. Beasley, B. Bizimungu, and M. S. Goettel. "Development of an effective protoplast fusion system for production of new potatoes with disease and insect resistance using Mexican wild potato species as gene pools." Canadian Journal of Plant Science 88, no. 4 (July 1, 2008): 611–19. http://dx.doi.org/10.4141/cjps07045.

Full text
Abstract:
Somatic hybridization through protoplast fusion is an important alternative approach for overcoming sexual incompatibility between diploid Solanum species and cultivated potatoes. However, compared with other potato species, methods for protoplast isolation and plant generation for several Mexican wild diploid potato species are not well established. In this study, a systematic procedure was designed for the isolation of a large number of high-quality protoplasts from various Mexican wild species that carry high levels of disease (late blight) and insect [Colorado potato beetle (CPB)] resistance. Using this procedure, an effective potato protoplast fusion system was developed to produce new somatic hybrids between two Mexican, one Argentina wild species, and cultivated potato clones. Regenerated plants and somatic hybrids were obtained at a high frequency from the protoplasts of the diploid wild species and their fused cells with S. tuberosum. Morphological, cytological and molecular marker analyses demonstrated that somatic hybrids were successfully obtained from the cell fusion of S. tuberosum and the diploid species S. pinnatisectum, S. cardiophyllum, and S. chacoense. Assessment of disease and insect reactions demonstrated that several of the protoplast-derived clones and somatic hybrids showed a higher level of resistance to both late blight and CPB than was found in S. tuberosum, confirming that the protoplast system is a powerful tool in potato breeding programs for the development of disease and insect resistance. This new fusion system provides breeders with opportunities to transfer disease and insect resistance genes from Mexican wild species into cultivated potato. Key words: Somatic hybrid, protoplast, fusion, potato, Solanum, late blight, disease resistance, Colorado potato beetle insect resistance
APA, Harvard, Vancouver, ISO, and other styles
4

Slack, S. A. "Comparison of PCR, ELISA, and DNA Hybridization for the Detection ofClavibacter michiganensissubsp.sepedonicusin Field-Grown Potatoes." Plant Disease 80, no. 5 (1996): 519. http://dx.doi.org/10.1094/pd-80-0519.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Drennan, J. L. "Comparison of a DNA Hybridization Probe and ELISA for the Detection ofClavibacter michiganensissubsp.sepedonicusin Field-Grown Potatoes." Plant Disease 77, no. 12 (1993): 1243. http://dx.doi.org/10.1094/pd-77-1243.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Kamoun, Sophien, Theo van der Lee, Grardy van den Berg-Velthuis, Koen E. de Groot, and Francine Govers. "Loss of Production of the Elicitor Protein INF1 in the Clonal Lineage US-1 of Phytophthora infestans." Phytopathology® 88, no. 12 (December 1998): 1315–23. http://dx.doi.org/10.1094/phyto.1998.88.12.1315.

Full text
Abstract:
The extracellular protein INF1 of Phytophthora infestans is a member of the elicitin family of protein elicitors known to induce a hypersensitive response on some solanaceous and cruciferous plants. The presence of INF1 elicitin in culture filtrates of 102 P. infestans isolates from 15 countries was examined. All tested isolates produced INF1 except five isolates collected in 1976 and 1977 from infected potatoes in East Germany (the former German Democratic Republic). Based on hybridization to the multi-locus DNA fingerprint probe RG57, all the INF1-nonproducing isolates were shown to belong to the clonal lineage US-1 that dominated world populations until the 1980s. Phylogenetic analysis of a set of European US-1 isolates using amplified fragment length polymorphism fingerprint data indicated that loss of INF1 production evolved independently in separate lineages within US-1. DNA and RNA blot hybridizations showed that INF1-nonproducing isolates still retain a copy of the inf1 gene, whereas little inf1 mRNA could be detected. Hypothetical interpretations of the evolution in a restricted geographic area of P. infestans lineages deficient in the production of a specific elicitor protein are discussed.
APA, Harvard, Vancouver, ISO, and other styles
7

Maune, Juan Federico, Elsa Lucila Camadro, and Luis Ernesto Erazzú. "Cross-incompatibility and self-incompatibility: unrelated phenomena in wild and cultivated potatoes?" Botany 96, no. 1 (January 2018): 33–45. http://dx.doi.org/10.1139/cjb-2017-0070.

Full text
Abstract:
Knowledge of internal hybridization barriers is relevant for germplasm conservation and utilization. The two pre-zygotic barriers are pollen–pistil self-incompatibility (SI) and cross-incompatibility (CI). To ascertain whether SI and CI were phenotypically related phenomena in potatoes, extensive intra- and interspecific, both intra- and interploidy breeding relationships were established, without previous assumptions on the compatibility behavior of the studied germplasm. Pollen–pistil relationships were analyzed at the individual genotype/accession/family level. In two seasons, 828 intra- and interspecific genotypic combinations were performed, using accessions of the wild potatoes Solanum chacoense Bitter (2n = 2x = 24), S. gourlayi Hawkes (2n = 2x = 24; 2n = 4x = 48), and S. spegazzinii Bitter (2n = 2x = 24), full-sibling (hereinafter “full-sib”) families (2n = 2x = 24) within/between the latter two diploids, and S. tuberosum L. (2n = 4x = 48) cultivars. Pollen–pistil incompatibility occurred in the upper first third of the style (I1/3) in all selfed diploids. In both the intra- and interspecific combinations, the most frequent relationship was compatibility, followed by I1/3, but incompatibility also occurred in the stigma and the style (middle third and bottom third). We observed segregation for these relationships in full-sib families, and unilateral and bilateral incompatibility in reciprocal crosses between functional SI genotypes. Cross-incompatibility in potatoes is, apparently, controlled by genes independent of the S-locus or its S-haplotype recognition region (although molecular evidence is needed to confirm it), with segregation even within accessions.
APA, Harvard, Vancouver, ISO, and other styles
8

Almeida, M. M. S., A. F. Orílio, F. L. Melo, R. Rodriguez, A. Feliz, X. Cayetano, R. T. Martínez, and R. O. Resende. "The First Report of Tomato chlorotic spot virus (TCSV) Infecting Long Beans and Chili Peppers in the Dominican Republic." Plant Disease 98, no. 9 (September 2014): 1285. http://dx.doi.org/10.1094/pdis-04-14-0348-pdn.

Full text
Abstract:
The Dominican Republic has a significant area of the country cultivated with vegetables. In July 2013, in the provinces of Moca and La Vega, horticultural crops showed typical tospovirus symptoms (>30% incidence), including bronzing, chlorosis, necrosis, and ring spots on leaves and fruits. Samples were collected from potatoes (Solanum tuberosum), long beans (Vignaun guiculata), chili peppers (Capsicum frutescens), sweet peppers (C. annuum), and tomatoes (S. lycopersicum). Serological tests were clearly positive for infection by Tomato spotted wilt virus (TSWV) and/or related tospoviruses when tested with AgDia immunostrips. The viral RNA extracted from five plants per host was pooled to construct a cDNA library that was sequenced using an Illumina HiSeq 2000 platform. The paired-end reads were assembled using CLC Genomic Workbench version 6.0.3. The assembled contigs were submitted to BLASTx against a viral genome database. The results confirmed the presence of Tomato chlorotic spot virus (TCSV) and TSWV. Then, PCR tests were performed with primers pairs TSWV-LF 5′ CTGTTGTCTATTGAGGATTGTG 3′ AND TSWV-LR 5′ CAGAGAGCTTGTTAATGCAGGAC 3′ to amplify part of the TSWV L RNA, the pairs TCSV-SF 5′ AACTGGGAAAGCAGAAAACC 3′ and TCSV-SR 5′ CCTTACTCCGAACATTGCA 3′, and GRSV-SF 5′ CTGTCAGGAAAATCTTGACCTG 3′ and GRSV-SR 5′ CTTGACTCCAAACATCTCGT 3′ to detect part of the TCSV and Groundnut ringspot virus (GRSV) S segments. In the long bean and chili pepper samples from La Vega, only TCSV was detected (40% of the all samples) based on amplification of the expected size fragment with the S RNA specific primer pair. All the other samples were positive for TSWV and no GRSV was detected. The complete N gene of TCSV and TSWV were amplified using the primer pairs TCSV-NR2 5′ CACACTGAACTGAACTATAACACAC 3′ and TCSV-NF 5′ ACCTTGAATCATATCTCTCG 3′ and primers N-TSWV_FW 5′ TACGGATCCGATGTCTAAGGTTAAGCTCAC 3′ and N-TSWV_RV 5′ TTATCTCGAGTCAAGCAAGTTCTGCGAG 3′. The TCSV N protein sequences (KJ399303 and KJ399304) were 99% identical with the TCSV found in processing tomatoes in the Dominican Republic (1) and the United States (2). The TSWV N protein sequences (KJ399313, KJ399314 and KJ399315) shared 96 to 98% identity with the TSWV N sequences available. Dot blot hybridization tests (1) using DIG-labeled specific TCSV N gene probe confirmed TCSV infection in PCR-positive long bean and chili pepper samples, whereas no hybridization signal was detected for TSWV-infected tomatoes, potatoes, sweet peppers, or healthy samples. In addition, no reassortants were detected based on amplification of the expected size RNA fragments (3). These other amplicons (KJ399301, KJ399299, KJ399302, and KJ399300) showed 98% identity with the L and M segments of TCSV. Thrips collected from symptomatic plants were identified mainly as Frankliniella schultzei, consistent with the main thrips species transmitting TCSV. In the last two years, TCSV was reported in North and Central America and in the Caribbean Basin (1,2,4). These findings have an important epidemiological impact since TCSV represents a new threat to other horticultural crops affected by this tospovirus. References: (1) O. Batuman et al. Plant Dis. 98:286, 2014. (2) A. Londono et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Virology 413:216, 2011. (4) C. G. Webster et al. Plant Health Progress. Online publication. doi:10.1094/PHP-2013-0812-01-BR, 2013.
APA, Harvard, Vancouver, ISO, and other styles
9

De Boer, S. H., and T. L. DeHaan. "Absence of Potato spindle tuber viroid within the Canadian Potato Industry." Plant Disease 89, no. 8 (August 2005): 910. http://dx.doi.org/10.1094/pd-89-0910a.

Full text
Abstract:
Potato spindle tuber viroid (PSTVd) causes a serious disease of potato, affecting yield and tuber quality. To control the disease, the Canadian seed certification program maintains a zero tolerance for the disease and a requirement that all nuclear stock, the micropropagated plantlets from which each lot of seed potatoes is initiated, is tested using reverse polyacrylamide gel electrophoresis (rPAGE) to ensure freedom from PSTVd. Moreover, seed potato fields are visually inspected during two or more annual field inspections for the presence of PSTVd and viruses. Symptoms of PSTVd have not been observed during field inspections for at least the last 25 years. Prior to 1989, seed potato stocks in the provinces of Prince Edward Island and New Brunswick were tested using rPAGE and nucleic acid dot blot hybridization for the presence of the viroid, and no infections were found (1). Similar surveys for PSTVd in Canada's western provinces of British Columbia, Alberta, and Saskatchewan also failed to detect the viroid (2). During 2000–2004, the PSTVd survey was extended to the provinces of Manitoba, Ontario, Quebec, Nova Scotia, and Newfoundland in which 211, 188, 95, 6, and 10 samples, respectively, were collected. Each sample consisted of 400 randomly selected leaves from selected potato fields representing seed lots registered in one of the four Elite seed classes or in the Foundation and Certified classes, except for a small number of samples (11%) that were from commercial nonseed fields. Leaves were tested using the dot blot procedure in composites of 50 leaves as described (2). Approximately 10% of the samples were retested using rPAGE followed by northern blotting to confirm dot blot results. All dot blot and rPAGE/northern blot results were negative for PSTVd. The cumulative results of the PSTVd surveys in all 10 Canadian provinces and the absence of the disease in the field as determined by annual visual inspection meets the International Standards of Phytosanitary Measures for the Requirements for the Establishment of Pest Free Areas (3). Hence, Canada declares that PSTVd is absent within its potato industry. A similar declaration was made by the United States recently on the basis of similar field inspection and survey data (4). References: (1) D. Coates-Milne. FAO Plant Prot. Bull. 37:130, 1989. (2) S. H. De Boer et al. Can. J. Plant Pathol. 24:372, 2002. (3) FAO. ISPM Pub. No. 4, 1996. (4) M. Sun et al. Am. J. Potato Res. 81:227, 2004.
APA, Harvard, Vancouver, ISO, and other styles
10

Qu, Xinshun, and Barbara J. Christ. "Single Cystosorus Isolate Production and Restriction Fragment Length Polymorphism Characterization of the Obligate Biotroph Spongospora subterranea f. sp. subterranea." Phytopathology® 96, no. 10 (October 2006): 1157–63. http://dx.doi.org/10.1094/phyto-96-1157.

Full text
Abstract:
Spongospora subterranea f. sp. subterranea causes powdery scab in potatoes and is distributed worldwide. Genetic studies of this pathogen have been hampered due, in part, to its obligate parasitism and the lack of molecular markers for this pathogen. In this investigation, a single cystosorus inoculation technique was developed to produce large amounts of S. subterranea f. sp. subterranea plasmodia or zoosporangia in eastern black nightshade (Solanum ptycanthum) roots from which DNA was extracted. Cryopreservation of zoosporangia was used for long-term storage of the isolates. S. subterranea f. sp. subterranea-specific restriction fragment length polymorphism (RFLP) markers were developed from randomly amplified polymorphic DNA (RAPD) fragments. Cystosori of S. subterranea f. sp. subterranea were used for RAPD assays and putative pathogen-specific RAPD fragments were cloned and sequenced. The fragments were screened for specificity by Southern hybridization and subsequent DNA sequence BLAST search. Four polymorphic S. subterranea f. sp. subterranea-specific probes containing repetitive elements, and one containing single copy DNA were identified. These RFLP probes were then used to analyze 24 single cystosorus isolates derived from eight geographic locations in the United States and Canada. Genetic variation was recorded among, but not within, geographic locations. Cluster analysis separated the isolates into two major groups: group I included isolates originating from western North America, with the exception of those from Colorado, and group II included isolates originating from eastern North America and from Colorado. The techniques developed in this study, i.e., production of single cystosorus isolates of S. subterranea f. sp. subterranea and development of RFLP markers for this pathogen, provide methods to further study the genetic structure of S. subterranea f. sp. subterranea.
APA, Harvard, Vancouver, ISO, and other styles
More sources

Book chapters on the topic "Plant hybridization. Potatoes"

1

Plaisted, Robert L. "Potato." In Hybridization of Crop Plants, 483–94. Madison, WI, USA: American Society of Agronomy, Crop Science Society of America, 2015. http://dx.doi.org/10.2135/1980.hybridizationofcrops.c34.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Jones, A. "Sweet Potato." In Hybridization of Crop Plants, 645–55. Madison, WI, USA: American Society of Agronomy, Crop Science Society of America, 2015. http://dx.doi.org/10.2135/1980.hybridizationofcrops.c46.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Schilde-Rentschler, L., G. Boos, and H. Ninnemann. "Somatic Hybridization of Diploid Potato Lines, a Tool in Potato Breeding." In Progress in Plant Protoplast Research, 195–96. Dordrecht: Springer Netherlands, 1988. http://dx.doi.org/10.1007/978-94-009-2788-9_66.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Karlsson, Sylvia B., and Tage Eriksson. "Somatic Hybridization between Anther-Derived Dihaploid Lines of Solanum Tuberosum L. (Potato)." In Progress in Plant Protoplast Research, 197–98. Dordrecht: Springer Netherlands, 1988. http://dx.doi.org/10.1007/978-94-009-2788-9_67.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Waara, Sylvia. "The potentials of using dihaploid/diploid genotypes in breeding potato by somatic hybridization." In In Vitro Haploid Production in Higher Plants, 321–38. Dordrecht: Springer Netherlands, 1996. http://dx.doi.org/10.1007/978-94-017-0477-9_15.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

"Somatic Cell Genetics Of Potato: Variant Cell Lines And Somatic Hybridization." In Genetic Manipulation in Plant Breeding, 701–2. De Gruyter, 1986. http://dx.doi.org/10.1515/9783110871944-122.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

"Investigations Into The Transfer Of Genetic Information Between Solanaceous Species And Potato By Somatic Hybridization." In Genetic Manipulation in Plant Breeding, 683–84. De Gruyter, 1986. http://dx.doi.org/10.1515/9783110871944-117.

Full text
APA, Harvard, Vancouver, ISO, and other styles
You might also be interested in the extended bibliographies on the topic 'Plant hybridization. Potatoes' for particular source types:
Journal articles
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography