To see the other types of publications on this topic, follow the link: Plant hybridization. Potatoes.
Journal articles on the topic 'Plant hybridization. Potatoes'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Plant hybridization. Potatoes.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Biryukova, V. A., I. V. Shmiglya, V. A. Zharova, M. P. Beketova, E. V. Rogozina, A. V. Mityushkin, and A. A. Meleshin. "Molecular markers of genes for extreme resistance to potato virus Y in varieties and hybrids Solanum tuberosum L." Rossiiskaia selskokhoziaistvennaia nauka, no. 5 (October 23, 2019): 17–22. http://dx.doi.org/10.31857/s2500-26272019517-22.
Full textAbstract:
Potato virus Y (PVY) are among the most harmful viral pathogens that reduce the yield and quality of potatoes. The number of modern varieties resistant to a wide range of PVY strains is very limited, therefore, the selection of potatoes in this direction does not become irrelevant. Molecular markers of the Ry genes are universal tools for identifying new sources of resistance among existing biodiversity of potato genotypes. Since potato varieties and hybrids containing Rysto tend to exhibit cytoplasmic male sterility associated with mitochondrial DNA, the definition of cytoplasmic types is important. In the article, molecular markers of the Ry genes YES3-3A, YES3-3B, RYSC3, Ry186 were used for screening foreign and Russian varieties and hybrids potatoes from the collections of Lorch Potato Research Institute and N.I.Vavilov Institute of Plant Genetic Resources. Molecular screening and analysis of рedigree revealed that russian varieties and hybrids of potatoes characterized by extreme resistance to PVY were obtained on the basis of foreign varieties Alwara, Arosa, Bison, Bobr, Roko, as well as backcrosses of the Hungarian selection donors of the Rysto gene linked to cytoplasmic male sterility, and forms 128/6 a donor of the Ryadg gene, derived from S. stoloniferum. The marker RYSC3 coupled to Ryadg was found in interspecies hybrids of N.I.Vavilov Institute of Plant Genetic Resources 8-1-2004, 8-3-2004, 8-5-2004, 135-5-2005, 135-3-2005, having the same origin with the participation of S. okadae species K-20921 Hawkes et Hjerting and S. chacoense K-19759 Bitt. The marker Ry186 of the gene Rychc is rare. It is present in 5% of the potato genotypes. Molecular screening revealed samples of potatoes with markers of the Ry genes. They are of particular interest for further breeding. Data on the presence of Ry markers of genes in potato varieties and hybrids, serve as valuable information in the selection of initial forms for hybridization.
2
Brown, Charles R. "Russet Burbank: No Ordinary Potato." HortScience 50, no. 2 (February 2015): 157–60. http://dx.doi.org/10.21273/hortsci.50.2.157.
Full textAbstract:
The ‘Russet Burbank’ potato cultivar currently occupies first place in acreage planted in North America and is worth in the United States $1.4 billion annually. It is a sport of ‘Burbank's Seedling’, which was selected by Luther Burbank in 1873. The ancestry of Burbank stems from a plant introduction brought to the United States by the Rev. Chauncey Goodrich of New York State in 1853. The priorities of potato breeding had been transformed by repetitive crop failures caused by the emergence of the plant pathogen Phytophthora infestans. Modern testing suggests that derivatives of Goodrich’s potatoes were slightly more resistant to Phytophthora. Burbank discovered a single fruit on one of these derivatives, ‘Early Rose’, in his mother’s garden. Taking the 23 true seeds, he nursed them to full-sized plants and selected ultimately No. 15. It produced an unusually high yield of large, very oblong tubers, stored well, and was a good eating potato. Burbank’s life was destined for a long career in California and he attempted to sell the clone to J.H.J. Gregory of Gregory’s Honest Seeds, a successful businessman. Ultimately Gregory agreed to buy it for $150, far less than Burbank wanted, but enough to propel him to California. Gregory named the potato ‘Burbank's Seedling’, which no doubt engendered fame for the entrepreneur. Luther Burbank had been allowed by Gregory to keep 10 tubers, which became the seed source for the ‘Burbank's Seedling’ to spread north and south along the West Coast of North America with a crop value, stated by Burbank, of $14 million in 1914. It is not clear that Luther Burbank prospered from ‘Burbank's Seedling’ in the West. A skin sport with a russet skin was found in Colorado in 1902 and was advertised by a seed company under the name ‘Netted Gem’. ‘Burbank's Seedling’ per se disappeared from commerce and ‘Netted Gem’ slowly increased, finding a special niche in production of French fry potatoes. It is clear that Luther Burbank gained tremendous insight into the dynamics of hybridization in revealing genetic variation from clonally propagated species. During the rest of his career he would use this technique to produce new and amazing forms of numerous food and ornamental species. ‘Burbank's Seedling’ was his entrez into the world of plant breeding.
3
Chen, Qin, H. Y. Li, Y. Z. Shi, D. Beasley, B. Bizimungu, and M. S. Goettel. "Development of an effective protoplast fusion system for production of new potatoes with disease and insect resistance using Mexican wild potato species as gene pools." Canadian Journal of Plant Science 88, no. 4 (July 1, 2008): 611–19. http://dx.doi.org/10.4141/cjps07045.
Full textAbstract:
Somatic hybridization through protoplast fusion is an important alternative approach for overcoming sexual incompatibility between diploid Solanum species and cultivated potatoes. However, compared with other potato species, methods for protoplast isolation and plant generation for several Mexican wild diploid potato species are not well established. In this study, a systematic procedure was designed for the isolation of a large number of high-quality protoplasts from various Mexican wild species that carry high levels of disease (late blight) and insect [Colorado potato beetle (CPB)] resistance. Using this procedure, an effective potato protoplast fusion system was developed to produce new somatic hybrids between two Mexican, one Argentina wild species, and cultivated potato clones. Regenerated plants and somatic hybrids were obtained at a high frequency from the protoplasts of the diploid wild species and their fused cells with S. tuberosum. Morphological, cytological and molecular marker analyses demonstrated that somatic hybrids were successfully obtained from the cell fusion of S. tuberosum and the diploid species S. pinnatisectum, S. cardiophyllum, and S. chacoense. Assessment of disease and insect reactions demonstrated that several of the protoplast-derived clones and somatic hybrids showed a higher level of resistance to both late blight and CPB than was found in S. tuberosum, confirming that the protoplast system is a powerful tool in potato breeding programs for the development of disease and insect resistance. This new fusion system provides breeders with opportunities to transfer disease and insect resistance genes from Mexican wild species into cultivated potato. Key words: Somatic hybrid, protoplast, fusion, potato, Solanum, late blight, disease resistance, Colorado potato beetle insect resistance
4
Slack, S. A. "Comparison of PCR, ELISA, and DNA Hybridization for the Detection ofClavibacter michiganensissubsp.sepedonicusin Field-Grown Potatoes." Plant Disease 80, no. 5 (1996): 519. http://dx.doi.org/10.1094/pd-80-0519.
Full text
5
Drennan, J. L. "Comparison of a DNA Hybridization Probe and ELISA for the Detection ofClavibacter michiganensissubsp.sepedonicusin Field-Grown Potatoes." Plant Disease 77, no. 12 (1993): 1243. http://dx.doi.org/10.1094/pd-77-1243.
Full text
6
Kamoun, Sophien, Theo van der Lee, Grardy van den Berg-Velthuis, Koen E. de Groot, and Francine Govers. "Loss of Production of the Elicitor Protein INF1 in the Clonal Lineage US-1 of Phytophthora infestans." Phytopathology® 88, no. 12 (December 1998): 1315–23. http://dx.doi.org/10.1094/phyto.1998.88.12.1315.
Full textAbstract:
The extracellular protein INF1 of Phytophthora infestans is a member of the elicitin family of protein elicitors known to induce a hypersensitive response on some solanaceous and cruciferous plants. The presence of INF1 elicitin in culture filtrates of 102 P. infestans isolates from 15 countries was examined. All tested isolates produced INF1 except five isolates collected in 1976 and 1977 from infected potatoes in East Germany (the former German Democratic Republic). Based on hybridization to the multi-locus DNA fingerprint probe RG57, all the INF1-nonproducing isolates were shown to belong to the clonal lineage US-1 that dominated world populations until the 1980s. Phylogenetic analysis of a set of European US-1 isolates using amplified fragment length polymorphism fingerprint data indicated that loss of INF1 production evolved independently in separate lineages within US-1. DNA and RNA blot hybridizations showed that INF1-nonproducing isolates still retain a copy of the inf1 gene, whereas little inf1 mRNA could be detected. Hypothetical interpretations of the evolution in a restricted geographic area of P. infestans lineages deficient in the production of a specific elicitor protein are discussed.
7
Maune, Juan Federico, Elsa Lucila Camadro, and Luis Ernesto Erazzú. "Cross-incompatibility and self-incompatibility: unrelated phenomena in wild and cultivated potatoes?" Botany 96, no. 1 (January 2018): 33–45. http://dx.doi.org/10.1139/cjb-2017-0070.
Full textAbstract:
Knowledge of internal hybridization barriers is relevant for germplasm conservation and utilization. The two pre-zygotic barriers are pollen–pistil self-incompatibility (SI) and cross-incompatibility (CI). To ascertain whether SI and CI were phenotypically related phenomena in potatoes, extensive intra- and interspecific, both intra- and interploidy breeding relationships were established, without previous assumptions on the compatibility behavior of the studied germplasm. Pollen–pistil relationships were analyzed at the individual genotype/accession/family level. In two seasons, 828 intra- and interspecific genotypic combinations were performed, using accessions of the wild potatoes Solanum chacoense Bitter (2n = 2x = 24), S. gourlayi Hawkes (2n = 2x = 24; 2n = 4x = 48), and S. spegazzinii Bitter (2n = 2x = 24), full-sibling (hereinafter “full-sib”) families (2n = 2x = 24) within/between the latter two diploids, and S. tuberosum L. (2n = 4x = 48) cultivars. Pollen–pistil incompatibility occurred in the upper first third of the style (I1/3) in all selfed diploids. In both the intra- and interspecific combinations, the most frequent relationship was compatibility, followed by I1/3, but incompatibility also occurred in the stigma and the style (middle third and bottom third). We observed segregation for these relationships in full-sib families, and unilateral and bilateral incompatibility in reciprocal crosses between functional SI genotypes. Cross-incompatibility in potatoes is, apparently, controlled by genes independent of the S-locus or its S-haplotype recognition region (although molecular evidence is needed to confirm it), with segregation even within accessions.
8
Almeida, M. M. S., A. F. Orílio, F. L. Melo, R. Rodriguez, A. Feliz, X. Cayetano, R. T. Martínez, and R. O. Resende. "The First Report of Tomato chlorotic spot virus (TCSV) Infecting Long Beans and Chili Peppers in the Dominican Republic." Plant Disease 98, no. 9 (September 2014): 1285. http://dx.doi.org/10.1094/pdis-04-14-0348-pdn.
Full textAbstract:
The Dominican Republic has a significant area of the country cultivated with vegetables. In July 2013, in the provinces of Moca and La Vega, horticultural crops showed typical tospovirus symptoms (>30% incidence), including bronzing, chlorosis, necrosis, and ring spots on leaves and fruits. Samples were collected from potatoes (Solanum tuberosum), long beans (Vignaun guiculata), chili peppers (Capsicum frutescens), sweet peppers (C. annuum), and tomatoes (S. lycopersicum). Serological tests were clearly positive for infection by Tomato spotted wilt virus (TSWV) and/or related tospoviruses when tested with AgDia immunostrips. The viral RNA extracted from five plants per host was pooled to construct a cDNA library that was sequenced using an Illumina HiSeq 2000 platform. The paired-end reads were assembled using CLC Genomic Workbench version 6.0.3. The assembled contigs were submitted to BLASTx against a viral genome database. The results confirmed the presence of Tomato chlorotic spot virus (TCSV) and TSWV. Then, PCR tests were performed with primers pairs TSWV-LF 5′ CTGTTGTCTATTGAGGATTGTG 3′ AND TSWV-LR 5′ CAGAGAGCTTGTTAATGCAGGAC 3′ to amplify part of the TSWV L RNA, the pairs TCSV-SF 5′ AACTGGGAAAGCAGAAAACC 3′ and TCSV-SR 5′ CCTTACTCCGAACATTGCA 3′, and GRSV-SF 5′ CTGTCAGGAAAATCTTGACCTG 3′ and GRSV-SR 5′ CTTGACTCCAAACATCTCGT 3′ to detect part of the TCSV and Groundnut ringspot virus (GRSV) S segments. In the long bean and chili pepper samples from La Vega, only TCSV was detected (40% of the all samples) based on amplification of the expected size fragment with the S RNA specific primer pair. All the other samples were positive for TSWV and no GRSV was detected. The complete N gene of TCSV and TSWV were amplified using the primer pairs TCSV-NR2 5′ CACACTGAACTGAACTATAACACAC 3′ and TCSV-NF 5′ ACCTTGAATCATATCTCTCG 3′ and primers N-TSWV_FW 5′ TACGGATCCGATGTCTAAGGTTAAGCTCAC 3′ and N-TSWV_RV 5′ TTATCTCGAGTCAAGCAAGTTCTGCGAG 3′. The TCSV N protein sequences (KJ399303 and KJ399304) were 99% identical with the TCSV found in processing tomatoes in the Dominican Republic (1) and the United States (2). The TSWV N protein sequences (KJ399313, KJ399314 and KJ399315) shared 96 to 98% identity with the TSWV N sequences available. Dot blot hybridization tests (1) using DIG-labeled specific TCSV N gene probe confirmed TCSV infection in PCR-positive long bean and chili pepper samples, whereas no hybridization signal was detected for TSWV-infected tomatoes, potatoes, sweet peppers, or healthy samples. In addition, no reassortants were detected based on amplification of the expected size RNA fragments (3). These other amplicons (KJ399301, KJ399299, KJ399302, and KJ399300) showed 98% identity with the L and M segments of TCSV. Thrips collected from symptomatic plants were identified mainly as Frankliniella schultzei, consistent with the main thrips species transmitting TCSV. In the last two years, TCSV was reported in North and Central America and in the Caribbean Basin (1,2,4). These findings have an important epidemiological impact since TCSV represents a new threat to other horticultural crops affected by this tospovirus. References: (1) O. Batuman et al. Plant Dis. 98:286, 2014. (2) A. Londono et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Virology 413:216, 2011. (4) C. G. Webster et al. Plant Health Progress. Online publication. doi:10.1094/PHP-2013-0812-01-BR, 2013.
9
De Boer, S. H., and T. L. DeHaan. "Absence of Potato spindle tuber viroid within the Canadian Potato Industry." Plant Disease 89, no. 8 (August 2005): 910. http://dx.doi.org/10.1094/pd-89-0910a.
Full textAbstract:
Potato spindle tuber viroid (PSTVd) causes a serious disease of potato, affecting yield and tuber quality. To control the disease, the Canadian seed certification program maintains a zero tolerance for the disease and a requirement that all nuclear stock, the micropropagated plantlets from which each lot of seed potatoes is initiated, is tested using reverse polyacrylamide gel electrophoresis (rPAGE) to ensure freedom from PSTVd. Moreover, seed potato fields are visually inspected during two or more annual field inspections for the presence of PSTVd and viruses. Symptoms of PSTVd have not been observed during field inspections for at least the last 25 years. Prior to 1989, seed potato stocks in the provinces of Prince Edward Island and New Brunswick were tested using rPAGE and nucleic acid dot blot hybridization for the presence of the viroid, and no infections were found (1). Similar surveys for PSTVd in Canada's western provinces of British Columbia, Alberta, and Saskatchewan also failed to detect the viroid (2). During 2000–2004, the PSTVd survey was extended to the provinces of Manitoba, Ontario, Quebec, Nova Scotia, and Newfoundland in which 211, 188, 95, 6, and 10 samples, respectively, were collected. Each sample consisted of 400 randomly selected leaves from selected potato fields representing seed lots registered in one of the four Elite seed classes or in the Foundation and Certified classes, except for a small number of samples (11%) that were from commercial nonseed fields. Leaves were tested using the dot blot procedure in composites of 50 leaves as described (2). Approximately 10% of the samples were retested using rPAGE followed by northern blotting to confirm dot blot results. All dot blot and rPAGE/northern blot results were negative for PSTVd. The cumulative results of the PSTVd surveys in all 10 Canadian provinces and the absence of the disease in the field as determined by annual visual inspection meets the International Standards of Phytosanitary Measures for the Requirements for the Establishment of Pest Free Areas (3). Hence, Canada declares that PSTVd is absent within its potato industry. A similar declaration was made by the United States recently on the basis of similar field inspection and survey data (4). References: (1) D. Coates-Milne. FAO Plant Prot. Bull. 37:130, 1989. (2) S. H. De Boer et al. Can. J. Plant Pathol. 24:372, 2002. (3) FAO. ISPM Pub. No. 4, 1996. (4) M. Sun et al. Am. J. Potato Res. 81:227, 2004.
10
Qu, Xinshun, and Barbara J. Christ. "Single Cystosorus Isolate Production and Restriction Fragment Length Polymorphism Characterization of the Obligate Biotroph Spongospora subterranea f. sp. subterranea." Phytopathology® 96, no. 10 (October 2006): 1157–63. http://dx.doi.org/10.1094/phyto-96-1157.
Full textAbstract:
Spongospora subterranea f. sp. subterranea causes powdery scab in potatoes and is distributed worldwide. Genetic studies of this pathogen have been hampered due, in part, to its obligate parasitism and the lack of molecular markers for this pathogen. In this investigation, a single cystosorus inoculation technique was developed to produce large amounts of S. subterranea f. sp. subterranea plasmodia or zoosporangia in eastern black nightshade (Solanum ptycanthum) roots from which DNA was extracted. Cryopreservation of zoosporangia was used for long-term storage of the isolates. S. subterranea f. sp. subterranea-specific restriction fragment length polymorphism (RFLP) markers were developed from randomly amplified polymorphic DNA (RAPD) fragments. Cystosori of S. subterranea f. sp. subterranea were used for RAPD assays and putative pathogen-specific RAPD fragments were cloned and sequenced. The fragments were screened for specificity by Southern hybridization and subsequent DNA sequence BLAST search. Four polymorphic S. subterranea f. sp. subterranea-specific probes containing repetitive elements, and one containing single copy DNA were identified. These RFLP probes were then used to analyze 24 single cystosorus isolates derived from eight geographic locations in the United States and Canada. Genetic variation was recorded among, but not within, geographic locations. Cluster analysis separated the isolates into two major groups: group I included isolates originating from western North America, with the exception of those from Colorado, and group II included isolates originating from eastern North America and from Colorado. The techniques developed in this study, i.e., production of single cystosorus isolates of S. subterranea f. sp. subterranea and development of RFLP markers for this pathogen, provide methods to further study the genetic structure of S. subterranea f. sp. subterranea.
11
Wełnicki, M., C. Zekanowski, and W. Zagórski. "Digoxigenin-labelled molecular probe for the simultaneous detection of three potato pathogens: potato spindle tuber viroid (PSTVd), potato virus Y (PVY), and potato leafroll virus (PLRV)." Acta Biochimica Polonica 41, no. 4 (December 31, 1994): 473–75. http://dx.doi.org/10.18388/abp.1994_4702.
Full textAbstract:
A molecular probe, p3POT, was constructed of PSTVd, PVY, PLRV cDNA fragments introduced into pUC18 vector. Sequencing of the inserts revealed that cloned fragments covered conservative parts of pathogenic genomes. Dot-blot hybridization of digoxigenin-labelled construct to crude extracts from plants infected with different potato viruses proved high sensitivity and specificity of the p3POT probe. This makes p3POT probe an useful tool for the routine testing, and selection of virus-free potatoes.
12
Kumar, Meetul, and Swarup Kumar Chakrabarti. "Expression of β-defensin gene in potato confers enhanced resistance to Ralstonia Solanacearum L." Defence Life Science Journal 3, no. 1 (December 15, 2017): 15. http://dx.doi.org/10.14429/dlsj.3.11416.
Full textAbstract:
An optimized methodology of <em>Agrobacterium</em>-mediated stable genetic transformation of potato (<em>Solanum tuberosum </em>L.) using the shoot organogenesis potential of internodal stem segments for increased resistance to bacterial plant pathogen, <em>Ralstonia solanacearum</em> L. was developed. Improvised plant regeneration protocol for expression of antimicrobial β-defensin transgene and efficient selection of tissues in plant selectable marker, kanamycin sulphate was successfully utilized for transformation of potato. Stable integration and expression of antimicrobial peptide was observed in plant tissues and validated by associated molecular analysis by RT PCR, Southern hybridization, northern hybridization and western blotting of the infected tissues. The bacterial wilt disease progression was monitored in controlled greenhouse and Percent Disease Index (PDI) was measured by analysis of variance (ANOVA) that selected superior resistant plants. These transformed plants were able to contain the disease progression and complete the life cycle stages and developed healthy tubers.
13
Kundu, BC, MS Islam, MA Kawochar, and MH Rashid. "Potato (Solanum tuberosum L.) variety development through hybridization: a new era in Bangladesh." Bangladesh Journal of Agricultural Research 38, no. 4 (May 31, 2014): 637–46. http://dx.doi.org/10.3329/bjar.v38i4.19019.
Full textAbstract:
Systematic research on potato variety development has been in practice in Bangladesh since 1960, but until 2012, not a single variety was developed in this country through conventional breeding method, mainly due to the short day climatic factors which are not congenial for potato plants to flower. Due to the diversified efforts, TCRC scientists were able to make a breakthrough to overcome the climatic barriers. Flowering was induced in HYV potatoes and produce berries in the year 2000. After hybridization and continuous selection, five hybrid clones were placed in a RYT in 2010-11 from a batch of 502 kg F1 seedling tubers produced from 45 gram hybrid seeds of 2001-02. Based on the performances of SYT, AYT, RYT and on-farm trials, three varieties were released by the NSB in 2012 as BARI Alu-35, BARI Alu-36, and BARI Alu-37. Their genotype numbers are 4.5W, 4.26R, and 4.40, their mean yields were 38.36, 33.82, and 34.88 t/ha in AYT, 44.01, 41.84, and 40.58 t/ha in RYT, and 38.87, 38.52, and 37.53 t/ha in on-farm trials, respectively. DOI: http://dx.doi.org/10.3329/bjar.v38i4.19019 Bangladesh J. Agril. Res. 38(4): 637-646, December 2013
14
Maoka, T., S. Sugiyama, Y. Maruta, and T. Hataya. "Application of cDNA Macroarray for Simultaneous Detection of 12 Potato Viruses." Plant Disease 94, no. 10 (October 2010): 1248–54. http://dx.doi.org/10.1094/pdis-12-09-0787.
Full textAbstract:
A complementary DNA (cDNA) macroarray was developed for simultaneous detection of 12 different potato viruses. A suitable region in the viral genome for each was selected for Alfalfa mosaic virus, Cucumber mosaic virus, Potato aucuba mosaic virus, Potato leafroll virus, Potato mop-top virus, Potato virus A, Potato virus M, Potato virus S, Potato virus X, Potato virus Y, Tomato ringspot virus, and Tomato spotted wilt virus, and their respective cDNAs were cloned into plasmid vectors. Capture probes for each virus ranging from 290 to 577 bp were generated by polymerase chain reaction (PCR) and immobilized on a nylon membrane. Total RNAs were extracted from each of these virus infected-plants, and cDNAs were synthesized from the RNA extracts using a random 9-mer primer. Subsequently, PCR reactions were performed using one primer pair for each of the 12 viruses. During PCR, amplified cDNAs were labeled with biotin and used as a target for hybridization analyses on a macroarray membrane. Hybridization signals between capture probes for the 12 viruses and their respective target cDNAs were observed using chemiluminescent or colorimetric detection. In all viruses, hybridization signals with capture probes were detected only when homologous virus targets were examined, and no hybridization to healthy plant extract was observed, facilitating identification of each virus. The results by colorimetric detection agreed with those obtained using chemiluminescence. The macroarray method developed was 5 × 102 to 4 × 106 times more sensitive than enzyme-linked immunosorbent assay and 5 to 5 × 104 times more sensitive than reverse-transcription PCR, except for Alfalfa mosaic virus. Colorimetric detection and substantial reduction in cross-hybridization signals much improved the method compared with other array-based detection methods for practical use.
15
Shi, Y. Z., Q. Chen, H. Y. Li, D. Beasley, and D. R. Lynch. "Somatic hybridization between Solanum tuberosum and S. cardiophyllum." Canadian Journal of Plant Science 86, no. 2 (May 5, 2006): 539–45. http://dx.doi.org/10.4141/p05-076.
Full textAbstract:
The wild diploid Mexican species, Solanum cardiophyllum Lindl. (2n = 2x = 24), is resistant to important potato diseases. However, introgression of resistance to the tetraploid cultivated potato (S. tuberosum L.) (2n = 4x = 48) by conventional crossing is not feasible due to the difference in their endosperm balance number between these species. Somatic hybrids between S. cardiophyllum and S. tuberosum were produced for the first time by electrofusion of protoplasts isolated from young leaves of each parental line. The hybrid nature of the regenerated plants was confirmed based on morphology, chromosome number and DNA species-specific RAPD markers. All the somatic hybrids produced a violet pigmentation on their stems and petioles, which resembled the wild partner. Most of the hybrid plants had 2n = 72 chromosomes and exhibited a morphology intermediate between the two fusion parents, but with a tendency towards cultivated potato. These plants flowered and set fruit when backcrossed with their S. tuberosum fusion parent. Key words: Potato (Solanum tuberosum), S. cardiophyllum, protoplast fusion, RAPD marker
16
SINGH, R. P., T.-L. DeHAAN, and A. S. JASWAL. "A SURVEY OF THE INCIDENCE OF POTATO SPINDLE TUBER VIROID IN PRINCE EDWARD ISLAND USING TWO TESTING METHODS." Canadian Journal of Plant Science 68, no. 4 (October 1, 1988): 1229–36. http://dx.doi.org/10.4141/cjps88-152.
Full textAbstract:
Return-polyacrylamide gel electrophoresis (R-PAGE) and nucleic acid hybridization (dot-blot) were used for the detection of potato spindle tuber viroid (PSTV) from potato leaves. Both methods detected potato plants experimentally infected in the first season or those produced from infected tubers (secondarily infected). PSTV concentration was lower in the first-season infected plants than those in the second. Both methods detected PSTV in a single leaf disc from field-grown infected plants combined with 399 – 499 discs from field-grown healthy plants. The sensitivity of detection by R-PAGE was lower for certain cultivars and increased with the age of plants. About 85 000 leaf samples collected from 123 tablestock fields, 170 seed fields, and 63 cultivars from the Fox Island Elite Seed Farm in Prince Edward Island were found to be free from PSTV infection. Reasons for PSTV absence in the potato crop are discussed.Key words: Diagnosis, dot-blot, return polyacrylamide gel electrophoresis, nucleic acid hybridization, Solanum tuberosum, potato
17
Möllers, C., and G. Wenzel. "Somatic Hybridization of Dihaploid Potato Protoplasts as a Tool for Potato Breeding*." Botanica Acta 105, no. 3 (June 1992): 133–39. http://dx.doi.org/10.1111/j.1438-8677.1992.tb00278.x.
Full text
18
Karjalainen, Reijo, Leo Rouhiainen, and Hans Söderlund. "Diagnosis of plant viruses by nucleic acid hybridization." Agricultural and Food Science 59, no. 3 (July 1, 1987): 179–91. http://dx.doi.org/10.23986/afsci.72262.
Full textAbstract:
Nucleic acid hybridization is a powerful technique for the diagnosis of many plant viruses not easily detected by serological techniques. It is particularly effective in the detection of viruses occurring in low amount in plant tissue, viruses that are poor immunogens or contain satellites. Molecular probes with desired specificities can be prepared by recombinant DNA techniques for large scale use. cDNA probes of potato virus X(PVX) RNA were made by molecular cloning, and the clones were 32P labelled by nick translation. Hybridization of cDNA to PVX RNA revealed 1 ng of purified virus in 2 µl spots dried onto nitrocellulose filter. Infected samples of crude leaf extracts were easily detected by hybridization, while probes did not react with healthy leaf samples. Nucleic acid hybridization research aims at replacing radiometric probes with nonradioactive methods involving enzymes which are directly or indirectly coupled to the probe and whose presence is observed with the aid of a colour changing substrate. Hybridization assay formats that can easily be automatized are under development. Sandwich hybridization is a simple test format developed for analyzing unpurified biological material, and it appears to be a powerful tool for microbial diagnostics. Sensitivity can be improved by using detection systems in which the specific activity of the probe is increased. Procedures such as ’polymerase chain reaction’, in which the amount of detectable nucleic acid sequences can be increased, are promising alternatives for increasing sensitivity. It is concluded that even if probe-based assays are in their infancy, they will no doubt develop towards such easy use as have immunological test kits.
19
Agindotan, Bright, and Keith L. Perry. "Macroarray Detection of Plant RNA Viruses Using Randomly Primed and Amplified Complementary DNAs from Infected Plants." Phytopathology® 97, no. 1 (January 2007): 119–27. http://dx.doi.org/10.1094/phyto-97-0119.
Full textAbstract:
Membrane-based macroarrays provide a relatively inexpensive technology with the potential to detect hundreds of pathogens in a single assay. For the simultaneous detection of a large number of pathogens, it is necessary to obtain sufficient nucleic acids for labeling, and any amplification reactions need to be performed using unbiased, pathogen-non-specific primers. A nonradioactive macroarray system is described to test for plant RNA viruses using 70-mer oligonucleotide probes immobilized on nylon membranes. Starting with a total plant RNA extract, complementary DNA (cDNA) and second-strand syntheses were carried out using an anchor primer sequence with random pentamers coupled at the 3′ end. Subsequent synthesis by polymerase chain reaction using the anchor primer alone resulted in a relatively unbiased amplification of plant and viral RNAs. These cDNAs were chemically labeled and the product used as a target in hybridization analyses. The system was validated using RNA extracts from plants infected with Cucumber mosaic virus, Potato virus Y, and Potato leaf roll virus (PLRV). Despite the relative excess of host-derived nonviral sequences, viral RNAs were amplified between 100- and 1,000-fold and were detected in single and mixed infections. The macroarray sensitivity was comparable to that of double-antibody sandwich enzyme-linked immunosorbent assay, with PLRV being detected in sap dilutions of 1:100. The potential for the development of a relatively inexpensive multipathogen detection system is discussed.
20
Kogovšek, P., A. Kladnik, J. Mlakar, M. Tušek Žnidarič, M. Dermastia, M. Ravnikar, and M. Pompe-Novak. "Distribution of Potato virus Y in Potato Plant Organs, Tissues, and Cells." Phytopathology® 101, no. 11 (November 2011): 1292–300. http://dx.doi.org/10.1094/phyto-01-11-0020.
Full textAbstract:
The distribution of Potato virus Y (PVY) in the systemically infected potato (Solanum tuberosum) plants of the highly susceptible cultivar Igor was investigated. Virus presence and accumulation was analyzed in different plant organs and tissues using real-time polymerase chain reaction and transmission electron microscopy (TEM) negative staining methods. To get a complete insight into the location of viral RNA within the tissue, in situ hybridization was developed and optimized for the detection of PVY RNA at the cellular level. PVY was shown to accumulate in all studied leaf and stem tissues, in shoot tips, roots, and tubers; however, the level of virus accumulation was specific for each organ or tissue. The highest amounts of viral RNA and viral particles were found in symptomatic leaves and stem. By observing cell ultrastructure with TEM, viral cytoplasmic inclusion bodies were localized in close vicinity to the epidermis and in trichomes. Our results show that viral RNA, viral particles, and cytoplasmic inclusion bodies colocalize within the same type of cells or in close vicinity.
21
McGrath, J. Mitchell, and John P. Helgeson. "Differential behavior of Solanum brevidens ribosomal DNA loci in a somatic hybrid and its progeny with potato." Genome 41, no. 3 (June 1, 1998): 435–39. http://dx.doi.org/10.1139/g98-039.
Full textAbstract:
Fluorescence in situ hybridization was used to characterize loci encoding ribosomal RNA (rDNA) among parents and progeny of a somatic fusion between tetraploid Solanum tuberosum (potato) and diploid Solanum brevidens. As expected, four major sites of hybridization to rDNA loci were evident in the tetraploid parent species, two in the diploid parent species, and six in the hexaploid somatic fusion plant. Two of the loci in the somatic fusion plant showed differential signals relative to the other four, which were interpreted as a delayed condensation of sites harboring the rDNA loci. This delayed condensation was heritable to the first backcross generation of the somatic hybrid crossed with potato. In the second backcross generation, differential condensation was not evident. However, a heterochromatic isochromosome was observed whose presence was correlated with a S. brevidens specific marker linked with the rDNA locus. It is suggested that the S. brevidens rDNA loci are preferentially affected in the somatic hybrid and its progeny, and that the delayed condensation may have contributed to the formation of the isochromosome.Key words: introgression, recombination, isochromosome, in situ hybridization.
22
Song, Junqi, Fenggao Dong, and Jiming Jiang. "Construction of a bacterial artificial chromosome (BAC) library for potato molecular cytogenetics research." Genome 43, no. 1 (February 1, 2000): 199–204. http://dx.doi.org/10.1139/g99-099.
Full textAbstract:
Lack of reliable techniques for chromosome identification is the major obstacle for cytogenetics research in plant species with large numbers of small chromosomes. To promote molecular cytogenetics research of potato (Solanum tuberosum, 2n = 4x = 48) we developed a bacterial artificial chromosome (BAC) library of a diploid potato species S. bulbocastanum. The library consists of 23 808 clones with an average insert size of 155 kb, and represents approximately 3.7 equivalents to the potato genome. The majority of the clones in the BAC library generated distinct signals on specific potato chromosomes using fluorescence in situ hybridization (FISH). The hybridization signals provide excellent cytological markers to tag individual potato chromosomes. We also demonstrated that the BAC clones can be mapped to specific positions on meiotic pachytene chromosomes. The excellent resolution of pachytene FISH can be used to construct a physical map of potato by mapping molecular marker-targeted BAC clones on pachytene chromosomes. Key words: potato, BAC library, chromosome identification, physical mapping, molecular cytogenetics.
23
ELOMAA, P., J. J. JOENSUU, and H. KORPELAINEN. "Plant biotechnology for deeper understanding, wider use and further development of agricultural and horticultural crops." Agricultural and Food Science 17, no. 3 (December 4, 2008): 307. http://dx.doi.org/10.2137/145960608786118767.
Full textAbstract:
Plants bind solar energy to organic matter via photosynthesis and assimilation of carbon dioxide from the atmosphere and comprise the major source of nutrition and bioenergy. Plant biotechnology contributes to solution of important constraints in food and feed production and creates new technologies and applications for the sustainable use of plant resources. Genome-wide approaches such as massive parallel sequencing and microarrays to study gene expression, molecular markers for selection of important traits in breeding, characterization of genetic diversity with the aforementioned approaches, and somatic hybridization and genetic transformation are important tools in plant biotechnology. In this paper, studies carried out on enhanced resistance to viruses and tolerance of cold stress in potato, genetic modification of flower pigmentation and morphology in gerbera, production of edible vaccines in transgenic barley seeds, and expression of heterologous proteins for pharmaceutical purposes from vector viruses were chosen to exemplify the general utility of biotechnological approaches and also how plant biotechnology research has developed on cultivated plants at University of Helsinki. The studies reveal cellular and genetic mechanisms and provide scientific information that can be used for widening the uses of crop plants. They can also be used to detect any putative risks associated with the use of the biotechnological application in agriculture and horticulture and to develop practises which reduce any inadvertent negative consequences that plant production may have to the environment.;
24
Fuentes, S., and L. F. Salazar. "First Report of Sweet potato leaf curl virus in Peru." Plant Disease 87, no. 1 (January 2003): 98. http://dx.doi.org/10.1094/pdis.2003.87.1.98c.
Full textAbstract:
Leaf curling symptoms have been reported in sweet potato (Ipomoea batatas) plants infected with a geminivirus (1). Leaf curl disease appeared in Peru after the 1997 to 1998 El Niño, when the population and activity of whiteflies (Bemisia tabaci, B. argentifolii, and B. afer) increased. Approximately 6% of plants in farmers' commercial fields in San Ramón, Junín (September 2000) and Cañete, Lima (February 2001) showed typical leaf curling symptoms. Seventeen plants in total were collected from both places, and stem scions from those plants were graft-inoculated to I. setosa, which developed symptoms of leaf curling, interveinal chlorosis, and stunting. Total nucleic acid was obtained from infected sweet potato and I. setosa plants using cetyltrimethylammoniumbromide (CTAB) extraction, and primers PW285-3 (5′-CGT CGT TAG CAG TCT GCA GGC CTC CTC TAG-3′) and PW285-4 (5′ -AAC TGT AAA TAC GGA ACT GCA GTT CGA ATT-3′) for Sweet potato leaf curl virus (SPLCV), developed and provided by R. Valverde and C. Clark of Louisiana State University (2), were used to amplify SPLCV by polymerase chain reaction (PCR). Expected DNA fragments of ca. 900 bp (in all samples) and 2.4 kp (in some samples), characteristic of the subgenomic and genomic DNAs of SPLCV respectively, were obtained from symptomatic but not from symptomless (uninfected) plants. This 2.4-kb fragment was amplified in relatively small amounts compared to the 900-bp fragment. Presence of SPLCV was also confirmed by nucleic acid spot hybridization using a full-length clone of SPLCV-US. Fourteen of 17 plants infected with SPLCV were also infected with Sweet potato chlorotic stunt virus (determined by nitrocellulose membrane enzyme-linked immunosorbent assay serological test), which is also transmitted by whiteflies. These viruses now seem to be common in farmers' fields in San Ramón and Cañete. To our knowledge, this is the first report of SPLCV in Peru. References: (1) P. Lotrakul et al. Plant Dis. 82:1253, 1998. (2) P. Lotrakul and R. A. Valverde. Cloning of a DNA-A like genomic component of sweet potato leaf curl virus: nucleotide sequence and phylogenetic relationships. Molecular Plant Pathology On-Line ( http://www.bspp.org.uk/mppol/1999/0422lotrakul/paper.htm ), 1999.
25
Karczmarek, Aneta, Sylwia Fudali, Malgorzata Lichocka, Miroslaw Sobczak, Wojciech Kurek, Slawomir Janakowski, Jan Roosien, et al. "Expression of Two Functionally Distinct Plant Endo-β-1,4-Glucanases Is Essential for the Compatible Interaction Between Potato Cyst Nematode and Its Hosts." Molecular Plant-Microbe Interactions® 21, no. 6 (June 2008): 791–98. http://dx.doi.org/10.1094/mpmi-21-6-0791.
Full textAbstract:
For the proliferation of their feeding sites (syncytia), the potato cyst nematode Globodera rostochiensis is thought to recruit plant endo-β-1,4-glucanases (EGases, EC. 3.2.1.4). Reverse-transcription polymerase chain reaction experiments on tomato (Solanum lycopersicum) indicated that the expression of two out of the at least eight EGases, namely Sl-cel7 and Sl-cel9C1, is specifically upregulated during syncytium formation. In situ hybridization and immunodetection studies demonstrated that both EGases are specifically expressed inside and adjacent to proliferating syncytia. To assess the importance of Sl-cel7 and Sl-cel9C1 for nematode development, we decided to knock them out individually. Sl-cel9C1 probably is the only class C EGase in tomato, and we were unable to regenerate Sl-cel9C1–silenced plants. Potato (S. tuberosum), a close relative of tomato, harbors at least two class C EGases, and St-cel7-or St-cel9C1–silenced potato plants showed no obvious aberrant phenotype. Infection with potato cyst nematodes resulted in a severe reduction of the number of adult females (up to 60%) and a sharp increase in the fraction of females without eggs (up to 89%). Hence, the recruitment of CEL7, an enzyme that uses xyloglucan and noncrystalline cellulose as natural substrates, and CEL9C1, an enzyme that uses crystalline cellulose, is essential for growth and development of potato cyst nematodes.
26
Badilla, R., R. Hammond, and C. Rivera. "First Report of Potato Spindle Tuber Viroid in Costa Rica." Plant Disease 83, no. 11 (November 1999): 1072. http://dx.doi.org/10.1094/pdis.1999.83.11.1072d.
Full textAbstract:
During 1997 to 1998, symptoms of leaf roll, dwarfism, chlorosis, and occasional leaf necrosis were observed on Solanum tuberosum in several plots in Cartago, the principal potato-production region of Costa Rica. Because of the known association between potato leafroll virus (PLRV) and viroids (1) and previous reports of PLRV in Costa Rica, the presence of potato spindle tuber viroid (PSTVd) was suspected. Leaf samples from 122 symptomatic potato plants, cvs. Atzimba, Floresta, Idiafrit, and Birris, were collected from 10 plots. Total nucleic acids (TNAs) were extracted and purified (2) from collected symptomatic samples and six healthy potato controls. TNAs were spotted on nylon membranes and hybridized to a digoxigenin-labeled DNA probe specific for PSTVd. Of 122 symptomatic plants, 71 were positive for PSTVd based on dot blot hybridization. TNAs from 12 positive potato samples, including at least 1 sample from each cultivar, were used to inoculate Lycopersicum esculentum cv. Super Marmande. Eleven of twelve inoculated tomato plants showed symptoms of dwarfism, leaf deformation, and grayish foliage, often with a dull surface. TNAs were extracted from inoculated tomato and hybridized to the PSTVd probe. All inoculated symptomatic plants were positive for PSTVd based on dot blot hybridization. This is the first report of PSTVd in Costa Rica. References: (1) M. Querci et al. J. Gen. Virol. 78:1207, 1997. (2) W. Villalobos et al. Rev. Biol. Trop. 45:983, 1997.
27
Fessehaie, Anania, Solke H. De Boer, and C. André Lévesque. "An Oligonucleotide Array for the Identification and Differentiation of Bacteria Pathogenic on Potato." Phytopathology® 93, no. 3 (March 2003): 262–69. http://dx.doi.org/10.1094/phyto.2003.93.3.262.
Full textAbstract:
Oligonucleotides, 16 to 24 bases long, were selected from the 3′ end of the 16S gene and the 16S–23S intergenic spacer regions of bacteria pathogenic on potato, including Clavibacter michiganensis subsp. sepedonicus, Ralstonia solanacearum, and the pectolytic erwinias, including Erwinia carotovora subsp. atroseptica and carotovora and E. chrysanthemi. Oligonucleotides were designed and formatted into an array by pin spotting on nylon membranes. Genomic DNA from bacterial cultures was amplified by polymerase chain reaction using conserved ribosomal primers and labeled simultaneously with digoxigenin-dUTP. Hybridization of amplicons to the array and subsequent serological detection of digoxigenin label revealed different hybridization patterns that were distinct for each species and subspecies tested. Hybridization of amplicons generally was restricted to appropriate homologous oligonucleotides and cross-hybridization with heterologous oligonucleotides was rare. Hybridization patterns were recorded as separate gray values for each hybridized spot and revealed a consistent pattern for multiple strains of each species or subspecies isolated from diverse geographical regions. In preliminary tests, bacteria could be correctly identified and detected by hybridizing to the array amplicons from mixed cultures and inoculated potato tissue.
28
Novy, Richard G., and R. E. Hanneman. "Hybridization between Gp. Tuberosum Haploids and 1EBN wild potato species." American Potato Journal 68, no. 3 (March 1991): 151–69. http://dx.doi.org/10.1007/bf02853896.
Full text
29
Listanto, Edy, Eny Ida Riyanti, Tri Joko Santoso, Toto Hadiarto, and A. Dinar Ambarwati. "GENETIC STABILITY ANALYSIS OF RB GENE IN GENETICALLY MODIFIED POTATO LINES TOLERANT TO Phytophthora infestans." Indonesian Journal of Agricultural Science 16, no. 2 (February 19, 2016): 51. http://dx.doi.org/10.21082/ijas.v16n2.2015.p.51-58.
Full textAbstract:
Development of potato cultivars with high levels of broad spectrum resistance is a key long-term management strategy against late blight disease caused by Phytophthora infestans. Six progeny lines of hybridization between transgenic potato Katahdin SP951 with non-transgenic Granola and Atlantic were selected based on agronomical characteristics and resistance to late blight disease. The study aimed to analyze the number of insertions and stability of inserted RB gene in the transgenic potato lines. The research was carried out through plant DNA extraction, southern blot analysis and polymerase chain reaction (PCR). Southern blot analysis was used to detect the number of inserts integrated into potato genome, while PCR analysis was used to detect stability of RB gene from generation to generation. The results showed that the progenies obtained from hybridization between Atlantic and transgenic Katahdin SP951 (lines No. 20 and 27) and between Granola and transgenic Katahdin SP951 (line No. 69) contained one copy number of RB gene, according to the probing of nptII. The result is similar to that of inserted RB gene found in the parental transgenic Katahdin SP951. The presence of RB gene in four different generations (G0, G1, G2 and G3) showed stable integration of the gene into the plant genome. The single copy number of RB gene will repress the occurrence of silencing gene expression. The stability analysis of RB gene can determine that the gene is still present in plant genome after several generations.
30
Listanto, Edy, Eny Ida Riyanti, Tri Joko Santoso, Toto Hadiarto, and A. Dinar Ambarwati. "GENETIC STABILITY ANALYSIS OF RB GENE IN GENETICALLY MODIFIED POTATO LINES TOLERANT TO Phytophthora infestans." Indonesian Journal of Agricultural Science 16, no. 2 (February 19, 2016): 51. http://dx.doi.org/10.21082/ijas.v16n2.2015.pp.51-58.
Full textAbstract:
Development of potato cultivars with high levels of broad spectrum resistance is a key long-term management strategy against late blight disease caused by Phytophthora infestans. Six progeny lines of hybridization between transgenic potato Katahdin SP951 with non-transgenic Granola and Atlantic were selected based on agronomical characteristics and resistance to late blight disease. The study aimed to analyze the number of insertions and stability of inserted RB gene in the transgenic potato lines. The research was carried out through plant DNA extraction, southern blot analysis and polymerase chain reaction (PCR). Southern blot analysis was used to detect the number of inserts integrated into potato genome, while PCR analysis was used to detect stability of RB gene from generation to generation. The results showed that the progenies obtained from hybridization between Atlantic and transgenic Katahdin SP951 (lines No. 20 and 27) and between Granola and transgenic Katahdin SP951 (line No. 69) contained one copy number of RB gene, according to the probing of nptII. The result is similar to that of inserted RB gene found in the parental transgenic Katahdin SP951. The presence of RB gene in four different generations (G0, G1, G2 and G3) showed stable integration of the gene into the plant genome. The single copy number of RB gene will repress the occurrence of silencing gene expression. The stability analysis of RB gene can determine that the gene is still present in plant genome after several generations.
31
van der Waarde, Jaap J., Bert Geurkink, Maurice Henssen, and Guido Heijnen. "Detection of filamentous and nitrifying bacteria in activated sludge with 16S rRNA probes." Water Science and Technology 37, no. 4-5 (February 1, 1998): 475–79. http://dx.doi.org/10.2166/wst.1998.0699.
Full textAbstract:
Activated sludge samples from wastewater treatment plants from potato starch and starch derivatives factory and from a municipal sewage treatment plant were analyzed with DNA probes specific for several filamentous bacteria. It was found that Haliscomenobacter hydrossis, Sphaerotilus natans, Thiothrix sp. and Eikelboom Type 021N were common in the activated sludges. Fluorescent in situ Hybridization (FISH) analysis could detect more types of sheathed bacteria and yielded a more accurate quantification of bacteria than conventional microscopy. In a pilot and a full scale wastewater treatment plant (WWTP) clear correlations were found between the SVI and growth of a Sphaerotilus natans and a Thiothrix sp. Addition of chlorine to the bulking sludge resulted in an improved SVI of the sludge but only damaged filamentous cells outside the floc. Nitrification was measured with substrate depletion and FISH analysis. Signal interpretation of FISH analysis was demonstrated both manually and with automated image analysis.
32
Shysha, O. M., S. I. Spivak, V. A. Tsygankova, G. O. Iutynska, L. O. Biliavska, A. I. Yemets, and Ya B. Blume. "The application of microbial originating bioregulators to obtain in vitro lines of potato with increased resistance to parasitic nematodes." Faktori eksperimental'noi evolucii organizmiv 26 (September 1, 2020): 287–92. http://dx.doi.org/10.7124/feeo.v26.1281.
Full textAbstract:
Aim. Obtaining in vitro new lines of potato (Solanum tuberosum L.) cultivar Vernissage with genetically mediated resistance to the parasitic nematode H. schachtii on nutrient MS media with microbial bioregulators. Methods. In vitro conditions the process of organogenesis of potato plants on nutrient MS media containing microbial bioregulators used at concentrations 25-100 μl/l in combination with phytohormones 2 mg/l BAP and 0,1 mg/l NAA was investigated. Using dot blotting method the degree of hybridization between cytoplasmic si/miRNA isolated from cells of potato plants-regenerants, grown on the artificial invasive background, and nematode mRNA was studied. In the wheat seedlings cell-free system in vitro the silencing activity of si/miRNA isolated from cells of potato plants-regenerants on the template of nematode mRNA was investigated. Results. The experiments conducted in vitro conditions showed that the addition of microbial bioregulators at concentrations 25-100 μl/l in combination with phytohormones 2 mg/l BAP and 0,1 mg/l NAA into MS media increased the efficiency of regeneration of potato shoots to 43–47 % as compared with similar indices obtained on control MS media. The increase of the degree of hybridization to 19-38 % between cytoplasmic mRNA isolated from cells of nematode H. schachtii and si/miRNA isolated from cells of experimental potato plants-regenerants grown in vitro conditions on nutrient media containing bioregulators on the artificial invasive background was shown. Conclusions. Using microbial bioregulators in vitro conditions as components of nutrient MS medium increases potato shoot regeneration efficiency and enhances RNAi-mediated resistance of plants-regenerants to parasitic nematode H. schachtii.
Keywords: microbial bioregulators, potato organogenesis in vitro, potato resistance to nematode Heterodera schachtii, RNA interference.
33
Gammelgård, E., M. L. Mohan, R. A. Andersson, and J. P. T. Valkonen. "Host gene expression at an early stage of virus resistance induction." Plant Protection Science 38, SI 2 - 6th Conf EFPP 2002 (December 31, 2017): 502–3. http://dx.doi.org/10.17221/10535-pps.
Full textAbstract:
Suppression subtractive hybridization (SSH) was carried out to detect genes differentially expressed in plants expressing resistance to systemic infection with Potato virus A (PVA), genus Potyvirus. Differential screening has up to now revealed 19 putative differentially expressed genes. Nothern blot hybridization has confirmed the differential expression of seven genes. Three of them were only induced by the virus, but four genes were also wound-induced.
34
Kolomiets, Mikhailo V., David J. Hannapel, and Richard J. Gladon. "Lipoxygenase POTLX-1 and POTLX-2 Genes are Expressed during Potato Tuber Initiation and Development." HortScience 32, no. 3 (June 1997): 453C—453. http://dx.doi.org/10.21273/hortsci.32.3.453c.
Full textAbstract:
Plant lipoxygenases (LOXs) (linoleate:oxygen oxidoreductase, EC 1.13.11.12) catalyze the oxygenation of polyunsaturated fatty acids such as linolenic and linoleic acids. Some of the final products of LOX-catalyzed reactions are traumatin, jasmonic acid (JA), methyl jasmonate (MJ), and C-6 volatile compounds, and they serve hormone-like regulatory and defense-related roles in plants. Recently, it has been proposed that LOXs play a role in potato tuberization processes because JA, MJ, and structurally similar tuberonic acid and tuberonic acid glycoside have been shown to be tuber-inducing substances. In order to study possible lipoxygenase involvement in potato tuberization, we have isolated, sequenced, and characterized the expression pattern of two cDNA clones, designated POTLX-1 and POTLX-2, that represent similar, but distinct, LOX genes. Within the scope of our experiments, northern hybridization studies with mRNA extracted from various organs of `Superior' potato plants indicated that the expression of these two genes is restricted to developing tubers and roots only. Moreover, there is a positive correlation between POTLX-1 and POTLX-2 mRNA accumulation and the stage of potato tuber development, and this implicates LOX in tuberization processes. Accumulation of their transcripts was not detected in leaves, flowers, stems, shoot tips, or axillary buds. These results indicate that the isozyme forms encoded by these two genes are tuber-specific, and they are good candidates to study LOX involvement in potato tuberization processes. Treatment of potato leaves with abscisic acid, MJ, gibberellic acid, auxin (NAA), and cytokinin (BA) did not trigger transcriptional activation of either of these genes.
35
Huai-Jun, Si, Liu Jun, and Xie Cong-Hua. "Transformation of potato using an antisense class I patatin gene and its effect on microtuber formation." Chinese Journal of Agricultural Biotechnology 2, no. 1 (April 2005): 7–11. http://dx.doi.org/10.1079/cjb200544.
Full textAbstract:
AbstractAn antisense class I patatin gene under control of the CaMV 35S promoter was introduced into potato (Solanum tuberosum) cultivar E-potato 3 using the Agrobacterium tumefaciens system. PCR amplification and PCR–Southern blot analysis indicated that the antisense class I patatin gene had been integrated into the potato genome. Northern hybridization analysis showed that the antisense gene transcribed normally in the transgenic potato plants and resulted in a reduction of endogenous class I patatin mRNA. Total soluble protein content and lipid acyl hydrolase activity of microtubers, derived from transformed plants, decreased by a maximum of 36.4% and 31.4%, respectively, compared with control plants. The expression of this antisense gene also resulted in reductions of the plantlets forming tubers, tubers per plantlet and the effective tubers (≥50 mg) of the transformed plants.
36
Sitohy, Mahmoud, Soad Taha, Ali Osman, Mahmoud Abdel-Hamid, Ali Hamed, and Ashraf Abdelbacki. "Antiviral Action of Native and Methylated Lactoferrin and β-Lactoglobulin against Potato Virus Y (PVY) Infected into Potato Plants Grown in an Open Field." Antibiotics 9, no. 7 (July 21, 2020): 430. http://dx.doi.org/10.3390/antibiotics9070430.
Full textAbstract:
Potato plants are liable to PVY infection without efficient control. Therefore, they were cultivated under greenhouse and open field conditions, artificially infected with PVY and then treated after 15 days of infection with native lactoferrin (LF) and native β-lactoglobulin (BL) and their esterified forms, MLF (methylated lactoferrin) and BLM (methylated β-lactoglobulin) to test the efficiency of this approach. Viral replication was inhibited by the applied substances, particularly the methylated forms, in a concentration-dependent manner, where the concentration of 500 μg·mL−1 was sufficient for plant protection against the PVY infection. An open field experiment showed that one single application of the antiviral substance was enough for maximum inhibitory action against PVY. The modified milk proteins induced higher inhibitory action on PVY virus replication in the plants, compared to their native forms, which was reflected by potato growth and yield. Using the dot blot hybridization and RT-PCR techniques to detect PVY in the experimental plants showed the supremacy of native and esterified LF in inhibiting the targeted virus. The generally observed scanning electronic microscopy (SEM) structural deformations and irregular appearance in PVY particles when treated with MLF and BLM revealed their direct action. BLM, MLF and LF are efficient antiviral agents against PVY. They can not only abolish the observed PVY-induced reduction in potato growth and tuber yield, but also further increase them to higher levels than negative control.
37
Ward, L. I., J. Tang, S. Veerakone, B. D. Quinn, S. J. Harper, C. Delmiglio, and G. R. G. Clover. "First Report of Potato spindle tuber viroid in Cape Gooseberry (Physalis peruviana) in New Zealand." Plant Disease 94, no. 4 (April 2010): 479. http://dx.doi.org/10.1094/pdis-94-4-0479a.
Full textAbstract:
In February 2009, 10 cape gooseberry plants (Physalis peruviana) grown from seed on a domestic property in Christchurch, New Zealand, showed severe leaf distortion, fasciation and etiolation of growing tips, and weak flowering. Symptoms were first observed in the emerging seedlings. No virus particles were observed in sap from infected plants with the electron microscope. Total RNA was isolated from leaves of the 10 plants with a Qiagen RNeasy Plant Mini Kit (Valencia, CA). All 10 plants tested positive for Potato spindle tuber viroid (PSTVd) by real-time reverse transcription (RT)-PCR (1) and by RT-PCR with PSTVd-specific primers (3) and generic pospiviroid primers (4). For both conventional PCRs, the expected 359-bp amplicons were sequenced directly and sequences were aligned together to create a consensus sequence (GenBank Accession No. FJ797614). BLASTn analysis showed 98% nucleotide identity to PSTVd (EU862231, DQ308556, X17268, and AY532801–AY532804). Sap from one of the infected plants was mechanically inoculated onto healthy P. peruviana, Solanum lycopersicum ‘Rutgers’, Chenopodium amaranticolor, C. quinoa, Cucumis sativum ‘Crystal Apple’, Gomphrena globosa, Nicotiana benthamiana, N. clevelandii, N. occidentalis ‘37B’, N. tabacum ‘WB’, N. sylvestris, and Phaseolus vulgaris ‘Prince’. After 4 weeks, the leaves of the ‘Rutgers’ tomato plants were showing severe distortion, purpling, and necrosis of mid-veins and P. peruviana plants were showing distortion of newly emerging apical leaves. Healthy control P. peruviana were asymptomatic. Symptoms appeared milder than that observed in the original P. peruviana plants, but this may be related to different environmental conditions or age or growth stage of the plants when inoculated. All other indicator plants were symptomless, but along with P. peruviana, tested positive for PSTVd by real-time RT-PCR (1). The presence of PSTVd was further confirmed in one original symptomatic and the mechanically inoculated P. peruviana plants and in the indicator plants by dot-blot hybridization with a digoxygenin-labeled synthetic ssRNA probe specific to the full-length PSTVd genome. PSTVd has been reported in New Zealand previously in commercial glasshouse crops of tomatoes and peppers (2), but was eradicated and so remains a regulated pest. The plants were grown from seeds imported from Germany and it is possible that the infection was seedborne. PSTVd was reported in young cape gooseberry seedlings in Germany and Turkey but the infection was asymptomatic (5). Symptoms were associated with the PSTVd-infected cape gooseberry in New Zealand. To our knowledge, this is the first report of the viroid in domestically grown plants in New Zealand, and only the second report of PSTVd in cape gooseberry worldwide. Our findings suggest that this species is an emerging host for PSTVd and that dissemination of seed may provide a pathway for international movement of the viroid. References: (1) N. Boonham et al. J. Virol. Methods 116:139, 2004. (2) B. S. M. Lebas et al. Australas. Plant Pathol. 34:129, 2005. (3) A. M. Shamoul et al. Can. J. Plant Pathol. 19:89, 1997. (4) J. T. H. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004. (5) J. T. H. Verhoeven et al. Plant Dis. 93:316, 2009.
38
Dong, F., R. G. Novy, J. P. Helgeson, and J. Jiang. "Cytological characterization of potato - Solanum etuberosum somatic hybrids and their backcross progenies by genomic in situ hybridization." Genome 42, no. 5 (October 1, 1999): 987–92. http://dx.doi.org/10.1139/g99-037.
Full textAbstract:
Four somatic hybrids derived from a diploid wild species Solanum etuberosum and a diploid tuber-bearing Solanum clone 463-4, together with five BC1 and three BC2 plants, were analyzed by genomic in situ hybridization (GISH). None of the four somatic hybrids had the expected chromosome constitutions, i.e., 24 chromosomes from each fusion parent. Either one chromosome from S. etuberosum or one from the potato parent 463-4 was lost in the hybrids. Three BC1 plants had exactly one set of S. etuberosum chromosomes. The other two BC1 plants either had one extra or one fewer S. etuberosum chromosome, possibly because their somatic hybrid parents had an extra or had lost one S. etuberosum chromosome. The presence of one set, or close to one set, of S. etuberosum chromosomes in all BC1 plants suggests a preferential pairing and segregation of the S. etuberosum chromosomes in the somatic hybrids. Two of the three BC2 plants had 52 chromosomes, deviating significantly from the expected chromosome number of 48. These results suggest poor pairing between S. etuberosum and S. tuberosum chromosomes in the BC1 plants. The present study demonstrates the importance of combining GISH and DNA marker analysis for a thorough characterization of potato germplasm containing chromosomes from different species.Key words: potato germplasm, Solanum etuberosum, molecular cytogenetics.
39
Dong, Fenggao, J. Mitchell McGrath, John P. Helgeson, and Jiming Jiang. "The genetic identity of alien chromosomes in potato breeding lines revealed by sequential GISH and FISH analyses using chromosome-specific cytogenetic DNA markers." Genome 44, no. 4 (August 1, 2001): 729–34. http://dx.doi.org/10.1139/g01-043.
Full textAbstract:
Genomic in situ hybridization (GISH) is one of the most popular and effective techniques for detecting alien chromatin introgressed into breeding lines; however, GISH analysis alone does not reveal the genetic identity of the alien chromosomes. We previously isolated a set of bacterial artificial chromosomes (BACs) specific to each of the 12 potato chromosomes. These BAC clones can be used as chromosome-specific cytogenetic DNA markers (CSCDMs) for potato chromosome identification. Here we demonstrate that GISH and fluorescence in situ hybridization (FISH), using CSCDMs, can be performed sequentially on the same chromosome preparations. Somatic metaphase chromosomes prepared using an enzymatic digestion and "flame-drying" procedure allows repeated probing up to five times without significant damage to chromosome morphology. The sequential GISH and FISH analyses reveal the genomic origin and genetic identity of the alien chromosomes in a single experiment and also determine whether an alien chromosome has been added to the genetic background of potato or is substituting for a homoeologous potato chromosome. The sequential GISH and FISH procedures should be widely applicable for germplasm characterization, especially in plant species with small-sized chromosomes.Key words: FISH, GISH, chromosome indentification, molecular cytogenetics, potato.
40
Roy, Gourgopal, Mysore R. Sudarshana, Diane E. Ullman, Shou-Wei Ding, Abhaya M. Dandekar, and Bryce W. Falk. "Chimeric cDNA Sequences from Citrus tristeza virus Confer RNA Silencing-Mediated Resistance in Transgenic Nicotiana benthamiana Plants." Phytopathology® 96, no. 8 (August 2006): 819–27. http://dx.doi.org/10.1094/phyto-96-0819.
Full textAbstract:
RNA silencing has been shown to be an important mechanism for conferring resistance in transgenic, virus-resistant plants. We used this approach to evaluate resistance in Nicotiana benthamiana plants transformed with chimeric coding and noncoding sequences from Citrus tristeza virus (CTV). Several independent transgenic plant lines were generated, using two constructs (pCTV1 and pCTV2) designed to produce self-complementary transcripts. The pCTV1 contained cDNA sequences from the CTV capsid protein (CP), p20, and 3′ untranslated region (UTR); and pCTV2 contained CP, p23, and 3′ UTR sequences. Heterologous recombinant Potato virus X (PVX) containing either homologous or heterologous CTV sequences was used to challenge plants and resistance was evaluated phenotypically and validated with reverse-transcriptase polymerase chain reaction and northern hybridization analysis. Transgenic plants (T1 generation) for each construct showed resistance to recombinant PVX constructs used for challenge experiments when PVX contained p20 or UTR (for CTV1 plants), or p23 or UTR (for CTV2 plants). However, no resistance was seen when plants were challenged with PVX containing the CTV CP. T2 generation plants also showed resistance even when challenged with PVX containing the cognate CTV sequences obtained from heterologous CTV isolates. The presence of transgene-specific small interfering RNAs in the resistant CTV1 and CTV2 plants indicated that resistance was mediated by post-transcriptional gene silencing.
41
Serraf, Isabelle, Darasinh Sihachakr, Georges Ducreux, Spencer C. Brown, Michè;e Allot, Nasrine Barghi, and Line Rossignol. "Interspecific somatic hybridization in potato by protoplast electrofusion." Plant Science 76, no. 1 (January 1991): 115–26. http://dx.doi.org/10.1016/0168-9452(91)90225-w.
Full text
42
Agindotan, Bright, and Keith L. Perry. "Macroarray Detection of Eleven Potato-Infecting Viruses and Potato spindle tuber viroid." Plant Disease 92, no. 5 (May 2008): 730–40. http://dx.doi.org/10.1094/pdis-92-5-0730.
Full textAbstract:
A macroarray was developed for the detection of 11 potato viruses and Potato spindle tuber viroid. The 11 viruses detected included those commonly found or tested for in North American potato seed certification programs: Alfalfa mosaic virus, Cucumber mosaic virus, Potato mop top virus, Potato leafroll virus, Potato latent virus, Potato virus A, Potato virus M, Potato virus S, Potato virus X, Potato virus Y, and Tobacco rattle virus. These viruses were detected using oligonucleotide 70-mer probes and labeled targets prepared by a random primed amplification procedure. Potato plants analyzed included those infected with 12 reference virus stocks and 36 field isolates. Results from the macroarray were entirely consistent with those obtained using a standard serological assay (enzyme-linked immunosorbent assay). Four isolates of Potato spindle tuber viroid, in mixed infection with one or more viruses, also were detected in the array, although strong hybridization signals required amplification with viroid-specific primers in combination with anchored-random primers. In individual plants, up to four viruses, or a viroid plus two viruses, were detected, with no apparent competition or inhibition. Macroarrays are a cost-effective approach to the simultaneous diagnostic detection of multiple pathogens from infected plants.
43
Davino, S., F. Di Serio, G. Polizzi, and M. Tessitori. "First Report of Cucumber mosaic virus Infecting Solanum jasminoides in Italy." Plant Disease 92, no. 11 (November 2008): 1585. http://dx.doi.org/10.1094/pdis-92-11-1585c.
Full textAbstract:
Solanum jasminoides Paxton (potato vine or jasmine nightshade) is a vegetatively propagated ornamental species within the Solanaceae family. Recently, symptomless plants of this species were reported as natural hosts of the quarantine pest, Potato spindle tuber viroid (PSTVd) in Italy (1). In January 2008, approximately 1,000 potted, 2-year-old plants of S. jasminoides growing in an ornamental nursery in Sicily showed virus-like mosaic and malformation of leaves. Symptoms were observed on approximately 60% of the plants. Leaf tissue, collected from 30 symptomatic and 10 symptomless plants, was analyzed by double-antibody sandwich-ELISA with polyclonal antisera specific to Cucumber mosaic virus (CMV), Tomato spotted wilt virus, and Impatiens necrotic spot virus (Loewe Biochemica, Sauerlach, Germany). The same samples were also analyzed by tissue-printing hybridization with a PSTVd-specific digoxigenin-labelled riboprobe. All the symptomatic samples tested positive only with antisera against CMV, but negative in all other tests. The symptomless samples were negative in all the performed tests. To confirm the association of CMV with the diseased plants, total RNA was extracted from the same samples (RNeasy Plant Mini Kit; Qiagen, Hilden, Germany) and analyzed by reverse transcription (RT)-PCR using CMV-specific primers MP+5′-CATGGCTTTCCAAGGTACCAG-3′ and MP-5′-CTAAAGACCGTTAACCACCTGC-3′ that amplify a 844-bp fragment from the MP gene (2). The expected fragment was amplified only from samples of symptomatic tissue. CMV was also detected in mother plants grown in the same nursery and showing same mosaic symptoms. Definitive identification of the pathogen was obtained by cloning and sequencing the RT-PCR product. The obtained sequence (GenBank Accession No. EU828783) had 99 and 98% similarity with the subgroup I-A isolates CMV-LUN (GenBank Accession No. EU432183) and CMV-Fny (GenBank Accession No. DI0538), respectively. To our knowledge, this is the first report of CMV infecting S. jasminoides and it adds a new host to the more than 1,000 species (85 plant families) infected by this virus. The high incidence of the disease in the nursery could be due to propagation of cuttings from an infected source. References: (1) F. Di Serio. J. Plant Pathol. 89:297, 2007. (2) H. X. Lin et al. J. Virol. 78:6666, 2004.
44
Gaswanto, Redy, and NFN Kusmana. "Karakterisasi dan Seleksi 139 Galur Kentang." Buletin Plasma Nutfah 14, no. 1 (October 7, 2016): 1. http://dx.doi.org/10.21082/blpn.v14n1.2008.p1-7.
Full textAbstract:
<p>Characterization and Selection of 139 Potato Lines. One of the ways of increasing genetic variability in potato is interspecific hybridization to obtain new potato lines. This lines should then be characterized and used to obtain new breeding materials for potato breeding program. A total of 139 potato lines were planted at Cibodas-Lembang (1,300 m asl), from June 2004 to October 2004 without replication with population number of 5 plants per line. The result showed that (1) Generally the planted lines were round tuber shape (61.9%), yellow skin (98.6%), shallow eyes (71.2%), and light tuber weight per plant (89.2%); (2) 18 potato lines were selected as new breeding materials (13%).</p><p> </p><p><strong>Abstrak</strong></p><p>Salah satu cara untuk menciptakan keragaman genetik pada tanaman kentang adalah melalui hibridisasi antarspesies. Selanjutnya dilakukan karakterisasi galur yang dihasilkan. Diharapkan hasil karakterisasi dapat digunakan sebagai materi dalam perakitan varietas baru. Penanaman galur kentang hasil hibridisasi dilakukan di Cibodas, Lembang (1.300 m dpl), pada bulan Juni-Oktober 2004. Jumlah materi yang ditanam sebanyak 139 galur kentang, tanpa ulangan, dengan jumlah populasi sebanyak lima tanaman per galur. Hasil karakterisasi menunjukkan bahwa (1) secara umum galur yang ditanam mempunyai umbi berbentuk bulat (61,9%), berwarna kuning (98,6%), mata dangkal (71,2%), dan bobot umbi ringan (89,2%); (2) sebanyak 18 galur (13%) terpilih untuk digunakan sebagai materi pemuliaan lebih lanjut.</p>
45
Singh, Rudra P. "Development of the molecular methods for potato virus and viroid detection and prevention." Genome 42, no. 4 (August 1, 1999): 592–604. http://dx.doi.org/10.1139/g99-047.
Full textAbstract:
Potato is the fourth most important food crop in the world and it forms the diet of a billion consumers in developing countries, where potato production is increasing rapidly. However, potato virus diseases in developing countries are one of the major causes of lower yields. Their control requires the development of appropriate virus-detection and seed-production technologies for the region. Recent progress in developing nucleic acid based virus detection methods are reviewed. Refinements of the protocols applicable to the laboratories located in seed producing areas are discussed. Nucleic acid spot hybridization (NASH) and reverse transcription polymerase chain reaction (RT-PCR) methods are described for the detection of viruses and viroids in dormant seed tubers and insect vectors. Although the potato crop is susceptible to over 25 virus and viroid diseases, only universally economically important viruses have been dealt with here. The progress of pathogen-derived resistance for the control of potato virus diseases is elaborated, and the results of field tests indicate their feasibility in virus control.Key words: dot-blot, spot-hybridization, reverse transcription, polymerase chain reaction, transgenic plants.
46
Podolich, O. V., L. P. Ovcharenko, N. O. Kozyrovska, and A. M. Pirttila. "Detection of Methylobacterium radiotolerans IMBG290 in potato plants by in situ hybridization." Biopolymers and Cell 25, no. 2 (March 20, 2009): 115–19. http://dx.doi.org/10.7124/bc.0007d3.
Full text
47
Vivanco, Jorge M., Maddalena Querci, and Luis F. Salazar. "Antiviral and Antiviroid Activity of MAP-Containing Extracts from Mirabilis jalapa Roots." Plant Disease 83, no. 12 (December 1999): 1116–21. http://dx.doi.org/10.1094/pdis.1999.83.12.1116.
Full textAbstract:
Extracts of Mirabilis jalapa (Nyctaginaceae), containing a ribosome inactivating protein (RIP) called Mirabilis antiviral protein (MAP), were tested against infection by potato virus X, potato virus Y, potato leaf roll virus, and potato spindle tuber viroid. Root extracts of M. jalapa sprayed on test plants 24 h before virus or viroid inoculation inhibited infection by almost 100%, as corroborated by infectivity assays and the nucleic acid spot hybridization test. Antiviral activity of MAP extracts was observed against mechanically transmitted viruses but not against aphid-transmitted viruses. Purified MAP showed the same antiviral effect as the crude extracts.
48
Douda, O., M. Zouhar, M. Renčo, and M. Marek. "Molecular and morphological exploration of a mixed population of two potato-parasiting nematode species, Globodera rostochiensis and G. pallida." Helminthologia 51, no. 1 (March 1, 2014): 3–6. http://dx.doi.org/10.2478/s11687-014-0201-3.
Full textAbstract:
Abstract In this work, we report results of molecular and morphological analyses of a potato field population of Globodera (Nematoda: Heteroderidae) species, in Slovakia. Unexpectedly, our data show a mixed occurrence of two potato cyst nematode species, Globodera rostochiensis and G. pallida, in this locality. To our knowledge, this is the first report of mixed occurrence of these economically important plant-parasitic species in the same locality in the Central Europe. In addition, this finding reinforces the possibility of the cross-hybridization between these two nematode species that might result in a generation of new genotypes.
49
NAWIRI, SYLVIA OBINDA, RICHARD OKOTH ODUOR, and ALLAN MGUTU JALEMBA. "Genetic engineering of sweet potatoes (Ipomoea batatas) using isopentenyl transferase gene for enhanced drought tolerance." Asian Journal of Agriculture 1, no. 02 (December 1, 2017): 85–99. http://dx.doi.org/10.13057/asianjagric/g010206.
Full textAbstract:
Nawiri SO, Oduor RO, Jalemba AM. 2017. Genetic engineering of sweet potatoes (Ipomoea batatas) using isopentenyl transferase gene for enhanced drought tolerance. Asian J Agric 1: 85-99. Approximately 70% of yield crop reduction worldwide is caused by drought. Due to severe drought which happened many times as a result of climate change, substantial yield deprivation is usual among the major cereals such as maize, wheat, and barley.. Therefore, drought tolerant crops that still yield amidst erratic climatic phenomenon are greatly needed. Due to its capability to produce high yield in a short period, sweet potato is suitable for cultivation in regions with limited or erratic rain water supply where other food crops cannot grow easily. Nevertheless, its sensitivity to water deficit may lead to the adverse crop growth and yield. By conventional hybridization method, sweet potato is tried to be improved, but it gives unsatisfied results due to its high male sterility, sexual incompatibility and hexaploid nature of its genome.The aim of this study, therefore, is to develop new varieties of sweet potato with improved tolerance to water-deficit stress for sustainable production of sweet potato under water-limited conditions. Three sweet potato genotypes: Jewel, Kemb36, and Ksp36 were transformed using isopentenyl transferase gene (IPT) that delays drought-induced senescence via up-regulation of cytokinin biosynthesis, under the control of a waterdeficit responsive and maturation specific promoter (PSARK). The PNOV-IPT gene construct was introduced into sweet potato to evaluate their transformability and regenerability. It is done via Agrobacterium tumefaciens strain EHA101 and the plants subsequently regenerated via somatic embryogenesis. Jewel genotype recorded the highest transformation and regeneration frequency followed by Kemb36 and KSP36. Calli were cultured on media supplemented with various mannose concentrations to evaluate the suitability of mannose as a selectable marker for sweet potato, and it was figured out that 30 g/L concentration was optimal for selection of transformed events. At the time of PCR analysis, Jewel had the highest transformation efficiency followed by Kemb36. At the time for evaluation on drought tolerance under controlled conditions, the sweet potato showed delayed senescence and greater drought tolerance under water deficit conditions in the glasshouse. These plants exhibited better growth, higher yield, higher water status maintenance, higher chlorophyll content, and thus higher photosynthetic rates under reduced water conditions in comparison to wild-type. These results, therefore, indicated that expression of isopentenyl transferase gene in sweet potato significantly improves drought tolerance. Therefore, IPT gene should be used to transform other economically important food crops to delay drought-induced senescence and enhance drought tolerance.
50
Ramulu, K. S., P. Dijkhuis, E. Rutgers, J. Blaas, F. A. Krens, J. J. M. Dons, C. M. Colijn-Hooymans, and H. A. Verhoeven. "Microprotoplast-mediated transfer of single specific chromosomes between sexually incompatible plants." Genome 39, no. 5 (October 1, 1996): 921–33. http://dx.doi.org/10.1139/g96-116.
Full textAbstract:
Microprotoplast-mediated chromosome transfer (MMCT) through fusion of small (subdiploid) microprotoplasts of a transgenic triploid potato (Solanum tuberosum) cell line with leaf protoplasts of tobacco (Nicotiana tabacum) and the wild tomato species Lycopersicon peruvianum is reported. The microprotoplasts contained one or a few chromosomes. Monosomic addition plants were produced from the fusion products. We employed mass-scale induction of micronuclei in donor suspension cells of potato using the microtubule inhibitor Cremart. Protoplasts were isolated from micronucleated cells after incubation in a cell wall digesting enzyme mixture. The microprotoplasts were isolated from the micronucleated protoplasts by high-speed centrifugation. By using sequential filtration, small microprotoplasts containing one or few chromosomes were separated from the bigger subdiploid microprotoplasts. These small microprotoplasts were fused with recipient protoplasts of tobacco or tomato using polyethylene glycol. The selectable marker kanamycin resistance (KanR) and the reporter gene β-glucuronidase (gus), carried by the donor potato chromosome, were used for the selection of fusion products and the isolation of hybrid calli. Several monosomic addition plants were obtained within the short period of 3–4 months after fusion. These contained one potato chromosome carrying a single copy of gus and one or two copies of the neomycin phosphotransferase (nptII) gene conferring KanR, and the complete set of chromosomes of tobacco or tomato, as revealed by genomic in situ hybridization and Southern blot hybridization. The alien genes, gus and nptII, were stably expressed in both the tobacco and tomato backgrounds. They were transmitted to the progeny after backcrossing to tomato. Monosomic and disomic additions, and some introgression plants showing integration of gus and nptII in the tomato genome, were recovered in the first backcross progeny. The potential value of MMCT for the transfer of economically important traits, genome analysis, and gene expression is discussed. Key words : chromosome transfer, microprotoplast fusion, monosomic–disomic additions, sexual transmission, DNA integration, alien gene expression.