To see the other types of publications on this topic, follow the link: Quina (Planta).
Journal articles on the topic 'Quina (Planta)'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Quina (Planta).'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Martínez-Pérez, Aniceto, Pedro Antonio López, Abel Gil-Muñoz, and Jesús Axayácatl Cuevas-Sánchez. "Plantas silvestres útiles y prioritarias identificadas en la Mixteca Poblana, México." Acta Botanica Mexicana, no. 98 (January 1, 2012): 73. http://dx.doi.org/10.21829/abm98.2012.1141.
Full textAbstract:
Uno de los factores de la producción sostenible de los bosques tropicales es la conservación de sus especies vegetales silvestres útiles, cuyo estado puede ser evaluado inicialmente a través del conocimiento tradicional local. El objetivo de este trabajo fue contribuir a la elaboración de un inventario de plantas útiles y, mediante valoración socioeconómica y ecológica, determinar prioridades de conservación en la Mixteca Poblana, México. Se realizaron 14 entrevistas y un taller participativo en dos comunidades del municipio de Chietla, Puebla, México. Se registraron los usos de las especies reconocidas, la importancia socioeconómica y el potencial ecológico de cada planta considerada relevante y se aplicó un análisis de factores principales. En ambas comunidades se reconocieron nueve categorías de uso, destacando las combustibles, las medicinales, las alimenticias y las de construcción. En Huajotitlán se reportaron 139 especies útiles, ubicando a palo dulce (Eysenhardtia polystachya), pitaya (Stenocereus stellatus) y palma (Brahea dulcis) como adecuadas para planes de manejo y aprovechamiento; las especies prioritarias para reforestación fueron cuachalalate (Amphipterygium adstringens), cuatomate (Solanum glaucescens), nanche (Byrsonima crassifolia), quina (Hintonia latiflora) y rabo de iguana (Havardia acatlensis). En Buenavista se reportaron 126 especies útiles, de las cuales pitaya y palma fueron percibidas como importantes para su manejo y aprovechamiento; ciruela (Spondias purpurea), palo dulce y árnica (Colubrina triflora) fueron identificadas como apropiadas para reforestación. El análisis de factores principales confirmó la importancia de las especies en cada comunidad.
2
Santos, Danillo Luiz dos, Heleno Dias Ferreira, José Realino de Paula, Stone de Sá, Pedro Henrique Ferri, and Tatiana De Sousa Fiuza. "Estudo morfo-anatômico de Hortia oreadica e análise da composição química dos óleos essenciais das folhas, flores e frutos." Fronteiras: Journal of Social, Technological and Environmental Science 9, no. 2 (2020): 328–47. http://dx.doi.org/10.21664/2238-8869.2020v9i2.p328-347.
Full textAbstract:
Hortia oreadica (Rutaceae), conhecida como quina-do-campo e para-tudo, é utilizada popularmente como estimulante e estomáquica. Os objetivos deste trabalho foram realizar: a descrição morfológica e o estudo do comportamento dos indivíduos de H. oreadica em relação às variações sazonais; o estudo anatômico das folhas e caule jovem; a triagem fitoquímica do pó das folhas e identificar os componentes do óleo essencial das inflorescências, folhas e frutos. Os estudos morfológicos da planta e anatômicos das folhas e caule jovem foram realizados de acordo com as técnicas convencionais de anatomia vegetal. Os óleos essenciais foram obtidos por hidrodestilação em um aparelho de Clevenger e analisados por CG/EM. Observou-se que H. oreadica é um subarbusto, com folhas simples e alternas. Lâmina foliar glabra em ambas as faces com pontos translúcidos. Inflorescência corimbo de dicásio, com cerca de 580 flores; ramos espessos. Flor com coloração variando do rosa ao vináceo e com néctar copioso. Fruto verde, capsular e sementes pretas. Anatomicamente verificaram cavidades secretoras, cristais prismáticos, e estômatos predominantemente anomocíticos. Os componentes majoritários no óleo essencial das folhas, flores e frutos foram: o amorfa-4,7(11)-dieno e o biciclogermacreno. O estudo morfológico de H. oreadica contribuiu para a compreensão do comportamento dos indivíduos adultos, em relação às variações sazonais. A análise anatômica das folhas e caule jovem forneceu parâmetros para a correta identificação botânica desta espécie. Este trabalho apresentou a composição química do óleo essencial das folhas, flores e frutos de H. oreadica, coletados em Pirenopólis (Goiás).
3
Nuñez Torreblanca, Nivardo. "LA QUINUA (Chenopodium quinoa Willd.) ALTERNATIVA DE SEGURIDAD ALIMENTARIA PARA ZONAS DESÉRTICAS." Ciencia & Desarrollo, no. 19 (April 29, 2019): 19–24. http://dx.doi.org/10.33326/26176033.2015.19.472.
Full textAbstract:
La quinua (Chenopodium quinoa Willd.) es una especie originaria de los andes Sudamericanos, que ha mostrado respuestas fisiológicas que son características de especies que toleran sequía y sales, por lo que constituye una alternativa de alto valor para obtención de proteínas y fibra de alta calidad en áreas donde el agua y las sales del suelo son restrictivos para que prosperen otros cultivos. Aproximadamente, casi en la mitad de la superficie del planeta están presentes las zonas áridas. El rasgo característico de estas zonas es que la sequía es un evento regular, con presencia también de altas temperaturas, con diferentes grados de salinidad de los suelos. Se estima que un quinto de la población mundial vive en estas zonas. En el caso particular del Perú el 90 por ciento de la población nacional habita estas zonas. En general, el agua es un recurso escaso, por lo que es prioridad el estudio de plantas alimenticias que toleren las condiciones adversas de estas áreas.
4
Gandarillas Espezúa, Daniel, and Nivardp Nuñez Torreblanca. "RENDIMIENTO DE FORRAJE DE DOS VARIEDADES DE QUINUA (Chenopodium quinoa Willd.)." Ciencia & Desarrollo, no. 16 (April 25, 2019): 34–40. http://dx.doi.org/10.33326/26176033.2013.16.350.
Full textAbstract:
El trabajo de investigación "Rendimiento de forraje de dos variedades de quinua" (Chenpodium quinoa Willd.) se instaló en la irrigación la Yarada (Tacna, Perú) a 71 m.s.n.m. El objetivo fue evaluar el rendimiento de dos variedades de quinua: ECU 420 y Amarilla Maranganí. El diseño utilizado fue el de bloques completos al Azar, con tres repeticiones y tres tratamientos. El tratamiento testigo estuvo constituido por el maíz variedad Opaco Mal Paso. Los resultados obtenidos indicaron que el tallo es el principal órgano de la planta con mayor contribución al rendimiento de forraje, tanto en quinua como en maíz. La variedad de quinua ECU 420 produjo mayores rendimientos (57,16 t/ ha), que la variedad Amarilla Maranganí (49,33 t/ ha.). El testigo (maíz) es superior a ambas variedades de quinua con rendimientos de 73,75 t/ ha. Los rendimientos de forraje de la quinua se encuentran en un nivel de aceptación, como alternativa o complemento para la producción de forraje, considerando su bajo consumo de agua.
5
Soto, R. L., O. M. Chumpitaz, E. Torres, J. Rojas, J. C. Llópiz, and S. Szegedi. "Estudio de la quinua, Chenopodium quinoa Willd, como fertilizante natural alternativo, mediante métodos nucleares analíticos." Revista de Investigación de Física 18, no. 1 (2015): 1–7. http://dx.doi.org/10.15381/rif.v18i1.11576.
Full textAbstract:
Con base en la aplicación de los métodos analíticos de caracterización multielemental de las muestras orgánicas, tales como la fluorescencia de rayos X, el análisis por activación neutrónica y el análisis químico de Coleman, se sugiere la posibilidad de uso de varias partes no comestibles de la planta denominada quinua, Chenopodium quinoa Willd, como fertilizante natural alternativo para este cultivo.
6
Calvache Ulloa, Marcelo, and Luciano Valle. "Índice de cosecha con macro-nutrientes en grano de quinua (Chenopodium quinoa Willd)." Revista Alfa 5, no. 13 (2021): 15–28. http://dx.doi.org/10.33996/revistaalfa.v5i13.95.
Full textAbstract:
En los Valles Interandinos del Ecuador entre 2000 y 3000 m.s.n.m se tienen bajos rendimientos de quinua con alto riesgo por la variabilidad del clima y la siembra de variedades criollas con inadecuadas prácticas de manejo. La investigación determinó las cantidades de nutrientes extraídos por tres variedades de quinua (Chenopodium quinoa Willd), durante el desarrollo del cultivo. El objetivo fue determinar las cantidades de nitrógeno, fósforo, potasio, calcio y magnesio que la planta de quinua extrae durante su ciclo de vida. Se evaluaron tres variedades de quinua, se determinó la cantidad de materia seca, porcentaje de nutrientes en estudio y cantidad de nutriente en kg ha-1 de las muestras tomadas en hojas, tallos y panículas a los 20, 40, 60, 80, 100 y 120 días después de la siembra. Los resultados obtenidos indican que la variedad Imbaya con la dosis 150-80-40 de N, P, K mostro una mayor cantidad de materia seca acumulada en la planta total con 9870 kg ha-1 a los 120 días después de la siembra (dds). Los nutrientes más absorbidos por la planta de quinua fueron K y N seguido de Ca, Mg y P en este orden. Los índices de cosecha (IC) obtenidos fueron: N=0,63; P=0,64; K= 0,55; Ca=0,52 y Mg=0,65. La aplicación del fertilizante en el cultivo de quinua se debe realizar en tres épocas: en la siembra, a la deshierba a los 30 días y al aporque a los 50 días de edad del cultivo.
7
García Parra, Miguel Ángel, and Nubia Zoraida Plazas Leguizamón. "La quinua (Chenopodium quinoa Willd) en los sistemas de producción agraria." Producción + Limpia 13, no. 1 (2018): 112–19. http://dx.doi.org/10.22507/pml.v13n1a6.
Full textAbstract:
En Suramérica, la quinua ha generado interés social y agroecológico, características que se resaltan en los sistemas diversificados de las comunidades campesinas, según la documentación consultada sobre el tema. En este sentido, se visualiza la necesidad de reconocer el desarrollo de la producción de quinua al nivel de investigación, como factor de importancia para la adaptabilidad del cultivo, a partir de la caracterización de las condiciones edáficas y climáticas de las localidades, que aportan a los procesos morfológicos, fenológicos y fisiológicos, con el fin de fortalecer el sistema de producción agrario frente a la relación suelo-planta-clima.
8
Núñez Torreblanca, Nivardo, Magno Robles Tello, and Marcos Alvarez Quispe. "INFLUENCIA DEL DISTANCIAMIENTO Y NÚMERO DE PLANTAS POR GOLPE EN EL RENDIMIENTO DE GRANO DE QUINUA (Chenopodium quinoa Willd)." Ciencia & Desarrollo, no. 22 (June 11, 2019): 58–65. http://dx.doi.org/10.33326/26176033.2018.22.746.
Full textAbstract:
El presente trabajo de investigación “Influencia del distanciamiento y número de plantas por golpe en el rendimiento de grano de quinua (Chenopodium quinoa Willd.)” se desarrolló en el Centro Experimental “Los Pichones” de la Facultad de Ciencias Agropecuarias de la UNJBG, con el objetivo de estudiar los efectos de cuatro distanciamientos (20,30,40 y 50 cm) entre golpes de siembra y número de plantas (1,2, 3, y 4) por golpe de siembra en el rendimiento de grano; el genotipo empleado fue la variedad Salcedo INIA. Se utilizó un diseño experimental de bloques completos al azar, con disposición factorial de los tratamientos con tres repeticiones. Los resultados muestran que el factor distanciamiento entre golpe de siembra no tuvo efecto alguno sobre el número de panojas secundarias, peso de panojas secundarias, peso de grano de panojas secundarias, peso de panoja principal, peso de grano de panoja principal. El factor número de plantas en cambio sí afectó las variables evaluadas, la quinua respondió mostrando valores decrecientes cuando el número de plantas por golpe de siembra fue mayor a tres. El número óptimo de plantas por golpe de siembra fue tres, con las cuales se presentó el mayor rendimiento de grano de quinua: 3 706,80 kilogramos por hectárea.
9
Mestanza Uquillas, Camilo Alexander, Katiuska Zambrano Calderón, John Pinargote Alava, et al. "Evaluación agronómica de genotipos de quinua (Chenopodium Quinoa willd.) En condiciones agroclimáticas en la zona de mocache." Ciencia y Tecnología 12, no. 1 (2019): 19–30. http://dx.doi.org/10.18779/cyt.v12i1.299.
Full textAbstract:
La quinua (Chenopodium quinoa Willd.) se ha cultivado principalmente en la cordillera de los Andes en Bolivia, Perú, Ecuador y Colombia, fue uno de los principales alimentos de los pueblos andinos preincaicos e incaicos. Las bondades de la quinua radican en su alto valor nutricional por su contenido de proteína y su gran plasticidad fenotípica. La presente investigación se realizó en la Finca Experimental “La María” de la Universidad Técnica Estatal de Quevedo, ubicada en la provincia de Los Ríos. El objetivo del trabajo fue analizar las características agronómicas de los genotipos de quinua en condiciones ambientales de la costa central. Se aplicó un diseño completamente al azar con veintiún tratamientos (genotipos) y tres repeticiones. Las variables agronómicas evaluadas mostraron diferencias estadísticas significativas (p<0.05). En la variable altura de planta destacó el genotipo 48 con 154.17 cm a los 90 días. Por otra parte, en la determinación de días a la cosecha el genotipo más tardío fue el genotipo RGG con 143 días, mientras el genotipo más precoz fue el 42 con 90 días a la cosecha. En la variable peso de 1,000 semillas los resultados alcanzados demostraron que el genotipo Faro 2 destacó ligeramente con un registro de 2.58 g. Finalmente, en cuanto al rendimiento por planta (g) el mayor registro lo obtuvo el genotipo O-5 con 143.15 g planta-1. Los datos registrados en las distintas variables demuestran viabilidad en la producción de quinua y debido a su amplia adaptabilidad, la convierten en una valiosa alternativa de diversificación para la costa ecuatoriana.
10
Mestanza Uquillas, Camilo, Katiuska Zambrano Calderón, John Pinargote Alava, et al. "Evaluación agronómica de genotipos de quinua (Chenopodium quinoa Willd.) en condiciones agroclimáticas en la zona de Mocache." Ciencia y Tecnología 12, no. 1 (2019): 19–30. http://dx.doi.org/10.18779/cyt.v12i1.316.
Full textAbstract:
La quinua (Chenopodium quinoa Willd.) se ha cultivado principalmente en la cordillera de los Andes en Bolivia, Perú, Ecuador y Colombia, fue uno de los principales alimentos de los pueblos andinos preincaicos e incaicos. Las bondades de la quinua radican en su alto valor nutricional por su contenido de proteína y su gran plasticidad fenotípica. La presente investigación se realizó en la Finca Experimental “La María” de la Universidad Técnica Estatal de Quevedo, ubicada en la provincia de Los Ríos. El objetivo del trabajo fue analizar las características agronómicas de los genotipos de quinua en condiciones ambientales de la costa central. Se aplicó un diseño completamente al azar con 21 tratamientos (genotipos) y tres repeticiones. Las variables agronómicas evaluadas mostraron diferencias estadísticas significativas (p<0.05). En la variable altura de planta destacó el genotipo 48 con 154.17 cm a los 90 días. Por otra parte, en la determinación de días a la cosecha el genotipo más tardío fue el genotipo RGG con 143 días, mientras el genotipo más precoz fue el 42 con 90 días a la cosecha. En la variable peso de 1,000 semillas los resultados alcanzados demostraron que el genotipo Faro 2 destacó ligeramente con un registro de 2.58 g. Finalmente, en cuanto al rendimiento por planta (g) el mayor registro lo obtuvo el genotipo O-5 con 143.15 g planta-1. Los datos registrados en las distintas variables demuestran viabilidad en la producción de quinua y debido a su amplia adaptabilidad, la convierten en una valiosa alternativa de diversificación para la costa ecuatoriana.
11
Ahumada, Andrés, Andrés Ortega, Diana Chito, and Ricardo Benítez. "Saponinas de quinua (Chenopodium quinoa Willd.): un subproducto con alto potencial biológico." Revista Colombiana de Ciencias Químico-Farmacéuticas 45, no. 3 (2016): 438–69. http://dx.doi.org/10.15446/rcciquifa.v45n3.62043.
Full textAbstract:
Las saponinas son un tipo de metabolito secundario ampliamente estudiado por susreconocidas propiedades biológicas. Gran parte de las investigaciones en fitoquímicaestán dirigidas a encontrar nuevas fuentes naturales de saponinas con aplicaciónmedicinal. La quinua (Chenopodium quinoa Willd.) es una planta que ha alcanzadoun valioso reconocimiento por ser una fuente de alimentos altamente nutritivos, asícomo una especie rica en saponinas triterpénicas contenidas, principalmente, en lacáscara de las semillas. A la fecha, se han identificado alrededor de 30 saponinas derivadasde la hederagenina y de los ácidos oleanólico, fitolacagénico y serjanico en laplanta. El consumo del grano de quinua implica la remoción de la cáscara a fin dereducir su sabor amargo, la ingesta de niveles residuales de saponinas y la obtenciónde un subproducto rico en las mismas. Esta revisión, inicialmente, ofrece una contextualizacióngeneral de las saponinas; posteriormente, recopila las característicasestructurales de las saponinas identificadas en la quinua, describe el efecto del procesamientodel grano en su contenido de saponinas y, finalmente, expone los efectosbiológicos explorados con extractos de saponinas de quinua, los cuales pueden serconsiderados como punto de partida en investigaciones futuras dirigidas al fortalecimientode su uso en el campo farmacéutico y/o nutracéutico.
12
García-Parra, Miguel Ángel, Nubia Zoraida Plazas-Leguizamón, Diana Carolina Carvajal Rodríguez, Shayla Cayet Ferreira Torrado, and Joel David Parra. "Descripción de las saponinas en quinua (Chenopodium quinoa willd) en relación con el suelo y el clima: Una revisión." Informador Técnico 82, no. 2 (2018): 241. http://dx.doi.org/10.23850/22565035.1451.
Full textAbstract:
Cada vez, toma mayor importancia la producción de la quinua (Chenopodium quinoa Willd) en diferentes regiones del mundo, debido a que se ha buscado posicionar el cultivo como una alternativa de seguridad alimentaria. Sin embargo, esta planta presenta metabolitos como taninos y saponinas que son sustancias químicas que sirven de barreras de protección a factores bióticos y abióticos. En el caso de las saponinas, se reconocen 31 estructuras químicas, presentes en hojas, tallos, panojas, cascarilla y semillas de diferentes especies y genotipos. Al respecto, esta revisión busca describir características generales de las saponinas presentes en la quinua y su relación con el suelo y el clima. Encontrando que las edafoclimáticas propias de cada lugar, así como las características genéticas de cada variedad son determinantes en el contenido de compuestos saponínicos, estimulados principalmente por estrés de tipo hídrico y salino.
13
Ku Soria, Pamela. "PERÚ COMO PRIMER EXPORTADOR DE QUINUA A NIVEL MUNDIAL." Quipukamayoc 25, no. 47 (2017): 75. http://dx.doi.org/10.15381/quipu.v25i47.13805.
Full textAbstract:
La quinua (Chenopodium quinoa) es una planta alimenticia nativa de los Andes, originaria de los contornos del lago Titicaca de Perú y Bolivia que formó parte de la alimentación básica de la población prehispánica y continúa presente en la elaboración de platillos. Actualmente es conocida en todo el mundo por su alto contenido nutricional, valorado para la seguridad alimentaria. El objetivo es describir la evolución de las exportaciones de quinua peruana de las dos principales sub partidas arancelarias, identificar los países importadores más importantes y las regiones productoras de quinua en costa, sierra y selva. Resulta relevante dado que se incrementaron significativamente las exportaciones desde el año 2013 declarado por la ONU “Año internacional de la quinua”; luego la CCL informó que en los años 2014 y 2015 el Perú se convirtió en el principal exportador mundial y se busca continuar con este crecimiento de manera sostenible. El tipo de estudio es descriptivo, no experimental, método hipotético deductivo, la población constituida por todos los datos ex post facto; concluyendo que dicho producto se ha expandido a diferentes mercados mundiales donde su mayor comprador es Estados Unidos, cultivándose principalmente en la región Puno y actualmente a lo largo de nuestro país.
14
Alfonso, Gustavo, Soraya Alvarado Ochoa, and Yamil Cartagena. "Evaluación de deficiencias nutricionales en el cultivo de quinua (Chenopodium quinoa Willd.) bajo invernadero." Siembra 4, no. 1 (2017): 93–109. http://dx.doi.org/10.29166/siembra.v4i1.504.
Full textAbstract:
La presente investigación evaluó las deficiencias nutricionales del cultivo quinua (Chenopodium quinoa Willd.); para el efecto se implementaron dos experimentos en invernadero, donde se trasplantaron plántulas en pomina y se mantuvieron durante 60 días. Las deficiencias nutricionales se indujeron mediante el uso de la técnica del elemento faltante con soluciones nutritivas bajo un diseño completamente al azar con catorce tratamientos y tres repeticiones para el primer experimento; y cuatro repeticiones para el segundo experimento. Las variables evaluadas en el primer experimento fueron altura de planta, diámetro del tallo, color y clorofila. En tanto que la producción de biomasa del cultivo fue evaluada en el segundo experimento. Los resultados indicaron que los tratamientos con omisión de nitrógeno (N), boro (B), y potasio (K) afectaron significativamente a todas las variables evaluadas y mostraron síntomas visuales de deficiencia en el cultivo de quinua. Sin embargo, las deficiencias de azufre (S) y fósforo (P) también fueron evidentes en las etapas de crecimiento más avanzadas.
15
Muñoz Certuche, Edwin Fernando, Néstor Raúl Basto Trochez, and Luis Antonio González Escobar. "Determinación de los indicadores de ecoeficiencia para el uso de los recursos, en la planta de producción de la industria caucana de alimentos a base de Quinua - Funprodesic." Ingenium 7, no. 17 (2013): 59. http://dx.doi.org/10.21774/ing.v7i17.318.
Full textAbstract:
El artículo presenta los resultados del trabajo de investigación realizado en la industria de alimentos a base de quinua (Chenopodium quinoa Willdenow) Funprodesic (Popayán, Colombia), el cual consistió en determinar los indicadores de ecoeficiencia dentro de su proceso de producción; para este trabajo se conformó un Comité de Ecoeficiencia, integrado por un equipo multidisciplinario dentro de la empresa; se analizaron varios métodos para determinar dichos indicadores y su fácil aplicabilidad al proceso productivo de la empresa; una vez calculados los indicadores de ecoeficiencia, se consideraron algunas modificaciones al proceso productivo de la empresa –que incluyeron la compra de equipos industriales modernos, como alternativa para la disminución de los valores de los indicadores de ecoeficiencia y los altos costos asociados con el tratamiento tradicional del grano de quinua por vía húmeda–, lo que permitirá a la empresa una separación más eficiente de las saponinas contaminantes y su uso con rentabilidad y sin contaminar el medio ambiente, obteniendo así un proceso de producción más ecoeficiente y rentable.
16
Cuvi, Nicolás. "Tecnociencia y colonialismo en la historia de las Cinchona." Asclepio 70, no. 1 (2018): 215. http://dx.doi.org/10.3989/asclepio.2018.08.
Full textAbstract:
En este artículo se reflexiona sobre la ciencia y tecnología (o tecnociencia) asociadas con el colonialismo. Se usa la metáfora de “capas de colonialismo” para aludir a ideas y prácticas asociadas con la tecnociencia que son continuamente innovadas, que pueden mantenerse o reaparecer en diferentes momentos, y que estructuran el hecho colonial. Se usa como caso la apropiación de plantas de quina (Cinchona spp.) en diferentes momentos entre los siglos XVI y XX. Algunas de las capas presentadas son: apropiación material del producto natural, deslocalización y relocalización del lugar de autoridad alrededor del mismo, soterramiento de los saberes y sabedores locales, inserción de ideas sobre lo que se debe hacer con esa naturaleza, quién y cómo debe apropiarla, no-transferencias de tecnología, fomento de proyectos sin mayores oportunidades, entre otras. En la historia de larga duración del colonialismo alrededor de la apropiación de las quinas, se enfatiza en capas que emergen o reemergen en momentos clave
17
Franco, Javier, and Papías Mosquera. "Patogenicidad del "nematodo de la oca" (Thecavermiculatus andinus sp. n) en cuatro cultivos andinos." Revista Latinoamericana de la Papa 5, no. 1 (2016): 30–38. http://dx.doi.org/10.37066/ralap.v5i1.55.
Full textAbstract:
Se estudió, bajo condiciones de invernadero la patogenicidad deThecavermiculatus andinus en los cultivos andinos de oca (Oxalis tuberosa Mol.), olluco (OH u cus tuberosas Loz.). quinua (Chenopodium quinoa Willd.) y tarwi (Lupinus mutabilis Sweet.), considerando cuatro densidades de inoculo (5,25,125 y 625 juveniles por gramo de suelo) y un control sin inoculo. La patogenicidad de T. andinus se determinó evaluando el crecimiento linear de las plantas, grosor del tallo, peso del follaje, peso seco del tubérculo y follaje, peso de la raíz y sus rendimientos. Al determinarse este último se extrajo la poblaciónfinal de nematodos, y se desarrolló la curva de reproducción para cada uno de los cultivos.Los resultados mostraron que las diversas densidades causaron diferencias significativas en la expresión de siete caracteres de la oca y olluco, y en seis del tarwi y la quinua. En general una densidad mayor a 25 juveniles por gramo de suelo afectó negativamente todos los cultivos y a medida que ésta se incrementaba la producción disminuía, principalmente en olluco y oca. Por otro lado, la multiplicación del nematodo disminuyó conforme se incrementó el inoculo y que, tanto los intervalos de máxima reproducción como los niveles de equilibrio fueron diferentes para cada uno de los cultivos. Así el olluco se comportó comoel hospedante más eficiente para multiplicar el nematodo T. andinus (41.0x) con respecto al tarwi, oca y quinua (6.0x, 5.0x y 4.0x respectivamente).Aceptado para publicación: diciembre 21,1992
18
Huamán Huamán, Eyner, Héctor Vásquez Pérez, Rolando Salas López, and Leidy Gheraldinne Bobadilla Rivera. "Efecto de los abonos orgánicos y dosis de un biofertilizante en el rendimiento de quinua (Chenopodium quinoa), en Chachapoyas, Amazonas." Revista de Investigación de Agroproducción Sustentable 1, no. 1 (2017): 63. http://dx.doi.org/10.25127/aps.20171.353.
Full textAbstract:
<p>El presente trabajo de investigación evaluó el efecto de tres tipos de abonos orgánicos más dos dosis de un biofertilizante en el rendimiento de quinua (<em>Chenopodium quinoa</em> Willd), variedad Negra Collana. Se utilizó un diseño en bloques completos al azar (DBCA) con seis tratamientos incluido un testigo absoluto. Los tipos de abono orgánico fueron humus de lombriz y guano de isla, mientras que las dosis del biofertilizante “biol” tuvieron niveles de 2,5y51/201 de agua. Posteriormente utilizando el software elibre R, se efectuó el análisis de varianza, y la prueba de comparaciones múltiples según Duncan. Las variables evaluadas fueron: altura de planta, longitud de panoja a la madurez fisiológica, y rendimiento alcanzado a la cosecha. Los resultados mostraron que el T7 (humus 5tn/ha con guano de isla 2tn/ha sumado biol a una dosis de 51/201de agua) obtuvo los mayores valores en cuantoa altura de planta (75,78cm), longitud de panoja (40,llcm) y rendimiento (3,01tn/ha), incrementándose estos valores muy por encima de los obtenidos en el testigo, que obtuvo los datos más bajos. Se concluye que los abonos orgánicos y el biofertilizante, en el T7, influyeron positivamente para obtener los mejores rendimientos.</p>
19
Spehar, C. R., R. L. B. Santos, and L. C. B. Nasser. "Diferenças entre Chenopodium quinoa e a planta daninha Chenopodium album." Planta Daninha 21, no. 3 (2003): 487–91. http://dx.doi.org/10.1590/s0100-83582003000300018.
Full textAbstract:
A experimentação pioneira com Chenopodium quinoa Willd tem demonstrado sua adaptabilidade à produção de grãos no cerrado. Seus frutos, do tipo aquênio, são cilíndricos, achatados e germinam rapidamente na presença de umidade, após a maturação fisiológica. Na fase inicial do seu desenvolvimento, a quinoa pode ser confundida com a planta daninha Chenopodium album, conhecida no Brasil como ançarinha-branca. As diferenças básicas entre as duas espécies se tornam mais visíveis após o florescimento: ramificação profusa, com rácemos axilares e terminais em C. album, em contraste com C. quinoa, na qual as panículas são terminais, à semelhança do sorgo; o pericarpo é claro e contrasta com o preto em C. album. A quinoa BRS Piabiru, primeiro cultivar para o Brasil, apresenta plantas com 190 cm, nas quais a panícula ocupa 45 cm; maturação fisiológica aos 145 dias; resistência ao acamamento; peso de grãos de 2,42 g 1.000-1; rendimento de 2,8 t ha-1; e biomassa total de 6,6 t ha-1. As sementes de C. album são muito pequenas (0,52 g 1.000-1), germinam gradativamente e permanecem no solo por muitos anos, infestando os cultivos. As diferenças no número de cromossomos, impedindo a polinização cruzada entre as duas espécies e as morfológicas, detectadas na experimentação, mostram que estas são distinguíveis e asseguram que a quinoa apresenta características de adaptação ao cultivo comercial, contrapondo-se às características de invasora em C. album.
20
Crutzen, François, Mohsen Mehrvar, David Gilmer, and Claude Bragard. "A full-length infectious clone of beet soil-borne virus indicates the dispensability of the RNA-2 for virus survival in planta and symptom expression on Chenopodium quinoa leaves." Journal of General Virology 90, no. 12 (2009): 3051–56. http://dx.doi.org/10.1099/vir.0.014548-0.
Full textAbstract:
For a better understanding of the functionality and pathogenicity of beet soil-borne virus (BSBV), full-length cDNA clones have been constructed for the three genomic RNAs. With the aim of assessing their effectiveness and relative contribution to the virus housekeeping functions, transcripts were inoculated on Chenopodium quinoa and Beta macrocarpa leaves using five genome combinations. Both RNAs-1 (putative replicase) and -3 (putative movement proteins) proved to be essential for virus replication in planta and symptom production on C. quinoa, whereas RNA-2 (putative coat protein, CP, and a read-through domain, RT) was not. No symptoms were recorded on B. macrocarpa, but viral RNAs were detected. In both host plants, the 19 kDa CP was detected by Western blotting as well as a 115 kDa protein corresponding to the CP–RT.
21
Carrillo, C. M., E. A. Chinchilla, L. A. González, R. A. Toledo, and H. G. Zambrana. "Prevención del cólera aviar con extractos acuosos de plantas en pollos de engorde." Agronomía Mesoamericana 8, no. 2 (2016): 152. http://dx.doi.org/10.15517/am.v8i2.24715.
Full textAbstract:
This research was conducted from October to De.cember, 1992, based upon the aqueous extracts from plants, at the Chemical, Agricultural and Pharmacy laboratories, by producing anphitochemicals and rnicrobiological tests on the bacterium Pasteurella multocida. The field stage was performed at the training cooperative agricultural farm (GECA) at Chalatenango, and we evaluated 16 treatments with substances from the four individual plants, and their possible combinations and witness. We performed inoculation of the bacteria on chickens of the Arbos Acres line, in arder to determine the preventive results of treatments. We utilized the Weibull model and the survival function, and we obtained significant statistics only for the treatments with the combinations of Quina/Epacine, Stinkwood/Tempate, Stinkwood/ Epacine, and T16 (Quina/Epacine/Stinkwood/ Tempate), and it was this last treatment which showed results on the prevention of fowl cholera.
22
Ariza Flores, Rafael, and Luis Antonio Gálvez Marroquín. "Quinba R-TC: nueva variedad de jamaica tipo criolla de alto rendimiento." Revista Mexicana de Ciencias Agrícolas 11, no. 5 (2020): 1197–202. http://dx.doi.org/10.29312/remexca.v11i5.1044.
Full textAbstract:
Los cultivadores de jamaica siembran genotipos criollos que se cosechan en el mes de diciembre con rendimientos bajos que promedian de 250 a 300 kg ha-1 en asociación con maíz y de 500 a 600kg ha-1 en unicultivo. Con el propósito de ampliar la oferta de genotipos, aumentar los rendimientos y disminuir las importaciones se ofrece la variedad mejorada Quinba R-TC que conserva el color, sabor y fecha de floración de la criolla regional y se mejoró el tamaño del cáliz, por lo que es una opción para incrementar los rendimientos y la rentabilidad de este cultivo en casi 20 mil hectáreas que se siembran a nivel nacional. Quinba R-TC, es producto de la cruza entre plantas de jamaica tipo Sudán (JTS) colectadas y seleccionadas en 2008 de un lote establecido en la zona jamaiquera del Estado de Guerrero y plantas provenientes de la variedad Tecoanapa conocida como criolla regional (CR). Con la F2 se inició la selección individual purificando en cada ciclo. La línea purificada se obtuvo en F7 y en 2013 se inició su evaluación y caracterización. Los descriptores básicos de selección fueron: uniformidad de la planta, tamaño y color rojo intenso del cáliz y rendimiento, el resultado fue una planta con siete días más precoz, los de cálices de color similar a la criolla regional y con 70% más grandes y de mínima pubescencia. Los rendimientos promedio fueron 80% mayores a la variedad de referencia; por lo tanto, es possible aumentar la producción de 4 500 a 8 000 t año-1.
23
Guevara Fernández, Elen, Manuel Oliva Cruz, and Roicer Collazos Silva. "Comportamiento agronómico de ocho genotipos de quinua (Chenopodium quinoa Willd.) en el distrito Molinopampa, provincia Chachapoyas, Amazonas, 2017." Revista Científica UNTRM: Ciencias Naturales e Ingeniería 1, no. 2 (2019): 63. http://dx.doi.org/10.25127/ucni.v3i2.324.
Full textAbstract:
<p>La quinua tiene excepcionales cualidades nutritivas, además posee amplia variabilidad genética que le permite adaptarse a diferentes zonas agroecológicas. El objetivo de esta investigación fue evaluar el comportamiento agronómico de ocho genotipos de quinua, en el anexo Santa Cruz del Tingo, distrito Molinopampa, provincia Chachapoyas. Fueron cultivados a dos distanciamientos entres surcos (50 cm y 70 cm), en un Diseño en Bloques Completos al Azar, durante los meses de enero - junio de 2017. La muestra que se evaluó fueron 10 plantas, en las que se midieron variables agronómicas y precocidad. Como resultado se obtuvo que la variedad Blanca de Junín tuvo el mejor rendimiento con 4 193 kg/ha a 50 cm de distanciamiento, mientras que Pasankalla a 70 cm de distanciamiento solo rindió 1 510 kg/ha, así mismo se encontró diferencias significativas (Duncan 0,05) en rendimiento a distanciamiento de 50 cm entre surcos. Además se encontró que la enfermedad principal fue mildiu (Peronospora sp) y la plaga principal fue el daño por gorrión (Zonotrichia sp.), asimismo las variedades más precoces fueron Altiplano y Salcedo INIA mientras que Blanca de Junín y la línea Mantaro fueron semiprecoces. En cuanto a peso de panoja, longitud de panoja, peso de mil semillas y rendimiento, la variedad Blanca de Junín superó a las demás.</p>
24
Rekaby, Saudi A., Mahrous Awad, Ali Majrashi, Esmat F. Ali, and Mamdouh A. Eissa. "Corn Cob-Derived Biochar Improves the Growth of Saline-Irrigated Quinoa in Different Orders of Egyptian Soils." Horticulturae 7, no. 8 (2021): 221. http://dx.doi.org/10.3390/horticulturae7080221.
Full textAbstract:
Biochar is one of the important recycling methods in sustainable development, as it ensures the transformation of agricultural wastes into fertilizers and conditioners that improve soil properties and fertility. In the current study, corn cob-derived biochar (CB) was used to reduce the negative effects of saline water on quinoa (Chenopodium quinoa cv. Utosaya Q37) grown on Aridisols and Entisols, which are the major soil groups of Egyptian soils. Quinoa plants were cultivated in pot experiment and were irrigated with saline water (EC = 10 dS m−1). The experiment contained three treatments, including control without any treatment, biochar at a rate of 1% (w/w) (BC1), and biochar at a rate of 3% (w/w) (BC3). The findings of the current study showed that BC treatments realized significant effects on soil salinity, pH, soil organic matter (SOM), and plant availability and nutrients’ uptake in the two soils types. BC3 increased the SOM in Entisols and Aridisols by 23 and 44%; moreover, the dry biomass of quinoa plants was ameliorated by 81 and 41%, respectively, compared with the control. Addition of biochar to soil increased the nutrients’ use efficiencies by quinoa plants for the two studied Egyptian soils. Biochar addition caused significant increases in the use efficiency of nitrogen (NUF), phosphorus (PUE), and potassium (KUE) by quinoa plants. BC3 increased NUE, PUE, and KUS by 81, 81, and 80% for Entisols, while these increases were 40, 41, and 42% in the case of Aridisols. Based on the obtained results, the application of corn cob biochar improves the soil quality and alleviates the negative effects of saline irrigation on quinoa plants grown on Aridisols and Entisols Egyptian soils. Biochar can be used as a soil amendment in arid and semi-arid regions to reduce the salinity hazards.
25
Hardy, Bruce L. "Neanderthal behaviour and stone tool function at the Middle Palaeolithic site of La Quina, France." Antiquity 78, no. 301 (2004): 547–65. http://dx.doi.org/10.1017/s0003598x00113213.
Full textAbstract:
Neanderthal diet is explored by examining stone tools found at the site of La Quina for residues and microwear. The Neanderthal people are found to be using their scrapers for working plants and woods as well as meat.
26
Sharma, Gitika, Sarla Lakhawat, and Sunil Kumar. "Effect of dehulling on nutritive value of quinoa seed." FOOD SCIENCE RESEARCH JOURNAL 11, no. 2 (2020): 62–69. http://dx.doi.org/10.15740/has/fsrj/11.2/62-69.
Full textAbstract:
In this era of ever-increasing world population, newer food and feed crops that have been hitherto neglected are gaining recognition. The rejection of such lesser-known food crops has been due not to any inferiority but to the lack of research resources in the place of origin and often to their being scorned as “poor people’s plants.” Quinoa whole and Quinoa dehulled was analyzed and reported that Depending on the chemical analysis of Quinoa whole, Quinoa dehulled, the Quinoa dehulled considered nutritionally dense due to its better nutritional composition and low anti-nutrients than Quinoa whole.
27
Testen, A. L., J. M. McKemy, and P. A. Backman. "First Report of Ascochyta Leaf Spot of Quinoa Caused by Ascochyta sp. in the United States." Plant Disease 97, no. 6 (2013): 844. http://dx.doi.org/10.1094/pdis-11-12-1008-pdn.
Full textAbstract:
The Andean crop quinoa (Chenopodium quinoa Willd.), an amaranthaceous pseudograin, is an important food and export crop for this region. Quinoa is susceptible to Ascochyta leaf spot reportedly caused by Ascochyta hyalospora and/or A. caulina (1,2), and quinoa seeds can be infested by A. hyalospora (3). Quinoa fields were established in Pennsylvania during summer 2011. Widespread leafspot symptoms were observed on quinoa in mid-August 2011 in Centre County, PA. Tan to reddish-brown, irregularly shaped lesions were observed with numerous black pycnidia randomly distributed within each lesion. Crushed pycnidia revealed sub-hyaline to light brown, 1 to 2, or less often 3 septate, cylindrical to ovoid spores, 13 to 25 μm long by 5 to 10 μm wide. Pure cultures of Ascochyta were obtained by plating pycnidia from surface disinfested leaves onto half strength acidified potato dextrose agar (APDA). To obtain conidia for pathogenicity trials, cultures were transferred to oatmeal agar and placed in a 20°C incubator with a 12-h photoperiod. Conidia were harvested by scraping 2-week-old cultures. The conidial suspension was filtered through cheesecloth and adjusted to 1.8 × 105 conidia/mL. Tween 20 (0.1%) was added to the final inoculum and sprayed (with a Crown Spra-tool) onto ten 1-month old quinoa plants. Six plants sprayed with sterile water with 0.1% Tween 20 served as controls. Plants were placed in a growth chamber and bagged for 48 h to maintain >95% humidity. After 48 h, tan, irregularly shaped lesions were observed on inoculated plants, but no symptoms were observed on control plants. Plants were grown for 2 more weeks to observe symptom development, and then leaves with characteristic lesions were collected for isolation. Symptomatic leaves were surface disinfested in 10% bleach for 1 min and tissue from the lesion periphery was plated onto APDA. Obtained cultures were morphologically and molecularly identical to those obtained from quinoa fields. For molecular identification of the pathogen, DNA was extracted from cultures of Ascochyta and amplified using ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG) primers. Sequences obtained shared 99% maximum identity with a GenBank accession of A. obiones (GU230752.1), a species closely related to A. hyalospora and A. caulina (4). However, the obtained pathogen is morphologically more similar to A. hyalospora and A. chenopodii, but not to A. caulina or A. obiones. At this time, final species identification is impossible because no GenBank sequence data is available for A. hyalospora or A. chenopodii. To our knowledge, this is the first report of Ascochyta leaf spot of quinoa in the United States. The impact of Ascochyta leaf spot on domestic and global quinoa production is unknown, but management of foliar diseases of quinoa, including Ascochyta leaf spot, is a critical component of any disease management program for quinoa. References: (1) S. Danielsen. Food Rev. Int. 19:43, 2003. (2) M. Drimalkova. Plant Protect. Sci. 39:146, 2003. (3) G. Boerema. Neth. J. Plant. Pathol. 83:153, 1977. (4) J. de Gruyter. Stud. Mycol. 75:1, 2012.
28
Minh, Nguyen Van, Dinh Thai Hoang, Nguyen Van Loc, and Nguyen Viet Long. "Effects of plant density on growth, yield and seed quality of quinoa genotypes under rain-fed conditions on red basalt soil regions." DECEMBER 2020, no. 14(12):2020 (December 10, 2020): 1977–82. http://dx.doi.org/10.21475/ajcs.20.14.12.2849.
Full textAbstract:
Because of rainfall shortage, quinoa has the potential to supersede traditional crops that contribute to agricultural production less effectively. The current study determined the quinoa genotypes and plant density suitable for production under rain-fed conditions in red basalt soil regions. The experiments were conducted in the rainy and dry seasons of 2018/2019 using split-plot designs with three replications. In these, the main factor consisted of four quinoa genotypes and the subfactor four plant densities (13.3, 10.0, 8.0 and 6.6 plants m-2) with a row interval of 50cm and a plant interval of 15, 20, 25 and 30cm, respectively. The current study’s results showed that plant density significantly affected polynomial trends on panicle length, panicle number/plant, seed number/panicle, 1000-seed weight, seed yield, protein content, and ash content. The plant density of 8.0 plants m-2 seems to be the optimal density for quinoa under the studied conditions. Results here also indicate significant differences among quinoa genotypes for agronomical and seed quality performance. Better performances of quinoa occurred in the dry season compared to the rainy season. Atlas and Cahuil were the best adaptive quinoa genotypes in the red basalt soil regions
29
Cai, Deyu, Ying Xu, Fei Zhao, Yan Zhang, Huirong Duan, and Xiaonong Guo. "Improved salt tolerance of Chenopodium quinoa Willd. contributed by Pseudomonas sp. strain M30-35." PeerJ 9 (January 13, 2021): e10702. http://dx.doi.org/10.7717/peerj.10702.
Full textAbstract:
Background Plant-growth-promoting rhizobacteria (PGPR) can promote plant growth and enhance plant tolerance to salt stress. Pseudomonas sp. strain M30-35 might confer abiotic stress tolerance to its host plants. We evaluated the effects of M30-35 inoculation on the growth and metabolite accumulation of Chenopodium quinoa Willd. during salt stress growth conditions. Methods The effects of M30-35 on the growth of C. quinoa seedlings were tested under salt stress. Seedling growth parameters measured included chlorophyll content, root activity, levels of plant- phosphorus (P), and saponin content. Results M30-35 increased biomass production and root activity compared to non-inoculated plants fertilized with rhizobia and plants grown under severe salt stress conditions. The photosynthetic pigment content of chlorophyll a and b were higher in M30-35-inoculated C. quinoa seedlings under high salt stress conditions compared to non-inoculated seedlings. The stability of P content was also maintained. The content of saponin, an important secondary metabolite in C. quinoa, was increased by the inoculation of M30-35 under 300 mM NaCl conditions. Conclusion Inoculation of M30-35 rescues the growth diminution of C. quinoa seedlings under salt stress.
30
FATHI, A., and F. KARDONI. "THE IMPORTANCE OF QUINOA (QUINOA CHENOPODIUM WILLD.) CULTIVATION IN DEVELOPING COUNTRIES: A REVIEW." Cercetari Agronomice in Moldova 53, no. 3 (2020): 337–56. http://dx.doi.org/10.46909/cerce-2020-030.
Full textAbstract:
Quinoa is a dicotyledonous species for seeds and, therefore, is not known as a cereal grain and is a pseudograin, which is introduced nowadays as a new crop in the world. Population growth and the need for more food put additional pressure on the environment, especially on water resources and agronomic ecosystems. This has led to more attention to plants that grow at different latitudes and altitudes. Climatic and environmental changes affect agricultural inputs, especially water resources. So, the best way of adapting to the current situation is the introduction of low-water, salt resistant, and drought-tolerant plants to the recent climatic changes. Water scarcity has become a serious problem in many countries. This restriction has had a significant impact on the development of countries. The plants which grow in arid and semi-arid regions are often exposed to adverse environmental factors, such as drought or salinity. Salinity and drought stress, more than any other factor, decrease crop yields around the world. These two abiotic stresses are the main limiting factors for crop production, especially in arid and semi-arid regions of the world. Quinoa is an exceptional plant that can adapt to adverse conditions and can serve as a solution to the challenge of global food security. Recent droughts that occurred in the world have prompted governments to include plants in their development plans, which are adapted to the country's existing water and soil conditions and have high nutritional value. This way, quinoa cultivation can ensure their food security in the coming years.
31
Lima-Medina, Israel. "Nematodos fitoparásitos asociados al cultivo de quinua en la región de Puno-Perú." Revista de Investigaciones Altoandinas - Journal of High Andean Research 21, no. 4 (2019): 257–63. http://dx.doi.org/10.18271/ria.2019.502.
Full text
32
Wang, Ning, Fengxin Wang, Clinton C. Shock, Chaobiao Meng, and Lifang Qiao. "Effects of Management Practices on Quinoa Growth, Seed Yield, and Quality." Agronomy 10, no. 3 (2020): 445. http://dx.doi.org/10.3390/agronomy10030445.
Full textAbstract:
Quinoa (Chenopodium quinoa Willd.) yield potential needs to be further achieved by good management practices to meet the increasing global demand. Two years of orthogonal field experiments were undertaken to investigate the effects of irrigation onset criteria using soil matric potential (SMP) (−15, −25, and −55 kPa), nitrogen fertilizer rate (80, 160, and 240 kg ha−1), and plant density (20, 30, and 40 plants m−2) on quinoa growth, seed yield, weight, and protein content. Initiating irrigations at an SMP of −15 to −25 kPa achieved significantly (p < 0.05) greater seed yield (37.2 g plant−1), thousand kernel weight (2.25 g), and protein content (21.2%) than −55 kPa (25.2 g plant−1, 2.08 g, and 19.8%, respectively). The 240 kg ha−1 nitrogen rate had significantly (p < 0.05) greater thousand kernel weight (2.26 g) and protein content (21.3%) than 80 (2.07 g and 19.5%, respectively) and 160 kg ha−1 (2.14 g and 20.7%, respectively). The yield under 20 plants m−2 reached 39.5 g plant−1, which was 13.5 g plant−1 higher than 40 plants m−2 (p < 0.05). The quinoa consumed most of the available nitrogen in the soil (410–860 kg ha−1), indicating that quinoa should be part of a sound crop rotation program.
33
Petr, J., I. Michalík, H. Tlaskalová, et al. "Extention of the spectra of plant products for the diet in coeliac disease." Czech Journal of Food Sciences 21, No. 2 (2011): 59–70. http://dx.doi.org/10.17221/3478-cjfs.
Full textAbstract:
The authors studied an extension of the sources of plant products for the diet in coeliac disease. This disease is induced by the components of glutenin proteins. In a collection of crops, they examined the contents of the total and protein nitrogen, the composition of protein fractions, the electrophoretic composition of reserve gluten and prolamine proteins, and the immunological determination of the gliadin amount using ELISA test. By immunological tests, gliadin content below 10 mg per 100 g of sample was found in the following species: amaranth (Amaranthus hypochondriacus and A. cruentus) followed by quinoa (Chenopodium quinoa), sorghum species &ndash; grain sorghum and sweet sorghum (Sorghum bicolor and S. saccharatum), millet (Panicum miliaceum), foxtail millet (Setaria italica ssp. maxima), broadrood (Digitaria sanguinalis) and buckwheat (Fagopyrum esculentum). These species can be considered as suitable for the diet in coeliac disease. Below-limit values were found in triticale (Triticosecale) and some oats varieties; this, however, will need some other tests. The analysed samples differred by the contents of crude protein and fraction structures of the protein complex. In pseudocereals amaranth, quinoa and buckwheat, the proportion of the soluble fractions of albumin and globulin was 50&ndash;65%. In grain sorghum, their proportion was 20.5%, in sweet sorghum 7.8%. In millet, foxtail millet, and broadrood, their proportion amounted to 12&ndash;13%. The proportion of prolamines was higher in sweet sorghum than in grain sorghum. Pseudocereals and millet contained 3&ndash;6% of prolamines, Italian millet 38.7%, and broadrood 23.1%, respectively. The two latter species had, however, lower contents of glutenins. In the other species studied, the contents of glutenins ranged from 12 to 22%. Electrophoretic analysis PAGE of prolamine proteins or SDS-PAGE ISTA, developed for gluten proteins, confirmed the results of immunological tests on the suitability of quinoa, grain sorghum, sweet sorghum, buckwheat, amaranth, broadrood, millet and foxtail millet for the diet in coeliac disease. These species did not contain prolamins or the content of -prolamins was negligible in the given samples. The tested species of wheat, triticale, and oats species were manifested as substandard or unhealthy for the diet. &nbsp;
34
Cruz, Rodrigo, Laura Carvajal, and Salomon Perez. "Identificación de Scleroderma citrinum Pers en una plantación de almendros de la ciudad de Villa Alemana, Chile." Boletín Micológico 32, no. 2 (2017): 34. http://dx.doi.org/10.22370/bolmicol.2017.32.2.1062.
Full textAbstract:
Las micorrizas son una asociación mutualista fundamental para el desarrollo tanto de las plantas como para los hongos que la establecen. Son comunes en bosques y existen muchas especies de hongos que realizan esta asociación. Las ectomicorrizas son hifas de un hongo que penetran las raíces secundarias de la planta para desarrollarse, rodeando las células de la corteza de las raices. En este trabajo se reporta el hallazgo de la ectomicorriza Scleroderma citrinum en un predio con almendros en la ciudad de Villa Alemana, Quinta región de Chile, lugar donde no había sido descrita. Tanto las condiciones ambientales, como las características del suelo del lugar no son las más favorables para el desarrollo de esta especie.
35
Khalofah, Ahlam, Hussein Migdadi, and Ehab El-Harty. "Antioxidant Enzymatic Activities and Growth Response of Quinoa (Chenopodium quinoa Willd) to Exogenous Selenium Application." Plants 10, no. 4 (2021): 719. http://dx.doi.org/10.3390/plants10040719.
Full textAbstract:
Selenium is a trace element essential to many organisms, including higher plants. At low concentrations, it enhances growth and development; however, it is toxic at high concentrations. The development of crops with proper levels of selenium will be worth for both nutrition and Se-based therapeutics. This study aimed to investigate the morphological, physiological, and biochemical responses of the quinoa plant to 0, 2.5, 5, 10, and 20 mg/L of Na2SeO3·5H2O. Selenium at low concentrations (2.5 and 5 mg/L), quinoa plant showed a significant increase of growth parameters, relative water content, photosynthetic pigments, proline, total soluble sugars, and antioxidant enzymes activities as (superoxide dismutase (SOD), catalase (CAT), peroxidase (POD, ascorbate peroxidase (APX), and glutathione reductase (GR)), and contents of malondialdehyde (MDA) and H2O2 were reduced. However, high concentrations (10 and 20) mg/L caused a decrease in plant growth parameters, relative water content, and photosynthetic pigments. In contrast, excess selenium increased the oxidative stress monitored by hydrogen peroxide and lipid peroxidation levels. The enzymatic antioxidant system responded to the selenium supply significantly increased. Osmolytes compounds, such as total sugars and proline, increased in selenium-treated plants. The increase in these osmolytes compounds may show a defense mechanism for the osmotic readjustment of quinoa plants to mitigate the toxicity caused by selenium. This study shows the morphological and physiological responses that must be considered for success in the sustainable cultivation of quinoa plants in environments containing excess selenium.
36
Testen, A. L., J. M. McKemy, and P. A. Backman. "First Report of Passalora Leaf Spot of Quinoa Caused by Passalora dubia in the United States." Plant Disease 97, no. 1 (2013): 139. http://dx.doi.org/10.1094/pdis-05-12-0472-pdn.
Full textAbstract:
The Andean seed crop quinoa, Chenopodium quinoa Willd., is an important export of Bolivia, Ecuador, and Peru. Key foliar diseases of quinoa include quinoa downy mildew (caused by Peronospora variabilis Gäum) (1), Ascochyta leaf spot (caused by Ascochyta sp.) (1), and a Cercospora-like leaf spot, the latter of which has been observed on cultivated quinoa (Jose B. Ochoa, unpublished) and native Chenopodium species. Passalora dubia (Riess) U. Braun (syn. Cercospora dubia) was tested in Europe as a biological control agent for Chenopodium album (3) and has been reported on C. album in the United States (U.S. National Fungus Collections). Quinoa field plots were established in Pennsylvania during summer 2011 and Cercospora-like leaf spot symptoms were first observed on quinoa in Centre Co. and Lancaster Co. in August 2011, after an extended rainy period. Foliar symptoms were round to oval, brown to grey-black lesions, less than 1 cm in diameter, with darker brown, reddish margins. Similar symptoms were observed on C. album weeds within both fields. Using a hand lens, conidia were observed within sporulating lesions. Conidia were hyaline and septate, 25 to 98 μm × 5 to 10 μm, and had an average of six cells per conidium. The fungus was isolated by picking single conidia from sporulating lesions (under a dissecting scope) and incubated on V8 agar in the dark at 20°C to induce sporulation. For DNA extraction, cultures were grown in potato dextrose broth amended with yeast extract. The internal transcribed spacer (ITS) region was amplified using primers ITS4 and ITS5 (2), and the resulting sequence shared 99% maximum identity with a vouchered isolate of P. dubia (GenBank EF535655). To test the pathogenicity of our P. dubia isolate, 5.9 × 103 conidia/ml (suspended in sterile water with 0.1% Tween 20) or the control solution with no conidia were sprayed, using an atomizer, onto 2-month-old quinoa plants, with 18 replications per treatment. Plants were covered with a humidity dome and maintained at >99% RH for 48 h. Plants were grown in the greenhouse at approximately 65% RH. After 1 month, circular to oval light brown lesions (<1 cm diameter) with darker margins were observed on approximately 10% of the leaves of inoculated plants, whereas no symptoms were observed on the control plants. Infected leaves were collected, incubated in a humidity chamber, and conidia were picked from sporulating lesions and inoculated onto V8 agar amended with 3% (w/v) fresh, ground quinoa plant tissue (4). Cultures were maintained at 20°C with 16-h photoperiod to induce sporulation. The identity of the reisolated fungus was confirmed morphologically and by DNA sequencing to be identical to the isolate used to test Koch's postulates. P. dubia was also isolated from C. album lesions and infected C. album may have served as a source of inoculum for quinoa. To our knowledge, this is the first report of Passalora leaf spot of quinoa in the United States. References: (1) S. Danielsen. Food Rev. Int. 19:43, 2003. (2) S. Goodwin et al. Phytopathology 91:648, 2001. (3) P. Scheepens et al. Integ. Pest. Man. Rev. 2:71, 1997. (4) M. Vathakos. Phytopathology 69:832, 1979.
37
Moreira, Rosilene da Conceição R., José Manuel Macário Rebêlo, Mônica Elinor Alves Gama, and Jackson Maurício L. Costa. "Nível de conhecimentos sobre Leishmaniose Tegumentar Americana (LTA) e uso de terapias alternativas por populações de uma área endêmica da Amazônia do Maranhão, Brasil." Cadernos de Saúde Pública 18, no. 1 (2002): 187–95. http://dx.doi.org/10.1590/s0102-311x2002000100019.
Full textAbstract:
Realizou-se estudo visando identificar e comparar que conhecimentos básicos e uso de terapias alternativas relativos à Leishmaniose Tegumentar Americana (LTA), têm populações residentes em cinco áreas rurais (Sexta Vicinal, Quinta Vicinal, Trilha 410, Vila União e Buritizinho) pertencentes ao município de Buriticupu, Maranhão. No período de setembro de 1997 a janeiro de 1998, aplicou-se questionários com perguntas abertas e fechadas, abordando aspectos epidemiológicos, modos de prevenção, clínica e terapêutica alternativa. A população estudada foi de 378 (19%) indivíduos de um total de 1980 habitantes. Na Sexta Vicinal (35 indivíduos), Quinta Vicinal (63), Trilha 410 (96), Vila União (85) e Buritizinho (99). Dos entrevistados, 72% tinham poucos conhecimentos dos modos de transmissão, 96,9% já ouviram falar da doença, a maioria obteve informações com amigos, 60,7% conheciam a LTA como lésh. O Glucantime foi a droga mais citada para o tratamento, 29,6% relataram uso de plantas no local da lesão. O Citrus limon (limão) foi a planta mais citada (15,4%) dos entrevistados, o modo de uso mais freqüente era o pó espalhado sobre a lesão. Conclui-se que o nível de conhecimento sobre LTA foi incipiente, principalmente na prevenção e terapêutica, situação similar nas cinco áreas estudadas.
38
Yang, Aizheng, Saqib Saleem Akhtar, Qiang Fu, et al. "Burkholderia Phytofirmans PsJN Stimulate Growth and Yield of Quinoa under Salinity Stress." Plants 9, no. 6 (2020): 672. http://dx.doi.org/10.3390/plants9060672.
Full textAbstract:
One of the major challenges in agriculture is to ensure sufficient and healthy food availability for the increasing world population in near future. This requires maintaining sustainable cultivation of crop plants under varying environmental stresses. Among these stresses, salinity is the second most abundant threat worldwide after drought. One of the promising strategies to mitigate salinity stress is to cultivate halotolerant crops such as quinoa. Under high salinity, performance can be improved by plant growth promoting bacteria (PGPB). Among PGPB, endophytic bacteria are considered better in stimulating plant growth compared to rhizosphere bacteria because of their ability to colonize both in plant rhizosphere and plant interior. Therefore, in the current study, a pot experiment was conducted in a controlled greenhouse to investigate the effects of endophytic bacteria i.e., Burkholderia phytofirmans PsJN on improving growth, physiology and yield of quinoa under salinity stress. At six leaves stage, plants were irrigated with saline water having either 0 (control) or 400 mM NaCl. The results indicated that plants inoculated with PsJN mitigated the negative effects of salinity on quinoa resulting in increased shoot biomass, grain weight and grain yield by 12%, 18% and 41% respectively, over un-inoculated control. Moreover, inoculation with PsJN improved osmotic adjustment and ion homeostasis ability. In addition, leaves were also characterized for five key reactive oxygen species (ROS) scavenging enzyme in response to PsJN treatment. This showed higher activity of catalase (CAT) and dehydroascobate reductase (DHAR) in PsJN-treated plants. These findings suggest that inoculation of quinoa seeds with Burkholderia phytofirmans PsJN could be used for stimulating growth and yield of quinoa in highly salt-affected soils.
39
Radovanovic, Vesna, Ilija Djekic, and Branka Zarkovic. "Characteristics of Cadmium and Lead Accumulation and Transfer by Chenopodium Quinoa Will." Sustainability 12, no. 9 (2020): 3789. http://dx.doi.org/10.3390/su12093789.
Full textAbstract:
Potentially toxic elements are persistent in the environment and plants have the ability to absorb and transfer them from soil in edible parts. The objectives of this study were to characterize the distribution of Cd and Pb in quinoa tissues and to investigate their accumulation and transfer from irrigated water in edible parts of quinoa. For the purpose of this study experiment and simulated pollution in the form of different metal concentration in water that was used for irrigation was designed. Distribution of metals in quinoa were determined and analyzed in seed formation and maturation stage. Bioaccumulation and translocation factors were calculated to characterize the efficiency of quinoa to absorb metals. The results of our study indicated that quinoa adopts potentially toxic metals from substrate but does not accumulate them. The potential of such a conclusion is useful for exploring the use of quinoa as lead and cadmium excluders.
40
Testen, A. L., J. M. McKemy, and P. A. Backman. "First Report of Quinoa Downy Mildew Caused by Peronospora variabilis in the United States." Plant Disease 96, no. 1 (2012): 146. http://dx.doi.org/10.1094/pdis-09-11-0728.
Full textAbstract:
Quinoa, Chenopodium quinoa Willd., is an Andean crop prized for its high nutritional value and adaptability to harsh environments. Quinoa is plagued by downy mildew caused by Peronospora variabilis Gäum (formerly Peronospora farinosa f. sp. chenopodii Byford) (1). Quinoa production has spread beyond native Andean ranges and quinoa downy mildew has been reported in India, Canada, and Denmark (1). During the summer of 2011, quinoa trials were established to determine the ability of quinoa to grow under Mid-Atlantic conditions and monitor for regional disease problems. In July, after cool, rainy conditions, downy mildew-like symptoms were observed on quinoa at research plots in Centre and Lancaster counties of Pennsylvania. Symptoms and signs consisted of irregularly shaped areas of foliar chlorosis or pink discoloration accompanied by dense, gray sporulation on both leaf surfaces. Sporangia were tan to gray-brown, semi-ovoid, often with a pedicel, mean length of 31 μm, and mean width of 23 μm. Sporangiophores branched dichotomously, and the terminal branchlets curved and tapered to a point. Orange oospores were present in field samples of leaf tissue. DNA was extracted from infected foliar tissue and sporangial suspensions. A seminested PCR protocol (2) was used to obtain partial internal transcribed spacer (ITS) sequences of six Peronospora isolates. The sequences shared 99% maximum identity to a known P. variabilis accession (FM863721.2) in GenBank. A voucher specimen was deposited into the U.S. National Fungus Collections (BPI 882064). Pathogenicity of each of two strains of P. variabilis was confirmed by inoculating quinoa with sporangia (4). Sporangia were shaken from leaves in sterile distilled water and the suspension was filtered through cheesecloth. A 0.01% Tween solution was added and the suspension diluted to 103 sporangia/ml. With an atomizer, a 10-ml sporangial suspension (or sterile water for noninoculated control plants) was sprayed onto one flat of 18 2-week-old quinoa plants, and relative humidity was increased to saturation using a humidity dome for 24 h. After 1 week, chlorosis and pink discoloration were noted on leaves of inoculated quinoa, and after 18 h of subsequent increased humidity (>95% relative humidity), dense gray sporulation was observed. No symptoms were noted on noninoculated control plants. Sporangia and sporangiophores were examined morphologically and confirmed to be P. variabilis, confirming Koch's postulates. For culture maintenance, 2-week-old quinoa leaves were placed onto a sporangial suspension on top of 1% water agar and maintained in a growth chamber at 20°C with 16 h of light per day. Quinoa downy mildew is seedborne (3) and initial infections may have occurred from oospores in the pericarp, despite intensive processing of consumable quinoa seeds to remove saponins. To our knowledge, this is the first report of quinoa downy mildew in the United States and also the first report of P. variabilis in the United States. References: (1) Y. Choi et al. Mycopathologia 169:403, 2010. (2) D. Cooke et al. Fungal Genet. Biol. 30:17, 2000. (3) S. Danielson et al. Seed Sci. Technol. 32:91, 2004. (4) J. Ochoa et al. Plant Pathol. 48:425, 1999.
41
Becker, Verena I., Johannes W. Goessling, Bernardo Duarte, et al. "Combined effects of soil salinity and high temperature on photosynthesis and growth of quinoa plants (Chenopodium quinoa)." Functional Plant Biology 44, no. 7 (2017): 665. http://dx.doi.org/10.1071/fp16370.
Full textAbstract:
The halophytic crop quinoa (Chenopodium quinoa Willd.) is adapted to soil salinity and cold climate, but recent investigations have shown that quinoa can be grown in significantly warmer latitudes, i.e. the Mediterranean region, where high temperature and soil salinity can occur in combination. In this greenhouse study, effects of saltwater irrigation and high temperature on growth and development of the Bolivian cultivar ‘Achachino’ were determined. Development was slightly delayed in response to saltwater treatment, but significantly faster at high temperature. Biomass and seed yield decreased in response to salt, but not to high temperature. Plants increased their number of stomata in response to salt stress, but reduced its size on both sides of the leaf, whereas high temperature treatment significantly increased the stomata size on the abaxial leaf surface. When salt and high temperature was combined, the size of stomata was reduced only on the abaxial side of the leaf, and the number of epidermal bladder cells significantly increased on the abaxial leaf surface, resulting in preservation of photosynthetic quantum yields. We hypothesise that this morphological plasticity improves the partition of water and CO2 resulting in maintenance of photosynthesis in quinoa under adverse environmental conditions. We present a GLM-model that predicts yield parameters of quinoa grown in regions affected by soil salinity, high temperature and the factors combined.
42
Yang, Aizheng, Saqib Saleem Akhtar, Shahid Iqbal, et al. "Enhancing salt tolerance in quinoa by halotolerant bacterial inoculation." Functional Plant Biology 43, no. 7 (2016): 632. http://dx.doi.org/10.1071/fp15265.
Full textAbstract:
Quinoa is a facultative halophytic seed crop of increasing interest worldwide. Its performance declines under high salinity but can be improved by using halotolerant plant growth-promoting bacteria (PGPB) containing multi-traits, i.e. ACC-deaminase activity, exopolysaccharide secretion and auxin production. This study focussed on improving the productivity of quinoa through the use of six plant growth-promoting bacterial strains (both endophytic and rhizosphere). These were screened by conducting osmoadaptation assay, and the two most halotolerant strains (Enterobacter sp. (MN17) and Bacillus sp. (MN54)) were selected. These two strains were evaluated for their effects on growth, physiological characters and yield of quinoa. At the five leaf stage plants were irrigated with saline water having either 0 or 400 mM NaCl. The results indicated that saline irrigation significantly decreased the growth of quinoa, whereas inoculation of plants with MN17 and MN54 mitigated the negative effects of salinity by improving plant water relations and decreasing Na+ uptake, which consequently, reduced osmotic and ionic stress. Strain MN54 performed better than MN17, which might be because of its better growth promoting traits and higher rhizosphere colonisation efficiency than MN17. Our results suggest that growth and productivity of quinoa could be improved by inoculating with highly tolerant PGPB strain in salt-affected soils.
43
Marcano, Carmen, Ingrid Acevedo, Jorge Contreras, Odalis Jiménez, Argelia Escalona, and Pablo Pérez. "Crecimiento y desarrollo del cultivo pepino (Cucumis sativus L.) en la zona hortícola de Humocaro bajo, estado Lara, Venezuela." Revista Mexicana de Ciencias Agrícolas 3, no. 8 (2018): 1629–36. http://dx.doi.org/10.29312/remexca.v3i8.1327.
Full textAbstract:

 
 
 Con el propósito de evaluar el crecimiento y desarrollo del cultivo de pepino (Cucucmis sativus L.) en la zona hortícola de Humocaro Bajo, estado Lara, se seleccionaron tres localidades, Sabaneta, Las Canoítas y La Estancia a 900, 110 y 840 msnm, respectivamente, en la parroquia Humocaro Bajo, municipio Morán, estado Lara. Se utilizó un diseño completamente al azar, con tres tratamientos y 20 repeticiones. Se cuantificó el número de hojas, zarcillos, f lores y frutos de hojas por planta durante la fase de crecimiento y desarrollo del cultivo de pepino. Se encontró que el crecimiento de la planta de pepino según las localidades Sabaneta, Las Canoítas y La Estancia fueron similares (p> 0.05) en cuanto a la altura de planta, números de hojas y de zarcillos hasta la séptima semana, aunque se encontró mayor altura de planta de pepino (10.55 cm) en la localidad de Las Canoítas en la tercera semana, y el mayor número de hojas en la cuarta y quinta semana (12 a 13 y 16 a 18, respectivamente) en La Estancia y Las Canoítas. El número y longitud de los frutos fue igual en las localidades. Sin embargo, se encontró mayor diámetro y peso fresco del fruto en la localidad Las Canoítas. Se concluyó que no hubo efecto evidente de las localidades sobre el crecimiento de las plantas de pepino, no así sobre los componentes del rendimiento, ref lejado en el diámetro y biomasa fresca del fruto en las plantas de pepino desarrolladas en la localidad de Las Canoítas.
 
 
44
Hariadi, Y., K. Marandon, Y. Tian, S. E. Jacobsen, and S. Shabala. "Ionic and osmotic relations in quinoa (Chenopodium quinoa Willd.) plants grown at various salinity levels." Journal of Experimental Botany 62, no. 1 (2010): 185–93. http://dx.doi.org/10.1093/jxb/erq257.
Full text
45
Lidório, Henrique Fernando, José Cardoso Sobrinho, Janine Farias Menegaes, et al. "Aqueous Extracts of Plants on the Physiological and Sanitary Quality of Chenopodium Quinoa Seeds as an Alternative to Conventional Seed Treatment." Journal of Agricultural Studies 8, no. 2 (2020): 237. http://dx.doi.org/10.5296/jas.v8i2.15848.
Full textAbstract:
This work evaluated the effect of aqueous plant extracts from chrysanthemum (Dendranthema grandiflora Tzvelev), cinnamon (Melia azedarach L.) and clove (Syzygium aromaticum L.) in the physiological and sanitary quality of germinating Chenopodium quinoa Willd (quinoa) seeds, as an alternative to seed treatment. The experiment was carried out under laboratory conditions in the year 2018. The experimental design was completely randomized in a 2×10 factorial scheme (two lots of quinoa seeds × ten doses of concentrated plant extracts), with four replicates each. The quinoa seeds were exposed to the plant extracts separately for ten minutes by submersion at the concentrations of 0, 1, 5 and 10%. The variables evaluated were germination, first germination count, field emergence, germination and emergence speed index, seedling length and sanity. The aqueous plant extracts of Dendranthema grandiflora Tzvelev, Melia azadarach L. and Syzygium aromaticum L. used in the quinoa seed treatment raised the emergence speed and the fungi control of these seeds within the variations and situations of each batch. The D. grandiflora extract, in all concentrations used, improved seed germination index, obtaining the highest rate of 70% in seeds treated with 5% concentration compared to the control treatment, which obtained 59%. M. azedarach (10% concentration) is the best treatment for emergence speed improvement, while S. aromaticum (10% concentration) provides the highest control of pathogens: 28% in relation to the control treatment that obtained 75%. These results highlighted the viability of the use of these species with low toxicity to man and the environment as treatment of quinoa seeds.
46
Rodrigues, D. B., L. V. M. Tunes, F. A. Villela, et al. "Production Potential and Quality of Chenopodium quinoa Willd. Seed Cultivated in Different Seeding Seasons." Journal of Agricultural Science 11, no. 1 (2018): 251. http://dx.doi.org/10.5539/jas.v11n1p251.
Full textAbstract:
Quinoa (Chenopodium quinoa Willd.) is an annual plant belonging to subfamily Chenopodiaceae containing such granite importance, being considered a pseudocereal. For the quinoa to gain widespread attention, to the point of achieving large scale cultivation in Brazil it is necessary for the studies to advance specially in regards to quality of produced seeds. The main aim of this work was to evaluate potential of quinoa seed&rsquo;s production cultivated in different seasons, as well as quality of seeds produced on primary and secondary stalks of quinoa plants from BRS Piabiru, produced in the South of Rio Grande do Sul (RS), Brazil. The evaluated seeding seasons were October, November and December, June, July and August of the years 2015/2016, after the plants were taken to evaluation regarding agronomical characters (fresh mass of ramification glomeruli, main glomeruli, fresh mass of stem from the main, fresh mass of stem ramification, fresh mass of leaves, dry mass of stem ramification, stem from the main, glomeruli from the main, stem ramification, of leaves, diameter of stem and panicle lenght) and quality of seeds (germination, test of cold, accelerated aging, and seed&rsquo;s emergency). Quality of the seed is assured when it&rsquo;s produced after months of July, August and November, given that quality of seeds from main stem is superior.
47
Jacobsen, S. E., C. Monteros, L. J. Corcuera, L. A. Bravo, J. L. Christiansen, and A. Mujica. "Frost resistance mechanisms in quinoa (Chenopodium quinoa Willd.)." European Journal of Agronomy 26, no. 4 (2007): 471–75. http://dx.doi.org/10.1016/j.eja.2007.01.006.
Full text
48
Jacobsen, S. E., and J. L. Christiansen. "Some Agronomic Strategies for Organic Quinoa (Chenopodium quinoa Willd.)." Journal of Agronomy and Crop Science 202, no. 6 (2016): 454–63. http://dx.doi.org/10.1111/jac.12174.
Full text
49
Hinojosa, Leonardo, Alex Leguizamo, Carlos Carpio, et al. "Quinoa in Ecuador: Recent Advances under Global Expansion." Plants 10, no. 2 (2021): 298. http://dx.doi.org/10.3390/plants10020298.
Full textAbstract:
Quinoa is a highly diverse crop domesticated in the Andean region of South America with broad adaptation to a wide range of marginal environments. Quinoa has garnered interest worldwide due to its nutritional and health benefits. Over the last decade, quinoa production has expanded outside of the Andean region, prompting multiple studies investigating the potential for quinoa cultivation in novel environments. Currently, quinoa is grown in countries spanning five continents, including North America, Europe, Asia, Africa, and Oceania. Here, we update the advances of quinoa research in Ecuador across different topics, including (a) current quinoa production situation with a focus on breeding progress, (b) traditional seed production, and (c) the impact of the work of the nongovernment organization “European Committee for Training and Agriculture” with quinoa farmers in Chimborazo province. Additionally, we discuss genetic diversity, primary pests and diseases, actions for adapting quinoa to tropical areas, and recent innovations in quinoa processing in Ecuador. Finally, we report a case study describing a participatory breeding project between Washington State University and the Association of Andean Seed and Nutritional Food Producers Mushuk Yuyay in the province of Cañar.
50
Testen, Anna L., María del Mar Jiménez-Gasco, José B. Ochoa, and Paul A. Backman. "Molecular Detection of Peronospora variabilis in Quinoa Seed and Phylogeny of the Quinoa Downy Mildew Pathogen in South America and the United States." Phytopathology® 104, no. 4 (2014): 379–86. http://dx.doi.org/10.1094/phyto-07-13-0198-r.
Full textAbstract:
Quinoa (Chenopodium quinoa) is an important export of the Andean region, and its key disease is quinoa downy mildew, caused by Peronospora variabilis. P. variabilis oospores can be seedborne and rapid methods to detect seedborne P. variabilis have not been developed. In this research, a polymerase chain reaction (PCR)-based detection method was developed to detect seedborne P. variabilis and a sequencing-based method was used to validate the PCR-based method. P. variabilis was detected in 31 of 33 quinoa seed lots using the PCR-based method and in 32 of 33 quinoa seed lots using the sequencing-based method. Thirty-one of the quinoa seed lots tested in this study were sold for human consumption, with seed originating from six different countries. Internal transcribed spacer (ITS) and cytochrome c oxidase subunit 2 (COX2) phylogenies were examined to determine whether geographical differences occurred in P. variabilis populations originating from Ecuador, Bolivia, and the United States. No geographical differences were observed in the ITS-derived phylogeny but the COX2 phylogeny indicated that geographical differences existed between U.S. and South American samples. Both ITS and COX2 phylogenies supported the existence of a Peronospora sp., distinct from P. variabilis, that causes systemic-like downy mildew symptoms on quinoa in Ecuador. The results of these studies allow for a better understanding of P. variabilis populations in South America and identified a new causal agent for quinoa downy mildew. The PCR-based seed detection method allows for the development of P. variabilis-free quinoa seed, which may prove important for management of quinoa downy mildew.