Journal articles: 'Reverse chemical genetics'

1

Ross-Macdonald, Petra. "Forward in reverse: how reverse genetics complements chemical genetics." Pharmacogenomics 6, no. 4 (July 2005): 429–34. http://dx.doi.org/10.1517/14622416.6.4.429.

Full text

APA, Harvard, Vancouver, ISO, and other styles

2

Jansen, Gert, Esther Hazendonk, Karen L. Thijssen, and Ronald H. A. Plasterk. "Reverse genetics by chemical mutagenesis in Caenorhabditis elegans." Nature Genetics 17, no. 1 (September 1997): 119–21. http://dx.doi.org/10.1038/ng0997-119.

Full text

APA, Harvard, Vancouver, ISO, and other styles

3

Thorpe, David. "Forward & Reverse Chemical Genetics Using SPOS-Based Combinatorial Chemistry." Combinatorial Chemistry & High Throughput Screening 6, no. 7 (November 1, 2003): 623–47. http://dx.doi.org/10.2174/138620703771981205.

Full text

APA, Harvard, Vancouver, ISO, and other styles

4

Becattini, Barbara, and Maurizio Pellecchia. "SAR by ILOEs: An NMR-Based Approach to Reverse Chemical Genetics." Chemistry - A European Journal 12, no. 10 (March 20, 2006): 2658–62. http://dx.doi.org/10.1002/chem.200500636.

Full text

APA, Harvard, Vancouver, ISO, and other styles

5

Koga, Hisashi. "Establishment of the platform for reverse chemical genetics targeting novel protein–protein interactions." Mol. BioSyst. 2, no. 3-4 (2006): 159–64. http://dx.doi.org/10.1039/b517589e.

Full text

APA, Harvard, Vancouver, ISO, and other styles

6

Wong, Lai H., Sunita Sinha, Julien R. Bergeron, Joseph C. Mellor, Guri Giaever, Patrick Flaherty, and Corey Nislow. "Reverse Chemical Genetics: Comprehensive Fitness Profiling Reveals the Spectrum of Drug Target Interactions." PLOS Genetics 12, no. 9 (September 2, 2016): e1006275. http://dx.doi.org/10.1371/journal.pgen.1006275.

Full text

APA, Harvard, Vancouver, ISO, and other styles

7

Kanoh, Naoki, Kaori Honda, Siro Simizu, Makoto Muroi, and Hiroyuki Osada. "Photo-Cross-Linked Small-Molecule Affinity Matrix for Facilitating Forward and Reverse Chemical Genetics." Angewandte Chemie International Edition 44, no. 23 (June 6, 2005): 3559–62. http://dx.doi.org/10.1002/anie.200462370.

Full text

APA, Harvard, Vancouver, ISO, and other styles

8

Kanoh, Naoki, Kaori Honda, Siro Simizu, Makoto Muroi, and Hiroyuki Osada. "Photo-Cross-Linked Small-Molecule Affinity Matrix for Facilitating Forward and Reverse Chemical Genetics." Angewandte Chemie International Edition 44, no. 28 (July 11, 2005): 4282. http://dx.doi.org/10.1002/anie.200590096.

Full text

APA, Harvard, Vancouver, ISO, and other styles

9

Kanoh, Naoki, Kaori Honda, Siro Simizu, Makoto Muroi, and Hiroyuki Osada. "Photo-Cross-Linked Small-Molecule Affinity Matrix for Facilitating Forward and Reverse Chemical Genetics." Angewandte Chemie 117, no. 23 (June 6, 2005): 3625–28. http://dx.doi.org/10.1002/ange.200462370.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

Kanoh, Naoki, Kaori Honda, Siro Simizu, Makoto Muroi, and Hiroyuki Osada. "Photo-Cross-Linked Small-Molecule Affinity Matrix for Facilitating Forward and Reverse Chemical Genetics." Angewandte Chemie 117, no. 28 (July 11, 2005): 4354. http://dx.doi.org/10.1002/ange.200590095.

Full text

APA, Harvard, Vancouver, ISO, and other styles

11

Wu, Jian-Li, Chanjian Wu, Cailin Lei, Marietta Baraoidan, Alicia Bordeos, Ma Reina Suzette Madamba, Marilou Ramos-Pamplona, et al. "Chemical- and Irradiation-induced Mutants of Indica Rice IR64 for Forward and Reverse Genetics." Plant Molecular Biology 59, no. 1 (September 2005): 85–97. http://dx.doi.org/10.1007/s11103-004-5112-0.

Full text

APA, Harvard, Vancouver, ISO, and other styles

12

Kim, Tae-Wan. "S2-03-04: Reverse chemical genetics approach to identify druggable gene products in Alzheimer's disease." Alzheimer's & Dementia 6 (July 2010): S93—S94. http://dx.doi.org/10.1016/j.jalz.2010.05.288.

Full text

APA, Harvard, Vancouver, ISO, and other styles

13

Bentley, Alyssa, Bridget MacLennan, Jonathan Calvo, and Charles R. Dearolf. "Targeted Recovery of Mutations in Drosophila." Genetics 156, no. 3 (November 1, 2000): 1169–73. http://dx.doi.org/10.1093/genetics/156.3.1169.

Full text

Abstract:

Abstract Reverse genetic techniques will be necessary to take full advantage of the genomic sequence data for Drosophila and other experimental organisms. To develop a method for the targeted recovery of mutations, we combined an EMS chemical mutagenesis regimen with mutation detection by denaturing high performance liquid chromatography (DHPLC). We recovered mutant strains at the high rate of ∼4.8 mutations/kb for every 1000 mutagenized chromosomes from a screen for new mutations in the Drosophila awd gene. Furthermore, we observed that the EMS mutational spectrum in Drosophila germ cells shows a strong preference for 5′-PuG-3′ sites, and for G/C within a stretch of three or more G/C base pairs. Our method should prove useful for targeted mutagenesis screens in Drosophila and other genetically tractable organisms and for more precise studies of mutagenesis and DNA repair mechanisms.

APA, Harvard, Vancouver, ISO, and other styles

14

Norberg, Stefan T., Matthew G. Tucker, and Stephen Hull. "Bond valence sum: a new soft chemical constraint forRMCProfile." Journal of Applied Crystallography 42, no. 2 (February 27, 2009): 179–84. http://dx.doi.org/10.1107/s0021889809004981.

Full text

Abstract:

The implementation of a new soft chemical constraint for the reverse Monte Carlo (RMC) programRMCProfile, based on bond valence sum (BVS) calculations, is described and its advantages for the analysis of `total scattering' diffraction data collected from disordered crystalline systems discussed. The inclusion of the BVS formalism proves particularly valuable in the early stages of the RMC fitting procedure, by avoiding the formation of regions containing chemically unreasonable local configurations which can become frozen in. Furthermore, this approach provides the fitting procedure with additional chemical information to differentiate between cation species that share the same crystallographic sites within the averaged unit cell and possess similar neutron scattering lengths. These issues are illustrated using total neutron scattering data collected at room temperature on the oxide-ion conductor Zr2Y2O7and the nonlinear optical material KTiOPO4.

APA, Harvard, Vancouver, ISO, and other styles

15

Markossian, Sarine, Kenny K. Ang, Christopher G. Wilson, and Michelle R. Arkin. "Small-Molecule Screening for Genetic Diseases." Annual Review of Genomics and Human Genetics 19, no. 1 (August 31, 2018): 263–88. http://dx.doi.org/10.1146/annurev-genom-083117-021452.

Full text

Abstract:

The genetic determinants of many diseases, including monogenic diseases and cancers, have been identified; nevertheless, targeted therapy remains elusive for most. High-throughput screening (HTS) of small molecules, including high-content analysis (HCA), has been an important technology for the discovery of molecular tools and new therapeutics. HTS can be based on modulation of a known disease target (called reverse chemical genetics) or modulation of a disease-associated mechanism or phenotype (forward chemical genetics). Prominent target-based successes include modulators of transthyretin, used to treat transthyretin amyloidoses, and the BCR-ABL kinase inhibitor Gleevec, used to treat chronic myelogenous leukemia. Phenotypic screening successes include modulators of cystic fibrosis transmembrane conductance regulator, splicing correctors for spinal muscular atrophy, and histone deacetylase inhibitors for cancer. Synthetic lethal screening, in which chemotherapeutics are screened for efficacy against specific genetic backgrounds, is a promising approach that merges phenotype and target. In this article, we introduce HTS technology and highlight its contributions to the discovery of drugs and probes for monogenic diseases and cancer.

APA, Harvard, Vancouver, ISO, and other styles

16

Dickinson, Christopher C., Alexandra J. Weisberg, and John G. Jelesko. "Transient Heterologous Gene Expression Methods for Poison Ivy Leaf and Cotyledon Tissues." HortScience 53, no. 2 (February 2018): 242–46. http://dx.doi.org/10.21273/hortsci12421-17.

Full text

Abstract:

Poison ivy [Toxicodendron radicans (L.) Kuntz] is a widely recognized native plant species because of its production of urushiol, which is responsible for delayed contact dermatitis symptoms in humans. Poison ivy is predicted to become both more prevalent and more noxious in response to projected patterns of climate change. Future studies on poison ivy chemical ecology will require reverse genetics to investigate urushiol metabolism. A prerequisite for reverse genetic procedures is the introduction and expression of recombinant DNA into poison ivy tissues. Poison ivy leaves and cotyledons were marginally susceptible to vacuum- and syringe-agroinfiltration and expression of two firefly luciferase (LUC)–based reporter genes. The efficacy of agroinfiltration and transient LUC expression was dependent on leaf age and plant growth environmental conditions, with young leaves grown in magenta boxes showing highest transient LUC expression levels. Agroinfiltrated leaves showed an Agrobacterium-dependent accumulation of brown–colored pigments. Biolistic transformation of a LUC reporter gene did not show brown pigment accumulation and readily displayed transient LUC bioluminescence in both leaves and cotyledon tissues. These studies establish best practices for introducing and transiently expressing recombinant DNA into poison ivy leaf and cotyledon tissues, on which future reverse genetic procedures can be developed.

APA, Harvard, Vancouver, ISO, and other styles

17

Bynum, D. G., and D. M. Barbano. "Whole Milk Reverse Osmosis Retentates for Cheddar Cheese Manufacture: Chemical Changes During Aging." Journal of Dairy Science 68, no. 1 (January 1985): 1–10. http://dx.doi.org/10.3168/jds.s0022-0302(85)80789-x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

18

Meng, Fanxue, Nan Mei, Jian Yan, Xiaoqing Guo, Patricia A. Richter, Tao Chen, and Mamata De. "Comparative potency analysis of whole smoke solutions in the bacterial reverse mutation test." Mutagenesis 36, no. 4 (June 16, 2021): 321–29. http://dx.doi.org/10.1093/mutage/geab021.

Full text

Abstract:

Abstract Short-term in vitro genotoxicity assays are useful tools to assess whether new and emerging tobacco products potentially have reduced toxicity. We previously demonstrated that potency ranking by benchmark dose (BMD) analysis quantitatively identifies differences among several known carcinogens and toxic chemicals representing different chemical classes found in cigarette smoke. In this study, six whole smoke solution (WSS) samples containing both the particulate and gas phases of tobacco smoke were generated from two commercial cigarette brands under different smoking-machine regimens. Sixty test cigarettes of each brand were machine-smoked according to the International Organization for Standardization (ISO) puffing protocol. In addition, either 60 or 20 test cigarettes of each brand were machine-smoked with the Canadian Intense (CI) puffing protocol. All six WSSs were evaluated in the bacterial reverse mutation (Ames) test using Salmonella typhimurium strains, in the presence or absence of S9 metabolic activation. The resulting S9-mediated mutagenic concentration–responses for the four WSSs from 60 cigarettes were then compared using BMD modelling analysis and the mutagenic potency expressed as number of revertants per μl of the WSS. The quantitative approaches resulted in a similar rank order of mutagenic potency for the Ames test in both TA98 and TA100. Under the conditions of this study, these results indicate that quantitative analysis of the Ames test data can discriminate between the mutagenic potencies of WSSs on the basis of smoking-machine regimen (ISO vs. CI), and cigarette product (differences in smoke chemistry).

APA, Harvard, Vancouver, ISO, and other styles

19

Lelyveld, Victor S., Derek K. O’Flaherty, Lijun Zhou, Enver Cagri Izgu, and Jack W. Szostak. "DNA polymerase activity on synthetic N3′→P5′ phosphoramidate DNA templates." Nucleic Acids Research 47, no. 17 (August 20, 2019): 8941–49. http://dx.doi.org/10.1093/nar/gkz707.

Full text

Abstract:

Abstract Genetic polymers that could plausibly govern life in the universe might inhabit a broad swath of chemical space. A subset of these genetic systems can exchange information with RNA and DNA and could therefore form the basis for model protocells in the laboratory. N3′→P5′ phosphoramidate (NP) DNA is defined by a conservative linkage substitution and has shown promise as a protocellular genetic material, but much remains unknown about its functionality and fidelity due to limited enzymatic tools. Conveniently, we find widespread NP-DNA-dependent DNA polymerase activity among reverse transcriptases, an observation consistent with structural studies of the RNA-like conformation of NP-DNA duplexes. Here, we analyze the consequences of this unnatural template linkage on the kinetics and fidelity of DNA polymerization activity catalyzed by wild-type and variant reverse transcriptases. Template-associated deficits in kinetics and fidelity suggest that even highly conservative template modifications give rise to error-prone DNA polymerase activity. Enzymatic copying of NP-DNA sequences is nevertheless an important step toward the future study and engineering of this synthetic genetic polymer.

APA, Harvard, Vancouver, ISO, and other styles

20

Harrigan, George, Daniel Brackett, and Laszlo Boros. "Medicinal Chemistry, Metabolic Profiling and Drug Target Discovery: A Role for Metabolic Profiling in Reverse Pharmacology and Chemical Genetics." Mini-Reviews in Medicinal Chemistry 5, no. 1 (January 1, 2005): 13–20. http://dx.doi.org/10.2174/1389557053402800.

Full text

APA, Harvard, Vancouver, ISO, and other styles

21

Kania, Urszula, Matyáš Fendrych, and Jiří Friml. "Polar delivery in plants; commonalities and differences to animal epithelial cells." Open Biology 4, no. 4 (April 2014): 140017. http://dx.doi.org/10.1098/rsob.140017.

Full text

Abstract:

Although plant and animal cells use a similar core mechanism to deliver proteins to the plasma membrane, their different lifestyle, body organization and specific cell structures resulted in the acquisition of regulatory mechanisms that vary in the two kingdoms. In particular, cell polarity regulators do not seem to be conserved, because genes encoding key components are absent in plant genomes. In plants, the broad knowledge on polarity derives from the study of auxin transporters, the PIN-FORMED proteins, in the model plant Arabidopsis thaliana. In animals, much information is provided from the study of polarity in epithelial cells that exhibit basolateral and luminal apical polarities, separated by tight junctions. In this review, we summarize the similarities and differences of the polarization mechanisms between plants and animals and survey the main genetic approaches that have been used to characterize new genes involved in polarity establishment in plants, including the frequently used forward and reverse genetics screens as well as a novel chemical genetics approach that is expected to overcome the limitation of classical genetics methods.

APA, Harvard, Vancouver, ISO, and other styles

22

Bovina, R., A. Brunazzi, G. Gasparini, F. Sestili, S. Palombieri, E. Botticella, D. Lafiandra, P. Mantovani, and A. Massi. "Development of a TILLING resource in durum wheat for reverse- and forward-genetic analyses." Crop and Pasture Science 65, no. 1 (2014): 112. http://dx.doi.org/10.1071/cp13226.

Full text

Abstract:

A durum wheat TILLING (targeting induced local lesions in genomes) population of 2601 M3 families was developed from cv. Svevo using ethyl methanesulfonate as a chemical mutagen. The entire M3 population was field-grown for phenotypic evaluations. Despite the polyploid nature of the wheat genome, a preliminarily phenotypic screening showed a high frequency of morphological alterations (~22%); specific phenotyping for seed morphology was undertaken. Furthermore, a reverse-genetics experiment was performed on DNA collected from M2 leaves for the homoeologous genes SBEIIa-A and SBEIIa-B involved in starch metabolism. One non-sense mutation for both genes was identified; specific crosses are planned in order to pyramid the two mutations.

APA, Harvard, Vancouver, ISO, and other styles

23

Lai, Kin Kui, Nam Nam Cheung, Fang Yang, Jun Dai, Li Liu, Zhiwei Chen, Kong Hung Sze, Honglin Chen, Kwok-Yung Yuen, and Richard Yi Tsun Kao. "Identification of Novel Fusion Inhibitors of Influenza A Virus by Chemical Genetics." Journal of Virology 90, no. 5 (December 16, 2015): 2690–701. http://dx.doi.org/10.1128/jvi.02326-15.

Full text

Abstract:

ABSTRACTA previous screening of more than 50,000 compounds led to the identification of a pool of bioactive small molecules with inhibitory effect on the influenza A virus. One of these compounds, now widely known as nucleozin, is a small molecule that targets the influenza A virus nucleoprotein. Here we identify and characterize two structurally different novel fusion inhibitors of the influenza A virus group 1 hemagglutinin (HA), FA-583 and FA-617, with low nanomolar activities. Escape mutants that are highly resistant to each of these compounds were generated, and both were found to carry mutations localized in close proximity to the B-loop of the hemagglutinin 2 protein, which plays a crucial role in the virion-host cell fusion process. Recombinant virus, generated through reverse genetics, confirmed the resistance phenotype. In addition, the proposed binding pockets predicted by molecular docking studies are in accordance with the resistance-bearing mutation sites. We show through mechanistic studies that FA-583 and FA-617 act as fusion inhibitors by prohibiting the low-pH-induced conformational change of hemagglutinin. Our study has offered concrete biological and mechanistic explorations for the strategic development of novel fusion inhibitors of influenza A viruses.IMPORTANCEHere we report two structurally distinctive novel fusion inhibitors of influenza A virus that act by interfering with the structural change of HA at acidic pH, a process necessary for successful entry of the virus. Mutational and molecular docking studies have identified their binding pockets situated in close proximity to the B-loop region of hemagglutinin 2. The reduced sensitivity of FA-583- or FA-617-associated mutants to another compound suggests a close proximity and even partial overlap of their binding sites on hemagglutinin. Amino acid sequence alignments and crystal structure analyses of group 1 and group 2 hemagglutinins have shed light on the possible binding mode of these two compounds. This report offers new lead compounds for the design of fusion inhibitors for influenza A viruses and further shows that analysis by forward chemical genetics is a highly effective approach for the identification of novel compounds that can perturb the infectivity of viruses and to probe new druggable targets or druggable domains in various viruses.

APA, Harvard, Vancouver, ISO, and other styles

24

Golovina, Anna Y., Margarita M. Dzama, Kirill S. Petriukov, Timofei S. Zatsepin, Petr V. Sergiev, Alexey A. Bogdanov, and Olga A. Dontsova. "Method for site-specific detection of m6A nucleoside presence in RNA based on high-resolution melting (HRM) analysis." Nucleic Acids Research 42, no. 4 (November 20, 2013): e27-e27. http://dx.doi.org/10.1093/nar/gkt1160.

Full text

Abstract:

Abstract Chemical landscape of natural RNA species is decorated with the large number of modified nucleosides. Some of those could easily be detected by reverse transcription, while others permit only high-performance liquid chromatography or mass-spectrometry detection. Presence of m6A nucleoside at a particular position of long RNA molecule is challenging to observe. Here we report an easy and high-throughput method for detection of m6A nucleosides in RNA based on high-resolution melting analysis. The method relies on the previous knowledge of the modified nucleoside position at a particular place of RNA and allows rapid screening for conditions or genes necessary for formation of that modification.

APA, Harvard, Vancouver, ISO, and other styles

25

Leal, Walter S., Rosângela M. R. Barbosa, Wei Xu, Yuko Ishida, Zainulabeuddin Syed, Nicolas Latte, Angela M. Chen, Tania I. Morgan, Anthony J. Cornel, and André Furtado. "Reverse and Conventional Chemical Ecology Approaches for the Development of Oviposition Attractants for Culex Mosquitoes." PLoS ONE 3, no. 8 (August 22, 2008): e3045. http://dx.doi.org/10.1371/journal.pone.0003045.

Full text

APA, Harvard, Vancouver, ISO, and other styles

26

Berenschot, Amanda S., Maria I. Zucchi, Augusto Tulmann-Neto, and Vera Quecini. "Mutagenesis in Petunia x hybrida Vilm. and isolation of a novel morphological mutant." Brazilian Journal of Plant Physiology 20, no. 2 (June 2008): 95–103. http://dx.doi.org/10.1590/s1677-04202008000200002.

Full text

Abstract:

Traditionally, mutagenesis has been used to introduce novel genetic variability in ornamental crops. More recently, it has become a powerful tool in gene discovery and functional analyses in reverse genetics approaches. The present work aimed to compare the efficiency of physical and chemical agents in generating mutant populations of petunia. We have indirectly evaluated the genomic damage by analyzing developmental characteristics of the plantlets derived from treated seeds employing gamma radiation at 0, 20, 40, 60, 80 and 100 Gy and the alkylating agent ethyl-methanesulfonate (EMS) at 0, 0.05, 0.1, 0.15, 0.2 and 0.25% (v/v). Gamma rays and EMS caused developmental defects and decreased seedling viability in plants obtained from the mutagenized seeds. High mutagen doses reduced in approximately 44% the number of plants with primary leaves at 15 days after sowing (DAS) and decreased seedling survival rates to 55% (gamma) and 28% (EMS), in comparison to untreated controls. Seedling height decrease was proportional to increasing EMS dosage, whereas 40 and 60 Gy of gamma irradiation caused the most significant reduction in height. Moderate DNA damage allowing a high saturation of mutant alleles in the genome and the generation of viable plants for reverse genetics studies was correlated to the biological parameter LD50, the dose required to kill half of the tested population. It corresponded to 100 Gy for gamma radiation and 0.1% for EMS treatment. The optimized mutagen treatments were used to develop petunia mutant populations (M1 and M2) and novel morphological mutants were identified.

APA, Harvard, Vancouver, ISO, and other styles

27

Rangan, Ramya, Andrew M. Watkins, Jose Chacon, Rachael Kretsch, Wipapat Kladwang, Ivan N. Zheludev, Jill Townley, Mats Rynge, Gregory Thain, and Rhiju Das. "De novo3D models of SARS-CoV-2 RNA elements from consensus experimental secondary structures." Nucleic Acids Research 49, no. 6 (March 8, 2021): 3092–108. http://dx.doi.org/10.1093/nar/gkab119.

Full text

Abstract:

AbstractThe rapid spread of COVID-19 is motivating development of antivirals targeting conserved SARS-CoV-2 molecular machinery. The SARS-CoV-2 genome includes conserved RNA elements that offer potential small-molecule drug targets, but most of their 3D structures have not been experimentally characterized. Here, we provide a compilation of chemical mapping data from our and other labs, secondary structure models, and 3D model ensembles based on Rosetta's FARFAR2 algorithm for SARS-CoV-2 RNA regions including the individual stems SL1-8 in the extended 5′ UTR; the reverse complement of the 5′ UTR SL1-4; the frameshift stimulating element (FSE); and the extended pseudoknot, hypervariable region, and s2m of the 3′ UTR. For eleven of these elements (the stems in SL1–8, reverse complement of SL1–4, FSE, s2m and 3′ UTR pseudoknot), modeling convergence supports the accuracy of predicted low energy states; subsequent cryo-EM characterization of the FSE confirms modeling accuracy. To aid efforts to discover small molecule RNA binders guided by computational models, we provide a second set of similarly prepared models for RNA riboswitches that bind small molecules. Both datasets (‘FARFAR2-SARS-CoV-2’, https://github.com/DasLab/FARFAR2-SARS-CoV-2; and ‘FARFAR2-Apo-Riboswitch’, at https://github.com/DasLab/FARFAR2-Apo-Riboswitch’) include up to 400 models for each RNA element, which may facilitate drug discovery approaches targeting dynamic ensembles of RNA molecules.

APA, Harvard, Vancouver, ISO, and other styles

28

Carradice, Duncan, and Graham J. Lieschke. "Zebrafish in hematology: sushi or science?" Blood 111, no. 7 (April 1, 2008): 3331–42. http://dx.doi.org/10.1182/blood-2007-10-052761.

Full text

Abstract:

Abstract After a decade of the “modern era” of zebrafish hematology research, what have been their major contributions to hematology and what challenges does the model face? This review argues that, in hematology, zebrafish have demonstrated their suitability, are proving their utility, have supplied timely and novel discoveries, and are poised for further significant contributions. It presents an overview of the anatomy, physiology, and genetics of zebrafish hematopoiesis underpinning their use in hematology research. Whereas reverse genetic techniques enable functional studies of particular genes of interest, forward genetics remains zebrafish's particular strength. Mutants with diverse and interesting hematopoietic defects are emerging from multiple genetic screens. Some mutants model hereditary blood diseases, occasionally leading to disease genes first; others provide insights into developmental hematology. Models of malignant hematologic disorders provide tools for drug-target and pharmaceutics discovery. Numerous transgenic zebrafish with fluorescently marked blood cells enable live-cell imaging of inflammatory responses and host-pathogen interactions previously inaccessible to direct observation in vivo, revealing unexpected aspects of leukocyte behavior. Zebrafish disease models almost uniquely provide a basis for efficient whole animal chemical library screens for new therapeutics. Despite some limitations and challenges, their successes and discovery potential mean that zebrafish are here to stay in hematology research.

APA, Harvard, Vancouver, ISO, and other styles

29

Krayzman, Victor, and Igor Levin. "Determination ofB-cation chemical short-range order in perovskites from the total pair-distribution function." Journal of Applied Crystallography 41, no. 2 (March 8, 2008): 386–92. http://dx.doi.org/10.1107/s0021889807067131.

Full text

Abstract:

Short-rangeB-cation order affects the functional properties of many complex perovskites. However, current ability to measure the characteristics of such chemical short-range order (SRO) in perovskite-structured ceramics is limited. In the present study, two distinct methods are compared for the determination of theB-cation SRO parameters from the total scattering pair-distribution function (PDF). Both methods rely on reverse Monte Carlo refinements of the structural models but differ in the procedures used to extract the SRO characteristics. The accuracy of these methods was tested using synthetic PDF data generated for models of prototype Ca(Zr,Ti)O3solid solutions. One of the approaches developed in the present study, which proved to yield the most accurate results, was used to analyze the SRO of Ti and Zr in powder samples of Ca(Zr,Ti)O3.

APA, Harvard, Vancouver, ISO, and other styles

30

Pandey, Rajan Kumar, Drista Sharma, Rupal Ojha, Tarun Kumar Bhatt, and Vijay Kumar Prajapati. "Chemical system biology based molecular interactions to identify inhibitors against Q151M mutant of HIV-1 reverse transcriptase." Infection, Genetics and Evolution 63 (September 2018): 5–12. http://dx.doi.org/10.1016/j.meegid.2018.05.005.

Full text

APA, Harvard, Vancouver, ISO, and other styles

31

Siddique, Muhammad Irfan, Seungki Back, Joung-Ho Lee, Jinkwan Jo, Siyoung Jang, Koeun Han, Jelli Venkatesh, Jin-Kyung Kwon, Yeong Deuk Jo, and Byoung-Cheorl Kang. "Development and Characterization of an Ethyl Methane Sulfonate (EMS) Induced Mutant Population in Capsicum annuum L." Plants 9, no. 3 (March 23, 2020): 396. http://dx.doi.org/10.3390/plants9030396.

Full text

Abstract:

Plant breeding explores genetic diversity in useful traits to develop new, high-yielding, and improved cultivars. Ethyl methane sulfonate (EMS) is a chemical widely used to induce mutations at loci that regulate economically essential traits. Additionally, it can knock out genes, facilitating efforts to elucidate gene functions through the analysis of mutant phenotypes. Here, we developed a mutant population using the small and pungent ornamental Capsicum annuum pepper “Micro-Pep”. This accession is particularly suitable for mutation studies and molecular research due to its compact growth habit and small size. We treated 9500 seeds with 1.3% EMS and harvested 3996 M2 lines. We then selected 1300 (32.5%) independent M2 families and evaluated their phenotypes over four years. The mutants displayed phenotypic variations in plant growth, habit, leaf color and shape, and flower and fruit morphology. An experiment to optimize Targeting Induced Local Lesions IN Genomes (TILLING) in pepper detected nine EMS-induced mutations in the eIF4E gene. The M2 families developed here exhibited broad phenotypic variation and should be valuable genetic resources for functional gene analysis in pepper molecular breeding programs using reverse genetics tools, including TILLING.

APA, Harvard, Vancouver, ISO, and other styles

32

Li, Q. L., S. C. Yi, D. Z. Li, X. P. Nie, S. Q. Li, M. Q. Wang, and A. M. Zhou. "Optimization of reverse chemical ecology method: false positive binding of Aenasius bambawalei odorant binding protein 1 caused by uncertain binding mechanism." Insect Molecular Biology 27, no. 3 (January 30, 2018): 305–18. http://dx.doi.org/10.1111/imb.12372.

Full text

APA, Harvard, Vancouver, ISO, and other styles

33

Biswas, Himadri, Indrani Kar, and Rajagopal Chattopadhyaya. "Deoxyadenosine family: improved synthesis, DNA damage and repair, analogs as drugs." BioMolecular Concepts 4, no. 4 (August 1, 2013): 401–10. http://dx.doi.org/10.1515/bmc-2013-0010.

Full text

Abstract:

AbstractImproved synthesis of 2′-deoxyadenosine using Escherichia coli overexpressing some enzymes and gram-scale chemical synthesis of 2′-deoxynucleoside 5′-triphosphates reported recently are described in this review. Other topics include DNA damage induced by chromium(VI), Fenton chemistry, photoinduction with lumazine, or by ultrasound in neutral solution; 8,5′-cyclo-2′-deoxyadenosine isomers as potential biomarkers; and a recapitulation of purine 5′,8-cyclonucleoside studies. The mutagenicities of some products generated by oxidizing 2′-deoxyadenosine 5′-triphosphate, nucleotide pool sanitization, and translesion synthesis are also reviewed. Characterizing cross-linking between nucleosides in opposite strands of DNA and endonuclease V-mediated deoxyinosine excision repair are discussed. The use of purine nucleoside analogs in the treatment of rarer chronic lymphoid leukemias is reviewed. Some analogs at the C8 position induced delayed polymerization arrest during HIV-1 reverse transcription. The susceptibility of clinically metronidazole-resistant Trichomonas vaginalis to two analogs, toyocamycin and 2-fluoro-2′-deoxyadenosine, were tested in vitro. GS-9148, a dAMP analog, was translocated to the priming site in a complex with reverse transcriptase and double-stranded DNA to gain insight into the mechanism of reverse transcriptase inhibition.

APA, Harvard, Vancouver, ISO, and other styles

34

Rudell, D. R., J. P. Mattheis, X. Fan, and J. K. Fellman. "Methyl Jasmonate Enhances Anthocyanin Accumulation and Modifies Production of Phenolics and Pigments in `Fuji' Apples." Journal of the American Society for Horticultural Science 127, no. 3 (May 2002): 435–41. http://dx.doi.org/10.21273/jashs.127.3.435.

Full text

Abstract:

Effects of artificial ultraviolet-visible light and methyl jasmonate (MJ) treatment on `Fuji' apple [Malus sylvestris (L.) Mill. var. domestica (Borkh.) Mansf.] fruit peel anthocyanin, phenolic, carotenoid, and chlorophyll production were examined using tristimulus color analysis and reverse-phase high performance liquid chromatography. Anthocyanin synthesis was enhanced by light and MJ treatment. Chlorogenic acid and most cyanidin, quercetin, and phloretin glycosides increased with MJ treatment concentration. Light alone also promoted increased production of most of these compounds. Production of catechin, (-)epicatechin, quercetin, and quercetrin was not enhanced by either light or MJ treatment. Light and MJ enhanced ß-carotene and chlorophyll b, synthesis but not xanthophyll or chlorophyll a synthesis. The chlorophyll a/b ratio decreased with MJ dosage. Results suggest MJ may provide a viable means of enhancing apple fruit coloration and other photoprotective mechanisms. Chemical name used: methyl 3-oxo-2-(2-pentenyl)cyclopentane-1-acetate (methyl jasmonate).

APA, Harvard, Vancouver, ISO, and other styles

35

Motorin, Yuri, and Virginie Marchand. "Analysis of RNA Modifications by Second- and Third-Generation Deep Sequencing: 2020 Update." Genes 12, no. 2 (February 16, 2021): 278. http://dx.doi.org/10.3390/genes12020278.

Full text

Abstract:

The precise mapping and quantification of the numerous RNA modifications that are present in tRNAs, rRNAs, ncRNAs/miRNAs, and mRNAs remain a major challenge and a top priority of the epitranscriptomics field. After the keystone discoveries of massive m6A methylation in mRNAs, dozens of deep sequencing-based methods and protocols were proposed for the analysis of various RNA modifications, allowing us to considerably extend the list of detectable modified residues. Many of the currently used methods rely on the particular reverse transcription signatures left by RNA modifications in cDNA; these signatures may be naturally present or induced by an appropriate enzymatic or chemical treatment. The newest approaches also include labeling at RNA abasic sites that result from the selective removal of RNA modification or the enhanced cleavage of the RNA ribose-phosphate chain (perhaps also protection from cleavage), followed by specific adapter ligation. Classical affinity/immunoprecipitation-based protocols use either antibodies against modified RNA bases or proteins/enzymes, recognizing RNA modifications. In this survey, we review the most recent achievements in this highly dynamic field, including promising attempts to map RNA modifications by the direct single-molecule sequencing of RNA by nanopores.

APA, Harvard, Vancouver, ISO, and other styles

36

Ravindran, J., B. Manikandan, P. V. Shirodkar, K. X. Francis, R. Mani Murali, and P. Vethamony. "Bacterial bioluminescence response to long-term exposure to reverse osmosis treated effluents from dye industries." Canadian Journal of Microbiology 60, no. 10 (October 2014): 661–68. http://dx.doi.org/10.1139/cjm-2014-0378.

Full text

Abstract:

The bacterial bioluminescence assay is one of the novel means for toxicity detection. The bioluminescence response of 2 marine bioluminescent bacteria was tested upon their long-term exposure to 9 different reverse osmosis (RO) rejects with varying chemical composition sampled from various dye industries. Bioluminescent bacteria were cultured in the RO reject samples, at different concentrations, and their growth rate and luminescence was measured for 24 h. The RO reject samples caused sublethal effects upon exposure and retarded the growth of bacteria, confirming their toxic nature. Further, continuation of the exposure showed that the initial luminescence, though reduced, recovered and increased beyond the control cultures irrespective of cell density, and finally decreased once again. The present study emphasizes the need of evolving a long-term exposure assay and shows that the method followed in this study is suitable to evaluate the toxicants that exert delayed toxicity, using lower concentrations of toxicants as well as coloured samples.

APA, Harvard, Vancouver, ISO, and other styles

37

Johannes, Ludger. "The Cellular and Chemical Biology of Endocytic Trafficking and Intracellular Delivery—The GL–Lect Hypothesis." Molecules 26, no. 11 (May 31, 2021): 3299. http://dx.doi.org/10.3390/molecules26113299.

Full text

Abstract:

Lipid membranes are common to all forms of life. While being stable barriers that delimitate the cell as the fundamental organismal unit, biological membranes are highly dynamic by allowing for lateral diffusion, transbilayer passage via selective channels, and in eukaryotic cells for endocytic uptake through the formation of membrane bound vesicular or tubular carriers. Two of the most abundant fundamental fabrics of membranes—lipids and complex sugars—are produced through elaborate chains of biosynthetic enzymes, which makes it difficult to study them by conventional reverse genetics. This review illustrates how organic synthesis provides access to uncharted areas of membrane glycobiology research and its application to biomedicine. For this Special Issue on Chemical Biology Research in France, focus will be placed on synthetic approaches (i) to study endocytic functions of glycosylated proteins and lipids according to the GlycoLipid–Lectin (GL–Lect) hypothesis, notably that of Shiga toxin; (ii) to mechanistically dissect its endocytosis and intracellular trafficking with small molecule; and (iii) to devise intracellular delivery strategies for immunotherapy and tumor targeting. It will be pointed out how the chemical biologist’s view on lipids, sugars, and proteins synergizes with biophysics and modeling to “look” into the membrane for atomistic scale insights on molecular rearrangements that drive the biogenesis of endocytic carriers in processes of clathrin-independent endocytosis.

APA, Harvard, Vancouver, ISO, and other styles

38

Gao, Peng, Pak Leung Ho, Bingpeng Yan, Kong Hung Sze, Julian Davies, and Richard Yi Tsun Kao. "Suppression of Staphylococcus aureus virulence by a small-molecule compound." Proceedings of the National Academy of Sciences 115, no. 31 (July 16, 2018): 8003–8. http://dx.doi.org/10.1073/pnas.1720520115.

Full text

Abstract:

Emerging antibiotic resistance among bacterial pathogens has necessitated the development of alternative approaches to combat drug-resistance-associated infection. The abolition of Staphylococcus aureus virulence by targeting multiple-virulence gene products represents a promising strategy for exploration. A multiplex promoter reporter platform using gfp-luxABCDE dual-reporter plasmids with selected promoters from S. aureus-virulence-associated genes was used to identify compounds that modulate the expression of virulence factors. One small-molecule compound, M21, was identified from a chemical library to reverse virulent S. aureus into its nonvirulent state. M21 is a noncompetitive inhibitor of ClpP and alters α-toxin expression in a ClpP-dependent manner. A mouse model of infection indicated that M21 could attenuate S. aureus virulence. This nonantibiotic compound has been shown to suppress the expression of multiple unrelated virulence factors in S. aureus, suggesting that targeting a master regulator of virulence is an effective way to control virulence. Our results illustrate the power of chemical genetics in the modulation of virulence gene expression in pathogenic bacteria.

APA, Harvard, Vancouver, ISO, and other styles

39

Li, Xiao-Dan, Xiao-Feng Li, Han-Qing Ye, Cheng-Lin Deng, Qing Ye, Chao Shan, Bao-Di Shang, et al. "Recovery of a chemically synthesized Japanese encephalitis virus reveals two critical adaptive mutations in NS2B and NS4A." Journal of General Virology 95, no. 4 (April 1, 2014): 806–15. http://dx.doi.org/10.1099/vir.0.061838-0.

Full text

Abstract:

A full-length genome infectious clone is a powerful tool for functional assays in virology. In this study, using a chemical synthesized complete genome of Japanese encephalitis virus (JEV) strain SA14 (GenBank accession no. U14163), we constructed a full-length genomic cDNA clone of JEV. The recovered virus from the cDNA clone replicated poorly in baby hamster kidney (BHK-21) cells and in suckling mice brain. Following serial passage in BHK-21 cells, adaptive mutations within the NS2B and NS4A proteins were recovered in the passaged viruses leading to viruses with a large-plaque phenotype. Mutagenesis analysis, using a genome-length RNA and a replicon of JEV, demonstrated that the adaptive mutations restored replication to different degrees, and the restoration efficiencies were in the order: NS2B-T102M<NS4A-R79K<NS2B-T102M+NS4A-R79K. An in vivo virulence assay in mice showed that the recombinant virus containing double mutations showed similar virulence to the WT SA14 (GenBank accession no. M55506). This study reports the first chemically synthesized JEV. A reverse genetics assay demonstrated that substitutions of NS2B-T102M and NS4A-R79K altered JEV replication.

APA, Harvard, Vancouver, ISO, and other styles

40

Su, L. J., P. K. Auluck, T. F. Outeiro, E. Yeger-Lotem, J. A. Kritzer, D. F. Tardiff, K. E. Strathearn, et al. "Compounds from an unbiased chemical screen reverse both ER-to-Golgi trafficking defects and mitochondrial dysfunction in Parkinson's disease models." Disease Models & Mechanisms 3, no. 3-4 (December 28, 2009): 194–208. http://dx.doi.org/10.1242/dmm.004267.

Full text

APA, Harvard, Vancouver, ISO, and other styles

41

Daina, Antoine, Olivier Michielin, and Vincent Zoete. "SwissTargetPrediction: updated data and new features for efficient prediction of protein targets of small molecules." Nucleic Acids Research 47, W1 (May 20, 2019): W357—W364. http://dx.doi.org/10.1093/nar/gkz382.

Full text

Abstract:

Abstract SwissTargetPrediction is a web tool, on-line since 2014, that aims to predict the most probable protein targets of small molecules. Predictions are based on the similarity principle, through reverse screening. Here, we describe the 2019 version, which represents a major update in terms of underlying data, backend and web interface. The bioactivity data were updated, the model retrained and similarity thresholds redefined. In the new version, the predictions are performed by searching for similar molecules, in 2D and 3D, within a larger collection of 376 342 compounds known to be experimentally active on an extended set of 3068 macromolecular targets. An efficient backend implementation allows to speed up the process that returns results for a druglike molecule on human proteins in 15–20 s. The refreshed web interface enhances user experience with new features for easy input and improved analysis. Interoperability capacity enables straightforward submission of any input or output molecule to other on-line computer-aided drug design tools, developed by the SIB Swiss Institute of Bioinformatics. High levels of predictive performance were maintained despite more extended biological and chemical spaces to be explored, e.g. achieving at least one correct human target in the top 15 predictions for >70% of external compounds. The new SwissTargetPrediction is available free of charge (www.swisstargetprediction.ch).

APA, Harvard, Vancouver, ISO, and other styles

42

Wang, Yan, Shuai Li, Zhenyu Tian, Jiaqi Sun, Shuobin Liang, Bo Zhang, Lu Bai, et al. "Generation of a caged lentiviral vector through an unnatural amino acid for photo-switchable transduction." Nucleic Acids Research 47, no. 19 (July 30, 2019): e114-e114. http://dx.doi.org/10.1093/nar/gkz659.

Full text

Abstract:

Abstract Application of viral vectors in gene delivery is attracting widespread attention but is hampered by the absence of control over transduction, which may lead to non-selective transduction with adverse side effects. To overcome some of these limitations, we proposed an unnatural amino acid aided caging–uncaging strategy for controlling the transduction capability of a viral vector. In this proof-of-principle study, we first expanded the genetic code of the lentiviral vector to incorporate an azido-containing unnatural amino acid (Nϵ-2-azidoethyloxycarbonyl-l-lysine, NAEK) site specifically within a lentiviral envelope protein. Screening of the resultant vectors indicated that NAEK incorporation at Y77 and Y116 was capable of inactivating viral transduction upon click conjugation with a photo-cleavable chemical molecule (T1). Exposure of the chimeric viral vector (Y77-T1) to UVA light subsequently removed the photo-caging group and restored the transduction capability of lentiviral vector both in vitro and in vivo. Our results indicate that the use of the photo-uncage activation procedure can reverse deactivated lentiviral vectors and thus enable regulation of viral transduction in a switchable manner. The methods presented here may be a general approach for generating various switchable vectors that respond to different stimulations and adapt to different viral vectors.

APA, Harvard, Vancouver, ISO, and other styles

43

Rozhon, Wilfried, Sonia Akter, Atiara Fernandez, and Brigitte Poppenberger. "Inhibitors of Brassinosteroid Biosynthesis and Signal Transduction." Molecules 24, no. 23 (November 29, 2019): 4372. http://dx.doi.org/10.3390/molecules24234372.

Full text

Abstract:

Chemical inhibitors are invaluable tools for investigating protein function in reverse genetic approaches. Their application bears many advantages over mutant generation and characterization. Inhibitors can overcome functional redundancy, their application is not limited to species for which tools of molecular genetics are available and they can be applied to specific tissues or developmental stages, making them highly convenient for addressing biological questions. The use of inhibitors has helped to elucidate hormone biosynthesis and signaling pathways and here we review compounds that were developed for the plant hormones brassinosteroids (BRs). BRs are steroids that have strong growth-promoting capacities, are crucial for all stages of plant development and participate in adaptive growth processes and stress response reactions. In the last two decades, impressive progress has been made in BR inhibitor development and application, which has been instrumental for studying BR modes of activity and identifying and characterizing key players. Both, inhibitors that target biosynthesis, such as brassinazole, and inhibitors that target signaling, such as bikinin, exist and in a comprehensive overview we summarize knowledge and methodology that enabled their design and key findings of their use. In addition, the potential of BR inhibitors for commercial application in plant production is discussed.

APA, Harvard, Vancouver, ISO, and other styles

44

Wang, Hong, Jia Jia, Lu Wang, Keith Butler, Rui Song, Gilberto Casillas, Le He, et al. "Heterostructure Engineering of a Reverse Water Gas Shift Photocatalyst." Advanced Science 6, no. 22 (October 4, 2019): 1902170. http://dx.doi.org/10.1002/advs.201902170.

Full text

APA, Harvard, Vancouver, ISO, and other styles

45

Liu, Mengjin, Bruno Bienfait, Oliver Sacher, Johann Gasteiger, Roland J. Siezen, Arjen Nauta, and Jan M. W. Geurts. "Combining Chemoinformatics with Bioinformatics: In Silico Prediction of Bacterial Flavor-Forming Pathways by a Chemical Systems Biology Approach “Reverse Pathway Engineering”." PLoS ONE 9, no. 1 (January 8, 2014): e84769. http://dx.doi.org/10.1371/journal.pone.0084769.

Full text

APA, Harvard, Vancouver, ISO, and other styles

46

Merthaningsih, Ni Putu, I. Putu Sudiarta, and Gusti Ngurah Alit Susanta Wirya. "IDENTIFICATION OF CITRUS WHITEFLY, HOST OF ENTOMOPATHOGENIC FUNGI (ASCHERSONIA PLACENTA) IN BALI INDONESIA." International Journal of Biosciences and Biotechnology 7, no. 2 (June 16, 2020): 57. http://dx.doi.org/10.24843/ijbb.2020.v07.i02.p01.

Full text

Abstract:

One of the pests of citrus is whitefly that, causes damage directly or/and indirectly to the citrus production. To control whitefly the farmer usually use chemical insecticide, however the utilization of chemical insecticide has been reported to haves many negative effect. To minimize the utilization of chemical insecticide, the environmentally friendly method is needed. One of the method is to utilize the natural enemies. Natural enemies are including, parasitiod, predator as well as insect pathogen (entomopathogen). In 2017 entomopathogenic fungi Aschersonia placenta was found to be associated with citrus whitefly in Bali Indonesia. However the species of whitefly has not been identified. In this research the identification of whitefly, the host insect of A. placenta was conducted based on morphological and molecular identification. Morphological identification of whitefly use puparial stage, started with sample preparation by Slide Mounting Protocol. The target of mitochondrial cytochrome c oxidase subunit I (mtCOI) gen was successfully amplified (700 bp) by PCR using forward primer LCO 5'GGTCAACAAATCATAAAGATATTGG3' and reverse primer HCO 5'TAAACTTCAGGGTGACCAAAAAATCA3'. The phylogenetic analysis using software ChromasPRO, Molecular Evolutionary Genetics Analysis (MEGA 5.05), PAUP, BioEdit, and TreeGraph2 was conducted. The result shows that the mtCOI sequence of P. minei from Bali (LC491421) has the highest percentage among others with MK421974 P. minei (score homology 96%). The morphological recognition and sequence analysis show that the species of citrus whitefly is Paraleyrodes minei.

APA, Harvard, Vancouver, ISO, and other styles

47

Liu, Aimin, Joyce G. Latimer, and Robert E. Wilkinson. "Growth Characteristics and Root Calcium Absorption of Watermelon Seedlings as Influenced by the Fungicides Captan and Thiram." Journal of the American Society for Horticultural Science 119, no. 2 (March 1994): 202–8. http://dx.doi.org/10.21273/jashs.119.2.202.

Full text

Abstract:

The influence of two fungicides—captan and thiram—on growth and 45Ca absorption by roots of `Starbrite' watermelon [Citrullus lanatus (Thunb.) Matsum. and Nakai] seedlings was investigated. Unilateral application of Ca+2 and Al in agar induced curvature in roots from untreated and pretreated seeds. In untreated seeds, PCMBS inhibited Ca+2- and Al-induced root curvature by 82% and 92%, respectively. In commercially pretreated seeds (captan + thiram), PCMBS inhibited Ca+2- but not Al-induced root curvature. Captan or thiram also inhibited Ca+2- or Al-induced root curvature, and the effects of captan and thiram on root curvature were additive. Serial concentration (0, 0.01, 0.1, 1, 10, or 100 mg·liter-1) tests indicated that captan inhibited 45Ca absorption the most at 100 mg·liter-1, whereas thiram inhibited 45Ca absorption the most at 0.01 mg·liter-1. The effects of captan and thiram on 45Ca absorption were statistically additive. Thiram seemed to influence Ca+2 uptake by affecting exofacial sulfhydryl groups (a mode of action similar to that of PCMBS). DTT reversed the inhibitory effect of thiram on 45Ca absorption by 34% but did not reverse the effect of captan. A field test showed that acidic soil (pH 4.55) reduced leaf number; leaf, stem, shoot, and whole-plant dry weights; and stem length of 15-day-old seedlings. Although there was no difference in root dry weights or root: shoot ratios of plants from pretreated and untreated seeds planted in soil at pH 6.26, planting commercially pretreated seeds in acidic soil produced plants with greater root dry weights and root: shoot dry weight ratios than those from untreated seeds. Seedlings showed a greater response to seed treatment in early growth stages. Captan and thiram may have influenced growth characteristics by inhibiting Al uptake of seedlings planted in acidic soil. To our knowledge, this is the first report on the influence of the fungicides captan and thiram on mineral ion uptake in roots. Chemical names used: p-Chloromercuribenzenesulfonic acid (PCMBS), dithiothreitol (DTT), N-trichloromethylthio-4-cyclohexene-1,2-dicarboximide (captan), tetramethylthiuram disulfide (thiram).

APA, Harvard, Vancouver, ISO, and other styles

48

Whitehead, Stephen S., Cai-Yen Firestone, Ruth A. Karron, James E. Crowe, William R. Elkins, Peter L. Collins, and Brian R. Murphy. "Addition of a Missense Mutation Present in the L Gene of Respiratory Syncytial Virus (RSV) cpts530/1030 to RSV Vaccine Candidate cpts248/404 Increases Its Attenuation and Temperature Sensitivity." Journal of Virology 73, no. 2 (February 1, 1999): 871–77. http://dx.doi.org/10.1128/jvi.73.2.871-877.1999.

Full text

Abstract:

ABSTRACT Respiratory syncytial virus (RSV) cpts530/1030 is an attenuated, temperature-sensitive subgroup A vaccine candidate derived previously from cold-passaged RSV (cpRSV) by two sequential rounds of chemical mutagenesis and biological selection. Here,cpts530/1030 was shown to be highly attenuated in the upper and lower respiratory tracts of seronegative chimpanzees. However, evaluation in seropositive children showed that it retains sufficient replicative capacity and virulence to preclude its direct use as a live attenuated vaccine. Nucleotide sequence analysis of the genome of cpts530/1030 showed that it had acquired two nucleotide substitutions (compared to its cpts530 parent), both of which were in the L gene: a silent mutation at nucleotide position 8821 (amino acid 108) and a missense mutation at nucleotide position 12458 resulting in a tyrosine-to-asparagine change at amino acid 1321, herein referred to as the 1030 mutation. It also contained the previously identified 530 missense mutation at nucleotide 10060 in the L gene. The genetic basis of attenuation ofcpts530/1030 was defined by the introduction of the 530 and 1030 mutations into a cDNA clone of cpRSV, from which recombinant RSV was derived and analyzed to determine the contribution of each mutation to the temperature sensitivity (ts) and attenuation (att) phenotypes of cpts530/1030. The 530 mutation, derived from cpts530, was previously shown to be responsible for the ts and attphenotypes of that virus. In the present study, the 1030 mutation was shown to be responsible for the increased temperature sensitivity ofcpts530/1030. In addition, the 1030 mutation was shown to be responsible for the increased level of attenuation ofcpts530/1030 in the upper and lower respiratory tracts of mice. The 530 and 1030 mutations were additive in their effects on thets and att phenotypes. It was possible to introduce the 1030 mutation, but not the 530 mutation, into an attenuated vaccine candidate with residual reactogenicity in very young infants, namely, cpts248/404, by use of reverse genetics. The inability to introduce the 530 mutation into thecpts248/404 virus was shown to be due to its incompatibility with the 248 missense mutation at the level of L protein function. The resulting rA2cp248/404/1030 mutant virus was more temperature sensitive and more attenuated than thecpts248/404 parent virus, making it a promising new RSV vaccine candidate created by use of reverse genetics to improve upon an existing vaccine virus.

APA, Harvard, Vancouver, ISO, and other styles

49

Caldwell, Kim A., Corey W. Willicott, and Guy A. Caldwell. "Modeling neurodegeneration in Caenorhabditiselegans." Disease Models & Mechanisms 13, no. 10 (October 1, 2020): dmm046110. http://dx.doi.org/10.1242/dmm.046110.

Full text

Abstract:

ABSTRACTThe global burden of neurodegenerative diseases underscores the urgent need for innovative strategies to define new drug targets and disease-modifying factors. The nematode Caenorhabditis elegans has served as the experimental subject for multiple transformative discoveries that have redefined our understanding of biology for ∼60 years. More recently, the considerable attributes of C. elegans have been applied to neurodegenerative diseases, including amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's disease and Huntington's disease. Transgenic nematodes with genes encoding normal and disease variants of proteins at the single- or multi-copy level under neuronal-specific promoters limits expression to select neuronal subtypes. The anatomical transparency of C. elegans affords the use of co-expressed fluorescent proteins to follow the progression of neurodegeneration as the animals age. Significantly, a completely defined connectome facilitates detailed understanding of the impact of neurodegeneration on organismal health and offers a unique capacity to accurately link cell death with behavioral dysfunction or phenotypic variation in vivo. Moreover, chemical treatments, as well as forward and reverse genetic screening, hasten the identification of modifiers that alter neurodegeneration. When combined, these chemical-genetic analyses establish critical threshold states to enhance or reduce cellular stress for dissecting associated pathways. Furthermore, C. elegans can rapidly reveal whether lifespan or healthspan factor into neurodegenerative processes. Here, we outline the methodologies employed to investigate neurodegeneration in C. elegans and highlight numerous studies that exemplify its utility as a pre-clinical intermediary to expedite and inform mammalian translational research.

APA, Harvard, Vancouver, ISO, and other styles

50

Yates, Laura, Fiona McMurray, Youming Zhang, Andy Greenfield, Miriam Moffatt, William Cookson, and Charlotte Dean. "ENU mutagenesis as a tool for understanding lung development and disease." Biochemical Society Transactions 37, no. 4 (July 22, 2009): 838–42. http://dx.doi.org/10.1042/bst0370838.

Full text

Abstract:

ENU (N-ethyl-N-nitrosourea) is a chemical mutagen that randomly induces point mutations in DNA. Since the 1990s ENU has been successfully used as a means to obtain mouse mutants using both gene-driven (reverse genetics) and phenotype-driven (forward genetics) approaches. A high-efficiency ENU approach results in approx. 25 functional mutations per genome; most of these will result in hypomorphic alleles. Our group has recently begun using ENU mutagenesis as a tool for understanding lung development and disease. In collaboration with other groups at MRC Harwell, we have undertaken a screen for recessive mutations affecting mouse lung development. We are currently pursuing two lines identified from this screen, Hel (head, eye and lung) and RecBA17. Both these lines exhibit lung defects and we believe that by studying the phenotypes and identifying the causative mutations, we may also shed light on lung disease pathogenesis. In collaboration with Bill Cookson and Miriam Moffatt, we are also taking a gene-driven approach for understanding asthma. Using the Harwell ENU sperm archive, we have recovered mouse lines harbouring mutations in the asthma-susceptibility genes Phf11 (PHD finger protein 11) and Dpp10 (dipeptidylpeptidase 10). Functional analyses of these alleles are currently under way.

APA, Harvard, Vancouver, ISO, and other styles

Journal articles on the topic 'Reverse chemical genetics'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles