To see the other types of publications on this topic, follow the link: Rymd.
Journal articles on the topic 'Rymd'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Rymd.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Kwiatkowska, Agnieszka. "Podkasany rym." Forum Poetyki, no. 7 (March 6, 2017): 80–85. http://dx.doi.org/10.14746/fp.2017.7.26763.
Full textAbstract:
Próby naśladowania starożytnego wiersza metrycznego w literaturze polskiej wiązały się z koniecznością zastosowania akcentu oksytonicznego w klauzuli. Wokół tego zjawiska w XVIII wieku wybuchł spór. Polemiści dyskutowali o możliwościach przeniesienia do polskiego wiersza struktury podawczej elegii oraz o funkcjonowaniu rymu męskiego, powiązanego z tym właśnie gatunkiem. Rym męski, postrzegany jako frywolny i lekki, w odczuciu oświeconych nie pasował do liryki nastrojowej i melancholijnej.
2
Suvi, William Titus, Hussein Shimelis, Mark Laing, Isack Mathew, and Admire I. T. Shayanowako. "Determining the Combining Ability and Gene Action for Rice Yellow Mottle Virus Disease Resistance and Agronomic Traits in Rice (Oryza sativa L.)." Agronomy 11, no. 1 (December 23, 2020): 12. http://dx.doi.org/10.3390/agronomy11010012.
Full textAbstract:
Selecting genetically diverse and complementary parental lines and superior crosses are pre-requisites in developing improved cultivars. The objectives of this study were to determine the combining ability effects and gene action conditioning rice yellow mottle virus disease (RYMVD) resistance and agronomic traits in rice (Oryza sativa L.). Ten parental lines and their 45 F2 progenies were field evaluated in three locations using a 5 × 11 alpha lattice design with two replications. The genotype × site interaction effects were significant (p < 0.05) for the number of tillers (NT), number of panicles per plant (NPP), number of grains per panicle (NGP), percentage of filled grains (PFG), thousand grain weight (TGW), RYMVD resistance and grain yield (GY). The analysis of general and specific combining ability (GCA and SCA) indicated involvement of both additive and non-additive gene action governing inheritance of traits. High GCA/SCA ratio estimate revealed additive genetic effect was predominant. Parental lines Mwangaza, Lunyuki, Salama M-57, Salama M-19, IRAT 256 and Salama M-55, which had negative GCA effects for RYMVD, and families such as SARO 5 × Salama M-55, IRAT 245 × Rangimbili, Rangimbili × Gigante and Rangimbili × Mwangaza, which had negative SCA effects for RYMVD, were selected for RYMV resistance breeding. The crosses Rangimbili × Gigante, Gigante × Salama M-19 and Rangimbili × Salama M-55 were selected due to their desirable SCA effects for GY. The predominance of additive gene effects for agronomic traits and RYMVD resistance in the present breeding populations suggested that rice improvement could be achieved through gene introgression using recurrent selection.
3
Sedláček, T., P. Mařík, and J. Chrpová. "Development of CAPS marker for identifi cation of rym4 and rym5 alleles conferring resistance to the Barley Yellow Mosaic Virus complex in barley." Czech Journal of Genetics and Plant Breeding 46, No. 4 (December 14, 2010): 159–63. http://dx.doi.org/10.17221/7/2010-cjgpb.
Full textAbstract:
In barley, soil-borne viruses of the barley mosaic virus complex (BaYMV, BaMMV, BaYMV-2) are of high importance due to their increased spread, yield losses, and the fact that protection with chemicals is not possible. Concerning resistance breeding, simple, cheap, and robust selection methods are required. Markerassisted selection (MAS) has a great potential to meet this demand. A CAPS marker designed directly for SNPs causing mutations responsible for resistance of rym4/rym5 alleles of the Hv-eIF4E gene was developed in this study. Results showed perfect correspondence between the CAPS marker and the allele identified indirectly on the basis of field tests.
4
Okada, Yoshihiro, Ryouichi Kanatani, Syouichi Arai, and Kazutoshi Ito. "Interaction between Barley Yellow Mosaic Disease-resistance Genes rym1 and rym5, in the Response to BaYMV Strains." Breeding Science 54, no. 4 (2004): 319–25. http://dx.doi.org/10.1270/jsbbs.54.319.
Full text
5
Uke, Ayaka, Naswiru Tibanyendela, Ryoichi Ikeda, Azusa Fujiie, and Keiko Teresa Natsuaki. "Modes of transmission and stability of Rice yellow mottle virus." Journal of Plant Protection Research 54, no. 4 (December 30, 2014): 363–66. http://dx.doi.org/10.2478/jppr-2014-0054.
Full textAbstract:
Abstract Rice yellow mottle virus (RYMV) is the most important rice virus in Africa. We examined RYMV transmission via soil and water contaminated with RYMV-infected rice plants and by serial cutting with RYMV-contaminated scissors. Transmission of RYMV via dried rice straw kept at 27°C was also examined. The results showed the virus could be transmitted via soil and water, and by scissors. Rice straw that was RYMV-infected was not infective if it was dried and was kept longer than 42 days. By insect transmission experiments and ELISA, long-horned grasshoppers (Conocephalus spp.) were found to be a possible vector of RYMV in Uganda.
6
Alkali, G., M. D. Alegbejo, B. D. Kashina, and O. O. Banwo. "Analysis of Serological Variability and Hierarchical Distribution of Rice Yellow Mottle Sobemovirus Isolates in Northern Nigeria." International Letters of Natural Sciences 37 (April 2015): 1–9. http://dx.doi.org/10.18052/www.scipress.com/ilns.37.1.
Full textAbstract:
A panel of four monoclonal antibodies (MAbs) was used to study the immunological profile of Rice yellow mottle virus (RYMV) genus Sobemovirus. Serological profiles of 35 representative isolates of RYMV from Borno, Gombe, Kaduna, Kano, Niger, Sokoto and Zamfara states in Northern Nigeria. All the RYMV isolates were classified into three major serogroups (SG1, SG2 and SG3) and further separated into six subgroups (Sg1a, Sg1b, Sg2a, Sg2b, Sg3a and Sg3b). The results demonstrate a significant serological variability among RYMV isolates in Northern Nigeria. The hierarchical analysis of the serological profiles data revealed high viral load in Kano, Kaduna and Gombe states, these show they are suitable locations for strategic RYMV diagnostic and field epidemiological studies
7
Krüger, Kai. "Rydd opp i kontraktslovgivningen!" Lov og Rett 41, no. 03 (April 5, 2002): 129–30. http://dx.doi.org/10.18261/issn1504-3061-2002-03-01.
Full text
8
Sere, Y., F. Sorho, A. Onasanya, L. Jobe, S. Darboe, Y. Bojang, M. L. Touray, A. Pinel-Galzi, and D. Fargette. "First Report of Rice yellow mottle virus in Rice in The Gambia." Plant Disease 92, no. 2 (February 2008): 316. http://dx.doi.org/10.1094/pdis-92-2-0316b.
Full textAbstract:
Rice yellow mottle virus (RYMV) of the genus Sobemovirus is a major biotic constraint to rice (Oryza sativa) production in Africa. First reported in Kenya during 1966, RYMV was later found in most countries in Africa where rice is grown (1). In countries in westernmost Africa (The Gambia, Guinea-Bissau, Mauritania, and Senegal), plants with leaf yellowing and mottling symptoms were observed, but RYMV was never isolated. Rice is the staple food in The Gambia. In 2006, four samples were collected from local rice varieties in the Kuntaur Region in the center of The Gambia. Mechanical inoculation with leaf extracts from all samples caused typical yellow mottle symptoms on the susceptible rice varieties BG90-2, Bouaké 189, and IR64. RYMV was detected in the four samples collected by ELISA with polyclonal antisera (2). The 720-nt coat protein gene was amplified for each isolate by reverse-transcriptase-PCR with primers 5′-CAAAGATGGCCAGGAA-3′ (sense) and 5′-CTCCCCCACCCATCCCGAGAATT-3′ (antisense) (2). The RT-PCR products were directly sequenced (EMBL Accession Nos. AM765810, AM765811, AM765812, and AM765813) and then aligned using ClustalW with a pool of RYMV coat protein sequences from West African isolates (EMBL Accession Nos. AJ279905, AJ279901, AJ885137, AJ885124, and AJ279935). Phylogenetic reconstruction by maximum-likelihood with PAUP indicated that the isolates from The Gambia formed a monophyletic group with over 97% nucleotide identity and are closely related to isolates of other countries in West Africa (Burkina Faso, Côte d'Ivoire, Guinea, Mali, and Sierra-Leone) with 91 to 94% identity. Detection of RYMV in The Gambia indicates that RYMV is present in westernmost Africa, which is referred to as the ‘rice belt’ of Africa, and shows that RYMV is widely distributed from eastern Africa (Tanzania) to the western part of the continent. References: (1) N. K. Kouassi et al. Plant Dis. 89:124, 2005. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000.
9
Abo, M. E., M. D. Alegbejo, and A. A. Sy. "Field incidence of rice yellow mottle virus, genus sobemovirus on rice and a weed species in the field in Cote d'Ivoire." Acta Agronomica Hungarica 50, no. 1 (April 1, 2002): 85–89. http://dx.doi.org/10.1556/aagr.50.2002.1.10.
Full textAbstract:
Field surveys carried out between 1996 and 1997 in Cote d'Ivoire on weed hosts to detect the occurrence and subsistence of rice yellow mottle virus (RYMV) in nature show that rice and Echinochloa crus-pavonis (Link) harbour the virus. There was consistent detection of RYMV throughout the sampling period in rice samples mostly from the lowland varieties. It is thus evident that RYMV subsists more on rice in nature. This could serve as a source of inoculum for infection to newly transplanted rice in the field.
10
Traoré, O., A. Pinel, D. Fargette, and G. Konaté. "First Report and Characterization of Rice yellow mottle virus in Central Africa." Plant Disease 85, no. 8 (August 2001): 920. http://dx.doi.org/10.1094/pdis.2001.85.8.920a.
Full textAbstract:
Rice yellow mottle virus (RYMV) of the genus Sobemovirus is the main virus infecting rice (Oryza sativa) in Africa. First reported in Kenya (East Africa), RYMV was later found in most countries of East and West Africa where rice is grown, and in Madagascar in the Indian Ocean. In Central Africa however, the disease had never been reported in rice fields. Ninety-eight field samples with typical yellow mottle symptoms from cultivated rice and two wild rice species (Oryza longistaminata and O. barthii) were collected in the Soudano-Sahelian zones, in the north of Cameroon and the south of Chad (Central Africa) in September 2000. RYMV was detected by ELISA with polyclonal antisera (1) in all samples. All virus isolates were also mechanically transmitted to rice cv. BG 90-2, which is highly susceptible to RYMV. Tests with monoclonal antibodies showed that most isolates from Central Africa were of the SI serotype, which is widespread in the Soudano-Sahelian zones of West Africa (1). The coat protein gene of 7 isolates was amplified by RT-PCR and the expected 720 bp fragment was obtained. Resulting sequences (AJ306735, AJ317949, AJ317950, AJ317951, AJ317952, AJ317953, AJ317954) shared over 95% sequence identity. They were compared to a set of sequences of RYMV isolates from cultivated rice of different geographical origins (2). Phylogenetic analyses by maximum parsimony (PAUP 4) showed that isolates from Central Africa belonged to a monophyletic group, a sister group of West African isolates from the Soudano-Sahelian zones, further supporting the geographic basis of RYMV diversity (2). RYMV incidence was generally less than 10% but reached 20% in some irrigated plots in the two countries. References: (1) G. Konaté et al. Arch Virol. 142:1117, 1997. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000.
11
Miedaner, Thomas, and Viktor Korzun. "Marker-Assisted Selection for Disease Resistance in Wheat and Barley Breeding." Phytopathology® 102, no. 6 (June 2012): 560–66. http://dx.doi.org/10.1094/phyto-05-11-0157.
Full textAbstract:
Marker-assisted selection (MAS) provides opportunities for enhancing the response from selection because molecular markers can be applied at the seedling stage, with high precision and reductions in cost. About each of 50 genes conferring monogenic resistances and hundreds of quantitative trait loci (QTL) for quantitative disease resistances have been reported in wheat and barley. For detecting single-major gene resistance, MAS could be easily applied, but is often not necessary because the resistances are selected phenotypically. In quantitative disease resistances, MAS would be very useful, but the individual QTL often have small effects. Additionally, only a few monogenic resistances are durable and only a few QTL with high effects have been successfully transferred into elite breeding material. Further economic and biological constraints, e.g., a low return of investment in small-grain cereal breeding, lack of diagnostic markers, and the prevalence of QTL–background effects, hinder the broad implementation of MAS. Examples in which MAS has been successfully applied to practical breeding are the wheat rust resistance genes Lr34 and Yr36, the eyespot resistance gene Pch1, the recessive resistance genes rym4/rym5 to barley yellow mosaic viruses, mlo to barley powdery mildew, and two QTL for resistance to Fusarium head blight in wheat (Fhb1 and Qfhs.ifa-5A). Newly identified broad-spectrum resistance genes/QTL conferring resistance to multiple taxa of pathogens offer additional perspectives for MAS. In the future, chip-based, high-throughput genotyping platforms and the introduction of genomic selection will reduce the current problems of integrating MAS in practical breeding programs and open new avenues for a molecular-based resistance breeding.
12
Koudamiloro, Augustin, Francis Eegbara Nwilene, Abou Togola, and Martin Akogbeto. "Insect Vectors of Rice Yellow Mottle Virus." Journal of Insects 2015 (February 2, 2015): 1–12. http://dx.doi.org/10.1155/2015/721751.
Full textAbstract:
Rice yellow mottle virus (RYMV) is the major viral constraint to rice production in Africa. RYMV was first identified in 1966 in Kenya and then later in most African countries where rice is grown. Several studies have been conducted so far on its evolution, pathogenicity, resistance genes, and especially its dissemination by insects. Many of these studies showed that, among RYMV vectors, insects especially leaf-feeders found in rice fields are the major source of virus transmission. Many studies have shown that the virus is vectored by several insect species in a process of a first ingestion of leaf material and subsequent transmission in following feedings. About forty insect species were identified as vectors of RYMV since 1970 up to now. They were essentially the beetles, grasshoppers, and the leafhoppers. For this review, we presented the chronology of their identification. Also, the biology, ecology, host range, distribution, and caused damage of these insects were briefly summarized.
13
Suvi, William Titus, Hussein Shimelis, Mark Laing, Isack Mathew, and Admire I. T. Shayanowako. "Variation among Tanzania Rice Germplasm Collections Based on Agronomic Traits and Resistance to Rice Yellow Mottle Virus." Agronomy 11, no. 2 (February 22, 2021): 391. http://dx.doi.org/10.3390/agronomy11020391.
Full textAbstract:
Rice (Oryza species) is a commercial crop worldwide. Across Africa, the potential yield and quality of rice is diminished by a lack of high performance, locally adapted varieties, and the impact of rice yellow mottle virus (RYMV). The objective of this study was to assess the performance of a diverse collection of rice germplasm for RYMV resistance and agronomic traits, and to select promising lines for breeding for Tanzanian conditions. Fifty-four rice genotypes were field evaluated in two important rice production sites (Ifakara and Mkindo) in Tanzania, which are recognized as RYMV hotspots, using a 6 × 9 alpha lattice design with two replications. There was significant (p < 0.05) genotypic variation for agronomic traits and RYMV susceptibility in the tested germplasm. Seven genotypes with moderate to high RYMV resistance were identified, including Salama M-57, SSD1, IRAT 256, Salama M-55, Mwangaza, Lunyuki, and Salama M-19, which were identified as new sources of resistance genes. Positive and significant correlations were detected between grain yield and number of panicles per plant (NPP), panicle length (PL), number of grains per panicle (NGP), percentage-filled grains (PFG), and thousand-grain weight (TGW), which are useful traits for simultaneous selection for rice yield improvement. A principal component analysis allocated five principal components, accounting for 79.88% of the total variation present in the assessed germplasm collection. Traits that contributed most to variability included NPP, number of tillers/plant (NT), PL, grain yield (GY), and days to 50% flowering (DFL). The genotypes Rangimbili, Gigante, and SARO possess complementary agronomic traits and RYMV resistance, and can be recommended for further evaluation, genetic analysis, and breeding.
14
Fargette, Denis, Agnès Pinel, Zakia Abubakar, Oumar Traoré, Christophe Brugidou, Sorho Fatogoma, Eugénie Hébrard, et al. "Inferring the Evolutionary History of Rice Yellow Mottle Virus from Genomic, Phylogenetic, and Phylogeographic Studies." Journal of Virology 78, no. 7 (April 1, 2004): 3252–61. http://dx.doi.org/10.1128/jvi.78.7.3252-3261.2004.
Full textAbstract:
ABSTRACT Fourteen isolates of Rice yellow mottle virus (RYMV) were selected as representative of the genetic variability of the virus in Africa from a total set of 320 isolates serologically typed or partially sequenced. The 14 isolates were fully sequenced and analyzed together with two previously reported sequences. RYMV had a genomic organization similar to that of Cocksfoot mottle sobemovirus. The average nucleotide diversity among the 16 isolates of RYMV was 7%, and the maximum diversity between any two isolates was 10%. A strong conservative selection was apparent on both synonymous and nonsynonymous substitutions, through the amino acid replacement pattern, on the genome size, and through the limited number of indel events. Furthermore, there was a lack of positive selection on single amino acid sites and no evidence of recombination events. RYMV diversity had a pronounced and characteristic geographic structure. The branching order of the clades correlated with the geographic origin of the isolates along an east-to-west transect across Africa, and there was a marked decrease in nucleotide diversity moving westward across the continent. The insertion-deletion polymorphism was related to virus phylogeny. There was a partial phylogenetic incongruence between the coat protein gene and the rest of the genome. Overall, our results support the hypothesis that RYMV originated in East Africa and then dispersed and differentiated gradually from the east to the west of the continent.
15
Pinel-Galzi, A., D. Fargette, and R. Hull. "First Report of Rice yellow mottle virus in Rice in Uganda." Plant Disease 90, no. 5 (May 2006): 683. http://dx.doi.org/10.1094/pd-90-0683b.
Full textAbstract:
Rice yellow mottle virus (RYMV) of the genus Sobemovirus is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa) is grown (2). During July 2000, plants with leaf yellowing and mottling symptoms were observed in Uganda in a subsistence rice field northeast of Lake Victoria, close to the Nile River. RYMV was detected by using enzyme-linked immunosorbent assay with polyclonal RYMV antisera (1) in the four samples collected. Discriminant monoclonal antibodies revealed that the samples contained RYMV serotype 4, a serotype found in eastern Africa (Madagascar, Kenya, and Tanzania) (2). The 720-nt long coat protein gene of two isolates was amplified by reverse transcriptase-polymerase chain reaction and sequenced (1). The two Ugandan isolates had 99% nt sequence identity (EMBL Accession Nos. AM114523 and AM114524). They belonged to a monophyletic group (97% nt identity) containing isolates from eastern Kenya and northern Tanzania (close to the Lake Victoria). These form a sister group (93% identity) of isolates from Lake Malawi Region in western Tanzania and are more distantly related (88% identity) to the basal strains from eastern Tanzania (2). Isolation of the Lake Victoria Region from the rest of the Tanzania by distance, physical barriers, and patchy rice cultivation explains the specificity of the strain. Year-round growth of wild and cultivated rice around the lake ensures host continuity in time and space that facilitates spread that accounts for the homogeneity of the isolates of this area. Knowledge of the presence of RYMV in Uganda is important since rice cultivation is intensified in this country and is planned in neighboring southern Sudan. References: (1) A. Pinel et al. Arch. Virol. 145:1621, 2000. (2) O. Traoré et al. Mol. Ecol. 14:2097, 2005.
16
Pinto, Yvonne M., Rosan A. Kok, and David C. Baulcombe. "Resistance to rice yellow mottle virus (RYMV) in cultivated African rice varieties containing RYMV transgenes." Nature Biotechnology 17, no. 7 (July 1999): 702–7. http://dx.doi.org/10.1038/10917.
Full text
17
Pellio, Bettina, Stefan Streng, Eva Bauer, Nils Stein, Dragan Perovic, Andrea Schiemann, Wolfgang Friedt, Frank Ordon, and Andreas Graner. "High-resolution mapping of the Rym4/Rym5 locus conferring resistance to the barley yellow mosaic virus complex (BaMMV, BaYMV, BaYMV-2) in barley (Hordeum vulgare ssp. vulgare L.)." Theoretical and Applied Genetics 110, no. 2 (November 18, 2004): 283–93. http://dx.doi.org/10.1007/s00122-004-1832-4.
Full text
18
Abubakar, Zakia, Fadhila Ali, Agnes Pinel, Oumar Traoré, Placide N'Guessan, Jean-Loup Notteghem, Frances Kimmins, Gnissa Konaté, and Denis Fargette. "Phylogeography of Rice yellow mottle virus in Africa." Journal of General Virology 84, no. 3 (March 1, 2003): 733–43. http://dx.doi.org/10.1099/vir.0.18759-0.
Full textAbstract:
The sequences of the coat protein gene of a representative sample of 40 isolates of Rice yellow mottle virus (RYMV) from 11 African countries were analysed. The overall level of nucleotide diversity was high ( ∼14 %). Great geographical distances between the sites where isolates were collected were consistently associated with high genetic distances. In contrast, a wide range of genetic distances occurred among isolates spread over short geographical distances. There was no evidence of long-range dispersal. RYMV diversity in relation to land area was eight times greater in East Africa than in West/Central Africa. West/Central African isolates with up to 9 % divergence belonged to a monophyletic group, whereas the East African isolates with up to 13 % divergence fell into distantly related groups. In East Africa, each Tanzanian strain had a specific and restricted geographical range, whereas West/Central African strains had large and partially overlapping geographical distributions. Overall, our results suggest an earlier RYMV diversification in East Africa and a later radiation in West/Central Africa. The West African situation was consistent with virus adaptation to savanna, forest and other ecological conditions. In contrast East Africa, as exemplified by the Tanzanian situation, with numerous physical barriers (mountain chains, sea channel, lakes), suggested that RYMV strains resulted from divergence under isolated conditions. For RYMV and for two other viruses, phylogenetic relationships were established between isolates from Madagascar and isolates from the Lake Victoria region.
19
Rymenants, Koen. "De Nieuwe Zakelijkheid in de journalistieke kritiek van het interbellum." Internationale Neerlandistiek 59, no. 2 (May 1, 2021): 154–59. http://dx.doi.org/10.5117/in2021.2.007.ryme.
Full text
20
Ménoret, Pascal. "Ryad, le pouvoir de dire non." Les Grands Dossiers des Sciences Humaines N°17, no. 12 (December 1, 2009): 21. http://dx.doi.org/10.3917/gdsh.017.0021.
Full text
21
Hébrard, Eugénie, Agnès Pinel-Galzi, Aderonke Oludare, Nils Poulicard, Jamel Aribi, Sandrine Fabre, Souley Issaka, et al. "Identification of a Hypervirulent Pathotype of Rice yellow mottle virus: A Threat to Genetic Resistance Deployment in West-Central Africa." Phytopathology® 108, no. 2 (February 2018): 299–307. http://dx.doi.org/10.1094/phyto-05-17-0190-r.
Full textAbstract:
Rice yellow mottle virus (RYMV) causes high losses to rice production in Africa. Several sources of varietal high resistance are available but the emergence of virulent pathotypes that are able to overcome one or two resistance alleles can sometimes occur. Both resistance spectra and viral adaptability have to be taken into account to develop sustainable rice breeding strategies against RYMV. In this study, we extended previous resistance spectrum analyses by testing the rymv1-4 and rymv1-5 alleles that are carried by the rice accessions Tog5438 and Tog5674, respectively, against isolates that are representative of RYMV genetic and pathogenic diversity. Our study revealed a hypervirulent pathotype, named thereafter pathotype T′, that is able to overcome all known sources of high resistance. This pathotype, which is spatially localized in West-Central Africa, appears to be more abundant than previously suspected. To better understand the adaptive processes of pathotype T′, molecular determinants of resistance breakdown were identified via Sanger sequencing and validated through directed mutagenesis of an infectious clone. These analyses confirmed the key role of convergent nonsynonymous substitutions in the central part of the viral genome-linked protein to overcome RYMV1-mediated resistance. In addition, deep-sequencing analyses revealed that resistance breakdown does not always coincide with fixed mutations. Actually, virulence mutations that are present in a small proportion of the virus population can be sufficient for resistance breakdown. Considering the spatial distribution of RYMV strains in Africa and their ability to overcome the RYMV resistance genes and alleles, we established a resistance-breaking risk map to optimize strategies for the deployment of sustainable and resistant rice lines in Africa.
22
Longué, D. R. S., A. Galzi-Pinel, S. Semballa, I. Zinga, D. Fargette, and O. Traoré. "First Report of Rice yellow mottle virus in Rice in the Central African Republic." Plant Disease 98, no. 1 (January 2014): 162. http://dx.doi.org/10.1094/pdis-04-13-0418-pdn.
Full textAbstract:
Rice yellow mottle virus (RYMV, genus Sobemovirus) is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa, O. glaberrima) is grown (4). In the Central African Republic, the disease has never been reported in rice fields. In October 2011, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes about 30 km west of Bangui, the capital of the Central African Republic, and in lowland subsistence fields in Bangui outskirts. Disease incidence was estimated at 5 to 10%, causing small patches in the fields. Mechanical inoculation with extracts of symptomatic leaves reproduced the typical yellow mottle symptoms on the susceptible O. sativa cultivar BG90-2 6 to 9 days after inoculation. Symptomatic leaves of 12 cultivated plants collected in seed beds or in fields reacted positively when tested by ELISA with polyclonal antisera raised against a Madagascan isolate of RYMV (1). Discriminating monoclonal antibodies showed that the samples contained RYMV serotype 1, a serotype found in West and Central Africa (1). Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from six samples. The 720-nt RYMV coat protein gene was amplified by reverse transcriptase (RT)-PCR with primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (2). RT-PCR products were directly sequenced and sequences were deposited in GenBank (Accession Nos. KF054740 through KF054745). These six sequences showed over 98% identity with each other, and were found to be closely related to sequences of isolates from Chad and Cameroon in Central Africa (3). Knowledge of the presence of RYMV in the Central African Republic is important since rice cultivation has intensified in this country. In addition, rice is also increasingly considered as one of the main staple crops in the country. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000. (3) O. Traoré et al. Plant Dis. 96:1230, 2001. (4) O. Traoré et al. Virus Res. 141:258, 2009.
23
Fargette, D., A. Pinel, M. Rakotomalala, E. Sangu, O. Traoré, D. Sérémé, F. Sorho, et al. "Rice Yellow Mottle Virus, an RNA Plant Virus, Evolves as Rapidly as Most RNA Animal Viruses." Journal of Virology 82, no. 7 (January 16, 2008): 3584–89. http://dx.doi.org/10.1128/jvi.02506-07.
Full textAbstract:
ABSTRACT The rate of evolution of an RNA plant virus has never been estimated using temporally spaced sequence data, by contrast to the information available on an increasing range of animal viruses. Accordingly, the evolution rate of Rice yellow mottle virus (RYMV) was calculated from sequences of the coat protein gene of isolates collected from rice over a 40-year period in different parts of Africa. The evolution rate of RYMV was estimated by pairwise distance linear regression on five phylogeographically defined groups comprising a total of 135 isolates. It was further assessed from 253 isolates collected all over Africa by Bayesian coalescent methods under strict and relaxed molecular clock models and under constant size and skyline population genetic models. Consistent estimates of the evolution rate between 4 × 10−4 and 8 × 10−4 nucleotides (nt)/site/year were obtained whatever method and model were applied. The synonymous evolution rate was between 8 × 10−4 and 11 × 10−4 nt/site/year. The overall and synonymous evolution rates of RYMV were within the range of the rates of 50 RNA animal viruses, below the average but above the distribution median. Experimentally, in host change studies, substitutions accumulated at an even higher rate. The results show that an RNA plant virus such as RYMV evolves as rapidly as most RNA animal viruses. Knowledge of the molecular clock of plant viruses provides methods for testing a wide range of biological hypotheses.
24
Sedláček, Tibor, and Pavel Mařík. "Haplotype analysis of the SSRs surrounding rym 11 locus in a set of winter barley." Journal of Agrobiology 27, no. 2 (December 1, 2010): 67–72. http://dx.doi.org/10.2478/s10146-009-0010-3.
Full textAbstract:
Haplotype analysis of the SSRs surrounding rym 11 locus in a set of winter barleyBreeding for Barley Mosaic Virus resistance is of great importance because of yield losses and the impossibility of plant protection using chemicals. Successful breeding of long-term resistant varieties requires widening of the genetic base of resistance, preferably by pyramiding of resistance genes. One of the perspective resistance genes is rym 11, resistant to all strains of Barley Mosaic Virus complex, but which is known to be present only in the cultivar Russia 57. In this work, the identification of potential new rym 11 resistance donors on the basis of haplotype analysis of the SSRs surrounding rym 11 locus is presented.
25
Anato, Vital Kouessi Sixte, Yves Agnoun, Joèl Houndjo, Aderonke Oludare, Clement Agbangla, Malachy Akoroda, and Victor O. Adetimirin. "Resistance of Oryza sativa and Oryza glaberrima Genotypes to RBe24 Isolate of Rice Yellow Mottle Virus in Benin and Effects of Silicon on Host Response." Plant Pathology Journal 37, no. 4 (August 1, 2021): 375–88. http://dx.doi.org/10.5423/ppj.oa.09.2020.0180.
Full textAbstract:
Rice yellow mottle virus (RYMV) is the most harmful virus that affects irrigated and lowland rice in Africa. The RBe24 isolate of the virus is the most pathogenic strain in Benin. A total of 79 genotypes including susceptible IR64 (Oryza sativa) and the resistant TOG5681 (O. glaberrima) as checks were screened for their reactions to RBe24 isolate of RYMV and the effects of silicon on the response of host plants to the virus investigated. The experiment was a three-factor factorial consisting of genotypes, inoculation level (inoculated vs. non-inoculated), and silicon dose (0, 5, and 10 g/plant) applied as CaSiO3 with two replications and carried out twice in the screen house. Significant differences were observed among the rice genotypes. Fifteen highly resistant and eight resistant genotypes were identified, and these were mainly O. glaberrima. Silicon application did not affect disease incidence and severity at 21 and 42 days after inoculation (DAI); it, however, significantly increased plant height of inoculated (3.6% for 5 g CaSiO3/plant and 6.3% for 10 g CaSiO3/plant) and non-inoculated (1.9% for 5 g CaSiO3/plant and 4.9% for 10 g CaSiO3/plant) plants at 42 DAI, with a reduction in the number of tillers (12.3% for both 5 and 10 g CaSiO3/plant) and leaves (26.8% for 5 g CaSiO3/plant and 28% for 10 g CaSiO3/plant) under both inoculation treatments. Our results confirm O. glaberrima germplasm as an important source of resistance to RYMV, and critical in developing a comprehensive strategy for the control of RYMV in West Africa.
26
Hubert, J. G., A. Pinel-Galzi, D. Dibwe, E. Cinyabuguma, A. Kaboré, D. Fargette, D. Silué, E. Hébrard, and Y. Séré. "First Report of Rice yellow mottle virus on Rice in the Democratic Republic of Congo." Plant Disease 97, no. 12 (December 2013): 1664. http://dx.doi.org/10.1094/pdis-06-13-0650-pdn.
Full textAbstract:
Rice yellow mottle virus (RYMV), genus Sobemovirus, is a widespread rice pathogen reported in nearly all rice-growing countries of Africa. Although the virus was detected in Cameroon, Chad, Tanzania, Rwanda, Burundi, and Uganda (2,3), RYMV has never been described in the Democratic Republic of Congo (DRC). In July 2012, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes 30 km south of Bukavu, in eastern DRC, and in lowland subsistence fields in the surroundings of Bukavu. Several dozen hectares affected by the disease were abandoned by the farmers. Symptomatic leaf samples were collected in different farmer fields. Back-inoculations to susceptible rice variety IR64 resulted in the same yellowing and mottling symptoms 7 to 9 days post-inoculation. Infected leaves gave positive results using double antibody sandwich (DAS)-ELISA tests with polyclonal antisera (as described in [1]), indicating for the first time the presence of RYMV in DRC. Triple antibody sandwich (TAS)-ELISA tests with discriminant monoclonal antibodies (1) revealed that they all belong to serotype 4 found in the neighboring region in Rwanda. Total RNA of three samples from South Kivu was extracted with the RNeasy Plant Mini kit (Qiagen, Germany). The 720 nucleotide coat protein (CP) gene was amplified by reverse transcription (RT)-PCR with primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (1). The sequences were deposited in GenBank (Accessions KC788208, KC788209, and KC788210). A set of CP sequences of 45 isolates representative of the RYMV diversity in Africa, including the sequences of the DRC samples, were used for phylogenetic reconstruction by maximum-likelihood method. The isolates from South Kivu belonged to strain S4-lv, mainly found around Lake Victoria. Specifically, within the S4-lv strain, the South Kivu isolates clustered with isolates from eastern and southern provinces of Rwanda and Burundi, respectively (2), suggesting a recent spread from these countries. Recently, efforts have been directed to shift from the traditional upland system to lowland and irrigated systems in which water availability allows sequential planting and maintenance of higher crop intensity. This agricultural change may increase insect vectors and alternate host plant populations which may result in higher RYMV incidence in DRC (3). Similar yellowing and mottling symptoms have been observed in Bas-Congo and Equateur provinces of the country, which would justify further surveys and characterisation of RYMV in the DRC. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) I. Ndikumana et al. Plant Dis. 96:1230, 2012. (3) O. Traoré et al. Mol. Ecol. 14:2097, 2005.
27
Bird, Patrick, Jonathan Flannery, Erin Crowley, James Agin, David Goins, and Robert Jechorek. "Evaluation of the 3M™ Petrifilm™ Rapid Yeast and Mold Count Plate for the Enumeration of Yeast and Mold in Food: Collaborative Study, First Action 2014.05." Journal of AOAC INTERNATIONAL 98, no. 3 (May 1, 2015): 767–83. http://dx.doi.org/10.5740/jaoacint.15-006.
Full textAbstract:
Abstract The 3M™ Petrifilm™ Rapid Yeast and Mold (RYM) Count Plate is a simple, ready-to-use chromogenic culture method for the rapid detection and enumeration of yeast and mold in food products. The 3M Petrifilm RYM Count Plate method was compared to the U. S. Food and Drug Administration Bacteriological Analytical Manual (FDA BAM) Chapter 18, Yeasts, Molds and Mycotoxins and the ISO 21527:2008 Microbiology of Food and Animal Feeding Stuffs—Horizontal Method for the Enumeration for Yeast and Molds – Part 1: Colony Count Technique in Products with Water Activity Greater Than 0.95 and Part 2: Colony Count Technique in Products with Water Activity Less Than or Equal to 0.95 reference methods for raw almonds and raw frozen ground beef patties (77% lean). The 3M Petrifilm RYM Count Plate method was evaluated using a paired study design in a multi-laboratory collaborative study following the current AOAC Validation Guidelines. Three target contamination levels (low, 10–100 CFU/g; medium, 100–1000 CFU/g; high 1000–10 000 CFU/g) as well as an uninoculated control level (0 CFU/g) were evaluated for each matrix. Samples evaluated by the 3M Petrifilm RYM Count Plate method were prepared in duplicate and incubated at both 25°C and 28°C. Plates at both temperatures were enumerated after 48 and 60 h of incubation. No significant difference was observed between the 3M Petrifilm RYM Count Plate method and the FDA BAM or ISO 21527 reference methods for each contamination level. No statistical differences were observed between samples analyzed by the 3M Petrifilm RYM Count Plate method (at either 25°C or 28°C) and the reference methods. No statistical significant differences were observed between enumeration of colonies at 48 and 60 h on the 3M Petrifilm RYM Count Plate method and the reference methods.
28
Suranata, Kadek Suranata, Adi Atmoko, and Nur Hidayah. "Validation of Psychological Resilience Youth Developement Module and Implication for Guidance and Counseling." GUIDENA: Jurnal Ilmu Pendidikan, Psikologi, Bimbingan dan Konseling 7, no. 1 (August 31, 2017): 57. http://dx.doi.org/10.24127/gdn.v7i1.648.
Full textAbstract:
This study investigated the validation of the psychological resilience scale adaptation from youth development module (RYDM) for secondary school. The psychological RYDM is measured by six factors psychological assets was strongly associated with students academic success. A sample of study is 158 seventh grade students from five secondary schools in Singaraja, Bali Province (75 or 47.4% male and 83 or 52.6% female, with age range 12-13 years). The constructs validation was conduct by exploratory factor analysis (EFA) method, with SPSS 22.0. Five iterations of the EFA reducing 18 original items to 14 items and 6 original factors to 5 factors. Five factors and 14 items produced are consistent with the conceptual basis used in the original RYDM. The stability of new five factors is formed by a split sample analysis method showed the all of the items of factors identified in the earlier testing stable adequacy of forming a common factor in this analysis in the first and second iteration. The results of analysis the item-total correlation on 14 item (n = 158) showed Cronbach's Alpha value of 0.777. Implications the study for guidance and counseling practice in schools is discussed.
29
Orjuela, Julie, E. F. Thiémélé Deless, Olufisayo Kolade, Sophie Chéron, Alain Ghesquière, and Laurence Albar. "A Recessive Resistance to Rice yellow mottle virus Is Associated with a Rice Homolog of the CPR5 Gene, a Regulator of Active Defense Mechanisms." Molecular Plant-Microbe Interactions® 26, no. 12 (December 2013): 1455–63. http://dx.doi.org/10.1094/mpmi-05-13-0127-r.
Full textAbstract:
RYMV2 is a major recessive resistance gene identified in cultivated African rice (Oryza glaberrima) which confers high resistance to the Rice yellow mottle virus (RYMV). We mapped RYMV2 in an approximately 30-kb interval in which four genes have been annotated. Sequencing of the candidate region in the resistant Tog7291 accession revealed a single mutation affecting a predicted gene, as compared with the RYMV-susceptible O. glaberrima CG14 reference sequence. This mutation was found to be a one-base deletion leading to a truncated and probably nonfunctional protein. It affected a gene homologous to the Arabidopsis thaliana CPR5 gene, known to be a defense mechanism regulator. Only seven O. glaberrima accessions showing this deletion were identified in a collection consisting of 417 accessions from three rice species. All seven accessions were resistant to RYMV, which is an additional argument in favor of the involvement of the deletion in resistance. In addition, fine mapping of a resistance quantitative trait locus in O. sativa advanced backcrossed lines pinpointed a 151-kb interval containing RYMV2, suggesting that allelic variants of the same gene may control both high and partial resistance.
30
Wójcik-Dudek, Małgorzata. "Edukacja/Migracja, czyli zamierzony rym." Postscriptum Polonistyczne 2, no. 22 (2018): 255–64. http://dx.doi.org/10.31261/ps_p.2018.22.16.
Full text
31
Quak, Arend. "Ortnamn på-ryd i Småland." AMSTERDAMER BEITRÄGE ZUR ÄLTEREN GERMANISTIK 37, no. 1 (November 17, 1993): 233–34. http://dx.doi.org/10.1163/18756719-037-01-90000028.
Full text
32
N'Guessan, P., A. Pinel, A. A. Sy, A. Ghesquière, and D. Fargette. "Distribution, Pathogenicity, and Interactions of Two Strains of Rice yellow mottle virus in Forested and Savanna Zones of West Africa." Plant Disease 85, no. 1 (January 2001): 59–64. http://dx.doi.org/10.1094/pdis.2001.85.1.59.
Full textAbstract:
In Côte d'Ivoire, the S2 strain of Rice yellow mottle virus (RYMV) predominated in the forested zones, including the “rice belt” to the west, in each of the cropping systems where rice was grown. The S1 strain occurred more frequently in the northern Guinean savanna, and only S1 isolates were found further north in the Sahelo-Soudanian zones. In mixed infection, S2 dominated over S1 both in viral capsid and RNA contents under temperature regimes encompassing those observed in savanna and forested zones of Côte d'Ivoire. There was no evidence of interactions in virus accumulation between the West African strains S1 or S2 with the more distantly related East African strain S4. Field trials emphasized the impact of RYMV, which induced yield losses of 40 to 60% in several widely grown cultivars of Oryza sativa indica and O. sativa japonica. We report the high resistance of the O. indica cv. Gigante under field conditions which was apparent with all the S1 and S2 isolates tested. Responses to RYMV infection of several cultivars were isolate dependent. With most differential cultivars, responses were not strain specific, with the exception of the O. japonica cv. Idsa6, in which the S2 isolates always induced higher yield losses than the S1 isolates.
33
Sarra, Soungalo, and Dick Peters. "Rice yellow mottle virus Is Transmitted by Cows, Donkeys, and Grass Rats in Irrigated Rice Crops." Plant Disease 87, no. 7 (July 2003): 804–8. http://dx.doi.org/10.1094/pdis.2003.87.7.804.
Full textAbstract:
Rice yellow mottle virus (RYMV), endemic in Africa, is believed to be spread by chrysomelid beetles, although the infections in a field often cannot be explained by the prevailing number of beetles. We show that the grass rat Arvicanthis niloticus, domestic cows (Bos spp.), and donkeys (Asinus spp.) are potent and efficient transmitters of RYMV. Spread of RYMV by rats was demonstrated in cage experiments wherein individual rats transmitted the virus from healthy to infected rice plants and confirmed in a field experiment. Experiments with cows and donkeys showed that they could transmit the virus in plots with healthy and infected plants and to plots with healthy plants. A high percentage of seedlings became infected when a cow grazed in a seedbed after being fed with infected rice plants. Transmission also was observed when cows were allowed to graze on the stubble of infected fields. The disease incidence increased at least fourfold over time to approximately 36% of the plants infected in the experimental plots of two stubble fields. The results obtained in these stubble fields suggest that cattle-mediated spread will enhance the size of the virus load in the contraseason and the infection potential to infect the next crop.
34
Jones, Roger A. C. "Virus diseases of pasture grasses in Australia: incidences, losses, epidemiology, and management." Crop and Pasture Science 64, no. 3 (2013): 216. http://dx.doi.org/10.1071/cp13134.
Full textAbstract:
This paper reviews current knowledge for Australia over the occurrence, losses caused, epidemiology, and management of virus diseases of pasture grasses. It also reviews all records of viruses in wild grasses likely to act as alternative host reservoirs for virus spread to nearby pastures or crops. Currently, 21 viruses have been found infecting 36 pasture or forage grass species and 59 wild grass species. These viruses are transmitted by arthropod vectors (mites or insects) or, in one instance, via grass seeds. Their modes of transmission are critical factors determining their incidences within pastures in different climatic zones. Large-scale surveys of perennial grass pastures growing in regions with temperate–Mediterranean climates revealed that Barley yellow dwarf virus (BYDV), Cereal yellow dwarf virus (CYDV), and Ryegrass mosaic virus (RyMV) sometimes reach high infection incidences. The same was true for BYDV and CYDV when perennial pasture grasses and wild grasses growing outside pastures were surveyed to establish their occurrence. Smaller scale surveys of grasses growing both inside and outside annual pastures found that Wheat streak mosaic virus (WSMV) infection could also reach high incidences in some annual grass species. Herbage yield loss data are available demonstrating potentially serious impacts on pasture production under Australian conditions from BYDV infection in perennial ryegrass swards, and from RyMV infection in both perennial and Italian ryegrass swards. Also, infection with BYDV or RyMV diminished the ability of infected pasture grass plants to compete with pasture legumes or weeds. Host resistance to BYDV, CYDV, and/or RyMV has been identified within a few temperate–Mediterranean pasture grasses, and is available for use in Australian pasture breeding programs. Integrated Disease Management tactics involving phytosanitary, cultural, chemical, and host resistance measures were devised against BYDV, CYDV, and RyMV infection in mixed species pasture, but no field experiments were undertaken with pasture grasses to validate their inclusion. Several other grass viruses that occur in other countries, but have not been looked for in Australia, are potentially important, especially in temperate–Mediterranean pasture grass species. With few exceptions, research on viruses of perennial or annual tropical–subtropical pasture or wild grass species growing within or outside pastures has focussed only on virus identification and characterisation studies, and information on incidences in pastures, losses caused, epidemiology, and management is lacking. Critical research and development gaps that need addressing are identified.
35
Ndikumana, I., A. Pinel-Galzi, Z. Negussie, S. N'chimbi Msolla, P. Njau, R. K. Singh, I. R. Choi, J. Bigirimana, D. Fargette, and E. Hébrard. "First Report of Rice yellow mottle virus on Rice in Burundi." Plant Disease 96, no. 8 (August 2012): 1230. http://dx.doi.org/10.1094/pdis-03-12-0293-pdn.
Full textAbstract:
Since the mid-1980s, rice cultivation has expanded rapidly in Burundi to reach approximately 50,000 ha in 2011. In 2007, leaf mottling, reduced tillering, and stunting symptoms were observed on rice at Gatumba near Bujumbura, causing small patches in less than 10% of the fields. Rice yellow mottle virus (RYMV, genus Sobemovirus), which has seriously threatened rice cultivation in Africa (1) and was recently described in the neighboring Rwanda (3), was suspected to be involved because of similar symptoms. To identify the pathogen that caused the disease in Burundi, a survey was performed in the major rice-producing regions of Burundi and Rwanda. Six locations in Burundi and four in Rwanda were investigated in April and October 2011. Disease incidence in the fields was estimated to be 15 ± 5%. Symptomatic leaves of 24 cultivated rice plants were collected and tested by double antibody sandwich-ELISA with polyclonal antibodies raised against the RYMV isolate Mg1 (2). All tested samples reacted positively. Four isolates were inoculated on susceptible Oryza sativa cultivar IR64 (2). The typical symptoms of RYMV were reproduced 7 days after inoculation, whereas the noninoculated controls remained healthy. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from 12 samples. The RYMV coat protein gene was amplified by RT-PCR with primers 5′CGCTCAACATCCTTTTCAGGGTAG3′ and 5′CAAAGATGGCCAGGAA3′ (3). The sequences were deposited in GenBank (Accession Nos. HE654712 to HE654723). To characterize the isolates, the sequences of the tested samples were compared in a phylogenic tree including a set of 45 sequences of isolates from Rwanda, Uganda, western Kenya, and northern Tanzania (2,3). Six isolates from western Burundi, namely Bu1, Bu2, Bu4, Bu7, Bu10, and Bu13 (Accession Nos. HE654712 to HE654716 and HE654718), and the isolate Rw208 (HE654720) from southwestern Rwanda, belonged to strain S4-lm previously reported near Lakes Malawi and Tanganyika. They fell within the group gathering isolates from the western Bugarama plain of Rwanda (3). The isolates Bu16 (HE654719) and Bu17 (HE654717) from Mishiha in eastern Burundi belonged to strain S4-lv previously reported around Lake Victoria. However, they did not cluster with isolates from the eastern and southern provinces of Rwanda. They were genetically more closely related to isolates of strain S4-lv from northern Tanzania. Overall, the phylogeography of RYMV in Burundi and Rwanda region was similar. In the western plain of the two countries, the isolates belonged to the S4-lm lineage, whereas at the east of the two countries at midland altitude, they belonged to the S4-lv lineage. The presence of RYMV in Burundi should be considered in the future integrative pest management strategies for rice cultivation in the country. References: (1) D. Fargette et al. Annu. Rev. Phytopathol. 44:235, 2006. (2) Z. L. Kanyeka et al. Afr. Crop Sci. J. 15:201, 2007. (3) I. Ndikumana et al. New Dis. Rep. 23:18, 2011.
36
Hébrard, Eugénie, Nils Poulicard, Clément Gérard, Oumar Traoré, Hui-Chen Wu, Laurence Albar, Denis Fargette, Yannick Bessin, and Florence Vignols. "Direct Interaction Between the Rice yellow mottle virus (RYMV) VPg and the Central Domain of the Rice eIF(iso)4G1 Factor Correlates with Rice Susceptibility and RYMV Virulence." Molecular Plant-Microbe Interactions® 23, no. 11 (November 2010): 1506–13. http://dx.doi.org/10.1094/mpmi-03-10-0073.
Full textAbstract:
The adaptation of Rice yellow mottle virus (RYMV) to recessive resistance mediated by the rymv1-2 allele has been reported as a model to study the emergence and evolution of virulent variants. The resistance and virulence factors have been identified as eukaryotic translation initiation factor eIF(iso)4G1 and viral genome–linked protein (VPg), respectively, but the molecular mechanisms involved in their interaction are still unknown. In this study, we demonstrated a direct interaction between RYMV VPg and the central domain of rice eIF(iso)4G1 both in vitro, using recombinant proteins, and in vivo, using a yeast two-hybrid assay. Insertion of the E309K mutation in eIF(iso)4G1, conferring resistance in planta, strongly diminished the interaction with avirulent VPg. The efficiency of the major virulence mutations at restoring the interaction with the resistance protein was assessed. Our results explain the prevalence of virulence mutations fixed during experimental evolution studies and are consistent with the respective viral RNA accumulation levels of avirulent and virulent isolates. Our results also explain the origin of the residual multiplication of wild-type isolates in rymv1-2–resistant plants and the role of genetic context in the poor adaptability of the S2/S3 strain. Finally, the strategies of RYMV and members of family Potyviridae to overcome recessive resistance were compared.
37
Rakotomalala, M. R., B. B. Abera, A. Pinel-Galzi, J. Rakotoarisoa, D. Alemu, and D. Fargette. "First Report of Rice yellow mottle virus in Rice in Federal Democratic Republic of Ethiopia." Plant Disease 98, no. 10 (October 2014): 1449. http://dx.doi.org/10.1094/pdis-05-14-0531-pdn.
Full textAbstract:
Rice yellow mottle virus (RYMV, genus Sobemovirus) is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa, O. glaberrima) is grown (5). In the Federal Democratic Republic of Ethiopia, however, the disease has never been reported in rice fields. In September 2012, plants with leaf yellowing and mottling symptoms were observed near Bahir Dar and in the Fogera district in the northwestern part of the country during a joint survey of scientists from Madagascar (FOFIFA), Ethiopian Institute of Agricultural Research (EIAR), and Japan International Cooperation Agency (JICA). The disease was observed in 2013 in Fogera and Dera districts, where samples were collected, causing small patches of infected plants in ~5% of the fields. Symptomatic leaves of two plants collected in the fields were inoculated on five plants of the susceptible O. sativa cultivar IR64. All inoculated plants reproduced the typical yellow mottle symptoms. Symptomatic leaves of eight plants collected in the fields reacted positively when tested by double antibody sandwich (DAS)-ELISA tests with a polyclonal antiserum raised against a Madagascan isolate of RYMV (2), indicating for the first time the presence of the virus in Ethiopia. Triple antibody sandwich (TAS) tests with discriminant monoclonal antibodies (2) revealed that they all belonged to serotype 4, a serotype found in East Africa and in Madagascar. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from four samples. The 720-bp coat protein (CP) gene was amplified with reverse transcription (RT)-PCR with the primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (3). The sequences were deposited in GenBank (Accession Nos. KMO17554, KMO14555, KMO17556, and KMO17557). The four sequences showed over 98% nucleotide identity between each other. They shared over 92% nucleotide identity with isolates of strains S4 found in Kenya, Uganda, Tanzania, and Madagascar (4). Agricultural changes associated to rice intensification are known to favor RYMV emergence and spread (5). Recent efforts have been led by the National Rice Research and Development Strategy (NRRDSE) to intensify rice cultivation in Ethiopia (1). Early knowledge of RYMV occurrence in the country is a prerequisite to extended surveys of the disease and implementation of control measures. References: (1) K. Assefa et al. Challenges and opportunities of rice in Ethiopian agricultural development. www.eiar.gov.et/Publications/frgseries2.pdf , 2011. (2) D. Fargette et al. Arch. Virol. 147:583, 2002. (3) A. Pinel et al. Arch. Virol. 145:1621, 2000. (4) M. Rakotomalala et al. Virus Res. 171:71, 2013. (5) O. Traoré et al. Virus Res. 141:258, 2009.
38
Durant, Joël M., Sylvie Massemin, and Yves Handrich. "More Eggs the Better: Egg Formation in Captive Barn Owls (Tyto Alba)." Auk 121, no. 1 (January 1, 2004): 103–9. http://dx.doi.org/10.1093/auk/121.1.103.
Full textAbstract:
Abstract We studied rapid yolk deposition (RYD) in Barn Owls (Tyto alba) on the basis of the analysis of 26 eggs laid by “dye-dosed” captive female Barn Owls in five different broods. Pictures of yolks were examined to assess daily rates of yolk deposition. We used those data in combination with data from the dissection of ovaries of another five breeding females. We found that the total duration between initiation of RYD and laying of the corresponding egg was only 13.6 days, with an interval between yolk completion and oviposition of 2.4 days. The total number of follicles that may have given eggs was found to be 25. That high number of follicles and the short RYD period explain the particularly high reproductive potential of this nocturnal raptor species.
39
Pellio, Bettina, W. Friedt, A. Graner, and F. Ordon. "Development of Pcr-based markers closely linked to rym5." Journal of Plant Diseases and Protection 111, no. 1 (February 2004): 30–38. http://dx.doi.org/10.1007/bf03356130.
Full text
40
Salaudeen, M. T. "Relative resistance to Rice yellow mottle virus in rice ." Plant Protection Science 50, No. 1 (January 27, 2014): 1–8. http://dx.doi.org/10.17221/61/2012-pps.
Full textAbstract:
We identified sources of Rice yellow mottle virus (RYMV) resistance in rice cultivars. Eight cultivars together with susceptible and resistant controls were evaluated under screenhouse conditions as inoculated and uninoculated treatment in completely randomised design with three replications. Seedlings were inoculated with the virus by sap transmission at two weeks after sowing. Disease incidence and severity (scale 1–9: 1–3 = green leaves with sparse dots or streaks, 9 = yellow or orange leaves and some plant dead), yield, and agronomic traits were recorded. Data analyses included Area Under the Disease Progress Curve (AUDPC), independent t-test, and Analysis of Variance. According to differences in most measured traits control cultivars FARO 29 and Gigante were proved to be the most susceptible and partially tolerant ones, respectively. Cvs FARO 12, FARO 17, FARO 37, and FARO 52 were classified as partially tolerant. Uninoculated control plants performed better than the inoculated for all the yield and agronomic parameters. Reduction in plant height (6%) and number of tillers per plant (4.8%), increased days to heading (3 days), and reduction in paddy yield (6.5%) was lowest in cv. Gigante. Paddy yield per plant of the RYMV-inoculated was the highest in cv. Gigante (2.4 g). The rice cultivars which combined RYMV-resistance with high-yield could be utilised in rice breeding programmes in order to enhance food security.
41
WATTAM, Beth, Dazhuang SHANG, Salman RAHMAN, Sofia EGGLEZOU, Mike SCULLY, Vijay KAKKAR, and Xinjie LU. "Arg-Tyr-Asp (RYD) and Arg-Cys-Asp (RCD) motifs in dendroaspin promote selective inhibition of β1 and β3 integrins." Biochemical Journal 356, no. 1 (May 8, 2001): 11–17. http://dx.doi.org/10.1042/bj3560011.
Full textAbstract:
Arg-Gly-Asp (RGD) is a unique minimal integrin-binding sequence that is found within several glycoprotein ligands. This sequence has also been found in snake-venom anti-platelet proteins, including the disintegrins and dendroaspin, a natural variant of short-chain neurotoxins isolated from the venom of Dendroaspis jamesonii. In the present study, the motifs RYD and RCD were introduced into the dendroaspin scaffold to replace RGD. Both motifs in dendroaspin caused inhibition of ADP-induced platelet aggregation with IC50 values of 200 and 300nM respectively, similar to that of the wild-type RGD motif (170nM). In comparison with wild-type dendroaspin, both RYD- and RCD-containing dendroaspins were more selective in the inhibition of the adhesion of K562 cells to laminin rather than to fibrinogen and fibronectin, even though they were 10–30-fold less potent at inhibiting K562 cell (containing α5β1 integrin) adhesion to laminin compared with wild-type. Interestingly, the RYD motif produced a similar IC50 value to the RGD motif at inhibiting A375-SM cell (β3 integrin) adhesion to collagen, whereas the RCD motif was approx. 2–6-fold less potent compared with either RGD or RYD. These findings show that the selectivity of dendroaspin binding to β1 and β3 integrins can be modulated by the introduction of alternative cell recognition sequences.
42
Sérémé, Drissa, Séverine Lacombe, Moumouni Konaté, Martine Bangratz, Agnès Pinel-Galzi, Denis Fargette, Alfred S. Traoré, Gnissa Konaté, and Christophe Brugidou. "Sites under positive selection modulate the RNA silencing suppressor activity of rice yellow mottle virus movement protein P1." Journal of General Virology 95, no. 1 (January 1, 2014): 213–18. http://dx.doi.org/10.1099/vir.0.057026-0.
Full textAbstract:
RNA silencing is a eukaryotic mechanism for RNA-based gene regulation that plays an essential role in diverse biological processes, such as defence against viral infections. The P1 of rice yellow mottle virus (RYMV) is a movement protein and displays RNA silencing suppression activity with variable efficiency, depending on the origin of the isolates. In this study, the positive selection pressure acting on the P1 protein gene was assessed. A site-by-site analysis of the d N/d S ratio was performed and 18 positively selected sites were identified. Four of these were mutated, and the ability to suppress RNA silencing was evaluated for the resulting mutants in a transient expression assay. All mutations affected quantitatively RNA silencing suppression, one caused a significant decrease in the activity and three significantly increased it. This work demonstrates, for what is to the best of our knowledge the first time, that the RYMV gene encoding the P1 RNA silencing suppressor is under adaptive evolution.
43
Kühne, Thomas, Nongnong Shi, Gerhard Proeseler, Michael J. Adams, and Konstantin Kanyuka. "The ability of a bymovirus to overcome the rym4-mediated resistance in barley correlates with a codon change in the VPg coding region on RNA1." Journal of General Virology 84, no. 10 (October 1, 2003): 2853–59. http://dx.doi.org/10.1099/vir.0.19347-0.
Full textAbstract:
The genome difference(s) that enable the European pathotype 2 isolates of Barley yellow mosaic virus (BaYMV-2) to infect barley genotypes with the rym4 resistance gene were investigated. Stable deletions of different sizes occurred in RNA2 of laboratory isolates of the common pathotype (BaYMV-1) and BaYMV-2. After mechanical inoculation of susceptible or rym4 genotypes with a mixture of both isolates, immunocapture-RT-PCR with RNA2-specific primers flanking stable deletion regions was used to detect and distinguish the two pathotypes. Individual leaves contained RNA2 of either or both isolates, showing that RNA2 of BaYMV-1 can replicate and move systemically in rym4 plants when co-inoculated with BaYMV-2. In contrast, sequences of RNA1-specific RT-PCR fragments showed that in resistant plants these were always BaYMV-2, suggesting that the pathogenicity determinant was on RNA1. The complete ORFs of RNA1 of three BaYMV-1 and four BaYMV-2 isolates from the UK and Germany were sequenced, and the RNA2 sequences of one BaYMV-1 and two BaYMV-2 isolates from the UK were also determined. All sequences were very similar to one another and to the published German BaYMV-1 isolate. The only consistent amino acid difference between the BaYMV-1 and BaYMV-2 isolates was in the RNA1-encoded polyproteins and this was confirmed by sequencing the relevant region of eight further German isolates. All BaYMV-1 isolates had lysine at aa 1307, whereas BaYMV-2 isolates had asparagine (or, in one isolate, histidine). The polymorphism occurred in the central region of VPg, which has been shown to be required for pathogenicity on genotypes carrying recessive resistance genes in several potyvirus/dicotyledonous plant pathosystems.
44
Lubbe, H. J. "KLEM IN AFRIKAANS EN DIE SUPERSWAAR RYM." South African Journal of Linguistics 11, sup18 (November 1993): 78–99. http://dx.doi.org/10.1080/10118063.1993.9724491.
Full text
45
ÖZCAN GÖNÜLAL, Yasemin. "A Language Analysis of Yunus Emre’s “Kayusu Değül” Rymed Poem." Journal of Turkish Studies Volume 6 Issue 4, no. 6 (2011): 183–90. http://dx.doi.org/10.7827/turkishstudies.2767.
Full text
46
Берковець, Віра. "ГОЛОС У РИТОРИЦІ: СЕГМЕНТНІ Й НАДСЕГМЕНТНІ ЗАСОБИ ФОНЕТИЧНОЇ ВИРАЗНОСТІ ТЕКСТУ." Studia Ukrainica Posnaniensia 5 (March 15, 2017): 19–27. http://dx.doi.org/10.14746/sup.2017.5.02.
Full textAbstract:
Artykuł poświęcony jest wskazaniu roli cech głosowych mówienia w dyskursie retorycznym. Rozpatrzono cechy charakterystyczne fonetycznej realizacji wypowiedzi ustnej na różnych etapach jej przygotowania i wygłoszenia z uwzględnieniem wymogów odnośnie do oddechu i artykulacji, normatywności wymowy, stosowania powtórzeń dźwiękowych, onomatopei, rymu, a także ekspresywnego potencjału różnych rodzajów akcentów i komponentów intonacji.
47
Astheimer, Lee B. "Egg Formation in Cassin's Auklet." Auk 103, no. 4 (October 1, 1986): 682–93. http://dx.doi.org/10.1093/auk/103.4.682.
Full textAbstract:
Abstract Female Cassin's Auklets (Ptychoramphus aleuticus) were given oral doses of lipophilic and proteophilic dyes during their prelaying period. Yolk ring structure in freshly laid eggs was analyzed to determine the timing of yolk deposition using the dye-stained layer as a date marker within the yolk. Additional information from necropsies of five females killed at specific intervals during the formation of a replacement egg indicated that only a single follicle enlarges in the ovary during a reproductive event and this yolk requires about 8 days to complete rapid yolk deposition (RYD). Once RYD is completed, the egg is not laid for a period of 4.2 ± 1.0 days, an interval termed the lag period (Astheimer et al. 1979). Albumen synthesis appears to begin at, or just before, completion of the yolk and continues until approximately 1 day before oviposition. During this time, however, the yolk remains in the follicle. Replacement eggs are laid 14.5 ± 1.7 days following egg removal or natural loss. Combining the above information with egg composition data, the daily deposition of lipid and protein from the female into the egg was computed. Evidence from the size distribution of small (<5 mm) primordial follicles suggests that the auklet ovary undergoes a cycle of follicular growth and atresia before a single follicle is selected for RYD. Based on these findings, and the correlation between initiation of spring egg laying and decreased sea surface temperatures for Farallon Island auklets, I suggest that the onset of RYD is modulated by environmental conditions.
48
Adur-Okello, Stella E., Simon Alibu, Jimmy Lamo, Moses Ekobu, and Michael H. Otim. "Farmers’ Knowledge and Management of Rice Diseases in Uganda." Journal of Agricultural Science 12, no. 12 (November 15, 2020): 221. http://dx.doi.org/10.5539/jas.v12n12p221.
Full textAbstract:
Rice in the recent past has picked up as a food security and income generating crop among farming households in Uganda. Even though, the crop is playing a significant role in reducing food insecurity and poverty within the country, its productivity has remained constant and low at about 1.5 metric tonnes per hectare. Using cross-sectional data collected from rice farmers in Northern (Lira, Dokolo, Otuke and Alebtong Districts); Eastern (Iganga, Bugiri and Kamuli Districts) and Central (Kayunga District) regions of the country, this paper establishes farmers’ knowledge and management of rice diseases from a total of 224 farmers, as a baseline for research initiatives focusing on improving rice productivity within the country. Farmers ranked diseases as the second most important constraint in rice production, after insect pests. Moreover, farmers ranked rice yellow mottle virus (RYMV) as the most important disease in rice production, followed by leaf blast (LB), brown spot (BS), sheath rot (ShR), panicle blast (PB) and bacterial leaf blight (BLB). However, 60% of farmers identified RYMV while less than 30% could clearly diagnose the symptoms of each of the other diseases. Surprisingly, only about 18% of farmers employed management options against RYMV, whereas less than 6% practiced some form of management for each of the other major diseases. The predominant disease control measure was uprooting diseased plants followed by insecticide application. About 10% of farmers reported sedges (Cyperus spp.), goat weed (Ageratum conyzoides), black jack (Bidens pilosa), and cut grass (Leersia spp.) as alternative host plants for rice diseases. An integrated disease management approach, whose development and implementation recognizes farmers as the key players in the rice production chain, is required to achieve improved and sustainable rice productivity.
49
Traoré, Oumar, Agnès Pinel, Eugénie Hébrard, Mawena Y. Dieudonné Gumedzoé, Denis Fargette, Alfred S. Traoré, and Gnissa Konaté. "Occurrence of Resistance-Breaking Isolates of Rice yellow mottle virus in West and Central Africa." Plant Disease 90, no. 3 (March 2006): 259–63. http://dx.doi.org/10.1094/pd-90-0259.
Full textAbstract:
Rice yellow mottle virus (RYMV) is the most important rice-infecting virus in Africa. Highly resistant rice (Oryza spp.) cultivars Gigante and Tog5681 were challenged with virus isolates from five countries of the west and central African Sudano-savannah zone in order to investigate the occurrence and prevalence of resistance-breaking (RB) isolates. High resistance was overcome by 38.6% of the isolates. RB isolates could be divided into three main pathogenic groups. Isolates of the first group (17.5%) and of the second group (16.4%) were able to break down the resistance of Gigante only and of Tog5681 only, respectively. Resistance in both cultivars was overcome simultaneously by isolates of the third group (4.7%). In each group, some isolates induced symptoms, whereas plant infection by others was evidenced only by serological tests. RB isolates occurred in all five countries with varying frequencies (19 to 57%). The wide geographical distribution and high frequencies of RB isolates represent a high risk for the durability of resistance to RYMV in the Sudano-savannah zone.
50
Carpenter, Bogdana, and Stanisɫaw Barańczak. "Widokówka z tego świata i inne rymy z lat 1986-1988." World Literature Today 64, no. 2 (1990): 329. http://dx.doi.org/10.2307/40146531.
Full text