Log in

Relevant bibliographies by topics / Sahel (Tunisie) / Journal articles

To see the other types of publications on this topic, follow the link: Sahel (Tunisie).

Journal articles on the topic 'Sahel (Tunisie)'

Author: Grafiati

Published: 4 June 2021

Last updated: 11 February 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic 'Sahel (Tunisie).'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Brahim, Fawzi. "Évolution de la paléolagune-sebkha d’Ennjila et de ses environs (Sahel tunisien – Tunisie orientale)." Méditerranée, no. 125 (November 1, 2015): 51–62. http://dx.doi.org/10.4000/mediterranee.7928.

Full text

APA, Harvard, Vancouver, ISO, and other styles

2

Ghram, Abdeljelil, A. Chabchoub, M. Boussetta, S. Baazaoui, H. Ibn Amor, and F. Landolsi. "Enquête séroépidémiologique de la rhinopneumonie des équidés en Tunisie." Revue d’élevage et de médecine vétérinaire des pays tropicaux 50, no. 4 (April 1, 1997): 273–76. http://dx.doi.org/10.19182/remvt.9555.

Full text

Abstract:

Une enquête séroépidémiologique, réalisée sur 789 équidés (400 élevés au Nord-Est de la Tunisie, 389 dans la région du Sahel et du Centre), a permis de détecter, par le test de fixation du complément, des anticorps spécifiques contre le virus de la rhinopneumonie équine. Les résultats ont montré que 15 équidés (1,9 %) étaient séropositifs, avec des taux variables d'anticorps fixant le complément. Ces résultats sont discutés en relation avec ceux obtenus par d'autres auteurs en Tunisie et dans les pays voisins.

APA, Harvard, Vancouver, ISO, and other styles

3

Trabelsi, Rouaida, Moncef Zaïri, Habib Smida, and Hamed Ben Dhia. "Salinisation des nappes côtières : cas de la nappe nord du Sahel de Sfax, Tunisie." Comptes Rendus Geoscience 337, no. 5 (April 2005): 515–24. http://dx.doi.org/10.1016/j.crte.2005.01.010.

Full text

APA, Harvard, Vancouver, ISO, and other styles

4

Smati, Nozha. "Patrimoine culinaire en Tunisie. Le festival de la Bsissa dans le sahel tunisien, entre valorisation du patrimoine et risque de folklorisation." Horizons Maghrébins - Le droit à la mémoire 55, no. 1 (2006): 114–20. http://dx.doi.org/10.3406/horma.2006.2382.

Full text

APA, Harvard, Vancouver, ISO, and other styles

5

Haddad, Samia, and Najeh Melliti. "Rôle des structures d’accompagnement dans la création des entreprises innovantes en Tunisie. Cas des pépinières de la région du Sahel Tunisien." Marché et organisations 33, no. 3 (2018): 79. http://dx.doi.org/10.3917/maorg.033.0079.

Full text

APA, Harvard, Vancouver, ISO, and other styles

6

Chulli, B., J. Makni, M. Bedir, and H. Ben Dhia. "Une approche multidisciplinaire pour la prospection des bassins hydrogéothermiques: cas du Sahel de Sfax (Tunisie orientale)." Hydrological Sciences Journal 56, no. 3 (April 26, 2011): 507–20. http://dx.doi.org/10.1080/02626667.2011.563057.

Full text

APA, Harvard, Vancouver, ISO, and other styles

7

Chouari, Walid. "Pluviométries exceptionnelles et occupation des sols mal maîtrisée : l'exemple d'inondations des 23 et 29 septembre 2016 dans le Sahel de Sousse (Tunisie centre-orientale)." La Houille Blanche, no. 1 (February 2020): 50–59. http://dx.doi.org/10.1051/lhb/2019062.

Full text

Abstract:

Le 23 et le 29 septembre 2016, des phénomènes de « Retour d'Est », ont provoqué dans la région du Sahel de Sousse en Tunisie des pluies diluviennes, des crues, des inondations et des conséquences socio-économiques et environnementales significatives. Les dégâts dramatiques enregistrés sont déterminés par l'importance des précipitations, par la concentration des eaux et par la configuration des bassins versants, et sont aggravés par un abandon des aménagements hydro-agricoles traditionnels du type « Meskat-Mankâa », en particulier dans les zones périurbaines. Aujourd'hui, les milieux urbain et périurbain sont devenus vulnérables aux manifestations pluviométriques normales et plus encore aux fortes pluies. Dans cet article, nous montrons en particulier que l'urbanisation modifie les composantes des écoulements en accroissant le ruissellement de surface et nous testons l'hypothèse que les dommages liés aux inondations sont plus attachés aux défaillances dans l'aménagement urbain qu'aux quantités et intensités pluviométriques.

APA, Harvard, Vancouver, ISO, and other styles

8

Bedir, M. "Contrôle tectonique et images sismiques de méga-structures syn-sédimentaires miocènes dans le Sahel de Mahdia — Tunisie orientale." Journal of African Earth Sciences (and the Middle East) 9, no. 3-4 (January 1989): 657–63. http://dx.doi.org/10.1016/0899-5362(89)90050-x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

9

Gabtni, Hakim. "Apport de la gravimétrie à l'étude des structures profondes du Sahel de Tunisie (cas de la région de Kairouan–Sousse–Monastir)." Comptes Rendus Geoscience 337, no. 16 (December 2005): 1409–14. http://dx.doi.org/10.1016/j.crte.2005.09.007.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

Trabelsi, Nadia, Imen Hentati, Ibtissem Triki, and Moncef Zairi. "Étude de la vulnérabilité à la pollution du système phréatique du sahel de Sfax par les outils SIG." Revue Internationale de Géomatique 29, no. 3-4 (July 2019): 317–38. http://dx.doi.org/10.3166/rig.2019.00087.

Full text

Abstract:

Le système phréatique du sahel de Sfax (Tunisie) constitue une source importante d’approvisionnement. Ces eaux ne cessent d’être menacées par la pollution nitrique. Dans le but de protéger cet aquifère, une étude de la vulnérabilité intrinsèque a été effectuée. Pour cela on a eu recours à l’utilisation de la méthode SI (Susceptibility Index) qui prend en considération les différents critères de vulnérabilités, régissant le processus de transfert de contaminants. Il s’agit des facteurs géologiques, hydrogéologiques, d’occupation du sol, de la topographie, ainsi que de la météorologie. Dans la présente étude, une modification de la méthode SI a été faite. Une méthode dérivée du modèle SI est présentée (SI modifié). Elle repose sur une démarche qui intègre la modélisation hydrologique sous Agriflux et les SIG. Le divers recours aux SIG a permis l’exécution des différentes opérations de calcul de débits, la création de bases de données ainsi que la cartographie des paramètres influençant la vulnérabilité. L’analyse de la carte de vulnérabilité a permis de distinguer trois zones de degrés de vulnérabilité différents allant du faible au très vulnérable. Les indices SI standard et SI modifié sont combinés, les deux indices de vulnérabilité sont mis en perspective et la pertinence des paramètres utilisés pour chacun est discutée. La cohérence des indices est comparée avec l’occurrence des nitrates dans la plaine de Sfax. La nouvelle carte a permis d’obtenir une meilleure corrélation entre les concentrations en nitrates mesurées et les zones vulnérables par rapport à la méthode originale.

APA, Harvard, Vancouver, ISO, and other styles

11

Jaziri, Brahim. "Évaluation quantitative et mise au point d'un SIG sur la structuration du paysage bocager de Ras Djebel dans le sahel de Bizerte (Tunisie)." Physio-Géo, Volume 11 (January 19, 2017): 161–80. http://dx.doi.org/10.4000/physio-geo.5451.

Full text

APA, Harvard, Vancouver, ISO, and other styles

12

Khomsi, Sami, Mourad Bédir, Mohamed Soussi, Mohamed Ghazi Ben Jemia, and Kmar Ben Ismail-Lattrache. "Mise en évidence en subsurface d'événements compressifs Éocène moyen–supérieur en Tunisie orientale (Sahel) : généralité de la phase atlasique en Afrique du Nord." Comptes Rendus Geoscience 338, no. 1-2 (January 2006): 41–49. http://dx.doi.org/10.1016/j.crte.2005.11.001.

Full text

APA, Harvard, Vancouver, ISO, and other styles

13

Challand, Benoît. "Current Legacies of Colonial Violence and Racialization in Tunisia." Comparative Studies of South Asia, Africa and the Middle East 40, no. 2 (August 1, 2020): 248–55. http://dx.doi.org/10.1215/1089201x-8524171.

Full text

Abstract:

Abstract The article argues that the social life of racialization in Tunisia can be traced back to colonial norms and that one cannot speak of racialization in isolation of class differentials, elements that arose historically with the spread of the tandem colonialism-capitalism in North Africa. From a direct form of racialized violence leaving Muslim Tunisians on the low end of the colonial social ladder of worth, salaries, and the right to life, one moved to a more symbolic form of violence, with the south of the country quasi-racialized as less valuable than the urban coastal areas around Tunis and the Sahel in contemporary Tunisia. In a polity that reached independence more than six decades ago, one can witness the perpetuation of a north-south divide that dates back to the colonial times; but a historical reading of racialized brutality can help us recognize a distinct tradition of activism, in particular trade union activism around the Tunisian General Labor Union (UGTT) and protests in the southern part of the country, such as the one that led to the ousting of dictator Ben Ali in 2011. Through a discussion of diachronic forms of racialization, the article suggests that Giorgio Agamben's focus on juridical issues of exception is partly misleading, for many forms of exception arise outside of the realm of emergency.

APA, Harvard, Vancouver, ISO, and other styles

14

Abu-Zahra, Nadio. "The Rain Rituals as Rites of Spirtual Passage." International Journal of Middle East Studies 20, no. 4 (November 1988): 507–29. http://dx.doi.org/10.1017/s0020743800053873.

Full text

Abstract:

The Sahel of Tunisia is part of the arid zone that extends from Morocco to Afghanistan. People in this region profess the religion of Islam. Their views on the links between divine power, human actions, and rain are based on the Quran and are expressed in the rain prayers (salat a1-isrisqa') prescribed by the Prophet and therefore common to all of them. This article refers to North Africa, centering on the village of Sidi Ameur in the Sahel of Tunisia.

APA, Harvard, Vancouver, ISO, and other styles

15

Mejri, Hajer, Sanda Balescu, Michel Lamothe, Magali Barré, Hakim Abichou, and Samir Bouaziz. "Mise en évidence par la luminescence des feldspaths de deux hauts niveaux marins interglaciaires du Pléistocène moyen (MIS 7 et MIS 9) le long de la côte orientale de la Tunisie (Sahel)." Quaternaire, no. 23/2 (June 1, 2012): 3. http://dx.doi.org/10.4000/quaternaire.6233.

Full text

APA, Harvard, Vancouver, ISO, and other styles

16

Mtiraoui, A., M. S. Soltani, H. Ghannem, M. Letaief, R. Zayani, H. Hdhiri, A. Bchir, and M. Marzouki. "Epidémiologie de la tuberculose dans le Sahel tunisien." Médecine et Maladies Infectieuses 28, no. 2 (February 1998): 199–202. http://dx.doi.org/10.1016/s0399-077x(98)80008-5.

Full text

APA, Harvard, Vancouver, ISO, and other styles

17

Essefi, Elhoucine, Jamel Touir, Mohamed Ali Tagorti, and Chokri Yaich. "Geodynamic Framework of Saline Systems in Eastern Tunisia: Saline Depressions Inherited from the Triassic Intrusions and/or the Messinian Salinity Crisis." ISRN Geology 2014 (April 24, 2014): 1–13. http://dx.doi.org/10.1155/2014/798706.

Full text

Abstract:

Based on the geodynamic context, two hypotheses of origin of salt in the subsurface of the Sahel area are worth being defended. The first suggests that the halokinesis activities, namely, of the Triassic evaporitic sedimentation, may still be until now influencing the functioning of the saline systems in the Sahel. The second integrates the Sahel area geodynamic evolution in the framework of the convergence between African and Eurasian plates. It suggests a link between the blockage of the subduction between African and Eurasian plates in North Tunisia, the Messinian Salinity Crisis, and eventually the concrete opening and evolution of the playa during the Quaternary. Such a suggestion is materialized by a geodynamic model relating successively these events. This scenario suggests that the Messinian Salinity Crisis constituted huge quantities of salt and/or salty water. This saline subsurface reserve is until now influencing the Sahel behavior as a whole. Through groundwater convergence, huge quantities of salt are accumulated within depressions of the Sahel area. Currently, the convergence of the plate between African and Eurasian plates results in a tectonic activity within these saline systems materialized by the formation of fault spring mounds along preferential orientation ensuring the surface-subsurface connectivity.

APA, Harvard, Vancouver, ISO, and other styles

18

Hadidane, R., C. Roger-Regnault, H. Bouattour, F. Ellouze, H. Bacha, E. E. Creppy, and G. Dirheimer. "Correlation between Alimentary Mycotoxin Contamination and Specific Diseases." Human Toxicology 4, no. 5 (September 1985): 491–501. http://dx.doi.org/10.1177/096032718500400505.

Full text

Abstract:

Several pathological cases including primitive hepatomas, Reye's syndrome, alimentary toxic aleukaemia, were encountered in two different Tunisian Sahel hospitals. Contamination of some nutriments of the patients by mycotoxins (aflatoxins, trichothecenes, ochratoxin A, citrinin) are most likely involved in the origin of these diseases.

APA, Harvard, Vancouver, ISO, and other styles

19

Brahim, Noureddine, and Éric Mercier. "Commentaire à la note intitulée Mise en évidence en subsurface d’événements compressifs Éocène moyen–supérieur en Tunisie orientale (Sahel) : généralité de la phase atlasique en Afrique du Nord de Sami Khomsi, Mourad Bédir, Mohamed Soussi, Mohamed Ghazi Ben Jemia, Kmar Ben Ismail-Lattrache." Comptes Rendus Geoscience 339, no. 2 (February 2007): 171–72. http://dx.doi.org/10.1016/j.crte.2006.12.003.

Full text

APA, Harvard, Vancouver, ISO, and other styles

20

Ben Abdelaziz, A., Z. Amira, K. Gaha, H. Thabet, A. Ghedira, R. Gaha, and H. Ghannem. "Le tabagisme des enseignants dans une commune du Sahel tunisien." Revue des Maladies Respiratoires 23, no. 4 (September 2006): 319–23. http://dx.doi.org/10.1016/s0761-8425(06)71597-2.

Full text

APA, Harvard, Vancouver, ISO, and other styles

21

Gaied, Mouhaned, Anis M’halla, Dimitri Lefebvre, and Kamel Ben Othmen. "Robust control for railway transport networks based on stochastic P-timed Petri net models." Proceedings of the Institution of Mechanical Engineers, Part I: Journal of Systems and Control Engineering 233, no. 7 (January 25, 2019): 830–46. http://dx.doi.org/10.1177/0959651818823583.

Full text

Abstract:

This article is devoted to the modeling, performance evaluation and robust control of the railway transport network in Sahel Tunisia. The regular increase in the number of passengers makes the management of transportation systems more and more complex. Railway transport requires specific needs. Indeed, many decision and optimization problems occur from the planning phase to the implementation phase. Railway transport networks can be considered as discrete event systems with time constraints. The time factor is a critical parameter, since it includes schedules to be respected in order to avoid overlaps, delays and collisions between trains. The uncertainties affect the service and the availability of transportation resources and, consequently, the transport scheduling plan. Petri nets have been recognized as powerful modeling and analysis tools for discrete event systems with time constraints. Consequently, they are suitable for railway transport systems. In this article, stochastic P-time Petri nets are used for the railway transport networks in Sahel Tunisia. A global model is first detailed. Then, this model is used to analyze the network traffic and evaluate the performance of the system. Robustness again disturbances is introduced and a control strategy is developed to reduce the consequences of the disturbances in order to maintain the expected schedule.

APA, Harvard, Vancouver, ISO, and other styles

22

Elie, Serge D. "Book Review: Continuity and change in the Tunisian Sahel." Progress in Development Studies 6, no. 3 (July 2006): 263–64. http://dx.doi.org/10.1177/146499340600600313.

Full text

APA, Harvard, Vancouver, ISO, and other styles

23

Letaief, M., M. Satar Soltani, K. Ben Salem, and Mohamed Ali Bchir. "Épidémiologie de l'insuffisance pondérale à la naissance dans le Sahel tunisien." Santé Publique 13, no. 4 (2001): 359. http://dx.doi.org/10.3917/spub.014.0359.

Full text

APA, Harvard, Vancouver, ISO, and other styles

24

Gafsi, Fadia. "Analyse rétrospective de la tension sur l'eau dans le Sahel tunisien." La Houille Blanche, no. 5 (October 2016): 45–50. http://dx.doi.org/10.1051/lhb/2016049.

Full text

APA, Harvard, Vancouver, ISO, and other styles

25

Ben Tekaya, Nizar. "Mobilité et insertion des immigrés à Téboulba, ville moyenne du Sahel tunisien." Insaniyat / إنسانيات, no. 42 (December 30, 2008): 41–64. http://dx.doi.org/10.4000/insaniyat.6785.

Full text

APA, Harvard, Vancouver, ISO, and other styles

26

La Rosa, Cristina. "Mahdia Dialect: An Urban Vernacular in the Tunisian Sahel Context." Languages 6, no. 3 (August 27, 2021): 145. http://dx.doi.org/10.3390/languages6030145.

Full text

Abstract:

This paper aims to present some preliminary results of the linguistic analysis of the dialect of the Wilāya of Mahdia on which few studies exist, focused mainly on phonology. My analysis, here extended to the morpho-syntactic level, is based on a corpus of interviews taken from some social media pages. The sample will be composed of respondents of different geographical origin (from Mahdia and some nearby towns), gender, age and social background. A deeper knowledge of the Arabic of Mahdia region, which is a bundle of urban, Bedouin and “villageois” varieties, would contribute to throw new light on the features of the Saḥlī dialects and would add a small piece to the complex mosaic of Tunisian and Maghrebi dialects, whose traditional categories of classification should be reconsidered.

APA, Harvard, Vancouver, ISO, and other styles

27

Aziza, Ibn Hadj Hassine, Bazin Ingrid, Um Khémary, Bartegi Aghleb, and Catherine Gonzalez. "Activité estrogénique et détection des parabènes dans trois stations d’épuration du Sahel tunisien." European journal of water quality 42, no. 2 (2011): 91–103. http://dx.doi.org/10.1051/wqual/2012002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

28

Hezzi, Imed, Tahar Aïfa, Fares Khemiri, and Mohamed Ghanmi. "Seismic and well log post-Cretaceous reservoir correlations in the Sahel, east Tunisia." Arabian Journal of Geosciences 8, no. 11 (April 12, 2015): 10031–63. http://dx.doi.org/10.1007/s12517-015-1886-4.

Full text

APA, Harvard, Vancouver, ISO, and other styles

29

Khomsi, Sami, Mourad Bédir, Mohamed Soussi, Mohamed Ghazi Ben Jemia, and Kmar Ben Ismail-Lattrache. "Réponse au commentaire de N. Brahim et É. Mercier à propos de l’article de S. Khomsi et al. (2006) : Mise en évidence en subsurface d’événements compressifs Éocène moyen–supérieur en Tunisie orientale (Sahel) : généralité de la phase atlasique en Afrique du Nord, C. R. Geoscience 338 (1–2) (2006) 41–49." Comptes Rendus Geoscience 339, no. 2 (February 2007): 173–77. http://dx.doi.org/10.1016/j.crte.2006.12.004.

Full text

APA, Harvard, Vancouver, ISO, and other styles

30

Hamed, I., and Y. M'Sadak. "Évaluations Sanitaires Mammaires, Hygiéniques, Techniques et Technologiques des Conditions de Traite chez Deux Grands Élevages Bovins : Sahel Tunisien = Breast Health Assessments, Hygiene, Technical and Technological Conditions of Trafficking in Two Large Farms Cattle : Tunisian Sahel." Revue des Bioressources 6, no. 1 (June 2016): 49–65. http://dx.doi.org/10.12816/0045896.

Full text

APA, Harvard, Vancouver, ISO, and other styles

31

Essefi, Elhoucine, Mohamed Ali Tagorti, Jamel Touir, and Chokri Yaich. "Hydrocarbons Migration through Groundwater Convergence toward Saline Depressions: A Case Study, Sidi El Hani Discharge Playa, Tunisian Sahel." ISRN Environmental Chemistry 2013 (October 30, 2013): 1–14. http://dx.doi.org/10.1155/2013/709190.

Full text

Abstract:

This paper aims to provide proofs of hydrocarbons migration from petroleum reservoirs towards the surface of discharge playas. This is a case study of the discharge playa of Sidi El Hani, eastern Tunisia. The geochemistry of water of some hydrological drills in the Sahel area and of water from the discharge playa proves relatedness between the deep aquifer and the water of the discharge playa. Thus, the hydrology is now more than likely converging from the subsurface. This convergence may be an agent of transport of hydrocarbons. Concerning the organic matter within the discharge playa, high percentages of different fractions seem abnormal in such a saline context. This maturated organic matter should be viewed in the widest context of a multidisciplinary study taking into account the presence of petroleum potentials in the subsurface, the converging hydrogeology, and the tectonised region. The high percentage of Aromatic Polycyclic Hydrocarbon (APH) may be the result of hydrocarbons migration rather than anthropogenic pollution. As for the reinterpretation of previous works about the organic matter in playas done in sebkha Moknine, the contaminated organic matter, which was interpreted as a human induced activity, may have another origin from a reservoir located in the subsurface of the Sahel area.

APA, Harvard, Vancouver, ISO, and other styles

32

Ben Salem, Y., O. Boullegue, M. Mastouri, S. Ktata, N. Boujaafar, and R. Mzoughi. "Caractérisation moléculaire des souches invasives d'Haemophilus influenzae isolées dans la région du Sahel tunisien." Pathologie Biologie 54, no. 3 (April 2006): 137–47. http://dx.doi.org/10.1016/j.patbio.2005.04.004.

Full text

APA, Harvard, Vancouver, ISO, and other styles

33

Feki, S., H. El Omri, M. A. Laatiri, S. Ennabli, K. Boukef, and F. Jenhani. "Contribution of Flow Cytometry to Acute Leukemia Classification in Tunisia." Disease Markers 16, no. 3-4 (2000): 131–33. http://dx.doi.org/10.1155/2000/953059.

Full text

Abstract:

The precision of immunological characterization of leukemias was improved by a certain number of technical innovations, particularly hybridoma production and standardization, resulting in monoclonal antibodies and definition of recognised cellular antigens (designated by CD: Cluster of Differentiation).The aim of this work was to determine the immunophenotyping profile of patients with leukemia, by means of a flow cytometric method: 66 blood samples coming from leukemic persons in the Sahel region were studied by flow cytometry, using about thirty monoclonal antibodies all marked with a fluorochrome, in one or two colour systems to assess their distribution according to type (lymphoid B or T / myeloid) and age, and to search for possible co-expressions of markers of different lineages.The marked preponderance of childhood B-ALL in our series is, at least partly, attributable to the age distribution of the Tunisian population. In agreement with studies from other countries, the majority of AML cases occurred among adults. A high proportion of AML cases in our series co-expressed markers of other lineages. Overall, accurate classification of acute leukemias was possible from a simple peripheral blood sample in 62 of 66 cases (93.9%).

APA, Harvard, Vancouver, ISO, and other styles

34

Jemaa, Riadh, Amani Kallel, Yosra Sédiri, Essia Boughezala, Habib Gamra, Faouzi Maatoug, Habib Ammar, Abdelhamid Ben Othmane, Ghabbara Abderraouf, and Naziha Kaabachi. "279 Prevalence of cardiovascular risk factors in coronary patients from the Sahel region of Tunisia." Archives of Cardiovascular Diseases Supplements 3, no. 1 (January 2011): 92–93. http://dx.doi.org/10.1016/s1878-6480(11)70281-6.

Full text

APA, Harvard, Vancouver, ISO, and other styles

35

Hanini, Asma El, Ayed Added, and Saâdi Abdeljaoued. "A GIS-Based DRASTIC Model for Assessing Phreatic Aquifere of Bekalta (Tunisian Sahel)." Journal of Geographic Information System 05, no. 03 (2013): 242–47. http://dx.doi.org/10.4236/jgis.2013.53023.

Full text

APA, Harvard, Vancouver, ISO, and other styles

36

Ferjani, Ezdine, Sadok Roudesli, and André Deratani. "Desalination of brackish water from Tunisian Sahel using composite polymethylhydrosiloxane-cellulose acetate membranes." Desalination 162 (March 2004): 103–9. http://dx.doi.org/10.1016/s0011-9164(04)00032-3.

Full text

APA, Harvard, Vancouver, ISO, and other styles

37

M’halla, Anis. "Static Integration Based on Stochastic P-Time Petri Nets of Maintenance Scheduling for Railway Transport Equipment." Journal of Advanced Transportation 2021 (August 7, 2021): 1–12. http://dx.doi.org/10.1155/2021/7506673.

Full text

Abstract:

In transport systems, all equipment requires maintenance, which directly affects the machine’s availability and consequently the planned transport schedule. The purpose of this paper is to carry out a method for integrating recovery jobs in railway systems. The proposed method allows the insertion of preventive and corrective maintenance operations when the transport equipment is available in order to minimize periods of inactivity, avoid catastrophic scenarios, and maintain stability and safety of the studied networks. A computing algorithm, allowing insertion of the planned recovery tasks in periods of metro availability, without changing the initial scheduling solution, is established. Finally, we illustrate the implementation of the proposed approach on Tunisian Sahel railway transport networks.

APA, Harvard, Vancouver, ISO, and other styles

38

Bout-Roumazeilles, V., N. Combourieu-Nebout, S. Desprat, G. Siani, J. L. Turon, and L. Essallami. "Tracking atmospheric and riverine terrigenous supplies variability during the last glacial and the Holocene in central Mediterranean." Climate of the Past 9, no. 3 (May 15, 2013): 1065–87. http://dx.doi.org/10.5194/cp-9-1065-2013.

Full text

Abstract:

Abstract. A multiproxy study – coupling mineralogical, grain size and geochemical approaches – was used to tentatively retrace eolian and fluvial contributions to sedimentation in the Sicilian–Tunisian Strait since the last glacial. The eolian supply is dominant over the whole interval, excepted during the sapropel S1 when riverine contribution apparently became significant. Saharan contribution increased during the Bølling–Allerød, evidencing the persistence of aridity over North Africa although the northern Mediterranean already experienced moister and warmer conditions. The Younger Dryas is marked by proximal dust inputs, highlighting intense regional eolian activity. A southward migration of dust provenance toward Sahel occurred at the onset of the Holocene, likely resulting from a southward position of the Inter Tropical Convergence Zone that was probably associated with a large-scale atmospheric reorganization. Finally, a peculiar high terrigenous flux associated with drastic modifications of the mineralogical and geochemical sediment signature occurred during the sapropel S1, suggesting the propagation of fine particles derived from major floodings of the Nile River – resulting from enhanced rainfall on northeastern Africa – and their transportation across the Sicilian–Tunisian Strait by intermediate water masses.

APA, Harvard, Vancouver, ISO, and other styles

39

Beni Akhy, R., H. Ben Dhia, A. Gamaoun, and R. Amri. "Modélisation de l'impact des activités anthropiques sur les nappes phréatiques côtières Cas de Chott Maria (Sahel tunisien)." La Houille Blanche, no. 6 (August 1997): 58–65. http://dx.doi.org/10.1051/lhb/1997053.

Full text

APA, Harvard, Vancouver, ISO, and other styles

40

Laajimi, Rawaa, Julie Le Gallo, and Saloua Benammou. "What Geographical Concentration of Industries in the Tunisian Sahel? Empirical Evidence Using Distance‐Based Measures." Tijdschrift voor economische en sociale geografie 111, no. 5 (April 30, 2020): 738–57. http://dx.doi.org/10.1111/tesg.12412.

Full text

APA, Harvard, Vancouver, ISO, and other styles

41

CHEHAIBI, Sayed. "Effects of planting depth on agronomic performance of two potato varieties grown in the Sahel region of Tunisia." Journal of Development and Agricultural Economics 5, no. 7 (July 31, 2013): 272–76. http://dx.doi.org/10.5897/jdae12.116.

Full text

APA, Harvard, Vancouver, ISO, and other styles

42

Asma, Salem, Majdoub Rajouene, M’sadak Youssef, and BOUJNAH Dalenda. "Impact de l’état Hydrique du Sol sur le Comportement Écophysiologique d’une Oliveraie Adulte Aménagée en Meskat ( Sahel Tunisien )." Algerian Journal of Arid Environment 3, no. 2 (December 2013): 4–14. http://dx.doi.org/10.12816/0008895.

Full text

APA, Harvard, Vancouver, ISO, and other styles

43

Bout-Roumazeilles, V., N. Combourieu-Nebout, S. Desprat, G. Siani, and J. L. Turon. "Tracking atmospheric and riverine terrigenous supplies variability during the last glacial and the Holocene in central Mediterranean." Climate of the Past Discussions 8, no. 4 (July 27, 2012): 2921–68. http://dx.doi.org/10.5194/cpd-8-2921-2012.

Full text

Abstract:

Abstract. The objectives were to retrace the eolian and fluvial terrigenous supplies in a sediment core from the Sicilian-Tunisian Strait by coupling mineralogical, grain-size and geochemical approaches, in order to get informations on the atmospheric versus riverine contributions to sedimentation on the southern side of central Mediterranean since the last glacial. The eolian supply is dominant over the whole interval, excepted during the sapropel S1 when riverine contribution apparently became significant, and particles provenance has been modified since Last Glacial. Saharan contribution increased during the Bølling-Allerød, evidencing the persistence of aridity over North Africa although the northern Mediterranean already experienced moister and warmer conditions. The Younger Dryas is marked by proximal dust inputs highlighting intense regional eolian activity. A southward migration of dust provenance toward Sahel occurred at the onset of the Holocene, likely resulting from a southward position of the Inter Tropical Convergence Zone, probably associated with a large-scale atmospheric reorganization. Finally, a peculiar high terrigenous flux associated with drastic modifications of the mineralogical and geochemical sediment signature occurred during the sapropel S1, suggesting the propagation of fine-particles derived from major floodings of the Nile River – resulting from enhanced rainfall on northeastern Africa – and their transportation across the Sicilian-Tunisian Strait by intermediate water-masses.

APA, Harvard, Vancouver, ISO, and other styles

44

Saidi, S., S. Bouri, H. Ben Dhia, and B. Anselme. "Assessment of groundwater risk using intrinsic vulnerability and hazard mapping: Application to Souassi aquifer, Tunisian Sahel." Agricultural Water Management 98, no. 10 (August 2011): 1671–82. http://dx.doi.org/10.1016/j.agwat.2011.06.005.

Full text

APA, Harvard, Vancouver, ISO, and other styles

45

Fekih Hassen, I., J. Kummert, S. Marbot, H. Fakhfakh, M. Marrakchi, and M. H. Jijakli. "First Report of Pear blister canker viroid, Peach latent mosaic viroid, and Hop stunt viroid Infecting Fruit Trees in Tunisia." Plant Disease 88, no. 10 (October 2004): 1164. http://dx.doi.org/10.1094/pdis.2004.88.10.1164a.

Full text

Abstract:

Viroids of fruit trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of fruit trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5′ GTCTGAAGCCTGGGCGCTGG 3′ and reverse primer 5′ CCTTCGT CGACGACGAGCCGAG 3′ were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach trees tested, 12 were found infected with PLMVd. Two pear trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in fruit trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting fruit trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Légumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.

APA, Harvard, Vancouver, ISO, and other styles

46

Tagorti, Mohamed Ali, Elhoucine Essefi, Jamel Touir, Rihab Guellala, and Chokri Yaich. "Geochemical controls of groundwaters upwelling in saline environments: Case study the discharge playa of Sidi El Hani (Sahel, Tunisia)." Journal of African Earth Sciences 86 (October 2013): 1–9. http://dx.doi.org/10.1016/j.jafrearsci.2013.05.004.

Full text

APA, Harvard, Vancouver, ISO, and other styles

47

Gabtni, Hakim, Badia Chulli Zenatti, Chokri Jallouli, Kevin L. Mickus, and Mourad Bedir. "The crustal structure of the Sahel Basin (eastern Tunisia) determined from gravity and geothermal gradients: implications for petroleum exploration." Arabian Journal of Geosciences 4, no. 3-4 (April 30, 2010): 507–16. http://dx.doi.org/10.1007/s12517-010-0151-0.

Full text

APA, Harvard, Vancouver, ISO, and other styles

48

M’Sadak, Y., R. Haj Mbarek, and L. Mighri. "Description and variation factors of individual cell counts of milk in of units bovins aboveground (Tunisian Sahel)." Journal of Fundamental and Applied Sciences 8, no. 1 (January 25, 2016): 61. http://dx.doi.org/10.4314/jfas.v8i1.4.

Full text

APA, Harvard, Vancouver, ISO, and other styles

49

Hajji, Soumaya, Ghada Nasri, Emna Boughariou, Moez Bahloul, Nabila Allouche, and Salem Bouri. "Towards understanding groundwater quality using hydrochemical and statistical approaches: case of shallow aquifer of Mahdia–Ksour Essaf (Sahel of Tunisia)." Environmental Science and Pollution Research 27, no. 5 (December 17, 2019): 5251–65. http://dx.doi.org/10.1007/s11356-019-06982-2.

Full text

APA, Harvard, Vancouver, ISO, and other styles

50

Trunov, Philipp O. "Germany and «Libyan problem» during 2010-s." Asia and Africa Today, no. 9 (2021): 65. http://dx.doi.org/10.31857/s032150750014942-8.

Full text

Abstract:

Germany has been growing political and military activity in Northern Africa and Sahel region by the mid 2010s. FRG and its EU partners faced the great number of instability risks which are projected from zones of armed conflicts located in northern part of Africa. The key elements of the corridor of instability which has connected the fragile states in Sahel and Northern Africa were the «Libyan door» (the upper part) and «Malian gates» (the lower one). But in the 2010s FRG faced the absence of opportunities for itself to be directly involved in the resolution of «Libyan problem». That is why in 2012-2019 Germany had been trying only to fence «Libyan problem» in. This perimeter has four segments. German contribution to the creation of Western one (the strengthening of Tunisian and Algerian borders with Libya) and especially Eastern segment (the same with Egypt) was rather limited and consisted of arms export to these countries. The article explores the evolution of German participation to the resolution of Mali armed conflict (first of all FRG`s military contribution to EUTM Mali and MINUSMA missions). This one and also German participation in the reform of Niger`s security sector was the creation of Southern segment of the perimeter. By 2020 Germany has deepened cooperation on «Libyan problem» not only with regional players but also world powers. During Merkel`s visit to Moscow (January 11, 2020) the scheme of future Berlin conference on Libya was declared. This format was established on January 19, 2020. Germany became the coordinator of inter-Libyan dialogue (between the Government of national consensus in the West of the country and Libyan national army in the East) and supported it by the launch of the EU mission «IRINI». The article concludes about the perspectives of German policy towards Libya considering COVID-19 pandemics.

APA, Harvard, Vancouver, ISO, and other styles

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!