Journal articles on the topic 'Salt red marl'

In antiquity, the production of sea salt was one of the most important sources of salt. According to Pliny the Elder (NH 31.81), the most common way of obtaining salt was through marine salinae: facticii varia genera, volgaris plurimusque in salinis mari adfuso. There are plenty of textual references to marine salt evaporation ponds: Livy (1.33) reported that Ancus Marcius opened saltworks on the Tiber next to Ostia; Pliny (NH 31.84-87) mentioned a series of examples of such installations distributed throughout the Mediterranean, while Columella (Rust. 10.135) indicated the existence of saltworks at Pompeii, and Cassiodorus (Var. 12.24) spoke of those located near Venice. Passages in Rutilius Namatianus (De red. 475-90) and Manilius (Astr. 5.682-92) are also well known for their explanations of how ancient saltworks operated.

Department of Chemistry, R. B. S. CoiJege, Agra-282 002, Uttar Pradesh, India <em>E-mail</em>: dev_bnt@yahoo.co.in <em>Manuscript received 17 July 2006, revised 8 February 2007, accepted 27 February 2007</em> The furan resins have been synthesized by condensation of furfuryl alcohol with anisaldehyde/salicyldehyde and furfuraldchyde with furfuryl alcoho<em>V</em>p-cresol using acid or base or metal salt as catalyst. These resins have been characterized by Fourier Transform Infra-red spectra (FTIR) and cross-linking of these resins arc accomplished by using various curing agents. These resins find extensive application in spandex fibers, laminates, lining for rocket fuels, abrasive wheels etc.&nbsp;

Environmental Monitoring Section, Department of Chemistry, S. V. University, Tirupati-517 502, India <em>E-mail</em> : chiranjeevi_sai@yahoo.co.in <em>Manuscript received 26 September 2003, revised 27 September 2004, accepted 19 May 2005&nbsp;</em> Simple and sensitive spectrophotometric methods for the determination of fenitrothion in either pure form or in its formulations are described. The methods are based on the diazotization of reduced fenitrothion followed by coupling with alcoholic iminodibenzyl (IDB) in acidic medium to give a purple coloured product having aƛ_min of 575 nm (first method) or coupling with 4-amino-5- hydroxy-2,7-naphthalene disulfonic acid monosodium salt (AHND) to produce red color product with ƛ_max of 523 nm (second method) at of pH 11.5. Both the methods are highly reproducible and have been applied formulations and in water samples. The proposed methods have been applied successfully for the determination of fenitrothion residues in water samples upto the ppb level with the preconcentration on Amberlite XAD-4.&nbsp;

&#x0D; &#x0D; &#x0D; &#x0D; Penggunaan Website pada zaman sekarang sedang berkembang pesat, berbagai jenis aplikasi, layanan dari swasta sampai pemerintah banyak menggunakan website sebagai media interaksi antar berbagai platform. Biasanya saat mengunggah berkas pada website, sistem melakukan validasi dengan menyaring jenis berkas objek digital di server side (backend) atau dalam halaman website pada web browser dalam bentuk HTML atau Javascript (frontend) dengan memanfaatkan penyaringan File Signature atau Multipurpose Internet Mail Extensions (MIME), File Extention dan File Size pada setiap berkas yang diunggah tanpa mengecek isi kontennya sehingga berkas digital object yang corrupt atau yang disisipi selain gambar dapat diproses dalam fitur unggahan. Faktor keamanan sangatlah penting dikarenakan pada zaman yang semakin berkembang banyak sistem yang berupa digital. Ancaman serangan terhadap berbagai jenis sistem yang berbentuk digital atau server juga ikut berkembang, maka diperlukan sebuah penanganan terhadap ancaman atau serangan pada server dengan celah fitur unggahan. Penelitian ini bertujuan untuk meneliti teknik validasi PNG yang tidak hanya mengecek MIME, File Extention dan File Size tetapi memanfaatkan juga Metadata PNG dan nilai warna RGBA (Red, Green, Blue, Alpha) pada setiap pixel dengan Metode Pengembangan menggunakan Extreme Programming (XP). Hasil penelitian dengan sampel 10 gambar berisi metadata dan 10 gambar yang tidak berisi metadata dapat mengecek validasi secara khusus unggahan gambar pada PNG File dengan menyaring secara khusus sesuai keunikan dari file gambar yaitu mempunyai panjang dan lebar pada metadatanya yang harus tersedia (Width, Height, Bits, Mime) serta RGBA (Red, Green, Blue, Alpha) pada setiap piksel sesuai dengan panjang dan lebar sebuah gambar PNG.&#x0D; &#x0D; &#x0D; &#x0D;

Department of Chemistry, JNTU Hyderabad (CEH), Kukatpally, Hyderabad-500 085, Telangana, India <em>E-mail </em>: vrr9@yahoo.com <em>Manuscript received online 21 May 2014, revised 24 March 2015, accepted 02 April 2015</em> The method developed is based on pK_a values and proton exchange concept, in which ponceau 4R reagent (pK_a = &ndash;2.8) reacts with amoxicillin (pK_a = 3.39), both of which are colorless solutions in protonated form. On mixing these compounds at suitable conditions, pale red color develops at room temperature. It is predicted that ponceau 4R undergoes proton exchange and forms salt based on number of carboxylate anions in amoxicillin. The formation of ionic solution, by mixing of amoxicillin and ponceau 4R imparts color to the resultant solution. The resultant ionic solution shows maximum absorbance at wavelength, &lambda;_max = 509 nm. The method complies with Beer&rsquo;s law at concentration range, 10&ndash;50 &micro;g/ml. The coefficient correlation was 0.999 for the linear curve equation, <em>Y</em> = 0.030x + 0.021. Method detection limit (MDL), limit of detection (LOD), limit of quantification (LOQ), lower critical limit (LCL), upper critical limit (UCL), signal noise ratio (SNR), <em>t</em>-value, <em>p</em>-value and confidence interval were calculated for the ionic solution of amoxicillin and ponceau 4R. Average recovery of amoxicillin solution was made to 100.6. The method validated is as per International conference on harmonization (ICH) and association of analytical communities (AOAC) guidelines. The method was found to be simple, accurate, and economical. Amoxicillin and its colored ionic solution were testified on RP-HPLC. ¹H NMR spectrum of the drug and the ionic solution formed was also recorded to verify the possible mechanism. The ionic solution was stable up to 12 h.

SALINIZAÇÃO POR POTÁSSIO NA PRODUÇÃO DE PIMENTÃO FERTIRRIGADO SOB AMBIENTE PROTEGIDO&#x0D; &#x0D; &#x0D; RENAN LIMA DE SOUSA1; ROBERTO LYRA VILLAS BÔAS2; POLIANA ROCHA D’ALMEIDA MOTA3; CAROLINE DE MOURA D’ANDRÉA MATEUS4 E RAFAEL BARCELOS MENDONÇA5&#x0D; &#x0D; 1Programa de Pós-graduação em Agronomia, Universidade Estadual Paulista “Júlio de Mesquita Filho”, UNESP, Avenida Universitária, nº 3780, Altos do Paraíso, CEP 18610-034, Botucatu, SP, Brasil. E-mail: renann.agro@hotmail.com&#x0D; 2Departamento de Solos e Recursos Ambientais, Universidade Estadual Paulista “Júlio de Mesquita Filho”, UNESP, Avenida Universitária, nº 3780, Altos do Paraíso, CEP 18610-034, Botucatu, SP, Brasil. E-mail: rlvboas@fca.unesp.br&#x0D; 3Departamento de Engenharia Agrícola e Solos, Universidade Federal do Piauí, UFPI, Rua Dirce Oliveira, nº 3397, Ininga, CEP 64048-550, Teresina, PI, Brasil. E-mail: poliana@ufpi.edu.br&#x0D; 4Departamento de Solos e Recursos Ambientais, Universidade Estadual Paulista “Júlio de Mesquita Filho”, UNESP, Avenida Universitária, nº 3780, Altos do Paraíso, CEP 18610-034, Botucatu, SP, Brasil. E-mail: caroline_mateus@hotmail.com&#x0D; 5Departamento de Solos e Recursos Ambientais, Universidade Estadual Paulista “Júlio de Mesquita Filho”, UNESP, Avenida Universitária, nº 3780, Altos do Paraíso, CEP 18610-034, Botucatu, SP, Brasil. E-mail: rafael.irrigacao@gmail.com&#x0D; &#x0D; &#x0D; 1 RESUMO&#x0D; &#x0D; Objetivou-se com a pesquisa avaliar doses de potássio na produção de pimentão, cultivar ‘Gaston’, e efeitos no extrato de solução do solo, utilizando extratores. Instalou-se a pesquisa na estufa agrícola do Departamento de Solos e Recursos Ambientais da Universidade Estadual Paulista “Júlio de Mesquita Filho” - Campus de Botucatu, tendo sido as plantas conduzidas em vasos. Utilizou-se o delineamento experimental em blocos casualizados, quatro repetições, testando quatro doses de K2O (363 kg ha-1, 726 kg ha-1, 1088 kg ha-1 e 1451 kg ha-1) aplicadas via fertirrigação por gotejamento. Foram avaliados: a condutividade elétrica e concentração de íons específicos da solução do solo extraída semanalmente, altura das plantas e produção. Os extratores permitiram monitoramento eficiente e houve diferença significativa entre os tratamentos. O aumento da concentração de sais na solução do solo reduziu a altura das plantas, número de frutos e a produção. A dose, além da calagem, que proporcionou maior produção de frutos foi: 363 kg ha-1 de K2O com 39,2 t ha-1, apresentando condutividade elétrica média ao longo do ciclo de 1,7 dS m-1 e concentração de 111 mg L-1 no extrato de solução do solo.&#x0D; &#x0D; Palavras chave: Capsicum annuum L., fertirrigação, extrator de solução, solução do solo, salinização&#x0D; &#x0D; &#x0D; SOUSA, R. L.; VILLAS BÔAS, R. L.; MOTA, P. R. D.; MATEUS, C. M. D.; MENDONÇA, R. B.&#x0D; &#x0D; &#x0D; EFFECTS OF POTASSIUM SALINIZATION IN THE PRODUCTION OF FERTIRRIGATED RED PEPPERS UNDER GREEN HOUSE&#x0D; &#x0D; &#x0D; 2 ABSTRACT&#x0D; &#x0D; The objective of this study was to evaluate potassium doses in the production of sweet pepper, 'Gaston' cultivar, and effects on soil solution extract, using extractors. The research was installed in the greenhouse of the Department of Soils and Environmental Resources of São Paulo State University "Júlio de Mesquita Filho" - Botucatu Campus, and the plants were carried in pots. The experimental design was a randomized block design, with four replicates, using four doses of K2O (363 kg ha-1, 726 kg ha-1, 1088 kg ha-1 and 1451 kg ha-1) applied via drip fertirrigation. Electrical conductivity and specific ion concentration of soil solution extracted weekly, plant height and yield were evaluated. The extractors allowed efficient monitoring and there was significant differences across treatments. Increase in salt concentration in the soil solution reduced plant height, number of fruits and yield. The dose, in addition liming, that provided the highest fruit yield was: 363 kg ha-1 of K2O with 39.2 t ha-1, with an average electrical conductivity over the cycle of 1.7 dS m -1 and concentration of 111 mg L-1 in soil solution extract.&#x0D; &#x0D; Keywords: Capsicum annuum L., fertirrigation, solution extractor, soil solution, salinization

Teknologi informasi yang berkembang begitu pesat sehingga setiap Perguruan Tinggi senantiasa bersaing dalam kegiatan penelitian yang dilakukan oleh peneliti dan dosen. Salah satunya Perguruan Tinggi Raharja yang bergerak dibidang komputer. Perguruan Tinggi Raharja yang memiliki banyak inovasi untuk menciptakan media pengumpulan data kinerja dosen yang tidak konvensional. Untuk itu dibuatlah sebuah media informasi yang dijadikan sebagai media dalam pengumpulan data dosen yang ada di Perguruan Tinggi Raharja. Kinerja Penelitian dan Kinerja Pengabdian kepada Masyarakat yang merupakan sebagai bagian dari Tri Dharma Perguruan Tinggi Raharja yaitu pusat bagi Perguruan Tinggi dalam pengembangan Ilmu Pengetahuan , Teknologi, dan IPTEKS. Dalam implementasinya saat ini masih kurang efektif yaitu dalam pengumpulan data kinerja dosen. Hal ini masih terlihat pada saat ingin menginput data dosen, dosen harus datang ke ruangan Rahaja Enrichment Centre (REC). Maka dari itu pastinya saat ini mayoritas pasti memiliki email. Dikarenakan email merupakan salah satu media yang paling aman, dengan email mudah sekali dalam bertukar file atau dalam hal yang lainnya. Dan pastinya akan memanfaatkan fasilitas yang ada pada email. salah satunya yang terdapat pada gmail adalah Google Form. Google Form ini memiliki fungsi yaitu untuk membuat formulir pendaftaran dan untuk membuat daftar - daftar lain yang kemudian dengan cara meminta kepada seseorang untuk mengisi formulir yang telah dibuat sesuai dengan ketentuan yang ada. Akan tetapi pada Perguruan Tinggi Raharja ini lebih dikenal sebagai Rinfo Form. Dengan melalui Rinfo Form ini diketahui dapat menutupi kekurangan yang berpengaruh dalam pengumpulan data kinerja dosen tersebut. Dalam penelitian ini dilakukan dengan menggunakan metode pengumpulan data, diantaranya yaitu metode observasi dan metode studi pustaka. Peneliti berharap dengan pemanfaatan Rinfo Form memberikan pengaruh baik dalam pengumpulan data kinerja dosen di Perguruan Tinggi Raharja. Kata kunci : Teknologi informasi, Data, RinfoForms Information technology is growing very rapidly so that every university is always competing in research activities undertaken by researchers and lecturers. One of them is Perguruan Tinggi Raharja which is engaged in computer. Perguruan Tinggi Raharja has many innovations to create unconventional lecturer data performance data collection. For that made a media information that serve as a medium in the data collection of lecturers in Perguruan Tinggi Raharja. Performance Research and Performance Devotion to the Society which is a part of Tri Dharma Perguruan Tinggi Raharja is the center for Universities in the development of Science, Technology, and IPTEKS. In the current implementation is still less effective in the collection of lecturer performance data. It is still visible at the time to enter the data of lecturers, lecturers must come to the room Raharja Enrichment CentRE (REC). Therefore of course now majority must have mail. Because email is one of the most secure media, with very easy email in exchange files or in other things. And certainly will take advantage of existing facilities on mail. One of which is in gmail is Google Form. This Google Form has a function that is to create other lists later by asking someone to fill out form that has been created in accordance with the existing provisions. However, in Perguruan Tinggi Raharja is better known as Rinfo From. By through Rinfo Form is known to cover the inadequate deficiencies in the collection of lecturer performance data. In this research is done by using data collection method, such us observation method, and literature review. Researchers hope by utilizing Rinfo Form give good influence in data performance data at Perguruan Tinggi Raharja.&#x0D; Keywords : Information technology, Data, RinfoForms&#x0D;

ABSTRAKTren masyarakat modern saat ini lebih senang membaca, belajar, dan berkumpul, sambil nongkrong ditempat-tempat hiburan dibanding harus pergi ke perpustakaan. Disisi lain, saat ini diberbagai pusat perbelanjaan seperti mall dan tempat wisata telah banyak didirikan public space dengan konsep mini library. Salah satu alasan masyarakat lebih memilih tempat tersebut dibanding perpustakaan adalah desain interior yang menarik dan aspek kenyamananya. Perpustakaan diharapkan mampu menyesuaikan diri dengan tren dan budaya masyarakat saat ini untuk menarik kembali minat pemustakanya. Penelitian ini bertujuan untuk menjelaskan konsep desain interior perpustakaan baik secara teoritis maupun praktis berdasarkan kajian literatur. Hasil penelitian menunjukkan bahwa desain interior merupakan bagian penting yang harus diperhatikan pengelola perpustakaan. Desain interior selain untuk menarik minat kunjung pemustaka juga dapat meningkatkan minat baca, membentuk citra positif perpustakaan, dan menumbuhkan kepuasan bagi pemustaka. Selain memperhatikan aspek estetika, desain interior sebuah perpustakaan tetap harus memperhatikan aspek fungsionalnya. Inovasi perpustakaan berkonsep Post-Modern Space dengan tambahan cafe dan lounge dapat diterapkan dalam perpustakaan modern dengan tetap memperhitungkan tata ruang, tata warna, pencahayaan, sirkulasi udara, dan tata suara.ABSTRACTModern society trends today prefer to read, study, and gather, while hanging out in places of entertainment rather than having to go to the library. On the other hand, currently in various shopping centers such as malls and tourist attractions have been established many public space with the concept of a mini library. One reason people prefer that place compared to the library is the attractive interior design and comfort aspects. Libraries are expected to adapt to the current trends and culture of society to reclaim the interests of its librarians. This study aims to explain the concept of library interior design both theoretically and practically based on literature review. The results showed that interior design is an important part that must be considered by library managers. Interior design in addition to attract visitors visit can also increase interest in reading, forming a positive image of the library, and foster satisfaction for pemustaka. In addition to considering the aesthetic aspect, the interior design of a library must still pay attention to its functional aspects. Post-Modern Space concept innovation with additional cafe and lounge can be applied in modern libraries while taking into account the layout, color, lighting, air circulation and sound system.

Department of Chemistry, National Institute of Technology, Agartala-799 046, Tripura, India <em>E-mail </em>: t_k_misra@yahoo.com <em>Manuscript received online 26 October 2014, revised 11 December 2014, accepted 15 January 2015</em> Nickel(II) complexes of acetylacetone are potential materials in all disciplines notably catalysis and biology. Most of them are not easy to prepare. A synthetic method of preparation and isolation of sodium salt of <em>tris</em>- (acetylacetonato)nickelate(II), Na[Ni(acac)₃ ] and study of its stability in aqueous and acidic media have been reported. The complex has been characterized by conductance, elemental and metal analysis, UV-Vis and IR spectroscopy studies. Conductance measurement supported that the complex is 1 : 1 electrolyte. Elemental and metal analysis evidenced the presence of three units of acac (= acetylacetonato) per complex and one nickel atom [19.32% (Calcd. 20.03)] per acac unit, respectively. UV-Vis absorbance bands :³A_2g( <em>³F</em>)&rarr;<em>³T_2g</em>( <em>³F</em>) (&nu;₁ = 9416 cm^&ndash;1); <em>³A_2g</em>(<em> ³F</em>)&rarr;<em>³T_1g</em>( <em>³F</em>) (&nu;₂ = 1605 cm^&ndash;1) of the <em>tris</em>-complex (azide assisted) are blue shifted in comparison with <em>trans</em>-[Ni(acac)₂ (H₂O)₂ ], revealing strong Ni^II - acac covalent interaction. IR spectra of tris-complex reveal that the tris-complex has no coordinated water molecules. The spectra provided &nu;(C=O) and &nu;(Ni-O) bands at 1590 and 433 cm^&ndash;1 which are red and blue shifted, respectively in comparison with <em>trans</em>-[Ni(acac)₂ (H₂O)₂ ], indicating strong Ni-O bonding. The tris-complex is susceptible to dissociates in aqueous medium (<em>k_obs</em> = 4.9 &times; 10^&ndash;3 min^&ndash;1) as well as in acid media (<em>k_s</em> = 2.0 &times; 10^&ndash;3 min^&ndash;1). To comprehend the potentiality of Ni^II-complexes of acetylacetone, the as-synthesized <em>tris</em>-complex must be a futuristic material.

ABSTRACT&#x0D; Hari Gusmina : 1306082/2013. Youths Concern in Basilawek Tradition of Funeral Ceremony at Kapelgam Village, Subdistrict of Bayang, Pesisir Selatan Regency.&#x0D; The purpose of this research describes the concern of youths in Basilawek tradition of funeralceremony in Kapelgam village, Bayang sub district, Pesisir Selatan regency.The approach from this research is qualitative by using purposive sampling technique to determine the informants. Data collection was done through interview, observations, and documentation studies.The test of data validity is done through triangulation technique of data source, analyzed by reduction of data , presentation of data, and withdrawal of conclusions. The results shows that in terms of implementation of Basilawek tradition at Kapelgam village has changed during the time of execution, formerly it used to performed after maghrib prayer, but now it is done after isya prayer. The changes are also seen in reading of letters of silawek , formerly letters were read in accordance with the day of the deceased's people, but now letters are read at the will of youth's heart. Concerning of youth in basilawek tradition at the funeral ceremony at Kapelgam village is looked reduced because not all of youths follow basilawek tradition. The efforts to maintain basilawek tradition are done by inviting and calling back young men and young women to follow basilawek tradition, giving early knowledge to the next generation (children), and giving training to keep this tradition running well for the better future.&#x0D; Keywords: Concern, Youths, Basilawek Tradition.&#x0D; &#x0D; KEPEDULIAN PEMUDA DALAM TRADISI BASILAWEK PADA UPACARA KEMATIAN DI KENAGARAIN KAPELGAM KECAMATAN BAYANG KABUPATEN PESISIR SELATAN&#x0D; &#x0D; Hari Gusmina[1],Isnarmi²,Nurman S³&#x0D; Program Studi Pendidikan Pancasila dan Kewarganegaraan&#x0D; FIS Universitas Negeri Padang&#x0D; E-mail :harigusmina@gmail.com&#x0D; &#x0D; Abstrak&#x0D; Tujuan penelitian ini menganalisis kepedulian Pemuda dalam Tradisi Basilawek pada Upacara Kematian di Kenagarian Kapelgam Kecamatan Bayang Kabupaten Pesisir Selatan. Penelitian ini menggunakan pendekatan kualitatif dengan, penentuan informan dalam penelitian memakai teknik Purposive sampling, teknik pengumpulan data adalah wawancara, observasi, dan studi dokumentasi. Uji keabsahan data dilakukan melalui teknik trianggulasi sumber data, dianalisis dengan cara reduksi data, penyajian data dan penarikan kesimpulan. Hasil penelitian menunjukan bahwa dari segi pelaksanaan tradisi basilawek di Kenagarain Kapelgam mengalami perubahan pada waktu pelaksanaan , dahulunya dilaksanakan sesudah shalat magrib namun saat ini dilaksanakan sesudah shalat isya. Perubahan juga terlihat dalam pembacakan surat silawek, dahulunya surat dibacakan sesuai dengan hari meninggalnya almarhum, saat ini surat yang dibacakan sekehendak hati pemuda. Kepedulain pemuda dalam tradisi basilawek pada upacara kematian di Kenagarain Kapelgam terlihat berkurang, belum semua pemuda mengikuti tradisi basilawek. Upaya untuk mempertahankan tradisi basilawek yaitu mengajak dan menghimbau kembali pemuda pemudi untuk mengikuti basilawek, dan memberi pengetahaun sejak dini kepada generasi penerus (anak-anak), serta diadakan pelatihan agar tradisi ini tetap berjalan semestinya untuk lebih baik kedepannya.&#x0D; &#x0D; Kata Kunci : Kepedulian, Pemuda, Tradisi Basilawek&#x0D; &#x0D; [1]Artikel ini ditulis dari skripsi penulis dengan judul Kepedulian Pemuda Dalam Tradisi Basilawek Pada Upacara Kematian di Kenagarian Kapelgam Kecamatan Bayang Kabupaten Pesisir Selatan dengan pembimbingI Dr. Isnarmi, M.Pd, M.A dan pembimbing II Drs. Nurman S, M.Si

Abstract term direct marketing was firstly born in the year 1961 in speech by Lester Wunderman he worked with the big brand American Express. he creates new ways to market direct to consumer. Today trade (buying and selling between the countries become more global .one of the major reasons is to be technology and better transportation and communication make it easier to trade now people and companies can buy the best product from the different companies. According to the U.S. Direct Marketing Association, direct marketing is a way of using one or more advertising methods to contact customers directly and get a quick response or sale. Direct marketing in India has emerged as a vital channel for brand engagement, customer acquisition, and sales growth. Through the growth of the digital technology business are direct interact with customer. Direct marketing differs from the usual mass marketing. Don peppers and Martha Rogers have differentiated the two (the one- to-one future1993). accordingly mass marketing is to be give attention to the average customer and customer profile is not very well known to him. on other side in direct marketing focus on the individual customer and its profile of the individual very well known to the marketer. Direct marketer faces a challenge in communicating with the customer because of the white noise. Marketer sent the information and customer refuse the communication, and they do read the mail, change tv channel, and not pay attention to the advertisement and mails. Major reason of such, large no of the marketer trying to reach with customer and promoting same product. marketer solve such kind of situation by providing various type of incentive and perk and attract more. Sore direct marketing changes the perception of the customer those who are willing and highly interested in the marketing communication. This paper explores direct marketing's scope, impact, and challenges in India, with a special focus on urban-rural dynamics, emerging techniques, and customer perceptions. . Data from a survey of 100 individuals in Delhi NCR supports the study. India’s diversity makes it both a challenging and rewarding space for direct marketing strategies.

Anyone familiar with Bruce Lawrence’s oeuvre knows that the book under review is the culmination of his long and serious engagement with Islam’s foundational texts. His earlier publication, The Qur’an: A Biography (2006), traces the central place of divine revelation in Muslim life and thought for many centuries. The Qur’an inspired its most faithful believers to become predominant in much of the medieval world and, in the process, it was a book that captured the interest and imagination of non-Muslims. Law- rence’s own translation of the Qur’an into English is now in the works. Be- fore completing this admirable feat at the prime of his scholarly life, he offers us an inventory of a number of influential and no less creative—some polemical—attempts at untying the Gordian knot of rendering classical Ar- abic into lucid English. But can God’s eternal word, revealed to Prophet Muhammad in the seventh century, be translated into English at all given the deep-seated differences between the two linguistic worlds in space and time? The answer to this question is not a simple yes or no, as Lawrence explains in this slim but indispensable volume. Unlike scriptures of other world religions, the Qur’an stakes a claim on its linguistic authoritativeness from the onset. Its self-image, as specialists such as Daniel Madigan, Toshi- hiko Izutsu, and Fazlur Rahman have it, was rooted in its unique language. The Qur’anic language is thus not merely one language among others of its time (or anytime) but is the distinctive language of God to be read, stud- ied, memorized and disseminated in the original form. From this angle of vision, no translation of the Qur’an is regarded by the majority of Muslims as the Qur’an itself. Lawrence acknowledges this longstanding credo, or the dominant “filter of orthodoxy,” as he puts it (xxi). The translated Qur’an is, to him, best referred to as a “Koran”. Not that the Arabic and translated texts are radically different in terms of their central messages and moral injunctions, but that the Koran was a historical and not an eternal artefact. The Koran was a product of a human endeavor to make the language of God accessible in the world of man. The filter of orthodoxy was however confronted with an ever-growing and cosmopolitan ummah which, for the most part, consisted of non-Ar- abs who knew little but a rudimentary form of Arabic. Translations became inevitable, as Lawrence informs us. The Arabic Qur’an in its pure form gen- erated Korans in other Muslim languages (Persian, Turkish, Malay, etc.) as Islam grew to become a juggernaut after the death of Muhammad (Chapter 1). And yet, as Islam emerged triumphant as a world-conquering faith, its adversaries saw the urgent need to fully discern the scriptures that made Muslims so powerful. Translations into Latin and then English from the twelfth through the eighteenth centuries were largely born out of hate en- meshed with fear and the passionate desire among translators to convince fellow Christians of “falsehood of the Qur’an” (33). Such adverse motives however turned into an emphatic understanding of what the Qur’an actu- ally stood for, as seen in George Sale and Edward Henry Palmer’s transla- tions. The Orientalists were not all cut from the same cloth. What Lawrence does not show quite clearly was how these early English translations provided the raison d’etre for Muslims to produce their own Korans as a corrective project against the biases of Western Orientalism. In South Asian translations by Muhammad Ali, Abdul Majid Daryabadi, Mar- maduke Pickhall, and Abdullah Yusuf Ali, allusions were made, be it direct- ly or obliquely, to the problems of earlier (non-Muslim) translations, just as they sought (for example) to undo use of the terms “Mohammedan” or “Mohametan” to describe Muslims. Granted that these translators belonged to different Muslim sects, their overriding concern was that the Qur’an suf- fered from imprecise translations into English. South Asian Muslims, in my view, were not only translating the Qur’an. They were arresting the march of a prejudiced form of Orientalism by producing English Korans of their own. In hindsight, their efforts were successful, at least for a while, until the advent of the digital age. The coming of the internet and the expansion of English as a lingua franca of most of the world, as Lawrence handsomely points out, has led to the proliferation of Korans, both online and offline, by Muslims and non-Muslims, conservatives and liberals, orientalists and their detractors, Sunnis and Shi’ites, feminists and artists. To Lawrence, most translations produced in an era of abundance fail to capture the Qur’an’s rhythmic prose, with the exception of a handful. Contemporary Korans are so often contorted by the politics of ideological hegemony and nationalist parochi- alism that hinder scholarly endeavor (Chapters 4-5). Lawrence singles out Saudi translations that purvey a puritanical strand of Islam. Interestingly, there are, within Saudi Arabia itself, less literalist Korans. One wonders whether the current political transition in Saudi Arabia will give rise to newer, state-sponsored translations of the Qur’an. I certainly believe it will. For now, Lawrence shows that Salafism in Saudi Arabia (as elsewhere in the Muslim world, as many analysts have pointed out) is not by any means monochrome and homogenous. It is therefore unsurprising that different Korans have been produced in a highly controlled and conservative state. Meantime, the market is flooded with highly popular alternatives in the likes of those by Thomas Cleary, Muhammad Abdul Haleem, and Tarif Khalidi. Spoilt for choice, Muslims and non-Muslims have now the liberty to choose which translation squares with their respective lingustic tastes, spiritual quests, and worldviews. Lawrence ends the book with the latest and most innovative venture at translating the Qur’an, by artist Sandow Birk. It is a translation that comes in the form of inventive expressions, a graphic Koran, so to speak, intended for an American audience whom Birk believes can discern how the Qur’an addresses their everyday trials and tribulations. The linguistic beauty of the Qur’an, in Birk’s formulation, is best expressed in colorful images. An American himself, Lawrence is most impressed by Birk’s project, couching it as “visual and visionary, it is a hybrid genre designed to reach a new audience not previously engaged either by the Koran or by Islam” (137). Had George Sale and Henry Palmet lived to this day, they would perhaps shudder over such an Americanization of the Qur’an. In displaying art with a Qur’anic glaze, Birk does more than translating the Qur’an to English. He demonstrates how the Qur’an can be embedded and normalized into Anglo-American lives and sensibilities. Provocatively-written, deftly-researched, and a pleasure to read, The Koran in English opens up many promising pathways and novel directions for future research. The specter of the Palestinian-American scholar, Is- mail al-Faruqi, came to mind as I was reading the book. Al-Faruqi once envisioned English becoming an Islamic language, or a language that can express what Islam is more accurately. Al-Faruqi held that this could be achieved by incorporating Arabic terms into the English corpus. Reading The Koran in English tells us that Al-Faruqi’s vision is currently realized in ways he barely imagined, or perhaps, in ways that are more subtle and sublime. In translating the Koran to English—an enterprise that is now undertaken by scholars, popular writers, and artists, and that will undoubt- edly grow exponentially in the years to come—English has been (or is) Ko- ranized. Or, to borrow and inflect Lawrence’s syllogism in the opening of the book: If you don’t know Arabic, you can still understand the Qur’an. By understanding the Qur’an, you can choose to become a Muslim. And if you do not become a Muslim, you may still appreciate and derive much benefit from the Qur’an. Therefore, the Qur’an, or the Koran, is not only for Muslims but for those who care to think and reflect about life and about the divine. Indeed, “He gives wisdom to whom He wills, and whoever has been given wisdom has certainly been granted much good. And none will grasp the message except the people of intellect” (al-Baqara: 269).&#x0D; Khairudin AljuniedMalaysia Chair of Islam in Southeast AsiaGeorgetown University

Anyone familiar with Bruce Lawrence’s oeuvre knows that the book under review is the culmination of his long and serious engagement with Islam’s foundational texts. His earlier publication, The Qur’an: A Biography (2006), traces the central place of divine revelation in Muslim life and thought for many centuries. The Qur’an inspired its most faithful believers to become predominant in much of the medieval world and, in the process, it was a book that captured the interest and imagination of non-Muslims. Law- rence’s own translation of the Qur’an into English is now in the works. Be- fore completing this admirable feat at the prime of his scholarly life, he offers us an inventory of a number of influential and no less creative—some polemical—attempts at untying the Gordian knot of rendering classical Ar- abic into lucid English. But can God’s eternal word, revealed to Prophet Muhammad in the seventh century, be translated into English at all given the deep-seated differences between the two linguistic worlds in space and time? The answer to this question is not a simple yes or no, as Lawrence explains in this slim but indispensable volume. Unlike scriptures of other world religions, the Qur’an stakes a claim on its linguistic authoritativeness from the onset. Its self-image, as specialists such as Daniel Madigan, Toshi- hiko Izutsu, and Fazlur Rahman have it, was rooted in its unique language. The Qur’anic language is thus not merely one language among others of its time (or anytime) but is the distinctive language of God to be read, stud- ied, memorized and disseminated in the original form. From this angle of vision, no translation of the Qur’an is regarded by the majority of Muslims as the Qur’an itself. Lawrence acknowledges this longstanding credo, or the dominant “filter of orthodoxy,” as he puts it (xxi). The translated Qur’an is, to him, best referred to as a “Koran”. Not that the Arabic and translated texts are radically different in terms of their central messages and moral injunctions, but that the Koran was a historical and not an eternal artefact. The Koran was a product of a human endeavor to make the language of God accessible in the world of man. The filter of orthodoxy was however confronted with an ever-growing and cosmopolitan ummah which, for the most part, consisted of non-Ar- abs who knew little but a rudimentary form of Arabic. Translations became inevitable, as Lawrence informs us. The Arabic Qur’an in its pure form gen- erated Korans in other Muslim languages (Persian, Turkish, Malay, etc.) as Islam grew to become a juggernaut after the death of Muhammad (Chapter 1). And yet, as Islam emerged triumphant as a world-conquering faith, its adversaries saw the urgent need to fully discern the scriptures that made Muslims so powerful. Translations into Latin and then English from the twelfth through the eighteenth centuries were largely born out of hate en- meshed with fear and the passionate desire among translators to convince fellow Christians of “falsehood of the Qur’an” (33). Such adverse motives however turned into an emphatic understanding of what the Qur’an actu- ally stood for, as seen in George Sale and Edward Henry Palmer’s transla- tions. The Orientalists were not all cut from the same cloth. What Lawrence does not show quite clearly was how these early English translations provided the raison d’etre for Muslims to produce their own Korans as a corrective project against the biases of Western Orientalism. In South Asian translations by Muhammad Ali, Abdul Majid Daryabadi, Mar- maduke Pickhall, and Abdullah Yusuf Ali, allusions were made, be it direct- ly or obliquely, to the problems of earlier (non-Muslim) translations, just as they sought (for example) to undo use of the terms “Mohammedan” or “Mohametan” to describe Muslims. Granted that these translators belonged to different Muslim sects, their overriding concern was that the Qur’an suf- fered from imprecise translations into English. South Asian Muslims, in my view, were not only translating the Qur’an. They were arresting the march of a prejudiced form of Orientalism by producing English Korans of their own. In hindsight, their efforts were successful, at least for a while, until the advent of the digital age. The coming of the internet and the expansion of English as a lingua franca of most of the world, as Lawrence handsomely points out, has led to the proliferation of Korans, both online and offline, by Muslims and non-Muslims, conservatives and liberals, orientalists and their detractors, Sunnis and Shi’ites, feminists and artists. To Lawrence, most translations produced in an era of abundance fail to capture the Qur’an’s rhythmic prose, with the exception of a handful. Contemporary Korans are so often contorted by the politics of ideological hegemony and nationalist parochi- alism that hinder scholarly endeavor (Chapters 4-5). Lawrence singles out Saudi translations that purvey a puritanical strand of Islam. Interestingly, there are, within Saudi Arabia itself, less literalist Korans. One wonders whether the current political transition in Saudi Arabia will give rise to newer, state-sponsored translations of the Qur’an. I certainly believe it will. For now, Lawrence shows that Salafism in Saudi Arabia (as elsewhere in the Muslim world, as many analysts have pointed out) is not by any means monochrome and homogenous. It is therefore unsurprising that different Korans have been produced in a highly controlled and conservative state. Meantime, the market is flooded with highly popular alternatives in the likes of those by Thomas Cleary, Muhammad Abdul Haleem, and Tarif Khalidi. Spoilt for choice, Muslims and non-Muslims have now the liberty to choose which translation squares with their respective lingustic tastes, spiritual quests, and worldviews. Lawrence ends the book with the latest and most innovative venture at translating the Qur’an, by artist Sandow Birk. It is a translation that comes in the form of inventive expressions, a graphic Koran, so to speak, intended for an American audience whom Birk believes can discern how the Qur’an addresses their everyday trials and tribulations. The linguistic beauty of the Qur’an, in Birk’s formulation, is best expressed in colorful images. An American himself, Lawrence is most impressed by Birk’s project, couching it as “visual and visionary, it is a hybrid genre designed to reach a new audience not previously engaged either by the Koran or by Islam” (137). Had George Sale and Henry Palmet lived to this day, they would perhaps shudder over such an Americanization of the Qur’an. In displaying art with a Qur’anic glaze, Birk does more than translating the Qur’an to English. He demonstrates how the Qur’an can be embedded and normalized into Anglo-American lives and sensibilities. Provocatively-written, deftly-researched, and a pleasure to read, The Koran in English opens up many promising pathways and novel directions for future research. The specter of the Palestinian-American scholar, Is- mail al-Faruqi, came to mind as I was reading the book. Al-Faruqi once envisioned English becoming an Islamic language, or a language that can express what Islam is more accurately. Al-Faruqi held that this could be achieved by incorporating Arabic terms into the English corpus. Reading The Koran in English tells us that Al-Faruqi’s vision is currently realized in ways he barely imagined, or perhaps, in ways that are more subtle and sublime. In translating the Koran to English—an enterprise that is now undertaken by scholars, popular writers, and artists, and that will undoubt- edly grow exponentially in the years to come—English has been (or is) Ko- ranized. Or, to borrow and inflect Lawrence’s syllogism in the opening of the book: If you don’t know Arabic, you can still understand the Qur’an. By understanding the Qur’an, you can choose to become a Muslim. And if you do not become a Muslim, you may still appreciate and derive much benefit from the Qur’an. Therefore, the Qur’an, or the Koran, is not only for Muslims but for those who care to think and reflect about life and about the divine. Indeed, “He gives wisdom to whom He wills, and whoever has been given wisdom has certainly been granted much good. And none will grasp the message except the people of intellect” (al-Baqara: 269).&#x0D; Khairudin AljuniedMalaysia Chair of Islam in Southeast AsiaGeorgetown University

Abstract We examined the influence of mangrove encroachment into salt marsh areas along the northern Gulf of Mexico (USA) on waterfront property owners' perceptions of coastal health and preferences for shoreline management. Using mail‐in and online surveys, we targeted over 3000 waterfront property owners across four jurisdictions experiencing or anticipating mangrove encroachment. Our findings revealed a nuanced perception of coastal health, with many respondents recognizing the potentially environmental impacts of mangrove encroachment but favouring low‐cost management strategies, such as maintaining current shoreline or passive monitoring. This reluctance to engage in active management highlights a perception‐behaviour gap, likely influenced by the gradual nature of mangrove transitions, which diminishes urgency for active intervention. Socio‐demographic factors such as age, gender, income, residency and reliance on coastal resources significantly shaped preferences for shoreline management and regional responses. These preferences varied across jurisdictions, reflecting the importance of incorporating localized community values into management decisions. Our findings highlight the need for a balanced approach to shoreline management that integrates ecological insights with the socio‐cultural priorities of local communities. By aligning adaptation strategies with regional perceptions and values, it is possible to protect individual properties while enhancing the long‐term resilience of coastal ecosystems under climate change pressures. Read the free Plain Language Summary for this article on the Journal blog.

Dr Raphael d’Abdon is a writer, scholar, spoken word poet, editor and translator. In 2007 he complied, translated and edited I nostri semi/Peo tsa rona, an anthology of contemporary South African poetry. In 2011 he translated into Italian (with Lorenzo Mari) Bless Me Father, the autobiography of South African poet Mario d’Offizi. In 2013, he compiled and edited the collection Marikana: A Moment in Time. He is the author of three collections of poems, sunnyside nightwalk (Johannesburg: Geko, 2013), salt water (Johannesburg: Poetree Publishing, 2016) and the bitter herb (East London: The Poets Printery, 2018), and he has read his poetry in South Africa, Nigeria, Somaliland, Italy, Sweden and the USA. His poems are published in journals, magazines and anthologies in South Africa, Nigeria, Ghana, Malawi, Singapore, Palestine, India, Italy, Canada, USA and UK, he is South Africa’s representative of AHN (Africa Haiku Network), and he is a member of ZAPP (The South African Poetry Project) and IPP (International Poetry Project), two joint-projects of the University of Cambridge, UNISA and the University of the Witwatersrand, whose chief aims are to promote poetry in schools in South Africa, UK and beyond, and to instill knowledge, understanding and a love of poetry in young learners.This interview is conducted through e mails in the months of April-May 2020 when Corona virus ravished the world. We saw light through the wings of poesy. We reached out each other through questions and answers about poetry, life and the immediate.

PENGARUH PEMBACAAN DZIKIR PADA IBU MELAHIRKAN TERHADAP TINGKAT NYERI INTRA NATAL DI RUMAH BERSALIN FAJAR YOGYAKARTAEffect of Reading Dhikr Women On The Level Of Birth Pain Intra Christmas At Home Delivery Dawn YogyakartaSri Sumaryani1 &amp; Indri Nurasa21, 2)Program Studi Ilmu Keperawatan Fakultas Kedokteran Universitas Muhammadiyah YogyakartaJl. Lingkar Barat Taman Tirto Kasihan Bantul Yogyakarta 55182*)e-mail: yanipsikumy@gmail.comABSTRAKMelahirkan atau yang biasa disebut dengan proses persalinan merupakan suatu proses membuka dan menipisnya serviks, dan janin turun ke dalam jalan lahir. Gejala awal persalinan akan menimbulkan nyeri yang sangat hebat karena adanya kontraksi uterus dan otot abdomen. Nyeri intra natal adalah suatu nyeri yang dirasakan saat terjadinya proses persalinan (melahirkan). Saat nyeri persalinan muncul, ada baiknya bagi ibu untuk membaca dzikir. Dzikir adalah mengingat Allah SWT dan menghadirkan apa yang tadinya ada di dalam benak untuk kemudian dilafadzkan atau disebut-sebut yang dapat dilakukan secara lisan dengan menggunakan lidah atau bisa juga diucapkan tanpa adanya keterlibatan lidah, yaitu melalui hati. Penelitian ini bertujuan untuk mengetahui pengaruh pembacaan dzikir pada ibu melahirkan terhadap tingkat nyeri intra natal. Teknik pengambilan sampel menggunakan purposive sampling. Desain penelitian pra eksperimen, dengan rancangan pre test-post test tanpa kelompok kontrol. Sampel penelitian berjumlah 30 responden. Pengumpulan data dilakukan dengan observasi langsung kepada responden untuk mengukur tingkat nyeri. Analisa data menggunakan uji statistik wilcoxon signed rank test dan regresi linier dengan menggunakan SPSS 14. Hasil penelitian menunjukkan bahwa hasil uji statistik untuk nilai pre test dan post test tingkat nyeri diperoleh nilai signifikansi 0,02 dengan p &lt; 0,05.Kata kunci: pembacaan dzikir, melahirkan, nyeri intra natal, tingkat nyeriABSTRACTThe delivery or usually called labor process is a process open and thin the cervix, and descent of the fetus into the way of birth. The early symptom of delivery will be appearing very heavy because there are uterus contraction and abdomen muscle. In partum pain is a pain which feel when delivery process happening (labor). When labor pain appears, there is a good for the mother to read dzikir. Dzikir is remembering Allah SWT and make present what before in the mind and then pronounced or make cal can do spoken by tongue or pronounced without there are involving tongue, by heart. The purpose of this research is to know about the influence of reading dzikir to the delivery mother toward in partum level of pain. Technique sampling used purpose sampling. The research of design pre experiment, with pre test-post test without control group design. The sample in this research’s total is 30 respondents. The manner of data was did by direct observation to the respondents to measure pain level. Data analysis used statistic test wilcoxon signed rank test and regression linier in SPSS 14. The results of research showed that results of the statistic pretest and posttest of pain level show significance value 0,02 with p &lt; 0,05.Keywords: reading dzikir, delivery, in partum pain, pain level

Carrier, Roch. The Hockey Sweater: 30th Anniversary Edition. Illus. Sheldon Cohen. Trans. Sheila Fischman. Toronto: Tundra Books, 2014. PrintWhat can one say about “The Hockey Sweater”? Could we simply say it is “most beloved”? No, that was used by Ken Dryden. How about “undeniably a Canadian classic” or “iconic depiction of a truly Canadian experience”? Nope, both done ( by Stephen Harper and Justin Trudeau respectively). Maybe, “will always stand the test of time”? That was taken by Cassie Campbell-Pascall. Could we even go all out and call it the “Bible” of “the Canadian religion”? Roy MacGregor claimed that one. Indeed, the 30th Anniversary Edition has these and more fascinating testimonials by a Who’s Who of Canadian culture.Perhaps, one could highlight why you would add the 30th anniversary edition to your collection (not already having it is reason enough!). This full reproduction of the 1984 illustrated version includes some interesting background by Roch Carrier himself. For example, he reflects on the unexpected popularity of the story (it was originally a last-minute essay for a CBC radio time slot that couldn’t be cancelled) and also relates the challenge for Sheldon Cohen to come up with only thirteen illustrations out of the 10,000 he used for the animated film (the illustrated book – though not the published short story from the radio essay – came after the film). I don’t know about your copies, but mine are a flimsy paperback and a VHS tape, so a longer-lasting hard-cover and DVD would be good (did I mention a DVD of the National Film Board film is included)?If you need more, how about inspiration to do some historical digging? I was inspired to see if the University of Alberta library had the Eaton’s catalogue for the winter of 1946. Fortunately, we do have it on a microfilm (which is always fun to use); unfortunately, the focus is not great. I wasn’t sure whether to look in the Fall/Winter 1945-46 catalogue (if Roch’s story took place in January/February 1946) or in the Fall/Winter 1946-47 (if it was November/December 1946) but that’s the sort of thing historians tend to worry about. The entries are almost identical except the price had increased from $1.65 to $1.75 for “boys’ sizes 28 to 34-inch chest” – so hopefully Monsieur Eaton sent Mrs. Carrier the correct change she asked for. The catalogue text says “many a Canadian boy has his idol in the N.H.L. and wants to have a sweater to represent his favorite team or player.” How intriguing is it that this almost summarizes the story perfectly. Also, only four team jerseys are offered for sale (Toronto, Montreal, Detroit, and New York but not Boston or Chicago); why was that? I won’t even get into whether “jersey” or “sweater” is correct (hint: Eaton’s uses both).It turns out there is lots of material on the internet as well. Here are just a few:Roch Carrier reading the whole story (not the abridged text in the film) and Peter Gzowski responding with his own hockey story. From the CBC digital archives http://www.cbc.ca/player/Digital+Archives/ID/1752124840/A virtual museum exhibit on the history of Canadian mail-order catalogues with a whole section on Roch Carrier and The Hockey Sweater. From the Canadian Museum of History http://www.historymuseum.ca/cmc/exhibitions/cpm/catalog/cat2208e.shtml#050A 2014 CBC interview with Roch Carrier for the 30th Anniversary Edition of the book. http://www.cbc.ca/news/canada/montreal/the-hockey-sweater-by-roch-carrier-celebrates-30-years-1.2845752The 1980 film itself. From NFB https://www.nfb.ca/film/sweater (or in French https://www.nfb.ca/film/chandail_le) A cleaner digitization (than the microfilms in our library) of the hockey sweater page from Eaton’s Fall and Winter 1948-1949 catalogue. However, the entry is completely different than 1946 with all six NHL jerseys offered and price jump to $2.15. From Library and Archives Canada: http://www.collectionscanada.gc.ca/cmc/009002-119.01-e.php?&amp;page_ecopy=nlc003958.490&amp;&amp;&amp;&amp;&amp;&amp;PHPSESSID=t03oo56jrsil3o0q9v5esobn02There are some things I’m still wondering about. Is the story as iconic in French as it is in English? If not, is there something about Sheila Fischman’s translation that makes it so special? (translators seldom get enough credit). The short story version appears in two collections (one English, one French) before the film and illustrated book came out, so was it immediately popular or was it the animations, illustrations, and Roch Carrier’s own beautifully accented narration that created the magic? And, where can I see the symphony version composed by Abigail Richardson who was apparently introduced to it “in grade three when a librarian read it to [her] school class”?I guess there is a lot to say, after all. Like, Roch Carrier was the National Librarian of Canada. He has written many other great stories. A quote from “The Hockey Sweater” and “Le Chandail de hockey” (or is it from “Une abominable feuille d’érable sur la glace”) was on the five-dollar bill. And more …, but I will stop here and let you explore on your own - if you even got this far without jumping up to go read and watch and listen to the real thing. Which you should do. Now. Stop reading and go! P.S., it was suggested I add a short synopsis.Young Quebec boy outgrows his favourite Montreal Canadians jersey. His mom orders a new one. Eaton’s mistakenly sends a Toronto Maple Leafs one. Boy has temper tantrum. Pragmatic mother convinces him to wear it. Boy is ostracized at the local rink; throws another tantrum. The young curate orders him to church to pray for forgiveness. Boy prays for “a hundred million moths” instead.Hmm, Carrier and Cohen’s version is much better. Read and watch theirs instead!Highly Recommended: 4 out of 4 starsReviewer: David SulzDavid is a Public Services Librarian at University of Alberta and liaison librarian to Economics, Religious Studies, and Social Work. He has university studies in Library Studies, History, Elementary Education, Japanese, and Economics; he formerly taught in schools and museums. His interests include physical activity, music, home improvements, and above all, things Japanese.

In rejoinder to a New York Times’s article claiming, “the value of used pianos, especially uprights, has plummeted … Instead of selling them … , donating them … or just passing them along … , owners are far more likely to discard them” (Walkin), artists Kathleen Irwin (scenography) and Jeff Morton (sound/composition) responded to this ignoble passing with an installation playing with the borders delineating music, theatre, digital technology, and economies of value using two upright red pianos, sound and video projection—and the sensibility of relational aesthetics. The installation was a collaboration between two artists who share a common interest in the performative qualities of public space and how technological augmentation is used in identificatory and embodied art processes as a means of extending the human body and enhancing the material space of person-to-person interaction. The title of the installation, PLAY, referenced the etymology of the word itself and how it has been variously understood over time, across artistic disciplines, and in digital and physical environments. Fundamentally, it explored the relative value of a material object (the piano) and how its social and cultural signification persists, shifts, is diminished or augmented by technology. The installation was mounted at the Dunlop Art Gallery, in the Regina Public Library (Saskatchewan, Canada, 14 June - 25 August 2013) and, as such, it illustrated the Library’s mandate to support all forms of literacy through community accessibility and forms of public outreach, social arrangements, and encounters. Indirectly, (as this was not the initial focus), it also exemplified the artists’s gentle probing of the ways, means, claims, and values when layering information and enhancing our visual experience as we interact with (literally, walk through) our physical landscapes and environments—“to see the world for what it is,” as Matt Turbow says “and to see the elements within” (Chapeau). The installation reflected on, among other things, the piano as a still potent cultural signifier, the persistent ability of our imagination to make meaning and codify experience even without digital overlay, and the library as an archive and disseminator of public knowledge. The artists questioned whether old technologies such as the piano will lose their hold on us entirely as technological augmentation develops the means to enhance or colonize the natural world, through graphics, sounds, haptic feedback, smell and, eventually, commodified experiences. This paper intends to reflect on our work and initiate a friendly (playful) interdisciplinary discussion about material objects in the age of physical and digital interactivity, and the terms of augmentation as we chose to understand it through our installation. In response to the call proposed by this journal on the subject of augmentation, we considered: 1. How audio/visual apparatuses in the gallery space augmented the piano’s expressivity; 2. How the piano augmented the social function of its physical situation; 3. How the technology augmented random and fragmentary musical phrases, creating a prolonged musical composition; 4. How each spectator augmented the art through his/her subjective engagement: how there is always meaning generated in excess of the artists’s intention. Image 1: Piano installed outside Dunlop Gallery/ Regina Public Library (photo credit: Jeff Morton) To begin, a brief description of the site of the installation is in order. The first of the red pianos was installed outside the main doors of the Central Library, located in the city’s downtown. The library’s entrance is framed within a two-story glass atrium and the red piano repeated the architecture’s function to open the space by breaking down perceived barriers, and beckoning the passersby inside. Reflecting Irwin’s community-oriented, site-specific practice, this was the relational catalyst of the work—the piano made available for anyone to play and enjoy, day or night, an invitation to respond to an object inserted into the shared space of the sidewalk: to explore, as Nicolas Bourriaud suggests, “the art as a state of encounter” (16). It was the centerpiece of the exhibition's outreach, which included the exhibition’s vernissage featuring new music and performance artists in concert, a costume and prop workshop for a late night public choir procession, and a series of artist talks. This was, arguably, a defining characteristic of the work, underscoring how the work of art, in this case the piano itself, its abjection illustrated by the perfunctory means typically used to dispose of them, is augmented or gains value through its social construction, over-and-above any that is originally ascribed to it. As Bourriaud writes, any kind of production takes on a social form which no longer has anything to do with its original usefulness. It acquires exchange value that partly covers and shrouds its primary “nature”. The fact is that a work of art has no a priori useful function—not that it is socially useless, but because it is available and flexible, and has an “infinite tendency”. (42) In the Dunlop’s press release, curator Blair Fornwald also confers a supplemental value ascribed to the reframed material object. She describes how the public space in front of the library, as a place of social interaction and cultural identification—of “being seen”—is augmented by the red piano: its presence in an unfamiliar setting underscores the multitude of creative and performative possibilities inherent within it, possibilities that may extend far beyond playing a simple melody. By extension, its presence asserts that the every day is a social, cultural, and physical environment rich with potentiality and promise. (Fornwald) Juxtaposed with the first red piano, the second was dramatically staged within the Dunlop gallery. The room, painted black, formally replicated the framing and focusing conventions of the theatre: its intention to propose other ways of “being seen” and to suggest the blurring of lines between “on stage and off,” and by extension, “on line and off.” A camera embedded in the front of the piano and a large projection screen in the space provided a celebrity moment for anyone approaching the instrument and implied, arguably, the ubiquitous surveillance associated with public space. Indeed, a plausible way of reading the red piano in the darkened gallery was as a provocation to think about how the digital and physical are increasingly enmeshed in our daily lives (Jurgenson). Lit by a chandelier and staged on a circular red carpet, this piano was also available to be played. Unlike the one outside of the building, it was augmented by speakers, a microphone, and a webcam. Through a custom-built digital system (using MaxMSP software), it recorded and played back the sound and image of everyone who sat down to perform, then repeated and superimposed these over similar previously captured material. Enhanced by the unusual stark acoustics of the gallery, the sound filled the reverberant space. Affixed to the gallery’s back wall was the projection screen made up of sheet music (Bach, Debussy and Mozart) taken from the Irwin family’s piano bench, a veritable time capsule from the 1950s. Image 2: Piano installed inside Dunlop Gallery (photo credit: Jeff Morton) In addition to the centrally placed piano, a miniature red piano was situated near the gallery entrance. It and a single red chair placed near the screen, repeated the vivid colour and drew the eye into and around the space underscoring its theatrical quality. The toy piano functioned as a lighthearted invitation, as well as a serious citation of other artists—Eikoh Sudoh, Margaret Leng Tan, John Cage, and Charles M. Schulz’s “Schroeder”—who have employed the miniature instrument to great advantage. It was intended as an illustration of the infinite resonances that material objects may provide and the diverse ways they may signify contingent on the viewer. Considered in a historical context, in the golden age of the upright and at the turn of the twentieth-century, piano lessons signified for many, the formation of a modern citizen schooled in European culture and values. Owning one of these intricately engineered and often beautiful machines, as one in five households did, reflected the social aspirations of its owners and marked their upward economic mobility (Canadian Encyclopedia). One hundred years later, pianos are often relegated to the basement or dump. Irretrievably out of tune, their currency as musical instruments largely devalued. Nonetheless, their cultural and social value persists, no longer the pervasive marker of status, but through the ways they are mediated by artists who prepare, deconstruct, and leave them to deteriorate in beautiful ways. They seem to retain their hold on us through the natural impulse to engage them kinetically, ergonomically, and metaphorically. Built to be an extension of the human hand, body, and imagination, they are a sublime human-scale augmentation of a precise musical system of notation, and a mechanism evolved over centuries through physical augmentations meant to increase the expressivity of both instrument and player. In PLAY, the use of the pianos referenced both their traditional role in public life, and our current relationship with forms of digital media that have replaced these instruments as our primary means of being linked, informed, and entertained—an affirmation of the positive attributes of technology and a reminder of what we may have lost. Indeed, while this was not necessarily clear from the written responses in the Gallery’s guest book (Gorgeous!: Neat!; Too, too cool!; etc.), we surmised that memory might have played a key role in the experience of the installation, set in motion by the precise arrangement of the few material objects – red piano, the piano bench, red chair, and toy piano, each object designed to fit the shape of the body and hold the memory of physical contact. These were designed to trigger a chain of recollections, each chasing the next; each actively participating in what follows. In the Gallery’s annual exhibition catalogue, Ellen Moffat suggests that the relationship the piano builds with the player is important: “the piano plays and is played by the performer. Performing the piano assigns a posture for the performer in relation to the keyboard physically and figuratively” (Moffat 80). Technically, the piano is the sum of many parts, understandable finally as a discrete mechanical system, but unbounded in imagination and limited only by our capacity to play it. Functionally, it acts as an affective repository of memory and feeling, a tool to control the variables of physical and expressive interaction. In PLAY, the digital system in the gallery piano captured, delayed and displayed audio and video clips according to a rubric of cause and effect. Controlled by computer software designed by Morton, the installation captured musical phrases played randomly by individuals and augmented these notes by playing them back at variable speeds and superimposing one over another—musical phrases iterated and reiterated. The effect was fugue-like—an indeterminate composition with a determinant structure, achieved by intertwining physical and digital systems with musical content supplied by participants. The camera hidden in the front of the piano recorded individuals as they sat at the instrument and, immediately, they saw themselves projected in extreme close up onto the screen behind. As the individual struck a note, their image faded and the screen was filled again with the image of a previous participant abstracted and in slow motion. The effect, we suggest, was dreamlike—an echo or a fleeting fragment of something barely remembered. Like the infinite variations the piano permits, the software was also capable of expressing immense variety—each sound and image adding to an expanding archive in an ever-changing improvised composition developed through iterative call and response. Drawing on elements of relational aesthetics, scenographic representation, and digital technology, in PLAY we attempted to cross disciplines in ways that distinguished it from the other piano projects seen over the past several years. Indeed, the image of the upright piano has resonated in the zeitgeist of the international art scene with colourful uprights placed in public places in urban centers across Europe and North America. Wherever they are, individuals engage enthusiastically with them and they, in turn, become the centre of attention: this is part of their appeal. The pianos seem to evoke a utopian sense of community, however temporary, providing opportunities to rediscover old neighbours and make new friends. In PLAY, we posed two different social and aesthetic encounters—one analogue, real, “off-line” and one digital, theatrical, and “on-line,” illustrating less a false binary between two possible realities that ascribes more value to one than the other, than a world where the digital and the physical comingle. Working within a public library, this was a germane train of thought considering how these institutes struggle to stay relevant in the age of Google search and the promise of technological augmentation. The piano also represents a dichotomy: both a failure to represent and an excess of meaning. For decades replete with social signification, they have now become an encumbrance, fit only for the bone yard. As these monumental relics come to the end of their mechanical life, there is more money made in their disposal than in musical production, and more value in their recycled metals, solid wooden bodies, and ivory keys then in their tone and function. The industry that supported their commodification collapsed years ago, as has the market for their sale and the popular music publishing industry that accompanied it. Of course, pianos will be with us for a long time in one form or another, but their history, as a culturally potent object, has diverged. The assumption could easily follow that they have been rendered useless as an aesthetic, generative, and social object. What this installation offered was the possibility of an alternative ending to the story of this erstwhile entertainment console even as we seek our amusement by other means and through other devices. Not surprisingly, the title of the installation suggests that the consideration of “play,” as social and recuperative engagement, is significant. In his seminal work, Homo Ludens, Johan Huizinga discusses the importance of play, suggesting that it is primary to and a necessary condition of the making of culture. He writes, “In play there is something in play, which transcends the immediate needs of life and imparts meaning to the action” (Huizinga 97). According to games theorist Mary Flanagan, playing may serve as a way of creating something beautiful, offering frameworks for new ways of thinking, exploring divergent logic, or for imaging what is possible. She writes, “Games, both digital and analog, offer a space to explore creativity, agency, representation and emergent behaviour” (Flanagan 2010). In reaching out to Regina’s downtown community, the Dunlop Art Gallery dispersed some of the playfulness of PLAY in planned and accidental ways, as the outdoor piano became a daily destination for individuals who live rough or in the city’s hostels, some of whom who have enviable musical skills and considerable stage presence. One man came daily with sheet music in hand to practice on the indoor piano—ignoring the inevitable echo and repeat that the software triggered. Another young woman appeared regularly to perform at the outdoor piano, her umbrella raised against sun and rain, wedged under her arm to keep both hands free. Children invariably drew parents to it as they entered or exited the library—for some it may have been the first time they had touched such an instrument. Overall, in press, blogs, and the visitors’s book, responses to the pianos were enthusiastic and positive. One blogger wrote in response to an online publication, Art, Music, News (Beatty), chapeau June 13, 2013 at 11:51am this is most definitely up and running, and it would be interesting to see/hear all that will go on with that red piano. my two-and-a-half year old daughter and i jammed a bit yesterday morning, while a stranger watched and listened, then insisted that i play the same mostly crappy c-blues again while he sang! so i did, and he did, and my daughter and i learned a bit about what he feels about his dog via his singing. it was the highlight of the day for us—I mean really, jamming outside on a very red upright piano with strangers—good times! (Simpson) As evidence of public approbation, for the better part of the summer it stood unprotected on the sidewalk in front of the library encountering only one minor incident of defacement—a rather fragile tag in white spray paint, someone’s name in proper cursive writing. Once repaired and retuned, it became a dynamic focus for the annual Folk Festival that takes over the area for a week in August. In these ways, PLAY fulfilled the Library’s aim of encouraging literacy and reinforcing a sense of community—a social augmentation, in a manner of speaking. As Moffat writes, it encourages the social dimension of participation through community-engagement and dialogic practices. It blurs distinctions between spectator and participant, professional and amateur. It generates relationships between people or social actions. (Moffat 76) Finally, PLAY toyed with the overtones of the word itself—as verb, noun, and adjective—signifier, and metaphor. The title illustrated its obvious current potential and evoked the piano’s past, referencing the glittering world of the stage. While many may have more memories of seeing pianos in disrepair than in the concert hall, its iconic stage setting is never far from the imagination, although this too changes as people from other cultures and backgrounds recognize little cultural capital in such activity. In current vernacular, the word “play” also implies the re-imagination of ourselves in the digital overlays of the future. So we ask, what will be the fate of the piano and its meme in the 22nd century? Will the augmentation of reality enhance our experience of the world in inverse proportion to a loss of social interaction? Conclusion In her essay, Moffat notes that as digital technology replaces the analog piano, a surplus of second-hand uprights has become available. Citing artists Luke Jerram, Monica Yunus, and Camille Zamora (among others), she argues that the use of them as public art coincides with their disappearance, suggesting a farewell or memorial to a collective cultural icon (Moffat 76). What is there in this piece of furniture that speaks to us in art practice? The answer, it would seem, is potential. In a curatorial interview, Irwin suggested the possibility that beyond the artist’s initial meaning, there is always something more—an augmentation. The pleasure of discovering this supplement is part of the pleasure of the subjective experience of the spectator. Similarly, the aleatoric in music composition, refers to the pursuit of chance as a formal determinant and its openness to individual interpretation at the moment of reception. For Morton, the randomness of memory and affect are key components in composition. They cannot be predicted, controlled or quantified; nor can they be denied. There is no correct interpretation or response to music or, indeed, to relational art practice. Moffat concludes, as a multi-faceted media installation, PLAY proposed “a suite, chorus or a polyphony of things” (Moffat 76). Depending on your point of reference, the installation provided a dynamic venue for considering our relationships with material objects, with each other and with new technologies asking how they may or may not augment our reality in ways that supplement real-time, person-to-person interaction. References Beatty, Gregory. “Exciting Goings-On at Central Library.” Prairie Dog Blog 11 June 2013. Bourriaud, Nicolas. Relational Aesthetics. Trans. Simon Pleasance and Fronza Woods. Paris: Les Presses du Réel, 1998. Canadian Encyclopedia. “Piano Building.” ‹http://www.thecanadianencyclopedia.com/en/article/piano-building-emc/›. Chapeau [David Simpson]. “One Response to ‘Exciting Goings-On at Central Library.’” Prairie Dog Blog 13 June 2013. Fornwald, Blair. PLAY. Regina, Saskatchewan: Dunlop Art Gallery. 2013. Flanagan, Mary. “Creating Critical Play.” In Ruth Catlow, Marc Garret and Corrado Morgana, eds., Artists Rethinking Games. Liverpool: Liverpool University Press, 2010. 49-53. Huizinga, Johan. Homo Ludens. Boston: Beacon Press, 1995. Jerram, Luke. Play Me, I’m Yours. Site-Specific Piano Installation. Multiple Venues. 2008-2013. Jurgenson, Nathan. “Digital Dualism versus Augmented Reality.” Cybergology: The Society Pages 24 Feb. 2011. 1 Dec. 2013 ‹http://thesocietypages.org/cyborgology/2011/02/24/digital-dualism-versus-augmented-reality/›. Moffat, Ellen. “Stages and Players” in DAG 2 (2013). Regina: Dunlop Art Gallery, 2013. 75-87. Walkin, Daniel J. “For More Pianos, Last Note Is Thud in the Dump.” New York Times 29 June 2012. Yunus, Monica, and Camille Zamora. Sing for Hope Pianos. Site-Specific Piano Installation and Performance. New York City. 2013.

&#x0D; &#x0D; &#x0D; 1991 An afternoon in late 1991 found me on a Sydney bus reading Brett Easton Ellis’ American Psycho (1991). A disembarking passenger paused at my side and, as I glanced up, hissed, ‘I don’t know how you can read that filth’. As she continued to make her way to the front of the vehicle, I was as stunned as if she had struck me physically. There was real vehemence in both her words and how they were delivered, and I can still see her eyes squeezing into slits as she hesitated while curling her mouth around that final angry word: ‘filth’. Now, almost fifteen years later, the memory is remarkably vivid. As the event is also still remarkable; this comment remaining the only remark ever made to me by a stranger about anything I have been reading during three decades of travelling on public transport. That inflamed commuter summed up much of the furore that greeted the publication of American Psycho. More than this, and unusually, condemnation of the work both actually preceded, and affected, its publication. Although Ellis had been paid a substantial U.S. $300,000 advance by Simon &amp; Schuster, pre-publication stories based on circulating galley proofs were so negative—offering assessments of the book as: ‘moronic … pointless … themeless … worthless (Rosenblatt 3), ‘superficial’, ‘a tapeworm narrative’ (Sheppard 100) and ‘vile … pornography, not literature … immoral, but also artless’ (Miner 43)—that the publisher cancelled the contract (forfeiting the advance) only months before the scheduled release date. CEO of Simon &amp; Schuster, Richard E. Snyder, explained: ‘it was an error of judgement to put our name on a book of such questionable taste’ (quoted in McDowell, “Vintage” 13). American Psycho was, instead, published by Random House/Knopf in March 1991 under its prestige paperback imprint, Vintage Contemporary (Zaller; Freccero 48) – Sonny Mehta having signed the book to Random House some two days after Simon &amp; Schuster withdrew from its agreement with Ellis. While many commented on the fact that Ellis was paid two substantial advances, it was rarely noted that Random House was a more prestigious publisher than Simon &amp; Schuster (Iannone 52). After its release, American Psycho was almost universally vilified and denigrated by the American critical establishment. The work was criticised on both moral and aesthetic/literary/artistic grounds; that is, in terms of both what Ellis wrote and how he wrote it. Critics found it ‘meaningless’ (Lehmann-Haupt C18), ‘abysmally written … schlock’ (Kennedy 427), ‘repulsive, a bloodbath serving no purpose save that of morbidity, titillation and sensation … pure trash, as scummy and mean as anything it depicts, a dirty book by a dirty writer’ (Yardley B1) and ‘garbage’ (Gurley Brown 21). Mark Archer found that ‘the attempt to confuse style with content is callow’ (31), while Naomi Wolf wrote that: ‘overall, reading American Psycho holds the same fascination as watching a maladjusted 11-year-old draw on his desk’ (34). John Leo’s assessment sums up the passionate intensity of those critical of the work: ‘totally hateful … violent junk … no discernible plot, no believable characterization, no sensibility at work that comes anywhere close to making art out of all the blood and torture … Ellis displays little feel for narration, words, grammar or the rhythm of language’ (23). These reviews, as those printed pre-publication, were titled in similarly unequivocal language: ‘A Revolting Development’ (Sheppard 100), ‘Marketing Cynicism and Vulgarity’ (Leo 23), ‘Designer Porn’ (Manguel 46) and ‘Essence of Trash’ (Yardley B1). Perhaps the most unambiguous in its message was Roger Rosenblatt’s ‘Snuff this Book!’ (3). Of all works published in the U.S.A. at that time, including those clearly carrying X ratings, the Los Angeles chapter of the National Organization for Women (NOW) selected American Psycho for special notice, stating that the book ‘legitimizes inhuman and savage violence masquerading as sexuality’ (NOW 114). Judging the book ‘the most misogynistic communication’ the organisation had ever encountered (NOW L.A. chapter president, Tammy Bruce, quoted in Kennedy 427) and, on the grounds that ‘violence against women in any form is no longer socially acceptable’ (McDowell, “NOW” C17), NOW called for a boycott of the entire Random House catalogue for the remainder of 1991. Naomi Wolf agreed, calling the novel ‘a violation not of obscenity standards, but of women’s civil rights, insofar as it results in conditioning male sexual response to female suffering or degradation’ (34). Later, the boycott was narrowed to Knopf and Vintage titles (Love 46), but also extended to all of the many products, companies, corporations, firms and brand names that are a feature of Ellis’s novel (Kauffman, “American” 41). There were other unexpected responses such as the Walt Disney Corporation barring Ellis from the opening of Euro Disney (Tyrnauer 101), although Ellis had already been driven from public view after receiving a number of death threats and did not undertake a book tour (Kennedy 427). Despite this, the book received significant publicity courtesy of the controversy and, although several national bookstore chains and numerous booksellers around the world refused to sell the book, more than 100,000 copies were sold in the U.S.A. in the fortnight after publication (Dwyer 55). Even this success had an unprecedented effect: when American Psycho became a bestseller, The New York Times announced that it would be removing the title from its bestseller lists because of the book’s content. In the days following publication in the U.S.A., Canadian customs announced that it was considering whether to allow the local arm of Random House to, first, import American Psycho for sale in Canada and, then, publish it in Canada (Kirchhoff, “Psycho” C1). Two weeks later, when the book was passed for sale (Kirchhoff, “Customs” C1), demonstrators protested the entrance of a shipment of the book. In May, the Canadian Defence Force made headlines when it withdrew copies of the book from the library shelves of a navy base in Halifax (Canadian Press C1). Also in May 1991, the Australian Office of Film and Literature Classification (OFLC), the federal agency that administers the classification scheme for all films, computer games and ‘submittable’ publications (including books) that are sold, hired or exhibited in Australia, announced that it had classified American Psycho as ‘Category 1 Restricted’ (W. Fraser, “Book” 5), to be sold sealed, to only those over 18 years of age. This was the first such classification of a mainstream literary work since the rating scheme was introduced (Graham), and the first time a work of literature had been restricted for sale since Philip Roth’s Portnoy’s Complaint in 1969. The chief censor, John Dickie, said the OFLC could not justify refusing the book classification (and essentially banning the work), and while ‘as a satire on yuppies it has a lot going for it’, personally he found the book ‘distasteful’ (quoted in W. Fraser, “Sensitive” 5). Moreover, while this ‘R’ classification was, and remains, a national classification, Australian States and Territories have their own sale and distribution regulation systems. Under this regime, American Psycho remains banned from sale in Queensland, as are all other books in this classification category (Vnuk). These various reactions led to a flood of articles published in the U.S.A., Canada, Australia and the U.K., voicing passionate opinions on a range of issues including free speech and censorship, the corporate control of artistic thought and practice, and cynicism on the part of authors and their publishers about what works might attract publicity and (therefore) sell in large numbers (see, for instance, Hitchens 7; Irving 1). The relationship between violence in society and its representation in the media was a common theme, with only a few commentators (including Norman Mailer in a high profile Vanity Fair article) suggesting that, instead of inciting violence, the media largely reflected, and commented upon, societal violence. Elayne Rapping, an academic in the field of Communications, proposed that the media did actively glorify violence, but only because there was a market for such representations: ‘We, as a society love violence, thrive on violence as the very basis of our social stability, our ideological belief system … The problem, after all, is not media violence but real violence’ (36, 38). Many more commentators, however, agreed with NOW, Wolf and others and charged Ellis’s work with encouraging, and even instigating, violent acts, and especially those against women, calling American Psycho ‘a kind of advertising for violence against women’ (anthropologist Elliot Leyton quoted in Dwyer 55) and, even, a ‘how-to manual on the torture and dismemberment of women’ (Leo 23). Support for the book was difficult to find in the flood of vitriol directed against it, but a small number wrote in Ellis’s defence. Sonny Mehta, himself the target of death threats for acquiring the book for Random House, stood by this assessment, and was widely quoted in his belief that American Psycho was ‘a serious book by a serious writer’ and that Ellis was ‘remarkably talented’ (Knight-Ridder L10). Publishing director of Pan Macmillan Australia, James Fraser, defended his decision to release American Psycho on the grounds that the book told important truths about society, arguing: ‘A publisher’s office is a clearing house for ideas … the real issue for community debate [is] – to what extent does it want to hear the truth about itself, about individuals within the community and about the governments the community elects. If we care about the preservation of standards, there is none higher than this. Gore Vidal was among the very few who stated outright that he liked the book, finding it ‘really rather inspired … a wonderfully comic novel’ (quoted in Tyrnauer 73). Fay Weldon agreed, judging the book as ‘brilliant’, and focusing on the importance of Ellis’s message: ‘Bret Easton Ellis is a very good writer. He gets us to a ‘T’. And we can’t stand it. It’s our problem, not his. American Psycho is a beautifully controlled, careful, important novel that revolves around its own nasty bits’ (C1). Since 1991 As unlikely as this now seems, I first read American Psycho without any awareness of the controversy raging around its publication. I had read Ellis’s earlier works, Less than Zero (1985) and The Rules of Attraction (1987) and, with my energies fully engaged elsewhere, cannot now even remember how I acquired the book. Since that angry remark on the bus, however, I have followed American Psycho’s infamy and how it has remained in the public eye over the last decade and a half. Australian OFLC decisions can be reviewed and reversed – as when Pasolini’s final film Salo (1975), which was banned in Australia from the time of its release in 1975 until it was un-banned in 1993, was then banned again in 1998 – however, American Psycho’s initial classification has remained unchanged. In July 2006, I purchased a new paperback copy in rural New South Wales. It was shrink-wrapped in plastic and labelled: ‘R. Category One. Not available to persons under 18 years. Restricted’. While exact sales figures are difficult to ascertain, by working with U.S.A., U.K. and Australian figures, this copy was, I estimate, one of some 1.5 to 1.6 million sold since publication. In the U.S.A., backlist sales remain very strong, with some 22,000 copies sold annually (Holt and Abbott), while lifetime sales in the U.K. are just under 720,000 over five paperback editions. Sales in Australia are currently estimated by Pan MacMillan to total some 100,000, with a new printing of 5,000 copies recently ordered in Australia on the strength of the book being featured on the inaugural Australian Broadcasting Commission’s First Tuesday Book Club national television program (2006). Predictably, the controversy around the publication of American Psycho is regularly revisited by those reviewing Ellis’s subsequent works. A major article in Vanity Fair on Ellis’s next book, The Informers (1994), opened with a graphic description of the death threats Ellis received upon the publication of American Psycho (Tyrnauer 70) and then outlined the controversy in detail (70-71). Those writing about Ellis’s two most recent novels, Glamorama (1999) and Lunar Park (2005), have shared this narrative strategy, which also forms at least part of the frame of every interview article. American Psycho also, again predictably, became a major topic of discussion in relation to the contracting, making and then release of the eponymous film in 2000 as, for example, in Linda S. Kauffman’s extensive and considered review of the film, which spent the first third discussing the history of the book’s publication (“American” 41-45). Playing with this interest, Ellis continues his practice of reusing characters in subsequent works. Thus, American Psycho’s Patrick Bateman, who first appeared in The Rules of Attraction as the elder brother of the main character, Sean – who, in turn, makes a brief appearance in American Psycho – also turns up in Glamorama with ‘strange stains’ on his Armani suit lapels, and again in Lunar Park. The book also continues to be regularly cited in discussions of censorship (see, for example, Dubin; Freccero) and has been included in a number of university-level courses about banned books. In these varied contexts, literary, cultural and other critics have also continued to disagree about the book’s impact upon readers, with some persisting in reading the novel as a pornographic incitement to violence. When Wade Frankum killed seven people in Sydney, many suggested a link between these murders and his consumption of X-rated videos, pornographic magazines and American Psycho (see, for example, Manne 11), although others argued against this (Wark 11). Prosecutors in the trial of Canadian murderer Paul Bernardo argued that American Psycho provided a ‘blueprint’ for Bernardo’s crimes (Canadian Press A5). Others have read Ellis’s work more positively, as for instance when Sonia Baelo Allué compares American Psycho favourably with Thomas Harris’s The Silence of the Lambs (1988) – arguing that Harris not only depicts more degrading treatment of women, but also makes Hannibal Lecter, his antihero monster, sexily attractive (7-24). Linda S. Kauffman posits that American Psycho is part of an ‘anti-aesthetic’ movement in art, whereby works that are revoltingly ugly and/or grotesque function to confront the repressed fears and desires of the audience and explore issues of identity and subjectivity (Bad Girls), while Patrick W. Shaw includes American Psycho in his work, The Modern American Novel of Violence because, in his opinion, the violence Ellis depicts is not gratuitous. Lost, however, in much of this often-impassioned debate and dialogue is the book itself – and what Ellis actually wrote. 21-years-old when Less than Zero was published, Ellis was still only 26 when American Psycho was released and his youth presented an obvious target. In 1991, Terry Teachout found ‘no moment in American Psycho where Bret Easton Ellis, who claims to be a serious artist, exhibits the workings of an adult moral imagination’ (45, 46), Brad Miner that it was ‘puerile – the very antithesis of good writing’ (43) and Carol Iannone that ‘the inclusion of the now famous offensive scenes reveals a staggering aesthetic and moral immaturity’ (54). Pagan Kennedy also ‘blamed’ the entire work on this immaturity, suggesting that instead of possessing a developed artistic sensibility, Ellis was reacting to (and, ironically, writing for the approval of) critics who had lauded the documentary realism of his violent and nihilistic teenage characters in Less than Zero, but then panned his less sensational story of campus life in The Rules of Attraction (427-428). Yet, in my opinion, there is not only a clear and coherent aesthetic vision driving Ellis’s oeuvre but, moreover, a profoundly moral imagination at work as well. This was my view upon first reading American Psycho, and part of the reason I was so shocked by that charge of filth on the bus. Once familiar with the controversy, I found this view shared by only a minority of commentators. Writing in the New Statesman &amp; Society, Elizabeth J. Young asked: ‘Where have these people been? … Books of pornographic violence are nothing new … American Psycho outrages no contemporary taboos. Psychotic killers are everywhere’ (24). I was similarly aware that such murderers not only existed in reality, but also in many widely accessed works of literature and film – to the point where a few years later Joyce Carol Oates could suggest that the serial killer was an icon of popular culture (233). While a popular topic for writers of crime fiction and true crime narratives in both print and on film, a number of ‘serious’ literary writers – including Truman Capote, Norman Mailer, Kate Millet, Margaret Atwood and Oates herself – have also written about serial killers, and even crossed over into the widely acknowledged as ‘low-brow’ true crime genre. Many of these works (both popular or more literary) are vivid and powerful and have, as American Psycho, taken a strong moral position towards their subject matter. Moreover, many books and films have far more disturbing content than American Psycho, yet have caused no such uproar (Young and Caveney 120). By now, the plot of American Psycho is well known, although the structure of the book, noted by Weldon above (C1), is rarely analysed or even commented upon. First person narrator, Patrick Bateman, a young, handsome stockbroker and stereotypical 1980s yuppie, is also a serial killer. The book is largely, and innovatively, structured around this seeming incompatibility – challenging readers’ expectations that such a depraved criminal can be a wealthy white professional – while vividly contrasting the banal, and meticulously detailed, emptiness of Bateman’s life as a New York über-consumer with the scenes where he humiliates, rapes, tortures, murders, mutilates, dismembers and cannibalises his victims. Although only comprising some 16 out of 399 pages in my Picador edition, these violent scenes are extreme and certainly make the work as a whole disgustingly confronting. But that is the entire point of Ellis’s work. Bateman’s violence is rendered so explicitly because its principal role in the novel is to be inescapably horrific. As noted by Baelo Allué, there is no shift in tone between the most banally described detail and the description of violence (17): ‘I’ve situated the body in front of the new Toshiba television set and in the VCR is an old tape and appearing on the screen is the last girl I filmed. I’m wearing a Joseph Abboud suit, a tie by Paul Stuart, shoes by J. Crew, a vest by someone Italian and I’m kneeling on the floor beside a corpse, eating the girl’s brain, gobbling it down, spreading Grey Poupon over hunks of the pink, fleshy meat’ (Ellis 328). In complete opposition to how pornography functions, Ellis leaves no room for the possible enjoyment of such a scene. Instead of revelling in the ‘spine chilling’ pleasures of classic horror narratives, there is only the real horror of imagining such an act. The effect, as Kauffman has observed is, rather than arousing, often so disgusting as to be emetic (Bad Girls 249). Ellis was surprised that his detractors did not understand that he was trying to be shocking, not offensive (Love 49), or that his overall aim was to symbolise ‘how desensitised our culture has become towards violence’ (quoted in Dwyer 55). Ellis was also understandably frustrated with readings that conflated not only the contents of the book and their meaning, but also the narrator and author: ‘The acts described in the book are truly, indisputably vile. The book itself is not. Patrick Bateman is a monster. I am not’ (quoted in Love 49). Like Fay Weldon, Norman Mailer understood that American Psycho posited ‘that the eighties were spiritually disgusting and the author’s presentation is the crystallization of such horror’ (129). Unlike Weldon, however, Mailer shied away from defending the novel by judging Ellis not accomplished enough a writer to achieve his ‘monstrous’ aims (182), failing because he did not situate Bateman within a moral universe, that is, ‘by having a murderer with enough inner life for us to comprehend him’ (182). Yet, the morality of Ellis’s project is evident. By viewing the world through the lens of a psychotic killer who, in many ways, personifies the American Dream – wealthy, powerful, intelligent, handsome, energetic and successful – and, yet, who gains no pleasure, satisfaction, coherent identity or sense of life’s meaning from his endless, selfish consumption, Ellis exposes the emptiness of both that world and that dream. As Bateman himself explains: ‘Surface, surface, surface was all that anyone found meaning in. This was civilisation as I saw it, colossal and jagged’ (Ellis 375). Ellis thus situates the responsibility for Bateman’s violence not in his individual moral vacuity, but in the barren values of the society that has shaped him – a selfish society that, in Ellis’s opinion, refused to address the most important issues of the day: corporate greed, mindless consumerism, poverty, homelessness and the prevalence of violent crime. Instead of pornographic, therefore, American Psycho is a profoundly political text: Ellis was never attempting to glorify or incite violence against anyone, but rather to expose the effects of apathy to these broad social problems, including the very kinds of violence the most vocal critics feared the book would engender. Fifteen years after the publication of American Psycho, although our societies are apparently growing in overall prosperity, the gap between rich and poor also continues to grow, more are permanently homeless, violence – whether domestic, random or institutionally-sanctioned – escalates, and yet general apathy has intensified to the point where even the ‘ethics’ of torture as government policy can be posited as a subject for rational debate. The real filth of the saga of American Psycho is, thus, how Ellis’s message was wilfully ignored. While critics and public intellectuals discussed the work at length in almost every prominent publication available, few attempted to think in any depth about what Ellis actually wrote about, or to use their powerful positions to raise any serious debate about the concerns he voiced. Some recent critical reappraisals have begun to appreciate how American Psycho is an ‘ethical denunciation, where the reader cannot but face the real horror behind the serial killer phenomenon’ (Baelo Allué 8), but Ellis, I believe, goes further, exposing the truly filthy causes that underlie the existence of such seemingly ‘senseless’ murder. But, Wait, There’s More It is ironic that American Psycho has, itself, generated a mini-industry of products. A decade after publication, a Canadian team – filmmaker Mary Harron, director of I Shot Andy Warhol (1996), working with scriptwriter, Guinevere Turner, and Vancouver-based Lions Gate Entertainment – adapted the book for a major film (Johnson). Starring Christian Bale, Chloë Sevigny, Willem Dafoe and Reese Witherspoon and, with an estimated budget of U.S.$8 million, the film made U.S.$15 million at the American box office. The soundtrack was released for the film’s opening, with video and DVDs to follow and the ‘Killer Collector’s Edition’ DVD – closed-captioned, in widescreen with surround sound – released in June 2005. Amazon.com lists four movie posters (including a Japanese language version) and, most unexpected of all, a series of film tie-in action dolls. The two most popular of these, judging by E-Bay, are the ‘Cult Classics Series 1: Patrick Bateman’ figure which, attired in a smart suit, comes with essential accoutrements of walkman with headphones, briefcase, Wall Street Journal, video tape and recorder, knife, cleaver, axe, nail gun, severed hand and a display base; and the 18” tall ‘motion activated sound’ edition – a larger version of the same doll with fewer accessories, but which plays sound bites from the movie. Thanks to Stephen Harris and Suzie Gibson (UNE) for stimulating conversations about this book, Stephen Harris for information about the recent Australian reprint of American Psycho and Mark Seebeck (Pan Macmillan) for sales information. References Archer, Mark. “The Funeral Baked Meats.” The Spectator 27 April 1991: 31. Australian Broadcasting Corporation. First Tuesday Book Club. First broadcast 1 August 2006. Baelo Allué, Sonia. “The Aesthetics of Serial Killing: Working against Ethics in The Silence of the Lambs (1988) and American Psycho (1991).” Atlantis 24.2 (Dec. 2002): 7-24. Canadian Press. “Navy Yanks American Psycho.” The Globe and Mail 17 May 1991: C1. Canadian Press. “Gruesome Novel Was Bedside Reading.” Kitchener-Waterloo Record 1 Sep. 1995: A5. Dubin, Steven C. “Art’s Enemies: Censors to the Right of Me, Censors to the Left of Me.” Journal of Aesthetic Education 28.4 (Winter 1994): 44-54. Dwyer, Victor. “Literary Firestorm: Canada Customs Scrutinizes a Brutal Novel.” Maclean’s April 1991: 55. Ellis, Bret Easton. American Psycho. London: Macmillan-Picador, 1991. ———. Glamorama. New York: Knopf, 1999. ———. The Informers. New York: Knopf, 1994. ———. Less than Zero. New York: Simon &amp; Schuster, 1985. ———. Lunar Park. New York: Knopf, 2005. ———. The Rules of Attraction. New York: Simon &amp; Schuster, 1987. Fraser, James. :The Case for Publishing.” The Bulletin 18 June 1991. Fraser, William. “Book May Go under Wraps.” The Sydney Morning Herald 23 May 1991: 5. ———. “The Sensitive Censor and the Psycho.” The Sydney Morning Herald 24 May 1991: 5. Freccero, Carla. “Historical Violence, Censorship, and the Serial Killer: The Case of American Psycho.” Diacritics: A Review of Contemporary Criticism 27.2 (Summer 1997): 44-58. Graham, I. “Australian Censorship History.” Libertus.net 9 Dec. 2001. 17 May 2006 http://libertus.net/censor/hist20on.html&gt;. Gurley Brown, Helen. Commentary in “Editorial Judgement or Censorship?: The Case of American Psycho.” The Writer May 1991: 20-23. Harris, Thomas. The Silence of the Lambs. New York: St Martins Press, 1988. Harron, Mary (dir.). American Psycho [film]. Edward R. Pressman Film Corporation, Lions Gate Films, Muse Productions, P.P.S. Films, Quadra Entertainment, Universal Pictures, 2004. Hitchens, Christopher. “Minority Report.” The Nation 7-14 January 1991: 7. Holt, Karen, and Charlotte Abbott. “Lunar Park: The Novel.” Publishers Weekly 11 July 2005. 13 Aug. 2006 http://www.publishersweekly.com/article/CA624404.html? pubdate=7%2F11%2F2005&amp;display=archive&gt;. Iannone, Carol. “PC &amp; the Ellis Affair.” Commentary Magazine July 1991: 52-4. Irving, John. “Pornography and the New Puritans.” The New York Times Book Review 29 March 1992: Section 7, 1. 13 Aug. 2006 http://www.nytimes.com/books/97/06/15/lifetimes/25665.html&gt;. Johnson, Brian D. “Canadian Cool Meets American Psycho.” Maclean’s 10 April 2000. 13 Aug. 2006 http://www.macleans.ca/culture/films/article.jsp?content=33146&gt;. Kauffman, Linda S. “American Psycho [film review].” Film Quarterly 54.2 (Winter 2000-2001): 41-45. ———. Bad Girls and Sick Boys: Fantasies in Contemporary Art and Culture. Berkeley: University of California Press, 1998. Kennedy, Pagan. “Generation Gaffe: American Psycho.” The Nation 1 April 1991: 426-8. Kirchhoff, H. J. “Customs Clears Psycho: Booksellers’ Reaction Mixed.” The Globe and Mail 26 March 1991: C1. ———. “Psycho Sits in Limbo: Publisher Awaits Customs Ruling.” The Globe and Mail 14 March 1991: C1. Knight-Ridder News Service. “Vintage Picks up Ellis’ American Psycho.” Los Angeles Daily News 17 November 1990: L10. Lehmann-Haupt, Christopher. “Psycho: Wither Death without Life?” The New York Times 11 March 1991: C18. Leo, John. “Marketing Cynicism and Vulgarity.” U.S. News &amp; World Report 3 Dec. 1990: 23. Love, Robert. “Psycho Analysis: Interview with Bret Easton Ellis.” Rolling Stone 4 April 1991: 45-46, 49-51. Mailer, Norman. “Children of the Pied Piper: Mailer on American Psycho.” Vanity Fair March 1991: 124-9, 182-3. Manguel, Alberto. “Designer Porn.” Saturday Night 106.6 (July 1991): 46-8. Manne, Robert. “Liberals Deny the Video Link.” The Australian 6 Jan. 1997: 11. McDowell, Edwin. “NOW Chapter Seeks Boycott of ‘Psycho’ Novel.” The New York Times 6 Dec. 1990: C17. ———. “Vintage Buys Violent Book Dropped by Simon &amp; Schuster.” The New York Times 17 Nov. 1990: 13. Miner, Brad. “Random Notes.” National Review 31 Dec. 1990: 43. National Organization for Women. Library Journal 2.91 (1991): 114. Oates, Joyce Carol. “Three American Gothics.” Where I’ve Been, and Where I’m Going: Essays, Reviews and Prose. New York: Plume, 1999. 232-43. Rapping, Elayne. “The Uses of Violence.” Progressive 55 (1991): 36-8. Rosenblatt, Roger. “Snuff this Book!: Will Brett Easton Ellis Get Away with Murder?” New York Times Book Review 16 Dec. 1990: 3, 16. Roth, Philip. Portnoy’s Complaint. New York: Random House, 1969. Shaw, Patrick W. The Modern American Novel of Violence. Troy, NY: Whitson, 2000. Sheppard, R. Z. “A Revolting Development.” Time 29 Oct. 1990: 100. Teachout, Terry. “Applied Deconstruction.” National Review 24 June 1991: 45-6. Tyrnauer, Matthew. “Who’s Afraid of Bret Easton Ellis?” Vanity Fair 57.8 (Aug. 1994): 70-3, 100-1. Vnuk, Helen. “X-rated? Outdated.” The Age 21 Sep. 2003. 17 May 2006 http://www.theage.com.au/articles/2003/09/19/1063625202157.html&gt;. Wark, McKenzie. “Video Link Is a Distorted View.” The Australian 8 Jan. 1997: 11. Weldon, Fay. “Now You’re Squeamish?: In a World as Sick as Ours, It’s Silly to Target American Psycho.” The Washington Post 28 April 1991: C1. Wolf, Naomi. “The Animals Speak.” New Statesman &amp; Society 12 April 1991: 33-4. Yardley, Jonathan. “American Psycho: Essence of Trash.” The Washington Post 27 Feb. 1991: B1. Young, Elizabeth J. “Psycho Killers. Last Lines: How to Shock the English.” New Statesman &amp; Society 5 April 1991: 24. Young, Elizabeth J., and Graham Caveney. Shopping in Space: Essays on American ‘Blank Generation’ Fiction. London: Serpent’s Tail, 1992. Zaller, Robert “American Psycho, American Censorship and the Dahmer Case.” Revue Francaise d’Etudes Americaines 16.56 (1993): 317-25. &#x0D; &#x0D; &#x0D; &#x0D; Citation reference for this article&#x0D; &#x0D; MLA Style&#x0D; Brien, Donna Lee. "The Real Filth in : A Critical Reassessment." M/C Journal 9.5 (2006). echo date('d M. Y'); ?&gt; &lt;http://journal.media-culture.org.au/0610/01-brien.php&gt;. APA Style&#x0D; Brien, D. (Nov. 2006) "The Real Filth in American Psycho: A Critical Reassessment," M/C Journal, 9(5). Retrieved echo date('d M. Y'); ?&gt; from &lt;http://journal.media-culture.org.au/0610/01-brien.php&gt;. &#x0D;

When historian Graeme Davison famously declared that “Australia was born urban and quickly grew suburban” (98), he was clearly referring to Melbourne or Sydney, but certainly not Brisbane. Although the Brisbane of 2011 might resemble a contemporary, thriving metropolis, its genealogy is not an urban one. For most of its history, as Gillian Whitlock has noted, Brisbane was “a place where urban industrial society is kept at bay” (80). What distinguishes Brisbane from Australia’s larger southern capital cities is its rapid morphology into a city from a provincial, suburban, town. Indeed it is Brisbane’s distinctive regionalism, with its sub-tropical climate, offering a steamy, fecund backdrop to narratives of the city that has produced a plethora of writing in literary accounts of the city, from author David Malouf through to contemporary writers such as Andrew McGahan, John Birmingham, Venero Armanno, Susan Johnson, and Nick Earls. Brisbane’s lack of urban tradition makes its transformation unique among Australian cities. Its rapid population growth and urban development have changed the way that many people now live in the city. Unlike the larger cities of Sydney or Melbourne, whose inner cities were established on the Victorian model of terrace-row housing on small lots, Brisbane’s early planners eschewed this approach. So, one of the features that gives the city its distinction is the languorous suburban quality of its inner-city areas, where many house blocks are the size of the suburban quarter-acre block, all within coo-ee of the city centre. Other allotments are medium to small in size, and, until recently, housed single dwellings of varying sizes and grandeur. Add to this a sub-tropical climate in which ‘green and growth’ is abundant and the pretty but flimsy timber vernacular housing, and it’s easy to imagine that you might be many kilometres from a major metropolitan centre as you walk around Brisbane’s inner city areas. It is partly this feature that prompted demographer Bernard Salt to declare Brisbane “Australia’s most suburban city” (Salt 5). Prior to urban renewal in the early 1990s, Brisbane was a low-density town with very few apartment blocks; most people lived in standalone houses.From the inception of the first Urban Renewal program in 1992, a joint initiative of the Federal government’s Building Better Cities Program and managed by the Brisbane City Council (BCC), Brisbane’s urban development has undergone significant change. In particular, the city’s Central Business District (CBD) and inner city have experienced intense development and densification with a sharp rise in medium- to high-density apartment dwellings to accommodate the city’s swelling population. Population growth has added to the demand for increased density, and from the period 1995–2006 Brisbane was Australia’s fastest growing city (ABS).Today, parts of Brisbane’s inner city resembles the density of the larger cities of Melbourne and Sydney. Apartment blocks have mushroomed along the riverfront and throughout inner and middle ring suburbs. Brisbane’s population has enthusiastically embraced apartment living, with “empty nesters” leaving their suburban family homes for the city, and apartments have become the affordable option for renters and first home purchasers. A significant increase in urban amenities such as large-scale parklands and river side boardwalks, and a growth in service industries such as cafes, restaurants and bars—a feature of cities the world over—have contributed to the appeal of the city and the changing way that people live in Brisbane.Urbanism demands specific techniques of living—life is different in medium- to high-density dwellings, in populous places, where people live in close proximity to one another. In many ways it’s the antithesis to suburban life, a way of living that, as Davison notes, was established around an ethos of privacy, health, and seclusion and is exemplified in the gated communities seen in the suburbs today. The suburbs are characterised by generosity of space and land, and developed as a refuge and escape from the city, a legacy of the nineteenth-century industrial city’s connection with overcrowding, disease, and disorder. Suburban living flourished in Australia from the eighteenth century and Davison notes how, when Governor Phillip drew up the first town plan for Sydney in 1789, it embodied the aspirations of “decency, good order, health and domestic privacy,” which lie at the heart of suburban ideals (100).The health and moral impetus underpinning the establishment of suburban life—that is, to remove people from overcrowding and the unhygienic conditions of slums—for Davison meant that the suburban ethos was based on a “logic of avoidance” (110). Attempting to banish anything deemed dangerous and offensive, the suburbs were seen to offer a more natural, orderly, and healthy environment. A virtuous and happy life required plenty of room—thus, a garden and the expectation of privacy was paramount.The suburbs as a site of lived experience and cultural meaning is significant for understanding the shift from suburban living to the adoption of medium- to high-density inner-city living in Brisbane. I suggest that the ways in which this shift is captured discursively, particularly in promotional material, are indicative of the suburbs' stronghold on the collective imagination. Reinforcing this perception of Brisbane as a suburban city is a history of literary narratives that have cast Brisbane in ways that set it apart from other Australian cities, and that are to do with its non-urban characteristics. Imaginative and symbolic discourses of place have real and material consequences (Lefebvre), as advertisers are only too well aware. Discursively, city life has been imagined oppositionally from life in the suburbs: the two sites embody different cultural meanings and values. In Australia, the suburbs are frequently a site of derision and satire, characterized as bastions of conformity and materialism (Horne), offering little of value in contrast to the city’s many enchantments and diverse pleasures. In the well-established tradition of satire, “suburban bashing is replete in literature, film and popular culture” (Felton et al xx). From Barry Humphries’s characterisation of Dame Edna Everage, housewife superstar, who first appeared in the 1960s, to the recent television comedy series Kath and Kim, suburbia and its inhabitants are represented as dull-witted, obsessed with trivia, and unworldly. This article does not intend to rehearse the tradition of suburban lampooning; rather, it seeks to illustrate how ideas about suburban living are hard held and how the suburban ethos maintains its grip, particularly in relation to notions of privacy and peace, despite the celebratory discourse around the emerging forms of urbanism in Brisbane.As Brisbane morphed rapidly from a provincial, suburban town to a metropolis throughout the 1990s and early 2000s, a set of metropolitan discourses developed in the local media that presented new ways of inhabiting and imagining the city and offered new affiliations and identifications with the city. In establishing Brisbane’s distinction as a city, marketing material relied heavily on the opposition between the city and the suburbs, implying that urban vitality and diversity rules triumphant over the suburbs’ apparent dullness and homogeneity. In a billboard advertisement for apartments in the urban renewal area of Newstead (2004), images of architectural renderings of the apartments were anchored by the words—“Urban living NOT suburban”—leaving little room for doubt. It is not the design qualities of the apartments or the building itself being promoted here, but a way of life that alludes to utopian ideas of urban life, of enchantment with the city, and implies, with the heavy emphasis of “NOT suburban,” the inferiority of suburban living.The cultural commodification of the late twentieth- and twenty-first-century city has been well documented (Evans; Dear; Zukin; Harvey) and its symbolic value as a commodity is expressed in marketing literature via familiar metropolitan tropes that are frequently amorphous and international. The malleability of such images makes them easily transportable and transposable, and they provided a useful stockpile for promoting a city such as Brisbane that lacked its own urban resources with which to construct a new identity. In the early days of urban renewal, the iconic images and references to powerhouse cities such as New York, London, and even Venice were heavily relied upon. In the latter example, an advertisement promoting Brisbane appeared in the Sydney Morning Herald colour magazine (May 2005). This advertisement represented Brisbane as an antipodean Venice, showing a large reach of the Brisbane river replete with gondolas flanked by the city’s only nineteenth-century riverside building, the Custom’s House. The allusion to traditional European culture is a departure from the usual tropes of “fun and sun” associated with promotions of Queensland, including Brisbane, while the new approach to promoting Brisbane is cognizant of the value of culture in the symbolic and economic hierarchy of the contemporary city. Perhaps equally, the advertisement could be read as ironic, a postmodern self-parodying statement about the city in general. In a nod to the centrality of the spectacle, the advertisement might be a salute to idea of the city as theme park, a pleasure playground and a collective fantasy of escape. Nonetheless, either interpretation presents Brisbane as somewhere else.In other promotional literature for apartment dwellings, suburban living maintains its imaginative grip, evident in a brochure advertising Petrie Point apartments in Brisbane’s urban renewal area of inner-city New Farm (2000). In the brochure, the promise of peace and calm—ideals that have their basis in suburban living—are imposed and promoted as a feature of inner-city living. Paradoxically, while suggesting that a wholesale evacuation and rejection of suburban life is occurring presumably because it is dull, the brochure simultaneously upholds the values of suburbia:Discerning baby boomers and generation X’ers who prefer lounging over latte rather than mowing the quarter acre block, are abandoning suburban living in droves. Instead, hankering after a more cosmopolitan lifestyle without the mind numbing drive to work, they are retreating to the residential mecca, the inner city, for chic shops and a lively dining, arts and theatre culture. (my italics)In the above extract, the rhetoric used to promote and uphold the virtues of a cosmopolitan inner-city life is sabotaged by a language that in many respects capitulates to the ideals of suburban living, and evokes the health and retreat ethos of suburbia. “Lounging” over lattes and “retreating to a residential mecca”[i] allude to precisely the type of suburban living the brochure purports to eschew. Privacy, relaxation, and health is a discourse and, more importantly, a way of living that is in many ways anathema to life in the city. It is a dream-wish that those features most valued about suburban life, can and should somehow be transplanted to the city. In its promotion of urban amenity, the brochure draws upon a somewhat bourgeois collection of cultural amenities and activities such as a (presumably traditional) arts and theatre culture, “lively dining,” and “chic” shops. The appeal to “discerning baby boomers and generation X’ers” has more than a whiff of status and class, an appeal that disavows the contemporary city’s attention to diversity and inclusivity, and frequently the source of promotion of many international cities. In contrast to the suburban sub-text of exclusivity and seclusion in the Petrie Point Apartment’s brochure, is a promotion of Sydney’s inner-city Newtown as a tourist site and spectacle, which makes an appeal to suburban antipathy clear from the outset. The brochure, distributed by NSW Tourism (2000) displays a strong emphasis on Newtown’s cultural and ethnic diversity, and the various forms of cultural consumption on offer. The inner-city suburb’s appeal is based on its re-framing as a site of tourist consumption of diversity and difference in which diversity is central to its performance as a tourist site. It relies on the distinction between “ordinary” suburbs and “cosmopolitan” places:Some cities are cursed with suburbs, but Sydney’s blessed with Newtown — a cosmopolitan neighbourhood of more than 600 stores, 70 restaurants, 42 cafes, theatres, pubs, and entertainment venues, all trading in two streets whose origins lie in the nineteenth century … Newtown is the Catwalk for those with more style than money … a parade where Yves St Laurent meets Saint Vincent de Paul, where Milano meets post-punk bohemia, where Max Mara meets Doc Marten, a stage where a petticoat is more likely to be your grandma’s than a Colette Dinnigan designer original (From Sydney Marketing brochure)Its opening oppositional gambit—“some cities are cursed with suburbs”—conveniently elides the fact that like all Australian cities, Sydney is largely suburban and many of Sydney’s suburbs are more ethnically diverse than its inner-city areas. Cabramatta, Fairfield, and most other suburbs have characteristically high numbers of ethnic groups such as Vietnamese, Korean, Lebanese, and so forth. Recent events, however, have helped to reframe these places as problem areas, rather than epicentres of diversity.The mingling of social groups invites the tourist-flâneur to a performance of difference, “a parade where Yves St Laurent meets Saint Vincent de Paul (my italics), where Milano meets post-punk bohemia,” and where “the upwardly mobile and down at heel” appear in what is presented as something of a theatrical extravaganza. Newtown is a product, its diversity a commodity. Consumed visually and corporeally via its divergent sights, sounds, smells and tastes (the brochure goes on to state that 70 restaurants offer cuisine from all over the globe), Newtown is a “successful neighbourhood experiment in the new globalism.” The area’s social inequities—which are implicit in the text, referred to as the “down at heel”—are vanquished and celebrated, incorporated into the rhetoric of difference.Brisbane’s lack of urban tradition and culture, as well as its lack of diversity in comparison to Sydney, reveals itself in the first brochure while the Newtown brochure appeals to the idea of a consumer-based cosmopolitanism. As a sociological concept, cosmopolitanism refers to a set of "subjective attitudes, outlooks and practices" broadly characterized as “disposition of openness towards others, people, things and experiences whose origin is non local” (Skrbis and Woodward 1). Clearly cosmopolitan attitudes do not have to be geographically located, but frequently the city is promoted as the site of these values, with the suburbs, apparently, forever looking inward.In the realm of marketing, appeals to the imagination are ubiquitous, but discursive practices can become embedded in everyday life. Despite the growth of urbanism, the increasing take up of metropolitan life and the enduring disdain among some for the suburbs, the hard-held suburban values of peace and privacy have pragmatic implications for the ways in which those values are embedded in people’s expectations of life in the inner city.The exponential growth in apartment living in Brisbane offers different ways of living to the suburban house. For a sub-tropical city where "life on the verandah" is a significant feature of the Queenslander house with its front and exterior verandahs, in the suburbs, a reasonable degree of privacy is assured. Much of Brisbane’s vernacular and contemporary housing is sensitive to this indoor-outdoor style of living, a distinct feature and appeal of everyday life in many suburbs. When "life on the verandah" is adapted to inner-city apartment buildings, expectations that indoor-outdoor living can be maintained in the same way can be problematic. In the inner city, life on the verandah may challenge expectations about privacy, noise and visual elements. While the Brisbane City Plan 2000 attempts to deal with privacy issues by mandating privacy screenings on verandahs, and the side screening of windows to prevent overlooking neighbours, there is ample evidence that attitudinal change is difficult. The exchange of a suburban lifestyle for an urban one, with the exposure to urbanity’s complexity, potential chaos and noise, can be confronting. In the Urban Renewal area and entertainment precinct of Fortitude Valley, during the late 1990s, several newly arrived residents mounted a vigorous campaign to the Brisbane City Council (BCC) and State government to have noise levels reduced from local nightclubs and bars. Fortitude Valley—the Valley, as it is known locally—had long been Brisbane’s main area for nightclubs, bars and brothels. A small precinct bounded by two major one-way roads, it was the locus of the infamous ABC 4 Corners “Moonlight State” report, which exposed the lines of corruption between politicians, police, and the judiciary of the former Bjelke-Petersen government (1974–1987) and who met in the Valley’s bars and brothels. The Valley was notorious for Brisbanites as the only place in a provincial, suburban town that resembled the seedy side of life associated with big cities. The BCC’s Urban Renewal Task Force and associated developers initially had a tough task convincing people that the area had been transformed. But as more amenity was established, and old buildings were converted to warehouse-style living in the pattern of gentrification the world over, people started moving in to the area from the suburbs and interstate (Felton). One of the resident campaigners against noise had purchased an apartment in the Sun Building, a former newspaper house and in which one of the apartment walls directly abutted the adjoining and popular nightclub, The Press Club. The Valley’s location as a music venue was supported by the BCC, who initially responded to residents’ noise complaints with its “loud and proud” campaign (Valley Metro). The focus of the campaign was to alert people moving into the newly converted apartments in the Valley to the existing use of the neighbourhood by musicians and music clubs. In another iteration of this campaign, the BCC worked with owners of music venues to ensure the area remains a viable music precinct while implementing restrictions on noise levels. Residents who objected to nightclub noise clearly failed to consider the impact of moving into an area that was already well known, even a decade ago, as the city’s premier precinct for music and entertainment venues. Since that time, the Valley has become Australia’s only regulated and promoted music precinct.The shift from suburban to urban living requires people to live in very different ways. Thrust into close proximity with strangers amongst a diverse population, residents can be confronted with a myriad of sensory inputs—to a cacophony of noise, sights, smells (Allon and Anderson). Expectations of order, retreat, and privacy inevitably come into conflict with urbanism’s inherent messiness. The contested nature of urban space is expressed in neighbour disputes, complaints about noise and visual amenity, and sometimes in eruptions of street violence. There is no shortage of examples in the Brisbane’s Urban Renewal areas such as Fortitude Valley, where acts of homophobia, racism, and other less destructive conflicts continue to be a frequent occurrence. While the refashioned discursive Brisbane is re-presented as cool, cultured, and creative, the tensions of urbanism and tests to civility remain in a process of constant negotiation. This is the way the city’s past disrupts and resists its cool new surface.[i] The use of the word mecca in the brochure occurred prior to 11 September 2001.ReferencesAllon, Fiona, and Kay Anderson. "Sentient Sydney." In Passionate City: An International Symposium. Melbourne: RMIT, School of Media Communication, 2004. 89–97.Australian Bureau of Statistics (ABS). Regional Population Growth, Australia, 1996-2006.Birmingham, John. "The Lost City of Vegas: David Malouf’s Old Brisbane." Hot Iron Corrugated Sky. Ed. R. Sheahan-Bright and S. Glover. St Lucia: U of Queensland P, 2002. xx–xx.Davison, Graeme. "The Past and Future of the Australian Suburb." Suburban Dreaming: An Interdisciplinary Approach to Australian Cities. Ed. L. Johnson. Geelong: Deakin University Press, 1994. xx–xx.Dear, Michael. The Postmodern Urban Condition. Oxford: Blackwell, 2000.Evans, Graeme. “Hard-Branding the Cultural City—From Prado to Prada.” International Journal of Urban and Regional Research 27.2 (2003): 417–40.Evans, Raymond, and Carole Ferrier, eds. Radical Brisbane. Melbourne: The Vulgar Press, 2004.Felton, Emma, Christy Collis, and Phil Graham. “Making Connections: Creative Industries Networks in Outer Urban Locations.” Australian Geographer 14.1 (Mar. 2010): 57–70.Felton, Emma. Emerging Urbanism: A Social and Cultural Study of Urban Change in Brisbane. PhD thesis. Brisbane: Griffith University, 2007.Glover, Stuart, and Stuart Cunningham. "The New Brisbane." Artlink 23.2 (2003): 16–23. Harvey, David. The Condition of Postmodernity: An Enquiry into the Origins of Cultural Change. Cambridge, MA: Blackwell, 1990. Horne, Donald. The Lucky Country: Australia in the Sixties. Ringwood: Penguin, 1964.Lefebvre, Henri. The Production of Space. Oxford: Basil Blackwell, 1991.Malouf, David. Johnno. St Lucia: University of Queensland Press, 1975. ---. 12 Edmondstone Street. London: Penguin, 1986.NSW Tourism. Sydney City 2000. Sydney, 2000.Salt, Bernard. Cinderella City: A Vision of Brisbane’s Rise to Prominence. Sydney: Austcorp, 2005.Skrbis, Zlatko, and Ian Woodward. “The Ambivalence of Ordinary Cosmopolitanism: Investigating the Limits of Cosmopolitanism Openness.” Sociological Review (2007): 1-14.Valley Metro. 1 May 2011 &lt; http://www.valleymetro.com.au/the_valley.aspx &gt;.Whitlock, Gillian. “Queensland: The State of the Art on the 'Last Frontier.’" Westerly 29.2 (1984): 85–90.Zukin, Sharon. The Culture of Cities. Cambridge, MA: Basil Blackwell, 1995.

We Break Up, I Publish: Theorising and Emotional Processing like Taylor Swift In 2007 after the rather painful end of my first long-term same-sex relationship I asked myself two questions (and like a good graduate student wrote a paper about it that was subsequently published): (1) what is love; (2) and if love exists, are queer and straight love somehow different. I asked myself the second question because, unlike my previous “straight” breakups (back when I honestly thought I was straight), this one was different, was far more messy, and seemed to have a lot to do with the fact that my then fresh ex-boyfriend and I had dramatically different ideas about how the relationship should look, work, be codified, or if it should or could be codified. It was an eye-opening experience since the truth that these different ideas existed—basically his point of view—really only “came out” in my mind through the act and learning involved in that breakup. Until then, from a Queer Theory perspective, you could have described me as a “man who had sex with men,” called himself homosexual, but was so homonormative that if you’d approached me with even a light version of Michel Foucault’s thoughts on “Friendship as a Way of Life” I’d have looked at you as queerly, and cluelessly, as possible. Mainstream Queer Theory would have put the end of the relationship down to the difference and conflict between what is pejoratively called the “marriage-chasing-Gay-normaliser,” represented by me, and the “radical-Queer(ness)-of-difference” represented by my ex-boyfriend, although like a lot of theory, that misses the personal (which I recall being political...), and a whole host of non-theoretical problems that plagued that relationship. Basically I thought Queer/Homosexual/Lesbian/Transgendered and the rest of the alphabet soup was exactly the same as Straight folks both with respect to a subjective understanding of the self, social relations and formations, and how you acted or enacted yourself in public and private except in the bedroom.. I thought, since Canada had legalised same-sex marriage, all was well and equal (other than the occasional hate-crime which would then be justly punished). Of course I understood that at that point Canada was the exception and not the rule with respect to same-sex rights and same-sex marriage, so it followed in my mind that most of our time collectively should be spent supporting those south of the border or overseas who still faced restrictions on these basic rights, or out-and-out violence, persecution and even state-sanctioned death for just being who they are and/or trying to express it. And now, five years on, stating that Canada is the exception as opposed to the rule with respect to the legalisation of same-sex marriage and the codification of same-sex rights in law has the potential to be outdated as the recent successes of social movements, court rulings and the tenor of political debate and voting has shifted internationally with rapid speed. But it was only because of that breakup that these theoretical and practical issues had come out of my queer closet and for the first time I started to question some necessary link between love and codification (marriage), and how the queer in Queer relationships does or potentially can disrupt this link. And not just for Queers, but for Straight folk too, which is the primary point that should be underlined now and is addressed at the end of this paper. Because, embittered as I was at the time, I still basically agree with the theoretical position that I came to in that paper on love—based on a queering of the terms of Alain Badiou—where I affirmed that love resisted codification, especially in its queer form, because it is fidelity to an act and truth between two or more partners which resists the rigid walls of State-based codification (Potts, Love Hurts; Badiou, Ethics and Saint Paul). But as one of the peer reviewers for this paper rightly pointed out, the above distinctions between my ex and myself implicitly rely upon a State-centric model of rights and freedoms, which I attacked in the first paper, but which I freely admit I am guilty of utilising and arguing in favour of here. But that is because I am interested, here, not in talking about love as an abstract concept towards which we should work in our personal relationships, but as the state of things, and specifically the state of same-sex marriage and the discourse and images which surrounds it, which means that the State does matter. This is specifically so given the lack of meaningful challenges to the State System in Canada and the US. I maintain, following Butler, that it is through power, and our response to the representatives of power “hailing us,” that we become bodies that matter and subjects (Bodies That Matter; The Psychic Life of Power; and Giving An Account of Oneself). While her re-reading of Althusser in these texts argues that we should come to a philosophical and political position which challenges this State-based form of subject creation and power, she also notes that politically and philosophically we have yet to articulate such a position clearly, and I’d say that this is especially the case for what is covered and argued in the mainstream (media) debate on same-sex marriage. So apropos what is arguably Foucault’s most mature analysis of “power,” and while agreeing that my State-based argument for inclusion and rights does indeed strengthen the “biopolitical” (The History of Sexuality 140 and 145) control over, in this case, Queer populations, I argue that this is nonetheless the political reality with which we are working in and analyzing, and that is my concern here. Despite a personal desire that this not be the case, the State or state sanctioned institutions do continue to hold a monopoly of power in conferring subjecthood and rights. To take a page from Jeremy Bentham, I would say that arguing from a position which does not start from or seriously consider the State as the current basis for rights and subjecthood, though potentially less ethically problematic and more in line with my personal politics, is tantamount to talking and arguing about “nonsense on stilts.” “Caught in a Bad Romance?” Comparing Homonationalist Trajectories and the Appeal of Militarist Discourse to LGBT Grassroots Organisations In comparing the discourses and enframings of the debate over same-sex marriage between Canada in the mid 1990s and early 2000s and in the US today, one might presume that how it came to say “I do” in Canada and how it might or might not get “left at the altar” in the US, is the result of very different national cultures. But this would just subscribe to one of a number of “cultural explanations” for perceived differences between Canada and the US that are usually built upon straw-man comparisons which then pillorise the US for something or other. And in doing so it would continue an obscuration that Canada, unlike the US, is unproblematically open and accepting when it comes to multicultural, multiracial and multisexual diversity and inclusion. Which Canada isn’t nor has it ever been. When you look at the current discourse in both countries—by their key political representatives on the international stage—you find the opposite. In the US, you have President Barack Obama, the first sitting President to come out in favour of same-sex marriage, and the Secretary of State, Hillary Clinton, setting same-sex rights at home and abroad as key policy planks (Gay Rights are Human Rights). Meanwhile, in Canada, you have Prime Minister Stephen Harper, in office since 2006, openly support his Conservative Party’s “traditional marriage” policy which is thankfully made difficult to implement because of the courts, and John Baird, the badly closeted Minister of Foreign Affairs, who doesn’t mention same-sex rights at home or with respect to foreign relations—unless it is used as supplementary evidence to further other foreign policy goals (c.f. Seguin)—only showing off his sexuality outside of the press-gallery to drum up gay-conservative votes or gay-conservative fundraising at LGBTQ community events which his government is then apt to pull funding for (c.f. Bradshaw). Of course my point is not to just reverse the stereotypes, painting an idyllic picture of the US and a grim one of Canada. What I want to problematise is the supposed national cultural distinctions which are naturalised when arguments are made through them as to why same-sex marriage was legalised in Canada, while the Defense of Marriage Act still stands in the US. To follow and extend Jasbir Puar’s argument from Terrorist Assemblages, what we see in both same-sex marriage debates and discourses is really the same phenomenon, but, so far, with different outcomes and having different manifestations. Puar contends that same-sex rights, like most equalising rights for minority groups, are only granted when all three of the following conditions prevail: (1) in a state or narrative of exception, where the nation grants a minority group equal rights because “the nation” feels threatened from without; (2) only on the condition that normalisation (or homonormalisation in the case of the Queer community) occurs, with those who don’t conform pushed further from a place in the national-subject; (3) and that the price of admission into being the “allowed Queer” is an ultra-patriotic identification with the Nation. In Canada, the state or narrative of exception was an “attack” from within which resulted in the third criterion being downplayed (although it is still present). Court challenges in a number of provinces led in each case to a successful ruling in favour of legalising same-sex marriage. Appeals to these rulings made their way to the Supreme Court, who likewise ruled in favour of the legalisation of same-sex marriage. This ruling came with an order to the Canadian Parliament that it had to change the existing marriage laws and definition of marriage to make it inclusive of same-sex marriage. This “attack” was performed by the judiciary who have traditionally (c.f. Makin) been much less partisan in appointment or ruling than their counterparts in the US. When new marriage laws were proposed to take account of the direction made by the courts, the governing Liberal Party and then Prime Minister Paul Martin made it a “free vote” so members of his own party could vote against it if they chose. Although granted with only lacklustre support by the governing party, the Canadian LGBTQ community rejoiced and became less politically active, because we’d won, right? International Queers flocked to Canada—one in four same-sex weddings since legalisation in Canada have been to out of country residents (Postmedia News)—as long as they had the proper socioeconomic profile (which is also a racialised profile) to afford the trip and wedding. This caused a budding same-sex marriage tourism and queer love normalisation industry to be built around the Canada Queer experience because especially at the time of legalisation Canada was still one of the few countries to allow for same-sex marriages. What this all means is that homonationalism in Canada is much less charged. It manifests itself as fitting in and not just keeping up with the Joneses when it comes to things like community engagement and Parent Teacher Association (PTA) meetings, but trying to do them one better (although only by a bit so as not to offend). In essence, the comparatively bland process in the 1990s by which Canada slowly underwent a state of exception by a non-politically charged and non-radical professional judiciary simply interpreting the Canadian Charter of Rights and Freedoms at the provincial and then the federal level is mirrored in the rather bland and non-radical homonationalism which resulted. So unlike the US, the rhetoric of the LGBT community stays subdued unless there’s a hint that the right to same-sex divorce might get hit by Conservative Party guns, in which case all hell breaks loose (c.f. Ha). While the US is subject to the same set of logics for the currently in-progress enactment of legalising same-sex marriage, the state of exception is dramatically different. Puar argues it is the never-ending War on Terror. This also means that the enframings and debate in the US are exceptionally charged and political, leading to a very different type of homonationalism and homonationalist subject than is found in Canada. American homonationalism has not radically changed from Puar’s description, but due to leadership from the top (Obama, Clinton and Lady Gaga) the intensity and thereby structured confinement of what is an acceptable Queer-American subject has become increasingly rigid. What is included and given rights is the hyper-patriotic queer-soldier, the defender of the nation. And what reinforces the rigidity of what amounts to a new “glass closet” for queers is that grassroots organisations have bought into the same rhetoric, logic, and direction as to how to achieve equality as the Homecoming advertisement from the Equal Love Campaign in Britain shows. For the other long-leading nation engaged in the War on Terror narrative, Homecoming provides the imagery of a gay member of the armed services draped in the flag proposing to his partner at the end of duty overseas that ends with the following text: “All men can be heroes. All men can be husbands. End discrimination.” Can’t get more patriotic—and heteronormative with the use of the term “husbands”—than that. Well, unless you’re Lady Gaga. Now Lady Gaga stands out as a public figure whom has taken an explicitly pro-queer and pro-LGBT stance from the outset of her career. And I do not want to diminish the fact that she has been admirably effective in her campaigning and consistent pro-queer and pro-LGBT stance. While above I characterised her input above as leadership from the top, she also, in effect, by standing outside of State Power unlike Obama and Clinton, and being able to be critical of it, is able to push the State in a more progressive direction. This was most obviously evidenced in her very public criticism of the Democratic Party and President Obama for not moving quickly enough to adopt a more pro-queer and pro-LGBT stance after the 2008 election where such promises were made. So Lady Gaga plays a doubled role whereby she also acts as a spokesperson for the grassroots—some would call this co-opting, but that is not the charge made here as she has more accurately given her pre-existing spotlight and Twitter and Facebook presence over to progressive campaigns—and, given her large mainstream media appeal and willingness to use this space to argue for queer and LGBT rights, performs the function of a grassroots organisation by herself as far as the general public is concerned. And in her recent queer activism we see the same sort of discourse and images utilised as in Homecoming. Her work over the first term of Obama’s Presidency—what I’m going to call “The Lady Gaga Offensive”—is indicative: she literally and metaphorically wrapped herself in the American flag, screaming “Obama, ARE YOU LISTENING!!! Repeal ‘Don’t Ask, Don’t Tell’ and [have the homophobic soldiers] go home, go home, go home!” (Lady Gaga Rallies for Repeal of Don’t Ask, Don’t Tell). And presumably to the same home of otherness that is occupied by the terrorist or anything that falls under the blanket of “anti-American” in Puar’s critique of this approach to political activism. This speech was modelled on her highly successful one at the National Equality March in 2009, which she ended with “Bless God and Bless the Gays.” When the highly watched speeches are taken together you literally can’t top them for Americanness, unless it is by a piece of old-fashioned American apple-pie bought at a National Rifle Association (NRA) bake-sale. And is likely why, after Obama’s same-sex “evolution,” the pre-election ads put out by the Democratic Party this year focused so heavily on the repeal of “Don’t Ask, Don’t Tell” and the queer patriotic soldier or veteran’s obligation to or previous service in bearing arms for the country. Now if the goal is to get formal and legal equality quickly, then as a political strategy, to get people onside with same-sex marriage, and from that place to same-sex rights and equal social recognition and respect, this might be a good idea. Before, that is, moving on to a strategy that actually gets to the roots of social inequality and doesn’t rely on “hate of ‘the other’” which Puar’s analysis points out is both a byproduct of and rooted in the base of any nationalist based appeal for minoritarian rights. And I want to underline that I am here talking about what strategy seems to be appealing to people, as opposed to arguing an ethically unproblematic and PC position on equality that is completely inclusive of all forms of love. Because Lady Gaga’s flag-covered and pro-military scream was answered by Obama with the repeal of “Don’t Ask, Don’t Tell” and the extension of some benefits to same-sex couples, and has Obama referring to Gaga as “your leader” in the pre-election ads and elsewhere. So it isn’t really surprising to find mainstream LGBT organisations adopting the same discourse and images to get same-sex rights including marriage. One can also take recent poll numbers from Canada as indicative as well. While only 10 percent of Canadians have trust in political parties, and 17 and 16 percent have trust in Parliament and Prime Minister Harper respectively, a whopping 53 percent have trust in the Canadian Forces (Leblanc). One aspect that undergirds Puar’s argument is that especially at a "time of war," more than average levels of affection or trust is shown for those institutions that defend “us,” so that if the face of that institution is reinscribed to the look of the hyper-patriotic queer-soldier (by advertising of the Homecoming sort which is produced not by the State but by grassroots LGBT organisations), then it looks like these groups seem to be banking that support for Gays and Lesbians in general, and same-sex marriage in specific, will further rise if LGBT and Queer become substantively linked in the imagination of the general public with the armed forces. But as 1980s Rockers Heart Asked: “But There’s Something That You Forgot. What about Love?” What these two homonationalist trajectories and rhetorics on same-sex marriage entirely skip over is how exactly you can codify “love.” Because isn’t that the purpose of marriage? Saying you can codify it is like grasping at a perfectly measured and exact cubic foot of air and telling it to stay put in the middle of a hurricane. So to return to how I ended my earlier exploration of love and if it could or should be codified: it means that as I affirm love, and as I remain in fidelity to it, I subject myself in my fundamental weakness constantly to the "not-known;" to constant heartbreak; to affirmations which I cannot betray as it would be a betrayal of the truth process itself. It's as if at the very moment the Beatles say the words 'All you need is love' they were subjected to wrenching heartbreak and still went on: 'All you need is love...' (Love Hurts) Which is really depressing when I look back at it now. But it was a bad breakup, and I can tend to the morose in word choice and cultural references when depressed. But it also remains essentially my position. If you impose “till death or divorce do us part” on to love you’re really only just participating in the chimera of static love and giving second wind to a patriarchal institution which has had a crappy record when it comes to equality. It also has the potential to preserve asymmetrical roles “traditional marriage” contains from when the institution was only extended to straight couples. And isn’t equality the underlying philosophical principle and political position that we’re supposedly fighting for if we’re arguing for an equal right to get married? Again, it’s important to try and codify the same rights for everyone through the State at the present time because I honestly don’t see major changes confronting the nation state system in Canada or the US in the near future. We remain the play-children of a digitally entrenched form of Foucaultian biopower that is State and Capital directed. Because while the Occupy Wall Street movements got a lot of hay in the press, I’ve yet to see any substantive or mainstreamed political change come out of them—if someone can direct me to their substantive contribution to the recent US election I’d be happy to revise my position—which is likely to our long term detriment. So this is a pragmatic analysis, one of locating one node in the matrices of power relations, of seeing how mainstream LGBT political organisations and Lady Gaga are applying the “theoretical tool kits” given to us by Foucault and Puar, and seeing how these organisations and Gaga are applying them, but in this case in a way that is likely counter to authorial intention(s) and personal politics (Power/Knowledge 145, 193; Terrorist Assemblages). So what this means is that we’re likely to continue to see, in mainstream images of same-sex couples put out by grassroots LGBT organisations, a homonationalism and ideological construction that grows more and more out of touch with Queer realities—the “upper-class house-holding PTA Gay”; although on a positive note I should point out that the Democratic Party in the US seems to be at least including both white and non-white faces in their pre-election same-sex marriage ads—and one that most Queers don’t or can’t fit themselves into especially when it comes down to the economic aspect of that picture, which is contradictory and problematic (c.f. Christopher). It also means that in the US the homonationalism on the horizon looks the same as in Canada except with a healthy dose of paranoia of outsiders and “the other” and a flag draped membership in the NRA, that is, for when the queer super-soldier is not in uniform. It’s a straightjacket for a closet that is becoming smaller because it seeks, through the images projected, inclusion for only a smaller and smaller social sub-set of the Lesbian and Gay community and leaves out more and more of the Queer community than it was five years ago when Puar described it. So instead of trying to dunk the queer into the institution of patriarchy, why not, by showing how so many Queers, their relationships, and their loving styles don’t fit into these archetypes help give everyone, including my “marriage-chasing-Gay-normaliser” former self a little “queer eye, for all eyes.” To look at and see modern straight marriage through the lenses and reasons LGBT and Queer communities (by-and-large) fought for years for access to it: as the codification and breakdown of some rights and responsibilities (i.e. taking care of children); as an act which gives you straightforward access to health benefits and hospital visitation rights; as an easy social signifier for others of a commitment to another person that doesn’t use diluted language like “special friend;” and because when it comes down to it that “in sickness and in health” part of the vow—in the language of a queered Badiou, a vow can be read as the affirmation of a universal and disinterested truth (love) and a moment which can’t be erased retrospectively, say, by divorce—seems like a sincere way to value at least one of those you really care for in the world. And hopefully it, as a side-benefit, it acts as a reminder but is not the actuality of that first fuzzy feeling which (hopefully) doesn’t go away. But I learned my lesson the first time and know that the fuzzy feeling might disappear as it often does. It doesn’t matter how far we try and cram it into any variety of homonationalist closets, since it’ll always find a way to not be there, no matter how tight you thought you’d locked the door to keep it in for good if it wants out. Because you can’t keep emotions by contract: so at the end of the day the logical, ethical and theoretically sound position is to argue for the abolition of marriage as an institution. However, Plato and others have been making that argument for thousands of years, and it still doesn’t seem to have gained popular traction. And we also need to realise, contrary to the opinion of my former self and The Beatles, that you really do need more than love as fidelity to an event of you and your partner’s making when you are being denied your partners health benefits just because you are a same-sex couple, especially when those health benefits could be saving your life. And if same-sex marriage codification is a quick fix for that and similar issues for those who can fit into the State sanctioned same-sex marriage walls, which admittedly leaves some members of the Queer community who don’t overlap out, as part of an overall and more inclusive strategy that does include them then I’m in favour of it. That is, till the time comes that Straight and Queer can, over time and with a lot of mutual social learning, explore how to recognise and give equal rights with or without State based codification to the multiple queer and sometimes polyamorous relationship models that already populate the Gay and Straight worlds right now. So in the meantime continue to count me down as a “marriage-chasing-Gay.” But just pragmatically, not to normalise, as one of a diversity of political strategies for equality and just for now. References Badiou, Alain. Ethics: An Essay on the Understanding of Evil. New York: Verso, 2001. ———. Saint Paul: The Foundation of Universalism, Stanford: Stanford UP, 2003. Bradshaw, James. “Pride Toronto Denied Federal Funding.” The Globe and Mail. 7 May. 2012 ‹http://www.theglobeandmail.com/news/toronto/pride-toronto-denied-federal-funding/article1211065/›. Butler, Judith. Gender Trouble: Feminism and the Subversion of Identity. New York: Routledge,1990. ———. Bodies That Matter: On the Discursive Limits of “Sex”. New York: Routledge, 1993. ———. Excitable Speech: A Politics of the Performative. New York: Routledge, 1997. ———. The Psychic Life of Power: Theories of Subjection. Stanford: Stanford UP, 1997. ———. Giving an Account of Oneself. New York: Fordham UP, 2005. Christopher, Nathaniel. “Openly Gay Men Make Less money, Survey Shows.” Xtra! .5 Nov. 2012 ‹http://www.xtra.ca/public/Vancouver/Openly_gay_men_make_less_money_survey_shows-12756.aspx›. Clinton, Hillary. “Gay Rights Are Human Rights, And Human Rights Are Gay Rights.” United Nations General Assembly. 26 Dec. 2011 ‹http://thinkprogress.org/lgbt/2011/12/06/383003/sec-clinton-to-un-gay-rights-are-human-rights-and-human-rights-are-gay-rights/?mobile=nc›. Foucault, Michel. Power/Knowledge: Selected Interviews and Other Writings 1972-1977. Ed. Colin Gordon. Trans. Colin Gordon, Leo Marshall, John Mepham, Kate Soper. New York: Random House,1980. —. Discipline and Punish: The Birth of the Prison. Trans. Alan Sheridan. Toronto: Random House, 1977. —. The History of Sexuality Volume One: An Introduction. Trans. Robert Hurley. New York: Random House, 1978. Heart. “What About Love.” Heart. Capitol Records, 1985. CD. Ha, Tu Thanh. “Dan Savage: ‘I Had Been Divorced Overnight’.” The Globe and Mail. 12 Jan. 2012 ‹http://www.theglobeandmail.com/news/politics/dan-savage-i-had-been-divorced-overnight/article1358211/›. “Homecoming.” Equal Love Campaign. ‹http://www.youtube.com/watch?v=a54UBWFXsF4›. Leblanc, Daniel. “Harper Among Least Trusted Leaders, Poll Shows.” The Globe and Mail. 12 Nov. 2012 ‹http://www.theglobeandmail.com/news/politics/harper-among-least-trusted-leaders-poll-shows/article5187774/#›. Makin, Kirk. “The Coming Conservative Court: Harper to Reshape Judiciary.” The Globe and Mail. 24 Aug. 2012 ‹http://www.theglobeandmail.com/news/politics/the-coming-conservative-court-harper-to-reshape-judiciary/article595398/›. “Lady Gaga Rallies for Repeal of ‘Don’t Ask, Don’t Tell’ in Portland, Maine.” 9 Sep. 2010 ‹http://www.youtube.com/watch?v=g4rGla6OzGc›. “Lady Gaga Speaks at Gay Rights Rally in Washington DC as Part of the National Equality March.” 11 Oct. 2009 ‹http://www.youtube.com/watch?v=7jepWXu-Z38›. “Obama’s Stirring New Gay Rights Ad.” Newzar.com. 24 May. 2012 ‹http://newzar.com/obamas-stirring-new-gay-rights-ad/›. Postmedia News. “Same-sex Marriage in Canada will not be Revisited, Harper Says.” 12 Jan. 2012 ‹http://news.nationalpost.com/2012/01/12/same-sex-marriage-in-canada-will-not-be-revisited-harper-says/›. Potts, Graham. “‘Love Hurts’: Hunter S. Thompson, the Marquis de Sade and St. Paul Queer Alain Badiou’s Truth and Fidelity.” CTheory. rt002: 2009 ‹http://www.ctheory.net/articles.aspx?id=606›. Puar, Jasbir. Terrorist Assemblages: Homonationalism in Queer Times. London: Duke UP, 2007. Seguin, Rheal. “Baird Calls Out Iran on Human Rights Violations.” The Globe and Mail. 22 Oct. 2012 ‹http://www.theglobeandmail.com/news/politics/baird-calls-out-iran-on-human-rights-violations/article4628968/›.

ExpositionPortland, Oregon (USA) has become known for an artisanal or ‘maker’ economy that relies on a resurgence of place specificity (Heying), primarily expressed and exported to a global audience in the notion of ‘Portland Made’ (Roy). Portland Made reveals a tension immanent in the notion of ‘place’: place is both here and not here, both real and imaginary. What emerges is a complicated picture of how place conceptually captures various intersections of materiality and mythology, aesthetics and economics. On the one hand, Portland Made represents the collective brand-identity used by Portland’s makers to signify a products’ material existence as handcrafted, place-embedded, and authentic. These characteristics lead to certain assumptions about the concept of ‘local’ (Marotta and Heying): what meaning does Portland Made convey, and how is such meaning distributed? On the other hand, the seemingly intentional embedding of place-specificity in objects meant for distribution far outside of Portland begs another type of question: how does Portland come to be discursively representative of these characteristics, and how are such representations distributed to global audiences? How does this global distribution and consumption of immaterial Portland feed back into the production of material Portland?To answer these questions we look to the realm of social media, specifically the popular image-based service Instagram. For the uninitiated, Instagram is a web-based social media service that allows pictures to be shared and seen by anyone that follows a person or business’ Instagram account. Actions include posting original photos (often taken and posted with a cell phone), ‘liking’ pictures, and ‘hash-tagging’ posts with trending terms that increase visibility. Instagram presents us with a complex view of place as both material and virtual, sometimes reifying and sometimes abstracting often-contradictory understandings of place specificity. Many makers use Instagram to promote their products to a broad audience and, in doing so, makers participate in the construction of Portland’s mythology. In this paper, we use empirical insights to theorise makers’ role in shaping and cultivating the virtual and material aspects of place. Additionally, we discuss how makers navigate the complex relationships tied to the importance of place in their specific cultural productions. In the first section, we develop the notion of a curated maker subjectivity. In the second section, we consider the relationship between subjectivity and place. Both sections emphasize how Instagram mediates the relationship between place and subjectivity. Through spotlighting particular literatures in each section, we attempt to fill a gap in the literature that addresses the relationship between subjectivity, place, and social media. Through this line of analysis, we attempt to better understand how and where Portland is made, along with the implications for Portland’s makers.ActionThe insights from this paper came to us inadvertently. While conducting fieldwork that interrogated ‘localism’ and how Portland makers conceptualise local, makers repeatedly discussed the importance of social media to their work. In our fieldwork, Instagram in particular has presented us with new opportunities to query the entanglements of real and virtual embedded in collective identifications with place. This paper draws from interviews conducted for two closely related research projects. The first examines maker ecosystems in three US cities, Portland, Chicago and New York (Doussard et. al.; Wolf-Powers and Levers). We drew from the Portland interviews (n=38) conducted for this project. The second research project is our multi-year examination of Portland’s maker community, where we have conducted interviews (n=48), two annual surveys of members of the Portland Made Collective (n=126 for 2014, n=338 for 2015) and numerous field observations. As will be evident below, our sample of makers includes small crafters and producers from a variety of ‘traditional’ sectors ranging from baking to carpentry to photography, all united by a common identification with the maker movement. Using insights from this trove of data as well as general observations of the changing artisan landscape of Portland, we address the question of how social media mediates the space between Portland as a material place and Portland as an imaginary place.Social Media, Subjectivity, and Authenticity In the post-Fordist era, creative self-enterprise and entrepreneurialism have been elevated to mythical status (Szeman), becoming especially important in the creative and digital industries. These industries have been characterized by contract based work (Neff, Wissinger, and Zukin; Storey, Salaman, and Platman), unstable employment (Hesmondhalgh and Baker), and the logic of flexible specialization (Duffy and Hund; Gill). In this context of hyper individualization and intense competition, creative workers and other entrepreneurs are increasingly pushed to strategically brand, curate, and project representational images of their subjectivity in order to secure new work (Gill), embody the values of the market (Banet-Weiser and Arzumanova), and take on commercial logics of authenticity (Duffy; Marwick and boyd). For example, Duffy and Hund explore how female fashion bloggers represent their branded persona, revealing three interrelated tropes typically used by bloggers: the destiny of passionate work; the presentation of a glam lifestyle; and carefully curated forms of social sharing. These curated tropes obscure the (unpaid) emotional and aesthetic labour (Hracs and Leslie), self-discipline, and capital required to run these blogs. Duffy and Hund also point out that this concealment is generative of particular mythologies about creative work, gender, race, and class. To this list we would add place; below, we will show the use of Instagram by Portland’s makers not only perpetuates particular mythologies about artisan labour and demands self-branding, but is also a spatial practice that is productive of place through the use of visual vernaculars that reflect a localized and globalized articulation of the social and physical milieu of Portland (Hjorth and Gu; Pike). Similar to many other artists and creative entrepreneurs (Pasquinelli and Sjöholm), Portland’s makers typically work long hours in order to produce high quality, unique goods at a volume that will afford them the ability to pay rent in Portland’s increasingly expensive central city neighbourhoods. Much of this work is done from the home: according to our survey of Portland Made Collective’s member firms, 40% consist of single entrepreneurs working from home. Despite being a part of a creative milieu that is constantly captured by the Portland ‘brand’, working long hours, alone, produces a sense of isolation, articulated well by this apparel maker:It’s very isolating working from home alone. [...] The other people I know are working from home, handmade people, I’ll post something, and it makes you realize we’re all sitting at home doing the exact same thing. We can’t all hang out because you gotta focus when you’re working, but when I’m like ugh, I just need a little break from the sewing machine for five minutes, I go on Instagram.This statement paints Instagram as a coping mechanism for the isolation of working alone from home, an important impetus for makers to use Instagram. This maker uses Instagram roughly two hours per workday to connect with other makers and to follow certain ‘trendsetters’ (many of whom also live in Portland). Following other makers allows the maker community to gauge where they are relative to other makers; one furniture maker told us that she was able to see where she should be going based on other makers that were slightly ahead of her, but she could also advise other makers that were slightly behind her. The effect is a sense of collaborative participation in the ‘scene’, which both alleviates the sense of isolation and helps makers gain legitimacy from others in their milieu. As we show below, this participation demands from makers a curative process of identity formation. Jacque Rancière’s intentional double meaning of the French term partage (the “distribution of the sensible”) creates space to frame curation in terms of the politics around “sharing in” and “sharing out” (Méchoulan). For Rancière, the curative aspect of communities (or scenes) reveals something inherently political about aesthetics: the politics of visibility on Instagram “revolve around what is seen and what can be said about it, who has the ability to see and the talent to speak, around the properties of space and the possibilities of time” (8-9). An integral part of the process of curating a particular identity to express over Instagram is reflected by who they follow or what they ‘like’ (a few makers mentioned the fact that they ‘like’ things strategically).Ultimately, makers need followers for their brand (product brand, self-brand, and place-brand), which requires makers to engage in a form of aesthetic labour through a curated articulation of who a maker is–their personal story, or what Duffy and Hund call “the destiny of passionate work”–and how that translates into what they make at the same time. These identities congeal over Instagram: one maker described this as a “circle of firms that are moving together.” Penetrating that circle by curating connections over Instagram is an important branding strategy.As a confections maker told us, strategically using hashtags and stylizing pictures to fit the trends is paramount. Doing these things effectively draws attention from other makers and trendsetters, and, as an apparel maker told us, getting even one influential trendsetter or blogger to follow them on Instagram can translate into huge influxes of attention (and sales) for their business. Furthermore, getting featured by an influential blogger or online magazine can yield instantaneous results. For instance, we spoke with an electronics accessories maker that had been featured in Gizmodo a few years prior, and the subsequent uptick in demand led him to hire over 20 new employees.The formulation of a ‘maker’ subjectivity reveals the underlying manner in which certain subjective characteristics are expressed while others remain hidden; expressing the wrong characteristics may subvert the ability for makers to establish themselves in the milieu. We asked a small Portland enterprise that documents the local maker scene about the process of curating an Instagram photo, especially curious about how they aesthetically frame ‘site visits’ at maker workspaces. We were somewhat surprised to hear that makers tend to “clean too much” ahead of a photo shoot; the photographer we spoke with told us that people want to see the space as it looks when it’s being worked in, when it’s a little messy. The photographer expressed an interest in accentuating the maker’s ‘individual understanding’ of the maker aesthetic; the framing and the lighting of each photo is meant to relay traces of the maker to potential consumers. The desire seems to be the expression and experience of ‘authenticity’, a desire that if captured correctly grants the maker a great deal of purchase in the field of Portland Made consumers. This is all to say that the curation of the workspaces is essential to the construction of the maker subjectivity and the Portland imaginary. Maker workshops are rendered as real places where real makers that belong to an authentic maker milieu produce authentic Portland goods that have a piece of Portland embedded within them (Molotch). Instagram is central in distributing that mythology to a global audience.At this point we can start to develop the relationship between maker subjectivity and place. Authenticity, in this context, appears to be tied to the product being both handmade and place-specific. As the curated imaginary of Portland matures, a growing dialogue emerges between makers and consumers of Portland Made (authentic) goods. This dialogue is a negotiated form of authority in which the maker claims authority while the consumer simultaneously confers authority. The aforementioned place-specificity signals a new layer of magic in regards to Portland’s distinctive position: would ‘making’ in any other place be generative of such authority? According to a number of our interviewees, being from Portland carries the assumption that Portland’s makers have a certain level of expertise that comes from being completely embedded in Portland’s creative scene. This complex interplay between real and virtual treats Portland’s imaginary as a concrete reality, preparing it for consumption by reinforcing the notion of an authoritative collective brand (Portland Made). One bicycle accessory maker claimed that the ability of Portland’s makers to access the Portland brand transmits credibility for makers of things associated with Portland, such as bikes, beer, and crafty goods. This perhaps explains why so many makers use Portland in the name of their company (e.g. Portland Razor Company) and why so many stamp their goods with ‘Made in Portland’.This, however, comes with an added set of expectations: the maker, again, is tasked with cultivating and performing a particular aesthetic in order to achieve legitimacy with their target audience, only this time it ends up being the dominant aesthetic associated with a specific place. For instance, the aforementioned bicycle accessory maker that we spoke with recalled an experience at a craft fair in which many of the consumers were less concerned with his prices than whether his goods were handmade in Portland. Without this legitimation, the good would not have the mysticism of Portland as a place locked within it. In this way, the authenticity of a place becomes metonymic (e.g. Portlandia), similar to how Detroit became known as ‘Motor City’. Portland’s particular authenticity is wrapped up in individuality, craftiness, creativity, and environmental conscientiousness, all things that makers in some way embed in their products (Molotch) and express in the photos on their Instagram feeds (Hjorth).(Social) Media, Place, and the Performance of Aesthetics In this section, we turn our attention to the relationship between subjectivity, place, and Instagram. Scholars have investigated how television production (Pramett), branding (Pike), and locative-based social media (Hjorth, Hjorth and Gu, Hjorth and Lim, Leszczynski) function as spatial practices. The practices affect and govern experiences and interactions with space, thereby generating spatial hybridity (de Souza e Silva). McQuire, for example, investigates the historical formation of the ‘media city’, demonstrating how various media technologies have become interconnected with the architectural structures of the city. Pramett expands on this analysis of media representations of cities by interrogating how media production acts as a spatial practice that produces and governs contested urban spaces, the people in those spaces, and the habitus of the place, forming what she dubs the “media neighbourhood.” The media neighbourhood becomes ordered by the constant opportunities for neighbourhood residents to be involved in media production; residents must navigate and interact with local space as though they may be captured on film or asked to work in the background production at any moment. These material (on site shooting and local hiring practices) and immaterial (textual, musical, and visual representations of a city) production practices become exploitative, extracting value from a place for media industries and developers that capitalize on a place’s popular imaginary.McQuire’s media city and Pramett’s media neighbourhood help us understand the embeddedness of (social) media in the material landscapes of Portland. Over the past few years, Portland has begun experiencing new flows of tourists and migrants–we should note that more than a few makers mentioned in interviews that they moved to Portland in order to become makers–expecting to find what they see on Instagram overlaid materially on the city itself. And indeed, they do: ‘vibrant’ neighbourhood districts such as Alberta Arts, Belmont, Mississippi, Hawthorne, Northwest 23rd, and downtown Portland’s rebranded ‘West End’ are all increasingly full of colourful boutiques that express maker aesthetics and sell local maker goods. Not only do the goods and boutiques need to exemplify these aesthetic qualities, but the makers and the workspaces from which these goods come from, need to fit that aesthetic.The maker subjectivity is developed through the navigation of both real and virtual experiences that contour the social performance of a ‘maker aesthetic’. This aesthetic has become increasingly socially consumed, a trend especially visible on Instagram: as a point of reference, there are at least four Portland-based ‘foodies’ that have over 80,000 followers on Instagram. One visible result of this curated and performed subjectivity and the place-brand it captures is the physical transformation of Portland: (material) space has become a surface onto which the (virtual) Instagram/maker aesthetic is being inscribed, a stage on which the maker aesthetic is performed. The material and immaterial are interwoven into a dramaturgy that gives space a certain set of meanings oriented toward creativity, quirkiness, and consumption. Meanings cultivated over Instagram, then, become productive of meaning in place. These meanings are consumed by thousands of tourists and newly minted Portlanders, as images of people posing in front of Portland’s hipster institutions (such as Salt &amp; Straw or Voodoo Donuts) are captured on iPhones and redistributed back across Instagram for the world to experience. Perhaps this is why Tokyo now has an outpost of Portland’s Blue Star Donuts or why Red Hook (Brooklyn) has its own version of Portland’s Pok Pok. One designer/maker, who had recently relocated to Portland, captured the popular imaginary of Portland in this conversation:Maker: People in Brooklyn love the idea that it came from Portland. People in Seattle love it; people in the Midwest love that it came from Portland right now, because Portland’s like the thing.Interviewer: What does that mean, what does it embody?Maker: They know that it’s local, it like, they know that maker thing is there, it’s in Portland, that they know it’s organic to Portland, it’s local to Portland, there’s this crazy movement that you hear throughout the United States about–Interviewer: So people are getting a piece of that?Maker: Yeah.For us, the dialogical relationship between material and immaterial has never been more entangled. Instagram is one way that makers might control the gap between fragmentation and belonging (i.e. to a particular community or milieu), although in the process they are confronted with an aesthetic distribution that is productive of a mythological sense of place that social media seems to produce, distribute, and consume so effectively. In the era of social media, where sense of place is so quickly transmitted, cities can come to represent a sense of collective identity, and that identity might in turn be distributed across its material landscape.DenouementThrough every wrench turn, every stitching of fabric, every boutique opening, and every Instagram post, makers actively produce Portland as both a local and global place. Portland is constructed through the material and virtual interactions makers engage in, both cultivating and framing everyday interactions in space and ideas held about place. In the first section, we focused on the curation of a maker aesthetic and the development of the maker subjectivity mediated through Instagram. The second section attempted to better understand how those aesthetic performances on Instagram become imprinted on urban space and how these inscriptions feedback to global audiences. Taken together, these performances reveal the complex undertaking that makers adopt in branding their goods as Portland Made. In addition, we hope to have shown the complex entanglements between space and place, production and consumption, and ‘here’ and ‘not here’ that are enrolled in value production at the nexus of place-brand generation.Our investigation opens the door to another, perhaps more problematic set of interrogations which are beyond the scope of this paper. In particular, and especially in consideration of Portland’s gentrification crisis, we see two related sets of displacements as necessary of further interrogation. First, as we answer the question of where Portland is made, we acknowledge that the capturing of Portland Made as a brand perpetuates a process of displacement and “spatio-subjective” regulation that both reflects and reproduces spatial rationalizations (Williams and Dourish). This dis-place-ment renders particular neighbourhoods and populations within Portland, specifically ethnic minorities and the outer edges of the metropolitan area, invisible or superfluous to the city’s imaginary. Portland, as presented by makers through their Instagram accounts, conceals the city’s “power geometries” (Massey) and ignores the broader social context Portland exists in, while perpetuating the exclusion of ethnic minorities from the conversation about what else is made in Portland.Second, as Portland Made has become virtually representative of a deepening connection between makers and place, the performance of such aesthetic labour has left makers to navigate a process that increasingly leads to their own estrangement from the very place they have a hand in creating. This process reveals an absurdity: makers are making the very thing that displaces them. The cultivation of the maker milieu attracts companies, in-movers, and tourists to Portland, thus creating a tight real estate market and driving up property values. Living and working in Portland is increasingly difficult for makers, epitomized by the recent sale and eviction of approximately 500 makers from the Town Storage facility (Hammill). Additionally, industrial space in the city is increasingly coveted by tech firms, and competition over such space is being complicated by looming zoning changes in Portland’s new comprehensive plan.Our conclusions suggest additional research is needed to understand the relationship(s) between such aesthetic performance and various forms of displacement, but we also suggest attention to the global reach of such dynamics: how is Portland’s maker ecosystem connected to the global maker community over social media, and how is space shaped differentially in other places despite a seemingly homogenizing maker aesthetic? Additionally, we do not explore policy implications above, although there is significant space for such exploration with consideration to the attention that Portland and the maker movement in general are receiving from policymakers hungry for a post-Fordist magic bullet. ReferencesBanet-Weiser, Sarah, and Inna Arzumanova. “Creative Authorship, Self-Actualizing Women, and the Self-Brand.” Media Authorship. Eds. Cynthia Chris and David A. Gerstner. New York, NY: Routledge, 2012: 163-179. De Souza e Silva, Adriana. “From Cyber to Hybrid: Mobile Technologies as Interfaces of Hybrid Spaces.” Space and Culture 9.3 (2006): 261–278.Duffy, Brooke Erin, “The Romance of Work: Gender and Aspirational Labour in the Digital Culture Industries.” International Journal of Cultural Studies (2015): 1–17. Duffy, Brooke Erin, and Emily Hund. “‘Having It All’ on Social Media: Entrepreneurial Femininity and Self-Branding among Fashion Bloggers.” Social Media + Society 1.2 (2015): n. pag. Doussard, Marc, Charles Heying, Greg Schrock, and Laura Wolf-Powers. Metropolitan Maker Networks: The Role of Policy, Organization, and "Maker-Enabling Entrepreneurs" in Building the Maker Economy. Progress update to the Ewing Marion Kauffman Foundation. 2015. Gill, Rosalind. “‘Life Is a Pitch’: Managing the Self in New Media Work.” Managing Media Work (2010): n. pag. Hammill, Luke. "Sale of Towne Storage Building Sends Evicted Artists, Others Scrambling for Space." The Oregonian, 2016.Hesmondhalgh, David, and Sarah Baker. Creative Labour: Media Work in Three Cultural Industries. London, UK: Routledge, 2011. Heying, Charles. Brew to Bikes: Portland’s Artisan Economy. Portland, OR: Ooligan Press, 2010. Hjorth, Larissa. “The Place of the Emplaced Mobile: A Case Study into Gendered Locative Media Practices.” Mobile Media &amp; Communication 1.1 (2013): 110–115. Hjorth, Larissa, and Kay Gu. “The Place of Emplaced Visualities: A Case Study of Smartphone Visuality and Location-Based Social Media in Shanghai, China.” Continuum: Journal of Media &amp; Cultural Studies 26.5 (2012): 699–713. Hjorth, Larissa, and Sun Sun Lim. “Mobile Intimacy in an Age of Affective Mobile Media.” Feminist Media Studies 12.4 (2012): 477–484. Hracs, Brian J., and Deborah Leslie. “Aesthetic Labour in Creative Industries: The Case of Independent Musicians in Toronto, Canada.” Area 46.1 (2014): 66–73. Leszczynski, A. “Spatial Media/tion.” Progress in Human Geography 39.6 (2014): 729–751. Marotta, Stephen, and Charles Heying. “Interrogating Localism: What Does ‘Made in Portland’ Really Mean?” Craft Economies: Cultural Economies of the Handmade. Eds. Susan Luckman and Nicola Thomas. London, UK: Bloomsbury Academic: forthcoming. Marwick, Alice E., and danah boyd. “I Tweet Honestly, I Tweet Passionately: Twitter Users, Context Collapse, and the Imagined Audience.” New Media &amp; Society 13.1 (2011): 114–133. Massey, Doreen. “A Global Sense of Place.” Space, Place, and Gender. Minneapolis, MN: University of Minnesota Press, 1994. McQuire, Scott. The Media City: Media, Architecture and Urban Space. Los Angeles, CA: Sage Publications Inc., 2008. Mechoulan, Eric. “Introduction: On the Edges of Jacques Ranciere.” SubStance 33.1 (2004): 3–9. Molotch, Harvey. “Place in Product.” International Journal of Urban and Regional Research 26.4 (2003): 665–688. Neff, Gina, Elizabeth Wissinger, and Sharon Zukin. “Entrepreneurial Labor among Cultural Producers: ‘Cool’ Jobs in ‘Hot’ Industries.” Social Semiotics 15.3 (2005): 307–334. Pasquinelli, Cecilia, and Jenny Sjöholm. “Art and Resilience: The Spatial Practices of Making a Resilient Artistic Career in London.” City, Culture and Society 6.3 (2015): 75–81. Pike, Andy. “Placing Brands and Branding: A Socio-Spatial Biography of Newcastle Brown Ale.” Transactions of the Institute of British Geographers 36.2 (2011): 206–222. ———. “Progress in Human Geography Geographies of Brands and Branding Geographies of Brands and Branding.” (2009): 1–27. Ranciere, Jacque. The Politics of Aesthetics. London: Bloomsbury Academic, 2004. Roy, Kelley. Portland Made. Portland, OR: Self-Published, 2015.

Introduction On Saturday 6 February 1954, on the third day of the Australian leg of their tour of the Commonwealth, Queen Elizabeth II and Prince Philip, the Duke of Edinburgh, visited Sydney’s Bondi Beach. The specially-staged Royal Surf Carnival they witnessed—comprising a spectacular parade, surf boat races, mock resuscitations and even unscheduled surf rescues—generated extensive media coverage. Attracting attention from historians (Warshaw 134; Ford 194–196), the carnival lingers in popular memory as not only a highlight of the Australian tour (Conway n.p.; Clark 8) and among the “most celebrated events in Australian surf lifesaving history” (Ford et al. 5) but also as “the most spectacular occasion [ever held] at Bondi Beach” (Lawrence and Sharpe 86). It is even, for some, a “highlight of the [Australian] post-war period” (Ford et al. 5). Despite this, the fuller history of the Queen’s visit to Bondi, including the detailed planning involved, remains unexplored. A small round tin medal, discovered online, offered a fresh way to approach this event. 31mm in diameter, 2mm in depth, this dual-sided, smooth-edged medal hangs from a hoop on approximately 80mm of discoloured, doubled red, white, and blue striped ribbon, fastened near its end with a tarnished brass safety pin. The obverse features a relief portrait of the youthful Queen’s face and neck in profile, her hair loosely pulled back into a low chignon, enclosed within a striped symmetrical scrolled border of curves and peaks. This is encircled with another border inscribed in raised capitals: “Her Majesty Queen Elizabeth II. Royal Visit to Waverley N.S.W.” The reverse features a smooth central section encircled with the inscription (again in raised capitals), “Presented to the Children of Waverley N.S.W. 1954”, the centre inscribed, “By Waverley Municipal Council C.A. Jeppesen Mayor”. Figs. 1 &amp; 2: Medal, c.1954. Collection of the Author. Medals are often awarded in recognition of achievement and, in many cases, are worn as prominent components of military and other uniforms. They can also be made and gifted in commemoration, which was the case with this medal, one of many thousands presented in association with the tour. Made for Waverley Council, it was presented to all schoolchildren under 15 in the municipality, which included Bondi Beach. Similar medals were presented to schoolchildren by other Australian councils and States in Australia (NAA A462). This gifting was not unprecedented, with medals presented to (at least some) Australian schoolchildren to commemorate Queen Victoria’s 1897 Diamond Jubilee (The Age 5; Sleight 187) and the 1937 coronation of King George VI and Queen Elizabeth (“Coronation Medals” 6). Unable to discover any provenance for this medal aside from its (probable) presentation in 1954 and listing for sale in 2021, I pondered instead Waverley Council’s motivation in sourcing and giving these medals. As a researcher, this assisted me in surmounting the dominance of the surf carnival in the history of this event and led to an investigation of the planning around the Bondi visit. Planning Every level of government was involved in planning the event. Created within the Prime Minister’s Department, the Royal Visit Organisation 1954—staffed from early 1953, filling positions from within the Commonwealth Public Service, armed services and statutory authorities—had overall authority over arrangements (NAA 127, 134). National planning encompassed itineraries, travel arrangements, security, public relations, and protocol as well as fly and mosquito control, the royals’ laundry arrangements, and advice on correct dress (NAA: A1533; NAA: A6122; NAA: A9708, RV/DD Annex.15; NAA: A1838, 1516/11 Parts 1&amp;2; NAA: A9708, RV/CD; NAA: A9708, RV/CQ; NAA: A9708, RV/T). Planning conferences were held with State officials who developed State visit programs and then devolved organisational responsibilities to Councils and other local organisations (NAA: A9708, RV/DD Annex.2; NAA: A9708, RV/DD Annex.3). Once the Bondi Beach location was decided, the Surf Life Saving Association of Australia received a Royal Command to stage a surf carnival for the royals. This command was passed to the president of the Bondi club, who organised a small delegation to meet with government representatives. A thirteen-member Planning Committee, all men (“The Queen to See” 12), was appointed “with full power to act without reference to any other body” (Meagher 6). They began meeting in June 1953 and, soon after this, the carnival was announced in the Australian press. In recognition, the “memorable finale” of a Royal Command Performance before the Queen in London in November 1953 marked the royal couple’s impending tour by filling the stage with people from Commonwealth countries. This concluded with “an Australian tableau”. Alongside people dressed as cricketers, tennis players, servicemen, and Indigenous people, a girl carrying a huge bunch of bananas, and a couple in kangaroo suits were six lifesavers dressed in Bondi march-past costumes and caps, carrying the club flag (Royal Variety Charity n.p.). In deciding on a club for the finale, Bondi was “seen the epitome of the surf lifesaving movement—and Australia” (Brawley 82). The Planning Committee worked with representatives from the police, army, government, local council, and ambulance services as well as the media and other bodies (Meagher 6). Realising the “herculean task” (Meagher 9) ahead, the committee recruited some 170 members (again all men) and 20 women volunteers from the Bondi and North Bondi Surf Clubs to assist. This included sourcing and erecting the carnival enclosure which, at over 200 meters wide, was the largest ever at the beach. The Royal dais that would be built over the promenade needed a canvas cover to shield the royal couple from the heat or rain. Seating needed to be provided for some 10,500 paying spectators, and eventually involved 17 rows of tiered seating set across the promenade, 2,200 deckchairs on the sand in front, and, on each flank, the Bondi Surf Club’s tiered stands. Accommodations also had to be provided at selected vantage points for some 100 media representatives, with a much greater crowd of 50–60,000 expected to gather outside the enclosure. Four large tents, two at each end of the competition area, would serve as both change rooms and shady rest areas for some 2,000 competitors. Two additional large tents were needed, one at each end of the lawns behind the beach, fitted out with camp stretchers that had to be sourced for the St John Ambulance Brigade to deal with first-aid cases, most of whom were envisaged to come from the crowds due to heat stroke (Meagher 6–7). The committee also had to solve numerous operational issues not usually associated with running a surf carnival, such as ensuring sufficient drinking water for so many people on what might be a very hot day (“The Queen to See” 12). With only one tap in the carnival area, the organisers had to lay a water line along the entire one-kilometre length of the promenade with double taps every two to three metres. Temporary toilets also had to be sourced, erected, and serviced. Self-financing and with costs adding up, sponsors needed to be secured to provide goods and services in return for advertising. An iced water unit was, for instance, provided on the dais, without cost, by the ElectrICE Commercial Refrigeration company. The long strip of red carpet laid from where the royals would alight from their car right through the dais was donated by the manufacturer of Feltex, a very popular Australian-made wool carpet. Prominent department store, Anthony Horden’s, loaned the intricately carved chairs to be used by the Royal couple and other officials, while The Bondi Diggers Club provided chrome plated chairs for other official guests, many of whom were the crew of royal yacht, the S.S. Gothic (Meagher 6). Fig. 3: “Feltex [Advertisement].” The Australian Home Beautiful Nov. 1954: 40. http://nla.gov.au/nla.obj-2985285882. The Ladies Committees of the Bondi and North Bondi surf clubs were tasked with organising and delivering lunch and drinks to over 400 officials, all of whom were to stay in position from early morning until the carnival concluded at 5 pm (Meagher 6). Girl members of the Bondi social clubs were to act as usherettes. Officials describe deciding who would meet, or even come in any close proximity to, the Queen as “most ticklish” and working with mayors and other officials a “headache” (“Socialites” 3). In Bondi, there were to be notably few officials sitting with the royal couple, but thousands of “ordinary” spectators seated around the carnival area. On her arrival, it was planned that the Queen would walk through a guard of honour of lifesavers from each Australian and New Zealand club competing in the carnival. After viewing the finals of the surf boat races, the Queen would meet the team captains and then, in a Land Rover, inspect the massed lifesavers and greet the spectators. Although these activities were not contentious, debate raged about the competitors’ uniforms. At this time, full-length chest-covering costumes were normally worn in march-past and other formal events, with competitors stripping down to trunks for surf races and beach events. It was, however, decided that full-length costumes would be worn for the entirety of the Queen’s visit. This generated considerable press commentary that this was ridiculous, and charges that Australians were ashamed of their lifesavers’ manly chests (“Costume Rule” 3). The president of the Bondi Life Saving Club, however, argued that they did not want the carnival spoiled by lifesavers wearing “dirty … track suits, football guernseys … old football shorts … and just about everything except proper attire” (ctd. in Jenkings 1). Waverley Council similarly attempted to control the appearance of the route through which the royals would travel to the beach on the day of the carnival. This included “a sequence of signs along the route” expressing “the suburb’s sentiments and loyalty” (“Queen in the Suburbs” 4; see also, “The Royal Tour” 9). Maintaining that “the greatest form of welcome will be by the participation of the residents themselves”, the Mayor sought public donations to pay for decorations (with donors’ names and amounts to be published in the local press, and these eventually met a third of the cost (“The Royal Tour” 9; Waverley Council n.p.). In January 1954, he personally appealed to those on the route to decorate their premises and, in encouragement, Council provided substantial prizes for the most suitably decorated private and commercial premises. The local Chamber of Commerce was responsible for decorating the transport and shopping hub of Bondi Junction, with many businesses arranging to import Coronation decorations from England (“Queen in the Suburbs” 4; “The Royal Tour” 9). With “colorful activity” providing the basis of Council’s plan (“Queen in the Suburbs” 4), careful choreography ensured that thousands of people would line the royal route through the municipality. In another direct appeal, the Mayor requested that residents mass along the roadsides, wearing appropriate rosettes or emblems and waving flags (“Queen in the Suburbs” 4; “The Royal Tour” 9). Uniformed nurses would also be released from duty to gather outside the War Memorial Hospital as the royals passed by (“Royal Visit” n.p.). At the largest greenspace on the route, Waverley Park, some 10,000 children from the municipality’s 18 schools would assemble, all in uniform and wearing the medal to be presented to them to commemorate the visit. Children would also be provided with large red, white, or blue rosettes to wave as the royals drove by. A special seating area near the park was to be set aside for the elderly and ex-servicemen (“Queen in the Suburbs” 4). Fostering Expectations As the date of the visit approached, preparation and anticipation intensified. A week before, a detailed visit schedule was published in local newspaper Bondi Daily. At this time, the Royal Tour Decorations Committee (comprised of Aldermen and prominent local citizens) were “erecting decorations at various focal points” throughout the municipality (“The Royal Tour” 9). On 4 February, the Planning Committee held their final meeting at the Bondi Beach clubhouse (Meagher 6). The next day, the entire beach was cleaned and graded (Wilson 40). The afternoon before the visit, the Council’s decoration competition was judged, with the winners a house alongside Waverley Park and the beachside Hotel Astra (“Royal Visit” n.p.), one of 14 Sydney hotels, and the only one in Bondi, granted permission to sell liquor with meals until the extended hour of 11.00 pm during the Royal visit (“State House” 5). On the day of the surf carnival, The Sydney Morning Herald featured a large photograph of the finishing touches being put to the official dais and seating the day before (“Stage Set” 15). In reality, there was still a flurry of activity from daybreak on the day itself (Meagher 7), with the final “tidying up and decorating still proceeding” (Meagher 7) as the first carnival event, the Senior boat race heats, began at 10.00 am (“N.Z. Surf” 15). Despite some resident anger regarding the area’s general dilapidation and how the money being spent on the visit could have been used for longstanding repairs to the Pavilion and other infrastructure (Brawley 203), most found the decorations of the beach area appealing (“Royal Visit” n.p.). Tickets to the carnival had sold out well in advance and the stands were filled hours before the Queen arrived, with many spectators wearing sundresses or shorts and others stripping down to swimsuits in the sunshine (“Royal Visit” n.p.). With Police Inspector Michael O’Neill’s collapse and death at a royal event the day before thought to be the result of heat exposure, and the thermometer reaching the high 80s°F (low 30s°C), a large parasol was sourced to be held over the Queen on the dais (Meagher 8). A little after 3:15 pm, the surf club’s P.A. system advised those assembled at the beach that the royal party had left Randwick Racecourse on time and were proceeding towards them (“Queen’s Visit to Races” 17), driving through cheering crowds all the way (“Sydney” 18). At Waverley Park, Council had ensured that the waiting crowds had been entertained by the Randwick-Coogee pipe band (“Royal Visit” n.p.) and spirits were high. Schoolchildren, wearing their medals, lined the footpaths, and 102-year-old Ernest Dunn, who was driven to the park in the morning by police, was provided with a seat on the roadway as well as tea and sandwiches during his long wait (“Royal Tour Highlights” 2; “Royal Visit” n.p.). The royal couple, driving by extremely slowly and waving, were given a rousing welcome. Their attire was carefully selected for the very warm day. The Queen wore a sunny lemon Dior-styled cap-sleeved dress, small hat and white accessories, the Duke a light-coloured suit and tie. It was observed that she wore heavier makeup as a protection against the sun and, as the carnival progressed, opened her handbag to locate her fashionable sunglasses (“Thrills” 1). The Duke also wore sunglasses and used race binoculars (Meagher 8). The Result Despite the exhaustive planning, there were some mishaps, mostly when the excitement of the “near-hysterical crowds” (Hardman n.p.) could not be contained. In Double Bay, for instance, as the royals made their way to Bondi, a (neither new nor clean) hat thrown into the car’s rear seat struck the Duke. It was reported that “a look of annoyance” clouded his face as he threw it back out onto the road. At other points, flags, nosegays, and flutter ribbons (long sticks tied with lengths of coloured paper) were thrown at, and into, the Royal car. In other places, hundreds raced out into the roadway to try to touch the Queen or the Duke. They “withstood the ordeal unflinchingly”, but the Duke was reportedly concerned about “this mass rudeness” (“Rude Mobs” 2). The most severe crowding of the day occurred as the car passed through the centre of Bondi Junction’s shopping district, where uniformed police had to jump on the Royal car’s running boards to hold off the crowds. Police also had to forcibly restrain a group of men who rushed the car as it passed the Astra Hotel. This was said to be “an ugly incident … resentment of the police action threatened to breed a riot” (“Rude Mobs” 2). Almost everything else met, and even exceeded, expectations. The Queen and Duke’s slow progress from Bondi Road and then, after passing under a large “Welcome to Bondi” sign, their arrival at the entrance to the dais only three minutes late and presence at the carnival went entirely to plan and are well documented in minute-by-minute detail. This includes in detailed press reports, newsreels, and a colour film, The Queen in Australia (1954). Their genuine enjoyment of the races was widely commented upon, evidenced in how they pointed out details to each other (Meagher 8), the number of times the Duke used his binoculars and, especially, in their reluctance to leave, eventually staying more than double the scheduled time (“Queen Delighted” 7). Sales of tickets and programs more than met the costs of mounting the event (Meagher 8–9) and the charity concert held at the beach on the night of the carnival to make the most of the crowds also raised significant funds (“Queen in the Suburbs” 4). Bondi Beach looked spectacularly beautiful and gained considerable national and international exposure (Landman 183). The Surf Life Saving Association of Australia’s president noted that the “two factors that organisation could not hope to control—weather and cooperation of spectators—fulfilled the most optimistic hopes” (Curlewis 9; Maxwell 9). Conclusion Although it has been stated that the 58-day tour was “the single biggest event ever planned in Australia” (Clark 8), focussing in on a single event reveals the detailed decentralised organisation which went into both each individual activity as well as the travel between them. It also reveals how significantly responsible bodies drew upon volunteer labour and financial contributions from residents. While many studies have discussed the warm welcome given to the monarch by Australians in 1954 (Connors 371–2, 378), a significant finding from this object-inspired research is how purposefully Waverley Council primed this public reception. The little medal discussed at the opening of this discussion was just one of many deliberate attempts to prompt a mass expression of homage and loyalty to the sovereign. It also reveals how, despite the meticulous planning and minute-by-minute scheduling, there were unprompted and impulsive behaviours, both by spectators and the royals. Methodologically, this investigation also suggests that seemingly unprepossessing material remnants of the past can function as portals into larger stories. In this case, while an object biography could not be written of the commemorative medal I stumbled upon, a thoughtful consideration of this object inspired an investigation of aspects of the Queen’s visit to Bondi Beach that had otherwise remained unexplored. References Brawley, Sean. “Lifesavers of a Nation.” 3 Feb. 2007: 82. [extract from The Bondi Lifesaver: A History of an Australian Icon. Sydney: ABC Books, 2007.] Clark, Andrew. “The Queen’s Royal Tours of Australia Remembered: Reflection.” The Australian Financial Review 10 Sep. 2022: 8. Connors, Jane. “The 1954 Royal Tour of Australia.” Australian Historical Studies 25 (1993): 371–82. Conway, Doug. “Queen’s Perennial Pride in Australia.” AAP General News Wire 26 Nov. 2021: n.p. “Coronation Medals Presented to School Children: 6000 Distributed in Rockhampton District.” Morning Bulletin 12 May 1937: 6. “Costume Rule for Queen’s Bondi Visit.” Barrier Miner 18 Dec. 1953: 3. Curlewis, Adrian. “Letter.” Bondi Surfer: Official Organ of the Bondi Surf Bathers’ Life Saving Club 2.7 (1954): 9. Ford, Caroline. Sydney Beaches: A History. Sydney: NewSouth Publishing, 2014. Ford, Caroline, Chris Giles, Danya Hodgetts, and Sean O’Connell. “Surf Lifesaving: An Australian Icon in Transition.” Australian Bureau of Statistics Year Book, Australia 2007. Ed. Dennis Trewin. Canberra: Australian Bureau of Statistics, 2007. 1–12. Hardman, Robert. Our Queen. London: Hutchinson, 2011. &lt;https://www.google.com.au/books/edition/OurQueen/DySbU9r0ABgC&gt;. Jenkings, Frank. “Editorial.” Bondi Surfer: Official Organ of the Bondi Surf Bathers’ Life Saving Club 2.6 (1954): 1. Landman, Jane. “Renewing Imperial Ties: The Queen in Australia.” The British Monarchy on Screen. Ed. Mandy Merck. Manchester: Manchester UP, 2016. 181–204. Lawrence, Joan, and Alan Sharpe. Pictorial History: Eastern Suburbs. Alexandria: Kingsclear Books, 1999. Maxwell, C. Bede. “Letter.” Bondi Surfer: Official Organ of the Bondi Surf Bathers’ Life Saving Club 2.7 (1954): 9. Meagher, T.W. “The Royal Tour Surf Carnival Bondi Beach, February 6, 1954.” Bondi Surfer: Official Organ of the Bondi Surf Bathers’ Life Saving Club 2.7 (1954): 6–9. National Archives of Australia (NAA): A462, 825/4/6, Royal tour 1954—Medals for School children—General representations, 1954. National Archives of Australia (NAA): A1533, 1957/758B, Royal Visit, 1953–1954. National Archives of Australia (NAA): A1838, 1516/11 Part 1, Protocol—Royal Visit, 1948–1954. National Archives of Australia (NAA): A1838, 1516/11 Part 2, Protocol—Royal Visit, 1954–1966. National Archives of Australia (NAA): A6122, 1861, Government Heads of State—Royal Visit 1954—ASIO file, 1953–1958. Canberra: Australian Security Intelligence Organization. National Archives of Australia (NAA): A9708, RV/CD, Fly and Mosquito Control. National Archives of Australia (NAA): A9708, RV/CQ, Laundry and Dry Cleaning and Pressing Arrangements. National Archives of Australia (NAA): A9708, RV/DD Annexure 2, Minutes of Conferences with State Directors, 22 January 1953–14 January 1954. National Archives of Australia (NAA): A9708, RV/DD Annexure 3, State Publications. National Archives of Australia (NAA): A9708, RV/DD Annexure 15, Report by Public Relations Officer. National Archives of Australia (NAA): A9708, RV/T, Matters Relating to Dress. National Archives of Australia (NAA). Royalty and Australian Society: Records Relating to The British Monarchy Held in Canberra. Research Guide. Canberra: Commonwealth of Australia, 1998. “N.Z. Surf Team in Dispute.” The Sydney Morning Herald 6 Feb. 1954: 15. “Queen Delighted by Carnival.” The Sun-Herald 7 Feb. 1954: 7. “Queen in the Suburbs: Waverley.” Sun 21 Jan. 1954: 4. “Queen’s Visit to Races: Drive in Suburbs.” The Daily Telegraph 6 Feb. 1954: 17. “Royal Tour Highlights.” The Mail 6 Feb. 1954: 2. Royal Variety Charity. “Coronation Year Royal Variety Performance.” London: London Coliseum, 2 Nov. 1953. &lt;https://www.royalvarietycharity.org/royal-variety-performance/archive/detail/1953-london-coliseum&gt;. “Royal Visit to Waverley.” Feb. 1954 [Royal Visit, 1954 (Topic File). Local Studies Collection, Waverley Library, Bondi Junction, LS VF] “Rude Mobs Spoil Happy Reception.” The Argus 8 Feb. 1954: 2. Sleight, Simon. Young People and the Shaping of Public Space in Melbourne, 1870–1914. Abingdon: Routledge, 2016. “Socialites in for Rude Shock on Royal Tour Invitations.” Daily Telegraph 3 Jan. 1954: 3. “Stage Set for Royal Surf Carnival at Bondi.” The Sydney Morning Herald 6 Feb. 1954: 15. “State House Rehearses Royal Opening.” The Sydney Morning Herald 27 Jan. 1954: 5. “Sydney.” Women’s Letters. The Bulletin 10 Feb. 1954: 18. The Age 24 Jun. 1897: 5. The Queen in Australia. Dir. Colin Dean. Australian National Film Board, 1954. “The Queen to See Lifesavers.” The Daily Telegraph 24 Aug. 1953: 12. “The Royal Tour.” Bondi Daily 30 Jan. 1954: 9. “Thrills for the Queen at Bondi Carnival—Stayed Extra Time.” The Sun-Herald 7 Feb. 1954: 1. Warshaw, Matt. The History of Surfing. San Fransisco: Chronicle Books, 2010. Wilson, Jack. Australian Surfing and Surf Lifesaving. Adelaide: Rigby, 1979.

Until the 1980s research into computer technology was developing outside of a context of media culture. Until the 1970s the computer was seen as a highly effective calculator and a tool for the use in government, military and economic life. Its popular image from the 1940s to 1950s was that of a calculator. At that time the computer was a large machine which only white lab-coated engineers could understand. The computer was studied as a technical instrument, not from the viewpoint of the user. The peculiar communication between the user -- engineers at this point -- and the machine was described in caricatures like those in Electric Media (Brown &amp; Marks 100). Many comics handled the issue of understanding. In one cartoon one engineer asks another: "Do you ever feel that it is trying to tell us something?" And in Robert Sherman Townes's novel "Problem of Emmy", the computer (Emmy) acts out of control and prints the words: "WHO AM I WHO AM I WHO AM I?". In these examples the man-machine relationship was taken under consideration, but the attitude towards the relationship was that of a master-tool way. The user was pronouncedly in control and the machine just a passive tool. After the 1980s the image of the computer was turning into that of a playful toy and a game machine, thanks to the game houses' and marketing departments' efforts. Suddenly the player was playing with the computer, and even fairly often got beaten by it. That definitely raises feelings towards the machine! The playing situation was so intensive that the player did not often pay any attention to the interface, and the roles were not so clear anymore. This was a step towards the idea of natural communication between human and machine. Later science fiction influenced depictions of virtual reality, and haptic interfaces mediated the ideas into reality. In this paper I will discuss the man-machine relationship from the viewpoint of interface design. My expertise is in electronic games, and thus I will use examples from the game industry. This paper is a sidetrack of RAID -- Research of Adaptive User Interface Design, which was going on at the University of Lapland, Finland in 1995-1999. The RAID project was about research into adaptive interface design from the viewpoint of media archaeology, electronic games, toys and media art. Early Visions Already in the 1960s, MIT professor J.C.R. Licklider wrote about man-machine symbiosis. He saw that "man machine symbiosis is an expected development in cooperative interaction between men and electronic computers". He believed that it would lead to a new kind of cooperative partnership between man and machine (9). Licklider's visions are important, because the relationship between man and machine was seen generally differently at those days. At the time of the first mainframe computers in the 1940s, man and machine were seen as separate entities from the viewpoint of data processing. The operator put in data to the machine, which processed it by its own language which only the machine and very few engineers could understand. Fear -- a fearful affection -- has affected the development of machines and the idea of man-machine relationships throughout the decades. One reason for this is that the ordinary person had no contact to the computer. That has led to fears that when cooperating with the machine, the user will become enslaved by it, or sucked into it, as in Charlie Chaplin's film Modern Times (1936). The machine captivates its user's body, punishes it and makes its movement impossible at the end. Or the machine will keep the body's freedom, but adapt its functions to work by the automatic rhythm: the human body will be subordinated to the machine or made a part of it. What Is the Interface? In reality there still is a mediator between the user and the machine: the interface. It is a connector -- a boundary surface -- that enables the user to control the machine. There has been no doubt who is in charge of whom, but the public image of the machine is changing from "computer as a tool" to "computer as an entertainment medium". That is also changing the somewhat fearful relationship to the computer, because such applications place the player much more intensively immersed in the game world. The machine as a tool does not lose its meaning but its functionality and usability are being developed towards more entertainment-like attributes. The interface is an environment and a structural system that consists of the physical machine, a virtual programming environment, and the user. The system becomes perfect when all its parts will unite as a functional, interactive whole. Significant thresholds will arise through the hapticity of the interface, on one hand questioning the bodily relationship between user and machine and on the other hand creating new ways of being with the machine. New haptic (wearable computing) and spatial (sensors in a reactive space) interfaces raise the question of man-machine symbiosis from a new perspective. Interfaces in a Game World In games the man-machine relationship is seen with much less emotion than when using medical applications, for example. The strength of electronic games is in the goal-oriented interaction. The passivity of older machines has been replaced by the information platform where the player's actions have an immediate effect in the virtual world. The player is already surrounded by the computer: at home sitting by the computer holding a joystick and in the arcades sometimes sitting inside the computer or even being tied up with the computer (as in gyroscope VR applications). The symbiosis in game environments is essential and simple. During the 1980s and 1990s a lot of different virtual reality gear variants were developed in the "VR boom". Some systems were more or less masked arcade game machines that did not offer any real virtuality. Virtuality was seen as a new way of working with a machine, but most of the applications did not support the idea far enough. Neither did the developers pay attention to interface design nor to new ways of experiencing and feeling pleasure through the machine. At that time the most important thing was to build a plausible "virtual reality system". Under the futuristic cover of the machine there was usually a PC and a joystick or mouse. Usually a system could easily be labelled as a virtual theater, a dome or a cabin, which all refer to entertainment simulators. At the beginning of the 1990s, data glasses and gloves were the most widely used interfaces within the new interaction systems. Later the development turned from haptic interfaces towards more spatial ideas -- from wearable systems to interaction environments. Still there are only few innovative applications available. One good example is Vivid Group's old Mandala VR system which was later in the 1990s developed further to the Holopod system. It has been promoted as the interface of the future and new way of being with the computer. As in the film Modern Times so also with Holopod the player is in a way sucked inside the game world. But this time with the user's consent. Behind the Holopod is Vivid Group's Mandala VGC (Video Gesture Control) technology which they have been developing since 1986. The Mandala VGC system combines real time video images of the player with the game scene. The player in the real world is the protagonist in the game world. So the real world and the game world are united. That makes it possible to sense the real time movement as well as interaction between the platform and the player. Also other manufacturers like American Holoplex has developed similar systems. Their system is called ThunderCam. Like Konami's Dance Dance Revolution, it asks heavy physical involvement in the Street Fighter combat game. Man-Man and Man-Machine Cooperation One of the most important elements in electronic games has been reaction ability. Now the playing is turning closer to a new sport. Different force feedback systems combined with haptic interfaces will create much more diverse examples of action. For example, the Japanese Konami corporation has developed a haptic version of a popular Playstation dance game where karaoke and an electronic version of the Twister game are combined. Besides new man-machine cooperative applications, there are also under development some multi-user environments where the user interacts with the computer-generated world as well as with other players. The Land of Snow and Ice has been under development for about a year now in the University of Lapland, Finland. It is a tourism project that is supposed to be able to create a sensation of the arctic environment throughout the year. Temperature and atmosphere are created with the help of refrigerating equipment. In the space there are virtual theatre and enhanced ski-doo as interfaces. The 3-D software makes the sensation very intense, and a hydraulic platform extends the experience. The Land of Snow and Ice is interesting from the point of view of the man-machine relationship in the way that it brings a new idea to the interface design: the use of everyday objects as interfaces. The machine is "hidden" inside an everyday object and one is interacting and using the machine in a more natural way. For example, the Norwegian media artist Stahl Stenslie has developed "an 'intelligent' couch through which you communicate using your body through tactile and visual stimuli". Besides art works he has also talked about new everyday communication environments, where the table in a café could be a communication tool. One step towards Stenslie's idea has already become reality in Lasipalatsi café in Helsinki, Finland. The tables are good for their primary purpose, but you can also surf the Internet and read your e-mail with them, while drinking your tea. These kind of ideas have also been presented within 'intelligent home' speculations. Intelligent homes have gained acceptance and there are already several intelligent homes in the world. Naturally there will always be opposition, because the surface between man and machine is still a very delicate issue. In spite of this, I see such homogeneous countries as Finland, for example, to be a good testing ground for a further development of new man-machine interaction systems. Pleasure seems to be one of the key words of the future, and with the new technology, one can make everyday routines easier, pleasure more intense and the Internet a part of social communication: within the virtual as well as in real world communities. In brief, I have introduced two ideas: using games as a testing ground, and embedding haptic and spatial interfaces inside everyday objects. It is always difficult to predict the future and there are always at least technology, marketing forces, popular culture and users that will affect what the man-machine relationship of the future will be like. I see games and game interfaces as the new developing ground for a new kind of man-machine relationship. References Barfield, W., and T.A. Furness. Virtual Environments and Advanced Interface Design. New York: Oxford UP, 1995. Brown, Les, and Sema Marks. Electric Media. New York: Hargrove Brace Jovanovich, 1974. Burdea, G., and P. Coiffet. Virtual Reality Technology. New York: John Wiley and Sons, 1994. Greelish, David. "Hictorically Brewed Magazine. A Retrospective." Classic Computing. 1 Sep. 1999 &lt;http://www.classiccomputing.com/mag.php&gt;. Huhtamo, Erkki. "Odottavasta Operaattorista Kärsimättömäksi Käyttäjäksi. Interaktiivisuuden Arkeologiaa." Mediaevoluutiota. Eds. Kari Hintikka and Seppo Kuivakari. Rovaniemi: U of Lapland P, 1997. Jones, Steve, ed. Virtual Culture: Identity and Communication in Cybersociety. Thousand Oaks, Calif.: Sage, 1997. Kuivakari, Seppo, ed. Keholliset Käyttöliittymät. Helsinki: TEKES, 1999. 1 Sep. 1999 &lt;http://media.urova.fi/~raid&gt;. Licklider, J.C.R. "Man-Computer Symbiosis." 1960. 1 Sep. 1999 &lt;http://memex.org/licklider.pdf&gt;. Picard, Rosalind W. Affective Computing. Cambridge, Mass.: MIT P, 1997. "Return of the Luddites". Interview with Kirkpatrick Sale. Wired Magazine June 1995. Stenslie, Stahl. Artworks. 1 Sep. 1999 &lt;http://sirene.nta.no/stahl/&gt;. Citation reference for this article MLA style: Sonja Kangas. "From Haptic Interfaces to Man-Machine Symbiosis." M/C: A Journal of Media and Culture 2.6 (1999). [your date of access] &lt;http://www.uq.edu.au/mc/9909/haptic.php&gt;. Chicago style: Sonja Kangas, "From Haptic Interfaces to Man-Machine Symbiosis," M/C: A Journal of Media and Culture 2, no. 6 (1999), &lt;http://www.uq.edu.au/mc/9909/haptic.php&gt; ([your date of access]). APA style: Sonja Kangas. (1999) From haptic interfaces to man-machine symbiosis. M/C: A Journal of Media and Culture 2(6). &lt;http://www.uq.edu.au/mc/9909/haptic.php&gt; ([your date of access]).

Fig. 1: “Pink Flamingo Furby” (2000), “Peachy Furby Baby” (1999), and “Owl Furby” (1999) Sunlight Up (“Dah-ay-loh oo-tye”): Introduction As playthings at the junction of human experience and imagination, toys like Furby present an interesting touch point to explore cultural imaginations, hopes, and fears about zoomorphic robots and AI toys. This year marks their 25th anniversary. Created by Dave Hampton and Caleb Chung, Furby publicly debuted at the American International Toy Fair in 1998. Originally released by Tiger Electronics, this toy was later sold to Hasbro in 2005 to 2007. Since their introduction to the market, Furbys have been occupying our shelves and basements, perceived as “annoying little owl-like dolls with embedded sound-recording chips” (Gullin) that speak their own language “furbish” (shown throughout in parenthesis). Early reportage likened Furby to all kinds of cute critters: mogwais, hamsters, and Star Trek’s tribbles. Narratively Furbys are framed as a benevolent, alien species, living in space in a cloud known as Furbyland. For motivations not revealed, Furbys, in looking down on our planet, were so struck by the beautiful view of nature and its signs of peacefulness — “no worry (boo boh-bay)” — that they jumped, plummeting to us like tiny fluffy asteroids. Little did they know that their arrival would spark an intergalactic diplomatic incident. During its introduction in 1998, the initial discourse in media reportage emphasised anxieties of the unknown. What lies beneath the surface of Furby, as a toy that might blur the line between the real and imagined for children? What technologies might it harbour? As a hybrid of technology and animal, Furby appeared as a creepy-cute cultural icon that simultaneously delighted and horrified children and adults alike. Today adult fans reimagine Furby through play and customisation as part of their reflections on their childhood experiences of this cultural moment, and as a way of exploring new futures. Furby provides an opportunity to reflect on adults’ interactions with toys, including parents, members of the public, and fans motivated by nostalgia. At the time of its release Furby presented adults with moments of “dissonance” towards new horrifying technologies that “might occur at the seams [of] … monumental cultural shifts” (Powell 4). But for adult fans today, as a childhood memory, the toy represents both strangeness and future possibilities; it has become a tool of “disrupt[ing] and challeng[ing] beliefs and connections” (Rand 9). In this article I primarily analyse the “original” Furbys of 1998 to 2002, but also mention a range of later versions. This includes: the Emoto-tronic Furbys (2006) which were designed to have more expressive faces; the Furby Boom (2003), a toy whose personality changes according to the level of care it is provided with; and the Furby Connect (2016), which has bluetooth capacity. This discussion is supported by a thematic analysis of 3800 news articles about Furby from 1998 to 2000, visual analysis of both the original and customised iterations of Furby, as well as my reflections as a member of the Furby fandom community. You Play? (U-nye-loo-lay-doo?): Furby Encounters A key part of the discourse around Furby since its introduction in 1998 was, “who would want one?” Indeed, the answer at the time appeared to be “several million of us, the toy demons hope” (Weeks). After their release in American toy stores on 2 October 1998 in limited supplies, a Furbish frenzy ensued, resulting in altercations between shoppers and staff (e.g. Munroe; Warmbir; Associated Press). Aged 10, I recall my little black and white Furby, Coco, waiting for me on the shelves of the electronics section of Big W in Australia, fortunately with no such commotion. Furby is classed by the Guinness World Records as the world’s first AI toy, but it was certainly not the first electronic toy to enter the market; at the time of Furby’s release, Tickle Me Elmo and My Interactive Pooh presented competition, and by the late 1980s there was already concern about how electronic pet toys might erode emotion and connection (Turkle, “Authenticity”; Turkle, “Nascent”). Speculation over the reason for the Furby mass hysteria ensued. Some suggested the appeal was the toy’s status symbol status (Beck), whereas others cited its broad appeal: “it's not gender specific; it doesn't appeal to a particular age group; and most important, it's affordable and doesn't require additional equipment or a computer” (Davis). Some experts offered their commentary of the cyberpet phenomena in general, suggesting that it is a way of dealing with isolation and loneliness (Yorkshire Post). Indeed, all of these features are important to note when we consider the transformation of Furby into queer icon. Central to Furby’s cultural narrative is the idea of contact, or a meeting between robot and user; through play children “teach” their new pet Earth’s new ways (Marsh, “Coded”; Marsh, “Uncanny”). And with this contact also comes a sense of the unknown: what lies beneath the creature’s surface? In their study of zoomorphic robots, Hirofumi Katsumi and Daniel White suggest that Donna Haraway’s work on animal encounters might help us understand this idea of contact. As “animal-like” creature, Furby recalls the transformative potentials of meeting with the more-than-human. Furby’s presence on toy shelves, in classrooms and in homes was one of the first times society had to consider what it meant to “enter the world of becoming with” zoomorphic robots, and to reflect on “who or what ... is precisely at stake” in this entanglement (Haraway 19). What do we learn about ourselves and the unknown through our encounters with Furby? “Monster” (Moh-moh): Technological Threat, Monstrous Other In media reportage, Furby is framed as both new and innovative, but also as a threatening fluffy anarchist. With its technology largely unknown, Furby at the time of its release presented society with a sense of “technohorror” and “imaginings of [social] collapse” (Powell 24). A common concern was that Furby might record and repeat inappropriate language in an act of rebellion. Occasionally tabloid newspapers would report claims such as, "MUM … was horrified when she sat down to play with her daughter's new Furby toy and it squeaked: "F*** me" (The Sun). Some concerns were quite serious, including that Furby could emit electromagnetic fields that would create interference for medical devices and aircraft instruments; this was later disproven by engineers (Tan and Hinberg; Basky; Computer Security). Other urban myths pointed to a more whimsical Furby, whose sensors had the capacity to launch spacecraft (Watson). One persistent concern was the surveillance potentials of Furby. In 1999 the US National Security Agency (NSA) issued a ban on Furby in their Fort Mead headquarters, with concern that they might record and repeat confidential information (Gullin; Ramalho; Borger). This was denied by Tiger Electronics, who emphatically stated “Furby is not a spy” (Computer Security). Engineers performing “autopsies” on Furbys quickly put much of this anxiety to rest (Phobe). This was met with mirthful rebuttals of how future Furbys might be transformed into cute and ubiquitous “wireless furby transmitters” to gather intelligence in warzones (Gullin). As a result, the initial anxiety about surveillance and toys dissipated. However, academics continue to remind us of the real risks of smart toys (e.g. Lupton; Milkaite and Lievens). The 2016 Furby Connect, equipped with voice recognition and Bluetooth capacities has been shown to be hackable (Williams). Further, Maria Ramalho has reported Snowden’s 2014 claims that both NSA and the UK Government Communication Headquarters have been accessing the data collected. In this context, Furby has become “Big Brother transmogrified into ambiguous, cute” unaccountable creature (Ramalho). Through this, we can see how our entanglement with Furby as an object of technohorror speaks both to our anxieties and the real possibilities of technology. In order to craft a narrative around Furby that speaks to this monstrous potential, many have drawn comparisons between Furby and the character Gizmo from the Gremlins franchise. This reference to Gizmo appears in the majority of the media articles sampled for this research. Gizmo is a “mogwai” (trans. demon) with both cute and monstrous potential; like Furby, it also has the potential to transform into a threat to “good society” (Chesher 153-4). This comparison speaks to Gremlins as an anti-technology statement (Sale). However, when we consider how media rhetoric has framed Furby as something to be tamed and controlled, it’s important we approach this comparison with caution in light of the Orientalist underpinnings of the Gremlins franchise. Wendy Allison Lee highlights how Gremlins reflects xenophobic themes of invasion and assimilation. While Gizmo is a “cute, well-behaved” character who “strives to assimilate” much like how Furby might, through play with children, it also harbours a threat to order. In this encounter are resonances of “racist love” that can sometimes underpin our affection for cuteness (Bow). Further reflection is needed on how we might unentangle ourselves from this framing and imagine more inclusive futures with toys like Furby. Fig. 2: Interactive Gizmo, a “Furby Friend” produced by Hasbro, Tiger and Warner Bros in 1999 Big Fun! (Dah doo-ay wah!): Queer Re-Imaginings of Furby Fig. 3: Party time! Adult fans around the world now gather under the “Furby” banner, participating in a colourful array of playful mischief. Reddit forum r/furby (11,200 subscribers) creates a fun space to enjoy the whimsy of Furby, transforming the figure into a sweet and kind companion. Under this umbrella, r/oddbodyfurby (997 subscribers) explore the horrifying potentials of Furby to its playful and surprising ends, which I discuss in this section. In other forums, such as Furby Collectors and Customisers (4.1k members) on Facebook, these different interests come together in a playful and creative space. There was also an active community on Tumblr, where some of the most creatively generative activities around Furby have occurred (Tiffany). In Japan, there is a lively community of fans on Twitter who dress and photograph Emoto-tronic Furbys in a range of cute and charming ways. This forms part of a broader network of creatives, such as “Circuit Benders” who tear down toys and rework them into instruments in a process known as “frankensteining”, such as Look Mum No Computer’s Furby Organ (Deahl). As fans and artists, people act as “queer accessories” to help Furby escape the world and narrative that sought to enclose it, so it might enact its revenge or transcend as a non-binary queer icon (Rand 9-11). As small, collectible and customisable friends, images of happy and creepy Furbys are part of a network of cute media that provides my generation with a source of comfort during times of precarity, occupying our spaces with their own vitality and presence as soothing companions (e.g. Stevens; Allison; Yano). Cuteness as media also lends itself to hybridisation; a mixing and matching with seemingly “opposing” aesthetics. For many fans, the charm of Furby lies in its nostalgic pull as a creature of childhood creepy-cute nightmares. Indeed, it seems that early concerns that Furby may “blur the line between the real and imagined for many children” were in fact valid (Knowlton). While we knew they weren’t “alive” in the true sense, to us they appeared “sort of alive” as our everyday environments became increasingly technological with a dazzling array of electronics (Turkle, “Authenticity”). As Allison (179) explains, we had to “adjust to a world where the border between the imaginary and the real” began to shift rapidly, leaving us open to dream, imagine, and craft narratives populated by a fear of the mechanised undead. Many Millennials were convinced as children that their Furby was waiting for them in the dark, watching, chuckling (“he he heeeee”). Patrick Lenton, diarising his adventures with a rescue Furby this year recalls his childhood toy as “a riot of noise and fury, the kind of demonic household terror”. Some adults, recalling these memories now refer to Furby as “it” or “evil” (Marsh, “Uncanny” 59). In 2020, adult Furby fans, thinking back to their childhood toys, speculated if the positioning of Furby’s eyes at the front of its head meant it was a predator (Watson). Some suggested that their short legs meant they are ambush predators, their infra-red sensor enabling them to detect prey in the dark. Other playful lore suggested that they were made of real cat and dog fur. Through this act of imaginative play, adults reach back to the playful horrors of their childhoods, combining their sense of dread with glee. This has been recently animated by films such as The Mitchells vs. The Machines (2021), where Furbys equipped with “PAL” chips transmogrify into a horrific pack of menacing creatures, and exact revenge. The main contributing factor to this experience is in part the puppetry of Furby. The 1999 Furby presents an exaggerated performance that is both “alive” and “unalive”, its wild rocking, owlish blinking, and cackling creating a sense of “dread and creeping horror” (Freud 2; Marsh, “Uncanny”). Through a blend of animation and imagination, agency is diffused between toy and child to give Furby “life” (Silvio 423). Interestingly, studies of the 2016 Furby Connect and its friendly and social programming that is designed to encourage positive care and engagement has counteracted some of this experience for children (Marsh, “Uncanny” 54). Likewise, in discussing the 2013 Furby Boom Chesher (151) describes this animation as “zany”, working with Sianne Ngai’s conceptualisation of this aesthetic and its relationship to cuteness. While some might praise these later developments in the Furby franchise as having saved another generation of children from nightmares, compared to the original Furby these later editions are less popular among fans; perhaps there is less “material” to work with. Fans as adults now draw on Furby as a playful and cute text to experiment with and hybridise with a variety of horrifying and surprising potentials. This leans into Furby’s design as a chimera, as it uses a combination of cute features to create a “short-hand” for life and also evoke the “idea” or “character” of appealing animals that form part of cultures “charismatic megafauna” (Nishimura 179; Stuck and Rogers; Gn). With cat-like ears, a tuft of hair that drifts with sympathetic movement, two wide eyes, framed with coquettish false lashes, a bird’s beak, and two paws, Furby both suspends and confounds our disbelief. Following the principles of the Kindchenschema (Lorenz) to a “100% ratio” its body is reduced to a round form, its most dominant feature its large eyes (Borgi, Cogliati-Dezza, Brelsford Meints, and Cirulli). While large eyes generally are thought to have an affective pull to them (Harris 4), their fixed placement in the original Furby’s skull creates a dead-pan gaze, that morphs into a Kubrik stare as the toy tilts forward to greet the viewer. Fig. 4: Kindschenschema at work in Furby’s design Furby fans mischievously extend this hybridisation of Furby’s body further through a range of customisation practices. Through “skinning”, Furby’s faux fur surfaces are removed and replaced with a fantastic array of colours and textures. Through breaking into their mechatronic shell – a practice known as “shucking” – their parts are repaired or modified. This results in a range of delightfully queer, non-binary representations of Furby with a range of vibrant furs, piercings, and evocative twinkling and gentle eyes (“tee-wee-lah!”). These figures act as both avatars and as companions for fans. Sporting earrings and rainbow bead necklaces, they are photographed resting in grassy fields, soft crochet rainbows, and bookshelves: they are an expression of all that is joyful in the world. Some fans push the customisation further to create whimsical creatures from another dimension. Some Furbys appear with moss and lichen for fur, sprouting tiny toadstools. Furbys are also transformed into “oddbodies” of varying species. Some appear both as winged fairies, and as transcendental multi-eyed and winged “biblically accurate” angels. Others are hybridised with plush toys or are reworked into handbags. Some veer into the realm of body horror, using doll limbs and bodies to create humanoid forms. The most iconic is the “long furby”, created by Tumblr user FurbyFuzz in 2018. Elongated and insect-like, the Long Furby wriggles into homes and curls up on soft furnishings. Collectors gather “haunted photos from the dark recesses of the internet” to document their escapades (Long Furby). Sometimes, hybridised Furbys appear not through creator interventions but rather emerge from nature itself. One such mythical creature is Murby, an original Furby unearthed in 2013 on an old farm property. Once toy, now woodland spirit, Murby gazes upon and blesses fans with dreamy, clouded eyes, its body an entanglement of thick moss, rich earth and time. Furby’s queerness, strangeness, and hybridity speaks to fans in different ways. Personally, as a neurodivergent person, I experience the coding and the playful reimaginings of Furby as a reflection of my own life experience. Neurodivergent people have a high capacity for care and empathy for objects as curiosities, supports, and friends (e.g. Atherton and Cross; White and Remington; Clutterbuck, Shah and Livingston). Like Furby, I am an alien whom people want to tame. My body and movement are treated with the same infantilising bemusement and suspicion. I feel like a chimera myself; an entanglement of many parts that make a whole, each on their own charming, but together forming a chaotic attempt to connect with neurotypicals. For me, what lies beneath Furby’s surface is my own psyche; rescuing and customising Furbys is a symbolic act, a creative expression of my desire to transcend and resist ableist forces. Together my Furbys and I revel in our strangeness in solidarity, plotting our mischievous revenge (“party time!”). This micro-level resistance will not overturn ableism but brings me a sense of reprieve as I work with my allies to bring socio-cultural change. Fig. 5: The author, Furby Queen. Photo by Sherbet Birdie Photography. Through their creative work, fans explore how Furbys could be reimagined. While fannish activities may at first glance appear fringe or frivolous, they hold up a mirror to our own limitations, anxieties, and practices as a society. The future is Furby. Go to Sleep Now (U-nye-way-loh-nee-way): Conclusions As a source of technohorror and queer potential, Furby provides a vessel by which we can imagine the futures of toys. Through encounter and contact, this seemingly harmless fluffy robot brought about disruption and chaos as a threat to securities and social fabrics. Adult fans, now recalling this cultural moment, lean into this creature’s promise of new possibilities, queering its cultural narrative. Through exploring adults’ interactions with toys, we explore new potentials for change and futures that are playful and creative. Acknowledgments This article was produced with the support of a Vitalities Lab Scholarship and the Australian Research Council Centre of Excellence for Automated Decision-Making and Society. I also thank Deborah Lupton and David Eastwood for their support in the production of an arts-based project that draws on this research into cyberpet histories. References Allison, Anne. Millennial Monsters: Japanese Toys and the Global Imagination. Berkeley: U of California P, 2006. Associated Press. “Two Injured in Flurry over Furby.” Charleston Daily Mail 28 Nov. 1998. Atherton, Gray, and Liam Cross. “Seeing More than Human: Autism and Anthropomorphic Theory of Mind.” Frontiers in Psychology 9 (2018): 1–18. Basky, Greg. “Furby Not Guilty as ‘Charged’.” The Western Journal of Medicine 172 (2000): 59. Beck, Rachel. “‘Must-Have’ Toys Created by Intense Publicity Campaigns.” AP Business Writer 16 Oct. 1998. Borgi, Marta, Irene Cogliati-Dezza, Victoria Brelsford, Kerstin Meints, and Francesca Cirulli. “Baby Schema in Human and Animal Faces Induces Cuteness Perception and Gaze Allocation in Children.” Frontiers in Psychology 5 (2014): 1–12. Borger, Julian. “Secret Agent Furby Sneaks into Spies’ Inner Sanctum.” The Guardian 14 Jan. 1999. &lt;https://www.theguardian.com/world/1999/jan/14/julianborger1&gt;. Bow, Leslie. Racist Love: Asian Abstraction and the Pleasures of Fantasy. Durham: Duke UP. Chesher, Chris. “Toy Robots on YouTube: Consumption and Peer Production at the Robotic Moment.” Convergence 25 (2019): 148–160. Clutterbuck, Rachel A., Punit Shah, and Lucy A. Livingston. “Anthropomorphic Tendencies in Autism: A Conceputal Replication and Extension of White and Remington (2019) and Preliminary Development of a Novel Anthropomorphism Measure.” Autism 26.4 (2021): 940–950. Computer Security. “Furby Alert: A National Security Concern?” Computer Security 36 (1999): 87–88. Davis, Pamela. “Too Cute to Mute?” St. Petersburg Times 9 Nov. 1998. Deahl, Dani. “Circuit Bending: Hacking a Furby in the Name of Music.” The Verge 14 Sep. 2018. Francescani, Christopher, and Tracy Connor. “Hot Toy’s a Doll Order; $30 Cuddlers Now Going for $100.” New York Post 29 Nov. 1998: 5. Freud, Sigmund. The Uncanny. Trans. D. McLintok. London: Penguin, 1919 [2003]. Gn, Joel. “Designing Affection: On the Curious Case of Machine Cuteness.” The Aesthetics and Affects of Cuteness. Eds. Joshua Paul Dale, Joyce Goggin, Julia Leyda, Anthony McIntyre, and Diane Negra. New York: Routledge, 2017. Gremlins. Dir. Joe Dante. Warner Bros, 1984. Gremlins 2. Dir. Joe Dante. Warner Bros, 1990. Guinness World Records. “First AI Robot Toy.” Guinness World Records, 2023. &lt;https://www.guinnessworldrecords.com/world-records/100867-first-ai-robot-toy&gt;. Gullin, Paul. “The Future Is Furbys.” Computerworld 33 (1999): 30. Harris, David. Cute, Quaint, Hungry and Romantic: The Aesthetics of Consumerism. New York: Basic. Katsuno, Hirofumi, and Daniel White. “Haptic Creatures: Tactile Affect and Human-Robot Intimacy in Japan.” Consumer Culture Theory in Asia: History and Contemporary Issues. Eds. Yuko Minowa and Russell Belk. New York: Routledge. 242–262. Knowlton, Brian. “If Raggedy Ann Could Talk.” International Herald Tribune 9. Nov 1998. Long Furby. 2018. &lt;https://www.longfurby.com/&gt;. Lorenz, Konrad. “Die angeborenen Formen möglicher Erfahrung [The Innate Condition of the Possibility of Experience].” Zeitschrift für Tierpsychologie 5.2 (1943): 245–409. Lupton, Deborah, and Ben Williamson. “The Datafied Child: The Dataveillance of Children and Implications for Their Rights.” New Media &amp; Society 19 (2017): 780–794. Marsh, Alison. “Coded for Cuteness.” IEE Spectrum 56.1 (2019): 60. Marsh, Jackie. “The Uncanny Valley Revisited: Play with the Internet of Toys.” The Internet of Toys: Practices, Affordances and the Political Economy of Children’s Smart Play. Eds. Giovanna Mascheroni and Donell Holloway. London: Palgrave Macmillan, 2019. Milkaite, Ingrida, and Eva Lievens. “The Internet of Toys: Playing Games with Children’s Data?” The Internet of Toys: Practices, Affordances and the Political Economy of Children’s Smart Play. Eds. Giovanna Mascheroni and Donell Holloway. London: Palgrave Macmillan, 2019. Lee, Wendy Allison. “Cute. Dangerous. Asian American. 'Gremlins' @ 35.” Public Books, 2019. &lt;https://www.publicbooks.org/cute-dangerous-asian-american-gremlins-35/&gt;. Lenton, Patrick. “Happy 25th Birthday Furby, the Toy That Stole a Generation’s Hearts.” Sydney Morning Herald 6 Apr. 2023. &lt;https://www.smh.com.au/culture/comedy/happy-25th-birthday-furby-the-toy-that-stole-a-generation-s-hearts-20230403-p5cxoe.html&gt;. The Mitchells vs. The Machines. Dir. Mike Rianda. Sony Pictures Animation, 2021 Munroe, Tony. “Fur Flies at Mass. Malls over Hasbro’s Furby Doll.” Reuters, 28 Nov. 1998. Ngai, Sianne. Our Aesthetic Categories: Zany, Cute, Interesting. Cambridge: Harvard UP, 2012. Nishimura, Keiko. Communication Robot: Animating a Technological Solution in Twenty-First Century Japan. Dissertation. University of North Carolina at Chapel Hill, 2021. Phobe. Furby Autopsy, 1998. &lt;http://www.phobe.com/furby/&gt;. Powell, Daniel. Horror Culture in the New Millennium: Digital Dissonance and Technohorror. Washington, D.C.: Lexington, 2018. Ramalho, Maria Irene. “The Private Is Public or Furbies Are Us.” e-cadernos 27 (2017). &lt;http://journals.openedition.org/eces/2199&gt;. Rand, Erica. Barbie’s Queer Accessories. Carolina: Duke UP. Sale, Kirkpatrick. Rebels against the Future. London: Quartet Books, 1996. Silvio, Terry. “Animation: The New Performance.” Journal of Linguistic Anthropology 20: 422–438. Stevens, Carolyn. “Cute But Relaxed: Ten Years of Rilakkuma in Precarious Japan.” M/C Journal 17.2 (2014). &lt;https://doi.org/10.5204/mcj.783&gt;. Stuck, Rachel E., and Wendy A. Rogers. “Older Adults Perceptions of Supporting Factors of Trust in a Robot Care Providers.” Journal of Robotics (2018): 6519713. The Sun. “Frisky Furby Fun.” 31 Dec. 1999. Tan, Kok-Swang, and Irwin Hinberg, “Furby Does Not Interfere with Medical Devices.” Canadian Medical Association Journal 161 (1999): 971. Tiffany, Kaitlyn. “Every Furby Gets a Home.” Vox, 21 Dec. 2018. &lt;https://www.vox.com/the-goods/2018/12/21/18149004/furby-collectors-tumblr-vintage-robots-fandom&gt;. Turkle, Sherry. “Authenticity in the Age of Digital Companions.” Interaction Studies: Social Behaviour and Communication in Biological and Artificial Systems 8 (2007): 501–517. Turkle, Sherry. “A Nascent Robotics Culture: New Complicities for Companionship.” Machine Ethics and Robot Ethics. London: Routledge, 2017. Warmbir, Steve. “Mild Weather Draws Shoppers Out into the Sun. But Furby Frenzy Drives Desperate into Long Lines.” Chicago Daily Herald, 28 Nov. 1998: 4. Watson, Averie. “A Dark Furby Theory May Reveal Them as Flesh-Devouring Predators.” CBR, 20 Nov. 2021. &lt;https://www.cbr.com/dark-furby-predator-theory/&gt;. White, Rebecca, and Anna Remington. “Object Personification in Autism: This Paper Will Be Very Sad If You Don’t Read It.” Autism 23.4 (2018): 1042–1045. Williams, Al. “Mission Impossible: Infiltrating Furby.” Hackaday, 26 Nov. 2017. &lt;https://hackaday.com/2017/11/26/mission-impossible-infiltrating-furby/&gt;. Weeks, Linton. “The Great Furby Fuss.” The Washington Post, 24 Nov. 1998. &lt;https://www.washingtonpost.com/archive/lifestyle/1998/11/24/the-great-furby-fuss/30a0a340-658a-4609-ae07-f38ff368c7c4/&gt;. Yano, Christine. “Reach Out and Touch Someone: Thinking through Sanrio’s Social Communication Empire.” Japanese Studies 31.1 (2011): 23–36. Yorkshire Post. “Cyberpets – Harmless Fun or Addictive Craze?” 9 Nov. 1998: 9.

Authors: Alyona Sukhanova, Klervi Even-Desrumeaux, Patrick Chames, Daniel Baty, Mikhail Artemyev, Vladimir Oleinikov &amp; Igor Nabiev ### Abstract Nanoparticle-based biodetection commonly employs monoclonal antibodies (mAbs) for targeting. Although several types of conjugates have been used for biomarker labeling, the large size of mAbs limits the number of ligands per nanoparticle, impedes their intratumoral distribution, and limits intracellular penetration. Furthermore, the conditions of mAb conjugation using conventional techniques provide nanoprobes with irregular orientation of mAbs on the nanoparticle surface and often provoke mAb unfolding. Here, we have developed a protocol to engineer ultrasmall diagnostic nanoprobes through directional conjugation of semiconductor quantum dots (QDs) with 13-kDa single-domain antibodies (sdAbs) derived from llama immunoglobulin G (IgG). sdAbs are conjugated with QDs in a highly oriented manner via an additional cysteine residue specifically integrated into the sdAb C-terminus. The resultant nanoprobes are &lt;12 nm in diameter, ten times smaller in volume compared to the known alternatives. They have been proved highly efficient in flow cytometry and immunuhistochemical diagnosis. This approach is easy to extend to other semiconductor and plasmonic nanoparticles. In general, sdAb-QD bioconjugation, quality control and characterization take 3 days. ### Introduction The common approach to bioimaging, detection, and diagnosis with nanoparticles is to make use of the specificity and avidity of monoclonal antibodies (mAbs) for targeting (Fig. 1a,b) (1,2). Although several mAb–nanoparticle conjugates have been used for biomarker labeling, these functionalized nanoprobes are large, which limits the number of ligands that can be linked to the surface of a nanoparticle, impedes intratumoral distribution of nanoprobes because of interstitial tumor pressure, and limits their intracellular and intratissular penetration (3). Immunoglobulins G (IgGs) have a molecular weight of 150 kDa and an average size of 14.5×8.5×4 nm, which considerably limits their use for targeting (4). Furthermore, the conditions of mAb conjugation using conventional techniques provide the nanoprobes with irregular orientation of mAbs on the nanoparticle surface and often provoke IgG unfolding (Fig. 1c) (5). Smaller antibody fragments conjugated with the nanoparticles in a highly oriented manner may become an attractive alternative as components of the smallest possible targeted nanoprobes. IgGs are composed of two identical light chains and two identical heavy chains (Fig. 1b). A light chain contains one variable domain (VL) and one constant domain (CL), and a heavy chain has one variable domain (VH) and three constant domains (CHs). The antigen-binding sites of IgG are formed by association of the variable domains, VL–VH. Three interchain disulfide bonds ensure the stability and functional activity of IgG (Fig. 1a,b). As free sulfhydryls of Ab may be useful in a conjugation reaction with nanoparticle, the disulfide bond in the hinge region of IgG should be selectively reduced to obtain a functionally active partially cleaved heavy–light chain Ab fragment (75 kDa, Fig. 1c).  **Figure 1**. *Schematic diagram of the structures of full-size antibodies (Abs), their fragments, and different approaches to their linkage to nanoparticles*. - *(a) The Y-shaped structure of a full-size Ab, which is the ligand to be attached to the nanoparticle; the two light chains (variable regions) and the heavy chains (constant regions) are shown in violet and red, respectively. The specific functional sites at which the Ab can bind antigens are shown in green. The groups that can be used for attachment to nanoparticles are shown in yellow*. - *(b) A three-dimensional model of an Ab based on X-ray crystallography data. The Ab structure was taken from entry 1IGY of the Protein Data Bank (PDB). Light chains are shown in orange and cyan; heavy chains, in yellow and green. Carbohydrate residues are shown in purple*. - *(c) Fragmentation of an Ab into functional and nonfunctional Ab fragments after reduction of their disulfide bonds*. - *(d) Fragmentation of a llama heavy-chain Ab (HcAb) resulting in single variable-domain Ab fragments (single-domain antibodies, sdAbs)*. **Previous techniques and alternative methods** In terms of increasing the number of functionally active Abs on the nanoparticle surface, the integrity of the Ab binding sites and proper orientation of Abs after conjugation are the two crucial conditions. Commercial Ab–nanoparticle probes, e.g., Ab–quantum dot (QD) nanoprobes are made by conjugation of fragments of completely reduced Abs with amino groups on the surface of QDs (Fig. 1c) (5,6). Complete reduction of Abs disrupts the integrity of the recognition sites, each of which is formed by the variable domains of a heavy and a light chain linked by disulfide bonds, because these are also reduced . Other known strategies for Ab covalent coupling to QDs require a passivating ligand bound to the quantum surface to make it possible to use carbodiimide (–COOH), NHS ester (–NH2), or maleimide (–SH) chemistry routes (8,9). These approaches are not specific for the conjugation site, and they yield nanoprobes with irregular orientation of Abs on the nanoparticle surface (Fig. 2a). Recently, we have developed an advanced conjugation procedure based on selective reduction of the disulfide bond in the hinge region of IgG, leaving the bonds between the heavy and light chains intact (Fig.1c) (7). This ensures a high yield of functionally active half-antibodies, which can be purified and covalently conjugated with QDs by sulfo-SMCC chemistry methods to obtain nanoprobes with intact recognition sites and homogeneous orientations of Abs relative to the QD surface. These probes, though rather large in size, exhibit a tenfold higher recognition capacity compared to conventional nanoprobes (7). Despite this improvement, the approach developed does not always guarantee uniform orientation of the Ab functional fragments on the QD surface; therefore, new approaches to directional conjugation are required. One strategy to overcome the aforementioned problems is to engineer very small but functional Ab fragments, modify them so that only one, unique site per fragment is accessible for conjugation with the carrier (e.g., a nanoparticle), and deliver many such fragments on a single carrier (Fig. 2b). It is even possible to obtain multivalent nanoprobes, where small, functionally active fragments of different Abs against different antigens may be bound to the same nanoparticle in the same orientation10. In this way, more than one cellular target can be identified with a single multivalent probe (11).  **Figure 2**. *Conjugates of (a) full-size and (b) single-domain antibodies with quantum dots*. - *(a) Quantum dots (QDs) are conjugated with full-size antibodies (Abs) using carbodiimide chemistry. Abs are oriented randomly relative to the nanoparticle surface; some antigen-binding domains (red ovals) are sterically inaccessible (blue arrows). Only domains exposed to the outside are functionally active (orange arrows)*. - *(b) QDs are conjugated with single-domain Abs (sdAbs) via a single Cys residue specifically integrated in the sdAb C terminus. The antigen-binding domain of every sdAb is exposed to the outside and remains functionally active*. - The anatomy of QDs: *Se, orange; Cd, violet; S, yellow; Zn, dark-blue; C, light-blue; O, red; H, white*. - The anatomy of Abs: *β-structures, green bands; α-helix, red cylinders*. **Objectives of this technique** With a molecular weight of only 13 kDa, single-domain antibodies (sdAbs or VhH, Fig. 1d) represent the smallest functional Ab fragments capable of binding antigens with affinities comparable to those of conventional antibodies (12). An sdAb molecule occupies 12 times less space than a conventional IgG antibody does, and its size allows it to bind epitopes inaccessible to conventional IgGs (13). In addition to their small size, sdAbs are not prone to aggregation; they exist as monomers, diffuse much better into tissues than full-size IgGs (14), and their size allows them to label finer and more remote segments of organs and bind with the corresponding antigens more accurately compared to conventional IgGs (15,16). sdAbs are resistant to chemical detergents, extreme pH levels, heat, and proteolytic enzymes , and can be produced inexpensively using Escherichia coli or yeast cultures. All these characteristics make sdAbs the best capture molecules to prepare QD-based fluorescent nanoprobes for biodetection and diagnosis. Zaman et al. (19,20) recently used carbodiimide chemistry to conjugate anti-EGFR sdAbs to QDs. However, this approach provides nanoprobes with irregular orientation of sdAbs on the nanoparticle surface; hence, the resultant conjugates are not more efficient than conventional mAb–QD conjugates. To fully use the advantages of these unique ultrasmall capture molecules, they should be coupled with nanoparticles in a highly oriented manner (Fig. 2b). Here, we describe a well-tested protocol for engineering a new generation of ultrasmall, stable, specific diagnostic nanoprobes based on sdAbs (Fig. 1d) linked to QDs in a highly oriented manner (Fig. 2b) (15,16). We present a method for preparing diagnostic nanoparticles &lt;12 nm in diameter (ten times smaller in volume than that obtainable with alternative techniques) and demonstrate their high efficiency in flow cytometry and immunohistochemical diagnostic platforms. The protocol is so designed that it can be easily extended to other types of semiconductor or noble metal plasmonic or magnetic nanoparticles of different shapes, such as nanodots, nanorods, and nanowires. sdAbs containing a single Cys residue for conjugation with these nanoparticles can be engineered in about the same way. In this case, the concentrations of functionalized sdAbs and nanoparticles in the conjugation reaction should be optimized depending on the nanoparticle size, shape, and concentration. **Experimental design** The protocol described here consists of - (i) colloidal nanocrystal synthesis, characterization, quality control, and standardization; - (ii) nanocrystal water-solubilization, purification, functionalization, and quality control; - (iii) llama immunization and construction of a sdAb library followed by selection and ELISA screening of phage–sdAbs; - (iv) sdAb cloning, specific Cys-residue integration, sdAb production and purification, and affinity measurements; - (v) conjugation of sdAb–Cys antibodies with hydroxy- or amino-modified colloidal nanocrystals followed by characterization and quality control of the resultant diagnostic nanoprobes. The efficiency of this protocol was proved by the use of the engineered diagnostic nanoprobes in flow cytometry detection of cells expressing a rare biomarker and detection of immunohistochemistry biomarkers in clinical biopsies, where the probes have ensured clear discrimination between pathological and healthy areas (15,16). The sdAb–QD conjugates stain all antigenic sites revealed by “gold standard” anatomopathological diagnostic methods, whereas the conventional fluorescence-based medical diagnostic protocol leaves many antigenic sites undetected (see ANTICIPATED RESULTS). ### Reagents **REAGENTS** 1. Cadmium oxide (Aldrich, cat. no. 244783) - 2-Ethylhexanoic acid, 99% (Aldrich, cat. no. E29141) - Octadecene, 90% (Aldrich, cat. no. O806) - Oleylamine,, technical grade, 70% (Aldrich, cat. no. O7805) - Hexadecylphosphonic acid, 97% (Strem, cat. no. 15-2400) - Selenium powder, 100 mesh, ≥99.5% trace metals basis (Aldrich, cat. no. 209651) - Trioctylphosphine, technical grade, 90% (Aldrich, cat. no. 17854) - Zinc oxide puriss. (Aldrich, cat. no. 14439) - Triethylene glycol dimethyl ether, 99% (Aldrich, cat. no. T59803) - Thiourea puriss. p.a., ACS reagent, ≥99.0% (RT) (Aldrich, cat. no. 88810) - Isopropanol, 99% (Fluka, cat. no. 59310) - Trioctylphosphine oxide ReagentPlus®, 99% (Aldrich, cat. no. 223301) - DL-Cysteine hydrochloride hydrate (Sigma, cat. no. C8256) - Methanol, ACS spectrophotometric grade (Sigma, cat. no. 154903) - Chloroform, ACS spectrophotometric grade (Sigma, cat. no. 366919) - NaOH (Fisher, cat. no. S318) ! CAUTION Wear gloves and use a fume hood when handling NaOH. - SH and OH-modified polyethylene glycol, PEG (ProChimia Surfaces, cat. no. TH 001-m11.n6) - SH and NH2-modified polyethylene glycol, PEG (ProChimia Surfaces, cat. no. TH 002-m11.n6) - Sephadex® G-25 (Sigma, cat. no. G2550) - Ficoll-Histopaque-1077 (PAA, cat. no. J15-004) - Phosphate-buffered saline (10× PBS) (Gibco, Invitrogen, cat. no. 14200-067) - GenElute Mammalian Total RNA Miniprep Kit (Sigma, cat. no. RTN70) - Sense and antisense primers (any commercial provider, e.g., Invitrogen): - 3’CH2-2: GGT ACG TGC TGT TGA ACT GTT CC - 3’VHH Not: CCA CGA TTC TGC GGC CGC TGA GGA GAC RGT GAC CTG GGT CC - 5’VH1 Sfi: C ATG CCA TGA CTC GCG GCC CAG CCG GCC ATG GCC CAG GTG CAG CTG GTG CAG TCT GG - 5’VH2 Sfi: C ATG CCA TGA CTC GCG GCC CAG CCG GCC ATG GCC CAG GTC ACC TTG AAG GAG TCT GG - 5’VH3 Sfi: C ATG CCA TGA CTC GCG GCC CAG CCG GCC ATG GCC GAG GTG CAG CTG GTG GAG TCT GG - 5’VH4 Sfi: C ATG CCA TGA CTC GCG GCC CAG CCG GCC ATG GCC CAG GTG CAG CTG CAG GAG TCG GG - Diethyl pyrocarbonate (DEPC) (Sigma, cat. no. D5758) - Transcriptor reverse transcriptase, 200 U/µl, and the appropriate buffer (Roche, cat. no. 03531317001) - Ribonuclease inhibitor from human placenta (RNAsine) (Sigma, cat. no. R2520). - dNTPs, (Eurogentec, cat. no. 0020-50) - Phusion, 2 U/µl and corresponding buffer (Finnzymes, cat. no. F-530L) - Ultra-pure water (Biochrom AG, cat. no. L0015) - Agarose (Eurobio, cat. no. GEPAGA07-65) - Dynazyme II DNA polymerase, 250 U (Fisher, cat. no. w386M5) - SfiI restriction enzyme (New England Biolabs, cat. no. R01235) - NotI restriction enzyme (New England Biolabs, cat. no. R01895) - BglII restriction enzyme (New England Biolabs, cat. no. R01435) - pHENI vector (available upon request) - Antarctic Phosphatase (New England Biolabs, cat. no. M0289L) - T4 DNA ligase (Promega, cat. no. M180B) - T4 DNA ligase 10× buffer (Promega, cat. no. C126B) - Agar (MP Biomedicals, cat. no. 150178) - 2×TY broth (MP Biomedicals, cat. no. 3012-032) - D-(+)-Glucose monohydrate (Fluka, cat. no. 49159) - Ampicillin (Sigma, cat. no. A9518) - Kanamycin (Sigma, cat. no. K1377) - 5-Bromo-4-chloro-3-indolyl phosphate sodium salt (BCIP) (Sigma, cat. no. B6149) - E. coli TG1 strain (Zymo research, cat no. T3017 ) - Glycerol, ultra-pure (MP Biomedicals, cat. no. 800688) - Tween 20 (Sigma, cat. no. P5927) - Nonfat dry milk - KM13 helper phage (available upon request) - Polyethylene glycol (Fluka, cat. no. 81268) - NaCl (Sigma, cat. no. 21074) - Epoxy Dynabeads® (Invitrogen, cat. no. 140.11) - Trypsin (Sigma, cat. no. T1426) - 0.25% Trypsin/EDTA (Gibco, Invitrogen, cat. no. 25200) - Trypan Blue Stain (Invitrogen, cat. no. 15250-061) - M13KO7 helper phage (New England Biolabs, cat. no. N0315S) - HRP-coupled anti-M13 monoclonal antibody (GE Healthcare, cat. no. 27-9421-01) - Sodium citrate (Fisher, cat. no. S279) ! CAUTION Wear gloves and use a fume hood when handling sodium citrate. - H2O2, 30% (Sigma, cat. no. 21-676-3) - Sodium citrate tribasic dehydrate, ACS reagent (Sigma, cat. no. 54641) - Citric acid (Sigma, cat. no. C0759) - ABTS (Sigma, cat. no. A9941) - Bl21(DE3) strain (EMD Millipore, cat. no. 69387) - Pfu Ultra High-Fidelity DNA polymerase, 100 U (Agilent, cat. no. 600380) - TG1 electrocompetent cells (Euromedex, cat. no. 60502-2) - Isopropyl β-D-1-thiogalactopyranosid (IPTG) (Sigma, cat. no. I1284) - BugBuster (VWR, cat. no.70584-4) - Talon™ metal affinity resin (Ozyme, cat. no. 635503) - Protein assay kit (Bio-Rad Laboratories, cat. nos. 500-0113 and 500-0114) - TCEP∙HCl (Pierce, cat. no. 20490) - Sulfosuccinimidyl 4-(N-maleimidomethyl)-cyclohexane-1-caroxylate water soluble heterobifunctional crosslinker, Sulfo-SMCC (Pierce, cat. no. 22322) - Superdex® 200 Prep Grade (Sigma, cat. no. S6782) - N-(p-Maleimidophenyl) isocyanate crosslinker, PMPI (Pierce, cat. no. 28100) - Dimethyl sulfoxide, DMSO (Sigma, cat. no. D8418) - Phosphate-buffered saline tablets, pH 7.4 (Sigma, cat. no. P4417) - BupH Borate Buffer Packs (Pierce, cat. no. 28384) - Sodium phosphate dibasic (Sigma, cat. no. 71636) - Sodium phosphate monobasic (Sigma, cat. no. S8282) - MC38 cells (available upon request) - MC38CEA (available upon request) - DMEM glutaMAX media (Invitrogen, Gibco, cat. no. 31965-023) - Heat-inactivated FCS (BioWhittaker, cat. no. 14-503) - Penicillin (Sigma, cat. no. P3032) - Streptomycin (Sigma, cat. no. S9137) - Fungizone (Sigma, cat. no. A9528) - G418 (Sigma, cat. no. A1720) - Human serum from a pool of nontransfused AB male donors (Institute Jacques Boy, cat. no. 201021334) - Human appendix tissue samples from retrospective incision biopsy specimens (Department of Pathology of University Hospital Robert Debré, Reims, France) - BSA (Sigma, cat. no. B4287) - BSA fraction V 7.5% solution (Life Technologies, cat. no. 15260037) - Polyoxylethylene-sorbitan monolaurate, Tween 20 (Sigma, cat. no. P2287) - CEA-specific monoclonal antibody, clone TF 3H8-1 (Ventana Medical Systems, cat. no. 760-2507) - Polyclonal goat anti-mouse immunoglobulin conjugated with fluorescein isothiocyanate (Dako, cat. no. F0479) - Biotinylated sheep anti-mouse polyclonal immunoglobulin (GE Healthcare, cat. no. RPN1001) - REAL™ system kit (peroxidase/DAB) (Dako, cat. no. K5001) - 40 mM HEPES, pHB8.5 (Fisher, cat. no. BP310) **REAGENT SETUP** 1. **2× TY medium**: prepare the solution and autoclave. - **Ampicillin stock solution (1000×)**: 100 mg/ml. - **Kanamycin stock solution (200×)**: 10 mg/ml. - **Glucose stock solution**: 40%. - **PEG8000/NaCl**: 20% PEG8000 and 2.5 M NaCl. - **TPBS**: 0.1% Tween 20 in PBS. - **2% MPBS**: 2% nonfat dry milk diluted in PBS. - **MT-PBS**: 2% Milk and 2% Tween 20 in PBS. - **Glycerol stock solution**: 80%. - **Trypsin stock solution (10×)**: 10 mg/ml in 50 mM tris HCl pH 7,4, 1 mM CaCl2 - **IPTG stock solution (1000×)**: 100 mM in water. - **ELISA revelation mixture**: 18 ml of PBS, 1 ml of 1 M sodium citrate, 1 ml of 1 M citric acid, 20 µl of 30% H2O2, and one tablet of ABTS. - **2× TYA**: 2× TY and 100 µg/ml ampicillin. - **2× TYAG**: 2× TY, 100 µg/ml ampicillin, and 2% glucose. - **2× TYAK**: 2× TY, 100 µg/ml ampicillin, and 50 µg/ml kanamycin. - **2× TYAG plates**: 90- or 120-mm Petri dishes containing 2× TY, 100 µg/ml ampicillin, 2% glucose, and agar. - **2× TYAG plates + BCIP**: 90-mm Petri dishes containing 2× TY, 100 µg/ml ampicillin, 50 µg/ml BCIP, and agar. - **5’VHx Sfi**: 50 µl of 10 µM 5’VH3 Sfi, 40 µl of 10 µM 5’VH1 Sfi, and 10 µl of 10 µM 5’VH4 Sfi. - **H2O DEPC**: 0.1% (v/v) DEPC in water. Incubate for 1 h at 37°C and autoclave. - **Sodium borate buffer, pH 8.5**: empty the contents of one foil envelope of a BupH Borate Buffer pack (Pierce, cat. no. 28384) into a beaker, add ultrapure water and stir to dissolve. When dissolved in 500 ml of water, each pack yields 50 mM borate, pH 8.5. - **Phosphate buffer, pH 7.0**: mix 423 ml of 1 M monobasic sodium phosphate (Sigma, cat. no. S8282) and 577 ml of 1 M dibasic sodium phosphate (Sigma, cat. no. 71636) to obtain 1 l of a 1 M buffer solution. - **Phosphate buffer, pH 7.2**: mix 316 ml of 1 M monobasic sodium phosphate (Sigma, cat. no. S8282) and 684 ml of 1 M dibasic sodium phosphate (Sigma, cat. no. 71636) to obtain 1 l of a 1 M buffer solution. - **PBS**: dissolve one tablet of phosphate-buffered saline (Sigma, cat. no. P4417) in 200 ml of deionized water to obtain 0.01 M phosphate buffer, add 0.0027 M potassium chloride and 0.137 M sodium chloride, pH 7.4, at 25°C. - **PBS with 0.05% Tween 20**: mix 0.5 ml of Tween 20 and 1 l of PBS on a magnetic stirrer. - **1% BSA in PBS**: dissolve 5 g of BSA (Sigma, cat. no. B4287) in 500 ml of PBS (Sigma, cat. no. P4417), mix on a magnetic stirrer, and filter through a 0.22-µm filter. - **2% BSA in PBS with 0.05% Tween 20**: add 10 g of BSA to 500 ml of PBS containing 0.05% Tween 20, stir on a magnetic stirrer, and filter through a 0.22-µm filter. - **DL-cysteine solution**: dissolve 10 mg of DL-cysteine hydrochloride hydrate (Sigma, cat. no. C8256) in 1 ml of methanol (Sigma, cat. no. 154903). ▲CRITICAL Use the solution immediately after preparation. - **PEG derivative solutions**: dissolve 75 mg of hydroxyPEG (ProChimia Surfaces, cat. no. TH 001-m11.n6) or 50 mg of aminoPEG SH and NH2-modified PEG (ProChimia Surfaces, cat. no. TH 002-m11.n6) in 0.5 ml of Milli-Q water. ▲CRITICAL Use the solutions immediately after preparation. ### Equipment 1. Heating mantle, model WM/R1/25 (Horst Winkler) - Power supply, Mc227 (VWR) - Thermocouple thermometer, HI 93531 (VWR) - Magnetic stirrer, KMO 2 basic IKAMAG (VWR) - Vacuum pump, LABOPORT N842.3 FT.18 (VWR) - Centrifuge, Eppendorf 5804 (VWR) - Three-neck round-bottom flask, 25 ml (Aldrich) - High-resolution Miniature Fiber Optic Spectrometer, HR 2000 (Ocean Optics, Inc.) - Spectrofluorimeter, Jobin Yvon Spex FluoroMax 2 (Jobin Yvon Inc.) - Varian Cary 50 Conc. UV/Vis spectrophotometer - Varian Cary Eclipse spectrofluorimeter - Zetasizer Nano ZS (Malvern Instruments) - Amicon Ultra-15 filter units of 10 kDa cut-off (VWR) - Disposable polypropylene columns (2-10 ml) (Pierce) - NucleoSpin Extract II column (Macherey-Nagel) - PCR thermocycler T3000 (Biometra) - Breathable sealer (Dutcher) - Blood separation tube (PAA) - VIVASPIN 20 PES 5 KD, (Dutcher) - iEMS Incubator/Shaker HT (Thermo Scientific) - Cuvette for electroporation (Ozyme) - PD MiniTrap G-25 (GE Healthcare) - Nalgene Filter Units, 500-ml capacity, MF75 series (VWR) - Bransonic ultrasonic cleaner, Branson 2510EMT (Sigma) - Eppendorf 5810R bench top centrifuge (Eppendorf) - Eppendorf 5418 microcentrifuge (Eppendorf) - Eppendorf concentrator plus complete system (Eppendorf) - RM-2L Intelli-Mixer (Dutscher) - FACStarPlus flow cytometer (Becton Dickinson). - Guava EasyCyte™ Plus, flow cytometer (Guava Technologies). - Fluorescence microscope, Intravert (Carl Zeiss). ### Procedure **COLLOIDAL NANOCRYSTAL SYNTHESIS, CHARACTERIZATION, QUALITY CONTROL, AND STANDARDIZATION** **Synthesis of colloidal hydrophobic CdSe core nanocrystals (quantum dots) ●TIMING 90 min** 1.Place 1 mmol of cadmium oxide, 3 mmol of 2-ethylhexanoic acid, and 2 ml of octadecene into a three-neck 25-ml round-bottom flask and heat in a heating mantle to ca. 200°C for 10 min until cadmium oxide completely dissolves and clear solution is obtained. Cool the mixture to the room temperature and add 6 ml of octadecene, 2 ml of oleylamine and 100 mg of hexadecylphosphonic acid. Equip the system with adapters for vacuum drying, argon flow, a thermocouple, and a magnetic stirring bar. Heat the reaction mixture to 100°C and pump out to 5 mbar for 5 min under vigorous magnetic stirring. Stop pumping, let the argon flow, and heat the mixture to 170°C. Stop the argon flow, pump out the system, and dry the reaction mixture at 170°C for 20 min under vigorous stirring. 2.Parallel to step 1, place 3 mmol of selenium powder into a glass tube, add 1 ml of octadecene, seal the tube with Parafilm and blow with argon for 10 min. Inject 4 mmol of trioctylphosphine into the solution with a syringe and blow the solution with argon for another 20 min until complete dissolution of selenium and formation of a clear viscous solution. ? TROUBLESHOOTING 3.Heat the reaction mixture in the flask to 250°C under argon flow and vigorous stirring. Inject the selenium solution with a syringe into the reaction mixture in the flask. Keep the temperature of the reaction mixture at 230°C. Every 30 s, take an aliquot (ca. 0.1 ml) of the reaction mixture with a glass syringe, dissolve it quickly in 2 ml of chloroform in an optical quartz cuvette, and record the optical absorption and the luminescence spectra (excitation wavelength, 400 nm; spectral range, 420–650 nm; integration time, 0.1 s; slit width, 3 nm). ▲CRITICAL STEP Initially, a weak photoluminescence band centered at ca. 480 nm is formed shortly after the injection of the selenium solution; it quickly shifts to the longer-wave region due to the growth of CdSe nanocrystals. The main photoluminescence band is also accompanied by a very broad secondary photoluminescence band in the red region. Be careful not to overgrow the CdSe core nanocrystals: do not miss the reaction time when the blue photoluminescence band approaches 510 nm. ? TROUBLESHOOTING 4.Immediately after the photoluminescence band has approached 510 nm, stop heating and quickly cool the reaction mixture to 100°C. ▲CRITICAL STEP Too slow cooling may result in overgrowth of CdSe core nanocrystals and a spectral shift of the photoluminescence band far from 510 nm. If necessary, inject 1–3 ml of cold benzene into the reaction mixture to speed up the cooling. **Growth of an epitaxial ZnS shell around the CdSe core ●TIMING 90 min** 5.Add 2 ml of oleylamine into the reaction mixture in the three-neck flask, keep stirring the mixture under argon at 100°C for 10 min. While the mixture is being stirred, place 3 mmol of zinc oxide, 7 mmol of ethylcaproic acid, and 3 ml of triethyleneglycol dimethyl ether into a 10-ml reaction tube and heat the mixture to 150°C to completely dissolve zinc oxide and obtain a clear solution. Cool the solution to the room temperature. Place 2.5 mol of thiourea and 3 ml of triethyleneglycol dimethyl ether into another 10-ml tube and slowly heat to 100°C to completely dissolve thiourea. Cool the solution to the room temperature. ▲CRITICAL STEP Do not overheat the thiourea solution. The appearance of opalescence or yellow–brown color will indicate partial decomposition of thiourea (Fig. 3). Such a colored solution should be discarded, and the procedure repeated.  **Figure 3**. *A test tube containing a thiourea solution in triethyleneglycol dimethyl ether*. - *(a) A properly prepared solution*. - *(b) The same solution when overheated, with thiourea partly decomposed*. 6.Mix together the solutions of zinc ethylcaproate and thiourea in one reaction tube, seal with Parafilm and purge with argon for 10 min at room temperature. Heat the reaction mixture in the flask to 180°C under argon while vigorously stirring and inject the zinc salt and thiourea dissolved in triethyleneglycol dimethyl ether dropwise to the reaction mixture at 180°C under argon flow. The injection rate should be about 1 ml/min. After finishing the injection, continue stirring the reaction mixture at 180°C for another 30 min and stop the heating. Cool the reaction mixture to 70–80°C. 7.Open the system, add ca. 10 ml of isopropanol to the reaction mixture and stir it for 1–2 min without heating. The initially clear colloidal solution with bright green luminescence (Fig. 4a) becomes muddy orange with weak yellow luminescence (Fig. 4b,c). ? TROUBLESHOOTING  **Figure 4**. *A flask containing CdSe/ZnS core–shell colloidal nanocrystals*. - *(a) A photoluminescence image of the flask containing as-synthesized nanocrystals*. - *(b, c) Optical and photoluminescence images, respectively, of the same flask after addition of isopropanol. The suspension of quantum dots is clearly seen as a muddy solution with weak yellow luminescence*. Transfer the suspension of the core–shell nanocrystals into a 50-ml polypropylene centrifuge tube and centrifuge the solid phase out of the mother solution at 5000 rpm for 5 min. Discard the solution, fill the tube with 10 ml of chloroform, completely dissolve the solid phase of nanocrystals in the chloroform and add 10 ml of methanol. Centrifuge the suspension at 5000 rpm for 10 min. Discard the solution, add a second portion of chloroform (10 ml), completely dissolve the nanocrystals, and add 10 ml of methanol. Centrifuge the suspension at 5000 rpm for 10 min. Discard the solution, add the third portion of chloroform (10 ml) and 200 mg of trioctylphosphine oxide. Completely dissolve the mixture to obtain a clear solution. ■PAUSE POINT The resultant CdSe/ZnS core–shell nanocrystals (quantum dots, QDs) can be stored in two forms (see options A and B below). (A) Transfer the solution into a vial and store at room temperature in the dark. It can be stored under these conditions for one year. (B) Put the solution into a 50-ml crystallization dish and slowly evaporate chloroform under a ventilation hood at room temperature to obtain a solid powder. Transfer the powder into a vial and store at room temperature in the dark. It can be stored under these conditions for one year. **NANOCRYSTAL WATER-SOLUBILIZATION, PURIFICATION, FUNCTIONALIZATION, AND QUALITY CONTROL** **Nanocrystal solubilization ●TIMING 120 min** 8.Dissolve 10 mg of nanocrystals (QDs) in 1 ml of chloroform. Add 1 ml of methanol and wash by centrifugation for 4 min at 14,000 rpm. Repeat the washing two times and dissolve a pellet in 1 ml of chloroform. Add 200 µl of 10 mg/ml solution of DL-Cystein in methanol dropwise to 1 ml of the solution of QDs in chloroform until the solution becomes cloudy. ? TROUBLESHOOTING 9.Sediment the QDs by centrifugation at 14,000 rpm, wash them three times with methanol to remove the excess Cys that has not reacted, and dry them under vacuum. 10.Dissolve the dry powder of QDs in Milli-Q water by adding 1 M solution of NaOH dropwise. Sonicate the solution and filter it through 0.22-µm Ultrafree-MC microcentrifuge filters. The resultant water-soluble QDs exhibit bright orange photoluminescence with an emission maximum at 570 nm and a quantum yield close to 40% at room temperature. ▲CRITICAL STEP Add the methanol solution of DL-Cys to the chloroform solution of QDs slowly and dropwise, controlling the aggregation state of the mixture. ? TROUBLESHOOTING **Quantum dot functionalization and purification ●TIMING 24 h** One of the possible ways to obtain water-stable QDs with functional groups available for conjugation with biomolecules is the use of polymers that form a self-assembled monolayer on the surface of QDs. 11.To replace DL-Cys from the surface of QDs with thiol-containing polyethyleneglycol (PEG) derivatives containing hydroxyl or amino end groups, add 156 µl of a 150 mg/ml hydroxyPEG solution in pure water or a mixture of 25 µl of a 100 mg/ml aminoPEG solution and 140 µl of a 150 mg/ml hydroxyPEG solution to 1 ml of a 10 mg/ml pure-water solution of the preparations of QDs conjugated with DL-Cys. 12.Incubate the samples overnight at +4°C, pre-purify them by centrifugation with the use of Amicon Ultra-15 filter units (10 kDa cut-off), and finally purify them from excess ligands by gel-exclusion chromatography on Sephadex-25 home-made columns. ▲CRITICAL STEP Use freshly prepared solutions of thiol-containing PEG derivatives. **Quantum dot quality control ●TIMING 24 h** 13.The QD samples can be characterized using the dynamic light scattering (DLS) and electrophoresis techniques by means of a Zetasizer Nano ZS device (Malvern Instruments). Pass the samples through a 0.1-µm filter and measure the particle size distribution at 25°C in a low-volume quartz batch cuvette. Calculate the particle hydrodynamic size from the diffusion times using the Stokes–Einstein equation. Repeat measurements at least three times for each sample and at each value of intensity of scattering measurement (10 runs per measurement) and calculate the hydrodynamic diameter of the sample using the CONTIN algorithm. Record the absorbance spectra and measure the photoluminescence at λex = 400 nm. ■ PAUSE POINT Functionalized QDs can be stored at +4°C for up to 2 months until conjugation with antibodies. Do not freeze the samples, because this will cause irreversible aggregation. **LLAMA IMMUNIZATION AND sdAb LIBRARY CONSTRUCTION FOLLOWED BY SELECTION AND ELISA SCREENING OF PHAGE PARTICLES CARRYING sdAbs (PHAGE–sdAbs) (Fig. 5)** **Llama immunization ●TIMING 2 months** 14.A young adult male llama (*Lama glama*) is immunized subcutaneously on days 1, 30, 60, 90, and 120 with cells expressing the antigen (50∙106 cells per immunization). Sera are collected 15 days before each injection to follow the immune response against the immunogen. **Lymphocyte preparation ●TIMING 5 h** 15.Blood samples (&gt;100 ml) are taken 15 days after each of the last three immunizations. Peripheral blood mononuclear cells (PBMCs) are isolated by discontinuous gradient centrifugation. The whole procedure should be performed at room temperature. 16.*Preparation of blood separation tubes* (50 ml). Place 17 ml of Ficoll-Histopaque-1077 into each tube and centrifuge it for 30 s at 840g at room temperature to force the medium through the porous barrier. Remove the excess ficoll from above the barrier. ▲CRITICAL STEP No air should be left under the barrier; the surface of the medium and the barrier should be at the same level. 17.*Lymphocyte purification*. Dilute blood twofold in PBS. Place 30 ml of the diluted blood into each tube and centrifuge it at 400g for 40 min at room temperature without using a brake for deceleration. The lymphocytes (70–100% enrichment) are concentrated in the interphase (a white layer) between the plasma and the separation solution (Fig. 5). Recover the lymphocytes by pipetting and wash them twice with PBS containing 1% FCS by centrifugation at 1500g for 20 min at room temperature. ■PAUSE POINT The lymphocyte pellet can be stored at –80°C until RNA extraction.  **Figure 5**. *Schematic overview describing the selection of single-domain antibodies*. - *(1) Llamas are immunized with the antigen of interest*. - *(2) Peripheral blood mononuclear cells are recovered from blood using density gradient centrifugation (ficoll)*. - *(3) A pool of cDNA coding for sdAb genes is amplified by RT–PCR from a total RNA preparation and cloned into a phagemid vector*. - *(4) A helper phage is used to produce a library of phage particles carrying sdAbs on their surface by fusion to the minor coat protein p3*. - *(5) This phage-sdAb library is enriched with binders by incubation with immobilized antigen, washing and elution*. - *(6) A monoclonal screening assay allows the identification of the binders*. - *(7) Soluble sdAbs corresponding to positive phage–sdAbs are produced, purified from E. coli and analyzed by SDS–PAGE*. **RNA extraction ●TIMING 2 h** 18.Lymphocyte RNA is extracted using the GenElute Mammalian Total RNA Miniprep Kit (Sigma Aldrich) according to the recommendations of the manufacturer. Check the RNA extraction on 2% agarose gel (Fig. 6a). ▲CRITICAL STEP When working with RNA, wear gloves, use filter tips, and H2O DEPC. ■PAUSE POINT RNA can be stored at –80°C until construction of the library. ** VHH library construction ●TIMING 4 days** *Insert preparation* 19.*Reverse transcription to obtain cDNA*. Put 1 µl of RNA mix, 1 µl of the 3’CH2-2 primer, and 13 µl of H2O DEPC into an RNase-free Eppendorf tube. Incubate for 5 min at 65°C and cool down on ice. Add 4 µl of the reverse transcriptase buffer, 0.5 µl of RNAsine, 2 µl of 10 mM dNTP mix, and 0.5 µl of reverse transcriptase. Incubate for 30 min at 55°C and 5 min at 85°C and cool down on ice. ▲CRITICAL STEP Wear gloves and use filter tips when working with RNA. 20.*The first PCR on cDNA for IgG gene amplificatio*n. PCR amplification is performed using the primer 3’CH2-2 (0.05 µM) and the 5’VHx Sfi mixture (0.1 µM) (50% of 5’VH3 Sfi, 40% of 5’VH1 Sfi, and 10% of 5’VH4 Sfi). Each reaction mixture (50 µl) contains 4 µl of cDNA, 1× Phusion HF buffer, 200 µM dNTPs, the primers, and 1 U of Phusion enzyme. The mixture is heated for 3 min at 94°C, which is followed by 40 cycles consisting of denaturation at 94°C (1 min), annealing at 65°C (1 min), and elongation at 72°C (1.5 min); finally, the mixture is heated for 10 min at 72°C to complete elongation. Check the results of PCR on 2% agarose gel (Fig. 6b). ■PAUSE POINT This product can be stored at –20°C. 20a.*(an optional step) HCAb (IgG2 and IgG3) gene purification*. If a library containing only VHH (without VH) is required, isolate the genes of IgG2 and IgG3 on agarose gel and purify DNA on a NucleoSpin Extract II column. 21.*The second PCR for VHH amplification*. For amplification, use the primer 3’VHHNot (0.5 µM) and the 5’VHx Sfi mixture (0.5 µM) (50% of 5’VH3 Sfi, 40% of 5’VH1 Sfi, and 10% of 5’VH4 Sfi). Each reaction mixture (200 µl) contains 0.8 µl of the first PCR product, 1× Dynazyme buffer, 200 µM dNTPs, the primers, and 1 U of Dynazyme II enzyme. The mixture is heated for 3 min at 94°C, which is followed by 30 cycles consisting of denaturation at 94°C (30 s), annealing at 65°C (30 s), and extension at 72°C (1 min); then, the mixture is heated for 10 min at 72°C for final extension. Check the PCR on 2% agarose gel (Fig. 6c). Purify the PCR product on a NucleoSpin Extract II column and elute it in a final volume of 30 µl. ■PAUSE POINT This product can be stored at –20°C.  **Figure 6**. *Examples of a successful total RNA isolation and PCR results*. - *(a) An example of a successful total RNA isolation from PBMCs. The main bands corresponding to 28S and 18S RNAs are shown*. - *(b) An example of the result of PCR1. Three main bands can be seen; they correspond to the amplification of the DNA fragments coding VH–CH1–CH2 of IgG1 and VHH–CH2 of the heavy chains of IgG2 and IgG3*. - *(c) An example of a successful result of PCR2. A diffuse band migrating at around 400 bp can be seen; it corresponds to VhH genes coding for single-domain antibodies*. 22.*Insert digestion*. Digest the entire PCR product for 3 h with the restriction endonucleases BglI (80 U) and NotI (80 U) following the recommendations of the manufacturer. Purify the digestion product on a NucleoSpin Extract II column and elute in a final volume of 20 µl. Check the digestion on 2% agarose gel. *Vector preparation* The pHENI vector containing the in-frame PhoA gene and the 6hisGS tag is used. 23.*Vector digestion*. Digest 5 µg of vector with the NotI (150 U, 3 h, 37°C) and SfiI (100 U, 3 h, 50°C) enzymes following the recommendations of the manufacturer. Purify the digestion product on a NucleoSpin Extract II column and elute in a final volume of 200 µl. Check the digestion on 1% agarose gel. 24.*Vector dephosphorylation*. Dephosphorylate the vector with Antartic phosphatase following the recommendations of the manufacturer. Purify the product on a NucleoSpin Extract II column and elute it in a final volume of 40 µl. 25.*Vector purification*. Purify the digested vector on agarose 1% gel and then purify DNA on a NucleoSpin Extract II column. *Ligation* 26.A fivefold molar excess of the insert over the vector is used for the ligation reaction. In this case, the insert is 10 times smaller than the vector, which corresponds to a twofold excess of the vector by weight. Thus, for one ligation reaction (in a final volume of 10 µl), use 80 ng of the vector, 40 ng of the insert, T4 DNA ligase (3 U), and enzyme buffer following the recommendations of the manufacturer. Do not forget to perform a negative control of ligation without the insert. Incubate overnight at 16°C. Inactivate the DNA ligase by incubation for 20 min at 65°C. ▲CRITICAL STEP This inactivation step is crucial for obtaining the necessary diversity, because it increases the efficiency of the subsequent electroporation step. *Electroporation* 27.Use 2 µl of the ligation product and 25 µl of the TG1 electrocompetent cell suspension per electroporation following the recommendations of the manufacturer. Plate the transformation product onto 2× TYAG agar plates (9-cm Petri dishes) containing BCIP for PhoA expression detection. Calculate the diversity obtained with one electroporation (with 2 µl of the ligation reaction mixture) and perform enough electroporations to reach a minimum diversity of 106. ? TROUBLESHOOTING *Library amplification* 28.Keep 10 µl of the electroporation pool for titration. Centrifuge the rest at 3000g for 10 min. Resuspend the pellet in 2 ml of 2× TYAG. Plate 500 µl of the bacteria suspension onto four 2× TYAG agar plates (15-cm Petri dish). Grow overnight at 37°C. Resuspend the colonies in 2.5 ml of 2× TYAG by scraping them with a spatula (from six 2× TYAG agar plates) and place them in a fresh test tube. Spin at 3000g for 10 min. Discard the supernatant, resuspend the cells using a volume of 2× TYAG equivalent to the pellet volume and add glycerol to a final concentration of 15%. Mix and store at –80°C (this will serve as the glycerol stock of your library). Resuspension of a pellet in an equal volume of 2× TYAG should yield a suspension with an OD of about 50–100. This value is used to calculate the amount of the glycerol stock required for the following rescue to avoid losing the diversity. *Library titration* 29.Use the electroporation product pool to perform serial dilutions. Add 10 µl of the pool to 995 µl of 2× TY (a 10–2 dilution). Make serial dilutions of the pool to a dilution of 10–8. Plate 100 µl of each dilution of the bacteria suspension onto 2× TYAG agar plates (9-cm Petri dish). Grow the cells overnight at 37°C. Count the colonies and calculate the CFU or CFU/ml titer according to the dilution. **Selection of sdAbs against the cell surface receptor target ●TIMING 5 days** ▲CRITICAL STEP Filamentous phages are difficult to eliminate. Use disposable tubes and pipettes as much as possible to avoid phage contamination. The most effective method for removing the phages is treatment with 2% hypochlorite. *Production of phage–sdAbs with helper phage KM13* 30.Inoculate 2× TYAG medium with a representative aliquot of your library. ▲CRITICAL STEP Use 10 to 100 times more bacteria compared to the library diversity to avoid the loss of diversity. As a rough guide, for TG1 strain, OD600 = 1 corresponds to 2∙10e8 cells. 31.Grow while shaking at 250 rpm at 37°C until the OD600 reaches 0.5. Add the KM13 helper phage to reach a ratio of 10–20 helper phages per cell. Incubate without shaking at 37°C for 30 min. Spin at 3000g for 10 min. Resuspend the pellet in a volume of 2× TYAK five times larger than the initial volume. 32.Grow the culture while shaking at 250 rpm at 30°C overnight. Centrifuge the bacterial culture in a 50-ml test tube at 3000g for 15 min. Precipitate phage particles by transferring 25 ml of the supernatant to a fresh test tube containing 1/5 the volume of PEG/NaCl. Mix by inversion and incubate for 1 h on ice. Centrifuge for 15 min at 3000g at 4°C and discard the supernatant. Resuspend the pellet in 1 ml of cold PBS and transfer the suspension to a 1.5-ml Eppendorf tube. Centrifuge for 5 min at 14,000g. Precipitate phage particles by transferring the supernatant to a fresh test tube containing 1/5 the volume of PEG/NaCl. Mix by inversion and incubate for 20 min on ice. Centrifuge for 5 min at 14,000g at 4°C and discard the supernatant. Resuspend the pellet in 1 ml of cold PBS containing 15% glycerol. ■PAUSE POINT The phage can be stored at –80°C until the selection step. *The first round of selection on purified antigen coated on epoxy beads* 33.Coat epoxy beads with antigen according to the manual. Prepare an overnight preculture from a fresh colony of TG1 in 3 ml of 2× TY. Incubate overnight at 37°C. Wash the immobilized antigen two or three times with TPBS and two or three times with PBS. Saturate the antigen-coated material and 1012 phages of your library for 1–2 h at room temperature in two separate vials using 1 ml of MPBS for each. Keep 10 µl of this phage suspension for titration (input). Remove the MPBS and add the preblocked phage to the blocked antigen. Incubate for 2 h at room temperature while shaking gently. Wash the beads nine times with TPBS and two times with PBS. ▲CRITICAL STEP When beads and test tubes are used, make sure to recover and wash beads that may have been trapped in the vial caps. *Elution* 34.Elute the phage by resuspending the cells in 500 µl of trypsin (10 µg/ml) in PBS for 30 min at room temperature on a rotator (DNase may be added if the eluate is too viscous). Add 500 µl of PBS to a final volume of 1 ml corresponding to the output of the selection. ■PAUSE POINT If necessary, the input and output phages can be stored at 4°C for 1 month. *Infection of E. coli TG1 with the selected phage* 35.Keep 10 µl of the eluted (output) phage for titration. Dilute the output phage suspension with 4 ml of 2× TY. Add 5 ml of TG1 at OD600 = 0.5. Incubate without shaking at 37°C for 30 min. Spin at 3000g for 10 min. Resuspend the pellet in 3 ml of 2× TYAG. Plate 500 µl of the bacteria suspension on six 2× TYAG agar plates (15-cm Petri dishes). 36.Grow the culture overnight at 37°C. Resuspend colonies in 2.5 ml of 2× TYAG by scraping them with a spatula (from six 2×TYAG agar plates) and place them into a fresh test tube. Centrifuge at 3000g for 10 min. Resuspend the cells using one pellet volume of 2× TYAG and add glycerol to a final concentration of 15%. Mix and store at –80°C (this will serve as the glycerol stock of the selection output). Start with this for the production of phage–sdAbs for the second round of selection. *Phage titration (of the input and output phage suspensions)* 37.Add 5 µl of each of the input and output phage suspensions to 495 µl of 2× TY (a 10e–2 dilution). Make serial dilutions of the phage suspension to a final dilution of 10–12 for the input suspension and 10e–8 for the output one. Inoculate the suspensions with 500 µl of TG1 at OD600 = 0.5. Incubate without shaking at 37°C for 30 min. Plate 100 µl of each dilution of the bacteria suspension onto 2× TYAG agar plates (9-cm Petri dishes). Grow overnight at 37°C. Count the colonies and calculate the CFU or CFU/ml titer according to the dilution. ▲CRITICAL STEP Monitor properly the OD of the TG1 culture. An OD of 0.4–0.6 (corresponding to the exponential phase) maximizes the expression of pili, which is required for infection with phages. *Master plate preparation* 38.Fill each well of a 96-well U-bottom polypropylene microtiter plate with 150 µl of 2× TYAG. Pick 94 clones with sterile tips from the desired panning round and inoculate each well. Seal the plate with a breathable sealing film. Leave two wells without clones as a negative control. 39.Incubate the cultures overnight in a microtiter plate shaker at 37°C at 900 rpm. Add glycerol solution to the overnight culture to a final concentration of 15%. Mix the cell suspensions and store this master plate at –80°C. *The second round of selection on intact cells* 40.*Preparation of cells*. Selection has to be performed on cells displaying the antigen. Adherent cells are enzymatically detached using a Trypsin–EDTA solution to obtain a suspension of separate cells. The trypsin incubation should be as short as possible. Add the medium containing 10% (v/v) serum to inhibit trypsin and to prevent further proteolytic degradation of surface molecules. Count the cells (the vitality of the cells can be determined by trypan blue exclusion staining). Sediment the cells by centrifugation for 5 min at 300g at 4°C. Add 10 ml of cold PBS and resuspend the cells. Sediment the cells for 5 min at 300g at 4°C. Use (10–50)∙106 of each cell type at the next step. ▲CRITICAL STEP In order to avoid the internalization of your target antigen during selection or screening, it is essential that all procedures involving cells should be performed at 4°C. 41.The second round of selection. Saturate antigen-positive cells by incubation with 5 ml of MPBS for 1 h on a rotator at 4°C. Sediment the cells by centrifugation for 5 min at 300g at 4°C and add 1012 phage–sdAb (blocked with MBPS as described above) to the cells. Incubate for 2 h at 4°C on a rotator. Pellet the cells for 5 min at 300g at 4°C and transfer the supernatant to a fresh test tube. Wash the cells with 1 ml of PBS. Pellet the cells for 5 min at 300g at 4°C. Repeat this washing procedure 10 times. All subsequent steps are identical to the first round of selection. The number of rounds required to select the majority of binders is usually two or three for an immune library and four to six for a nonimmune library. This number should be varied depending on the enrichment obtained; i.e., if few relevant clones are obtained during screening, an additional round is required. ▲CRITICAL STEP In order to avoid the internalization of your target antigen during selection or screening, it is essential that all procedures involving cells should be performed at at 4°C. ? TROUBLESHOOTING **Screening of phage–sdAbs against the cell surface receptor target ●TIMING 2 days** *Phage–antibody production in 96-well microtiter plates* 42.Fill a 96-well U-bottom polypropylene microtiter plate with 150 µl of 2× TYAG and add 5 µl of the glycerol culture from the master plate. Incubate at 37°C with a breathable sealer in a microtiter plate shaker at 900 rpm (to a OD600 = 0.5) for about 1.5 h if you have used a fresh master plate culture for inoculation or about 2.5 h if a frozen master plate is used. Add helper phage M13KO7 to obtain a ratio of 10–20 helper phages per cell. Incubate the cells without shaking at 37°C for 30 min. Centrifuge the suspension at 350g for 10 min. Resuspend the pellet in 150 µl/well of 2× TYAK. Grow the culture overnight in a microtiter plate shaker at 30°C at 900 rpm. ▲CRITICAL STEP Be careful not to add glucose while producing phage–sdAbs; otherwise, the promoter will be repressed and no production will occur. *Screening for positive phage–sdAb by ELISA on intact cells* 43.Centrifuge the 96 well U-bottom polypropylene microtiter plate containing the phage–antibodies at 350g for 10 min. The supernatant contains the phage–antibodies that will be used for ELISA. Screening should be performed for both the cells expressing the specific antigen and the cells devoid of this antigen to be used as a negative control (ideally, use cells from the same line transfected and not transfected with the antigen). Adherent cells are enzymatically detached with a Trypsin–EDTA solution to obtain a suspension of separate cells. The trypsin incubation should be as short as possible. Add the medium containing 10% (v/v) serum to inhibit trypsin and to prevent further proteolytic degradation of surface molecules. Count cells (the vitality of the cells can be determined by trypan blue exclusion staining). Sediment the cells by centrifugation for 5 min at 300g at 4°C. Discard the supernatant completely. Saturate cells and V-bottom microtiter plates using 5% MPBS for 1 h at 4°C. Resuspend the cells (2×10e6 cells/ml) and place the suspension into V-bottom microtiter plates using100 µl/wells. Centrifuge the cells for 5 min at 300g at 4°C. Discard the supernatant completely (the microtiter plate should be emptied immediately after centrifugation by turning the plate face down and discarding the supernatant with one push). Put the microtiter plate on ice and resuspend the cells in 80 µl of 5% MPBS and 20 µl of the phage–antibody solution per well for 2 h at 4°C while mixing gently. Wash the cells three times with 150 µl/well of PBS (add PBS, mix the cells, centrifuge the suspension, and discard the supernatant; repeat three times). Put the microtiter plate on ice and resuspend the cells in 50 µl per well of anti-M13-HRP monoclonal antibody for 1 h at 4°C while mixing gently. Wash the cells three times with 150 µl/well of PBS (add PBS, mix cells, centrifuge the suspension, and discard the supernatant; repeat three times). Finally, resuspend the cells in 100 µl/well of the staining solution (18 ml of PBS, 1 ml of 1 M sodium citrate, 1 ml of 1 M citric acid, 20 µl of 30% H2O2, and one pastille of ABTS). ▲CRITICAL STEP When the output of the selection is less than 10% of positive clones, it is advisable to perform an additional round of selection. ? TROUBLESHOOTING **sdAb CLONING, SPECIFIC CYS-RESIDUE INTEGRATION, sdAb PRODUCTION, PURIFICATION, AND AFFINITY MEASUREMENTS** **SdAb subcloning in the pET vector for cytoplasmic production of sdAb ●TIMING 2 days** 44.The sdAbs are first subcloned into the pET vector allowing its cytoplasmic pool to be linked to the hexahistidine tag under the control of the T7 promoter in the BL21DE3 strain, which yields the plasmid pET sdAb-his6. **Specific Cys-residue integration ●TIMING 1 day** 45.Engineer an extra C-terminal cysteine to facilitate sdAb conjugation by linear amplification using the primers 6hisCysfor (CCATCATCATCACGGATCCTGCTAAGCTTGCTGAGCAATAACTAGC) and 6hisCysrev (GCTAGTTATTGCTCAGCAAGCTTAGCAGGATCCGTGATGATGATGG); this yields pET sdAb–his6Cys. Each reaction mixture (25 µl) contains 50 ng of the vector, 1× PCR buffer, 200 µM dNTPs, 150 ng of each of the sense and antisense primers, and 1.25 U of Pfu Ultra DNA polymerase (Stratagene). Heat the mixture for 30 s at 95°C and then perform 25 cycles consisting of denaturation at 95°C (30 s), annealing at 55°C (1 min), and elongation at 68°C (2 min per kilobase of the new construct). On completion, treat 9 µl of the reaction with 1 µl of a DpnI solution for 2 h at 37°C to digest the methylated parental plasmid. Purify DNA by precipitation with absolute ethanol and washing with 70% ethanol. The reaction mixture is electroporated into electrocompetent XL1-blue cells following the manufacturer’s instructions. Clones are checked by DNA sequencing. **SdAb–Cys production and purification ●TIMING 2 days** 46.The pET sdAb–his6Cys vectors are electroporated into the E. coli strain Bl21DE3. Inoculate the cells containing the plasmid in 10 ml of 2× TYAG medium. Grow the cells overnight at 37°C (250 rpm), dilute the cultures to an OD600 of 0.1 in 400 ml of fresh 2× TYA, then grow the cultures until the OD600 reaches 0.5. SdAb expression is induced by addition of 0.1 mM IPTG, and the cells are incubated at 30°C while shaking at 250 rpm for 20 h. Freeze the cell pellet for 20 min at –80°C and lyse it by adding 20 ml of BugBuster for 20 min while gently shaking. Purification on Talon™ metal affinity resin is performed following the recommendation of the manufacturer. Concentrate proteins in PBS by ultrafiltration with VIVASPIN 20 PES 5 kD and store them at –20°C. Their purity is evaluated by SDS–PAGE analysis, and the protein concentration (on average, 5 mg/ml) is determined spectrophotometrically using a protein assay kit. **CONJUGATION OF sdAb–CYS WITH HYDROXY-MODIFIED COLLOIDAL NANOCRYSTALS FOLLOWED BY CHARACTERIZATION AND QUALITY CONTROL OF THE RESULTANT DIAGNOSTIC NANOPROBES** **TCEP reduction of the intermolecular disulfide bonds within sdAb dimers ●TIMING 1 h** 47.Prepare a 10 mM stock solution of Tris(2-carboxyethyl)phosphine (TCEP) in 50 mM phosphate buffer (pH 7.0) immediately before use. Dilute an sdAb sample to obtain a 100 µM solution of protein in 50 mM phosphate buffer, pH 7.0. 48.Add a tenfold molar excess of TCEP and incubate the mixture for 30 min at room temperature, then use PD MiniTrap G-25 desalting centrifugation columns to remove the TCEP products and concentrate the sdAb–SH. ▲CRITICAL STEP Use the sample of reduced sdAb–SH for conjugation with QDs immediately. **Conjugation of sdAb-SHs with QDs ●TIMING 1 day (either option)** 49.This step can be performed using option A or option B, depending on the active functional groups at the surface of QDs (Fig. 7).  **Figure 7**. *Schematic presentation of the use of (a) the sulfosuccinimidyl 4-(N-maleimidomethyl)-cyclohexane-1-caroxylate (sulfo-SMCC) or (b) the N-(p-maleimidophenyl) isocyanate (PMPI) conjugation reaction. Conjugation reactions (a) and (b) were used to obtain oriented sdAb–QD conjugates by linking, respectively, NH2 and OH groups on the QD surface with SH groups of sdAbs. Both conjugations involve the SH group of the single Cys residue specifically integrated in the C terminus of sdAbs that is available for conjugation. The procedures yield conjugates with an average of four copies of homogeneously oriented sdAbs per QD*. (A) *Conjugation of sdAb–SH with amino-modified QDs using the sulfosuccinimidyl 4-(N-maleimidomethyl)-cyclohexane-1-caroxylate (Sulfo-SMCC) reaction* (Fig. 7a) - (i) Dilute water-soluble QDs containing 10% of aminoPEG and 90% of hydroxyPEG on their surface to obtain 0.5 ml of a 4 mg/ml QD solution in 100 mM phosphate buffer, pH 7.2. - (ii) Add a 100-fold molar excess of Sulfo-SMCC to the QD preparation. Incubate the reaction mixture for 1 h at room temperature in the dark while stirring gently (40 rpm) on an RM-2L Intelli-Mixer. Immediately purify the maleimide-activated QDs by applying the reaction mixture onto a home-made column packed with Sephadex G-25 resin equilibrated with 100 mM phosphate buffer, pH 7.2. - (iii) Mix the maleimide-activated QDs with sdAb-SH to obtain a molar ratio of 1:10. Incubate the reaction mixture for 2 h at room temperature in the dark while stirring gently (40 rpm) on an RM-2L Intelli-Mixer. Finally, purify sdAb–QD conjugates by gel exclusion chromatography on a home-made Superdex 200 resin column equilibrated with 100 mM phosphate buffer, pH 7.2. ▲CRITICAL STEP Use freshly prepared samples of sdAb-SH and solution of the Sulfo-SMCC crosslinker. (B) *Conjugation of sdAb-SHs with hydroxy-modified QDs using the PMPI (N-(p-maleimidophenyl) isocyanate) reaction* (Fig. 7b) - (i) Prepare the working solution of the PMPI crosslinker in DMSO. Dilute the water-soluble QDs containing only hydroxyl groups on their surface to obtain 0.5 ml of a 2 mg/ml QD solution in 50 mM sodium borate buffer, pH 8.5. - (ii) Add a 50-fold molar excess of PMPI to the sample. Incubate the reaction mixture for 30 min at room temperature in the dark while stirring gently (40 rpm) on an RM-2L Intelli-Mixer. Immediately purify maleimide-activated QDs by applying the reaction mixture onto a home-made column packed with Sephadex G-25 resin and equilibrated with 50 mM phosphate buffer, pH 7.0. - (iii) Mix purified maleimide-activated QDs with sdAb-SH to obtain a molar ratio of 1:10. Incubate the mixture for 2 h at room temperature in the dark while stirring gently (40 rpm) on an RM-2L Intelli-Mixer. Finally, purify the sdAb–QD conjugate by gel exclusion chromatography on a home-made Superdex 200 resin column equilibrated with 50 mM phosphate buffer, pH 7.0. ▲CRITICAL STEP Use freshly prepared samples of sdAb-SH and solution of the PMPI crosslinker. ■PAUSE POINT The prepared conjugates can be kept at +4°C. **A functional test: cell labeling and immunohistochemistry** *Labelling cells with sdAb–QD conjugates and flow cytometry measurements* 50.Suspend MC38 and MC38CEA cells by gently shaking for 5 min. Wash 3∙10e5 cells and incubate them for 30 min at 4°C in the dark with 50 µl of different dilutions of sdAb–QD conjugates in PBS or human serum. Wash two times with PBS containing 1% of bovine serum albumin (BSA). Begin the next step immediately. 51.Perform flow cytometry measurements of the stained cells with a FACStarPlus (Becton Dickinson) or Guava EasyCyte™ Plus (Guava Technologies™) flow cytometer. Use a 488-nm argon laser for excitation and measure the fluorescence intensity in the range 564–586 nm with a FACStarPlus flow cytometer or in the range 570–596 nm with a Guava EasyCyte™ Plus flow cytometer. Collect at least 5000 events for each sample. Use geometric mean fluorescence (GMF) intensity channels to quantify the staining of each sample. *Immunohistochemistry and fluorescence immunostaining* 52.Deparaffinize 5-μm paraffin sections in xylene, rehydrate them through ethanol (100, 96, and 70%), and finally bring them to water. Incubate the slides for 60 min in a citrate buffer solution (2% citric acid and 8% sodium citrate) at 95°C and then for 20 min at room temperature in the same buffer. Incubate slides with 3% hydrogen peroxide and 20% methanol to quench the endogenous peroxidase activity and then wash them with water. Block nonspecific binding by a 20-min incubation of the tissue sections in a 2% solution of BSA in PBS containing 0.05% Tween 20. 53.Stain the tissue section with a 1.5∙10e–8 M solution of anti-CEA (carcinoembryogenic antigen) sdAb–QD570 conjugates for 1 h in a humidified chamber at room temperature. Wash three times with PBS. Observe fluorescence emission under a fluorescence microscope (Carl Zeiss) using 350–400 nm UV excitation and 450-nm (long pass) emission filters. 54.For the control test, apply a 1.6∙10e–9 M solution of anti-CEA monoclonal antibody (clone TF3H8) to the tissue section for 1 h in a humidified chamber at room temperature. Wash it three times with PBS. Stain the tissue with polyclonal goat anti-mouse IgG conjugated with FITC for 1 h at room temperature. After washing three times with PBS, mount the slides with the mounting medium and view them under a fluorescence microscope (Carl Zeiss) using a 420- to 490-nm excitation filter and a 520-nm (long pass) emission filter. 55.For the “gold standard” immunohistochemical control labeling of the tissue section, incubate the slides with anti-CEA monoclonal antibody (clone TF 3H8-1, 6∙10e–9 M) for 1 h in a humidified chamber at room temperature. Wash the slides with PBS and incubate them with biotinylated sheep anti-mouse polyclonal IgG in PBS at room temperature for 1 h; develop the slides using a REAL™ system kit (peroxidase/DAB). After washing with PBS–Tween, view the slides under an optical microscope (Carl Zeiss). ? TROUBLESHOOTING ### Timing In general, sdAb-QD bioconjugation, quality control, and characterization take 3 days. ### Troubleshooting  ### Anticipated Results We have recently used ultrasmall diagnostic nanoprobes engineered by our method in the flow cytometry and immunohistochemical cancer diagnostic platforms (15,16). In order to prove the concept, we used carcinoembryonic antigen (CEA), a well-known cancer biomarker, as a target (21). An elevated concentration of CEA can be detected in the blood of patients with some cancers, especially large intestine (colorectal) cancer. It may also be detected in patients with pancreas, breast, ovary, or lung cancer. CEA is normally produced during embryonic development (21). The production of CEA stops before birth, and the antigen is not normally found in the blood of healthy adults. The CEA test is used to find how widespread some cancers, especially colorectal cancer, are and to test the success of their treatment. The CEA levels before and after surgery can be measured to evaluate both the success of the surgery, the patient’s chances of recovery, and the efficiency of therapy, as well as to detect recurrence of the disease (21). As a membrane antigen overexpressed by cancer cells, CEA can be targeted for imaging or therapeutic purposes. We have shown that sdAb–QD conjugates are stable, retain target specificity to CEA-expressing tumor cells in human serum, and may be used for detection of CEA-expressing tumor cells by means of flow cytometry assay. Moreover, the data show excellent correlation between the number of cells detected as CEA-positive and the actual number of CEA-positive cells in mixtures of CEA-positive and CEA-negative MC38 cells, where as few as 1% of CEA-positive cells can be easily detected (Fig. 8). This confirms the high specificity of flow cytometry detection using sdAb–QD conjugates.  **Figure 8**. *Discrimination of CEA-positive (MC38CEA) and CEA-negative (MC38) cells in their mixture using sdAb–QD conjugates*. - *(a) Distribution of the intensity of staining with sdAb–QD conjugates in a mixture of MC38CEA and MC38 cells. The MF intensity of MC38 cells (M1) is 5.7; the MF intensity of MC38CEA cells (M2) is 95.7 (red, 100% of MC38; pink, 90% of MC38 + 10% of MC38CEA; blue, 75% of MC38 + 25% of MC38CEA; green, 100% of MC38CEA)*. - *(b) The calibration curve for quantitative detection of MC38CEA cells in mixtures of MC38CEA and MC38 cells*. Finally, immunolabeling of human biopsies with the use of sdAb–QD conjugates is as efficient as that provided by the “gold standard” DAB-based protocol or, in some respects, more efficient than it and ensures clear discrimination between tumor and non-pathological tissue areas. The sdAb–QD fluorescent detection has also been favorably compared with the standard fluorescence detection procedure, where biopsies are stained with anti-CEA mAbs revealed using polyclonal goat anti-mouse IgG–FITC conjugates. In addition, sdAb–QD conjugates have been shown to stain all antigenic sites revealed with the “gold standard” anatomopathological diagnosis, whereas the conventional fluorescence-based medical diagnostic protocol leaves many antigenic sites undetected (Fig. 9). Our protocol has been so designed that it can be easily extended to other types of plasmonic and semiconductor nanoparticles.  **Figure 9**. *Comparative histochemical immunostaining of a patient’s appendix epithelial crypts using the sdAb–QD and conventional techniques*. - *(a) CEA (brown) revealed with the use of anti-CEA IgG and DAB chromogen (light microscopy)*. - *(b) CEA (yellow) revealed with the use of anti-CEA sdAb covalently linked to QD570 (epi-fluorescence microscopy)*. - *(c) CEA (green) revealed with the use of mouse anti-CEA IgG and anti-mouse IgG–FITC (epi-fluorescence microscopy)*. ### References 1. Xing, Y. &amp; Rao, J. Quantum dot bioconjugates for in vitro diagnostics &amp; in vivo imaging. *Cancer Biomarkers* 4, 307-19 (2008). - Jaiswal, J.K., Goldman, E.R., Mattoussi, H. &amp; Simon, S.M. Use of quantum dots for live cell imaging. *Nat. Methods* 1, 73-78 (2004). - Parak, W.J. et al. Biological applications of colloidal nanocrystals. *Nanotechnology* 14, R15 (2003) - Amit, A., Mariuzza, R.A., Phillips, S.E. &amp; Poljak, R.J. Three-dimensional structure of an antigen-antibody complex at 2.8 A resolution. *Science* 233, 747-753 (1986). - Pathak, S., Davidson, M.C. &amp; Silva, G.A. Characterization of the functional binding properties of antibody conjugated quantum dots. *Nano Lett*. 7, 1839-1845 (2007). - Invitrogen : http://probes.invitrogen.com/media/pis/mp19010.pdf - Mahmoud, W. et al. Advanced procedures for labelling of antibodies with quantum dots. *Anal. Biochem*. 416, 180-185 (2011). - Liu, W. et al. Compact biocompatible quantum dots functionalized for cellular imaging. *J. Am. Chem. Soc*. 130, 1274–1284 (2008). - Xing, Y. et al. Bioconjugated quantum dots for multiplexed and quantitative immunohistochemistry. *Nat. Protocols* 2, 1152-1165 (2007). - Kumar, S., Aaron, J. &amp; Sokolov, K. Directional conjugation of antibodies to nanoparticles for synthesis of multiplexed optical contrast agents with both delivery and targeting moieties. *Nat. Protocols* 3, 314-320 (2008) - Holliger, P. &amp; Hudson, P.J. Engineered antibody fragments and the rise of single domains. *Nat. Biotechnol*. 23, 1126-1136 (2005). - Saerens, D. et al. Single domain antibodies derived from dromedary lymph node and peripheral blood lymphocytes sensing conformational variants of prostate-specific antigen. *J. Biol. Chem*. 279, 51965-51972 (2004). - Behar, G. et al. Llama single-domain antibodies directed against nonconventional epitopes of tumour-associated carcinoembryonic antigen absent from nonspecific cross-reacting antigen. *FEBS J*. 276, 3881-3893 (2009) - Perruchini, C. et al. Llama VHH antibody fragments against GFAP: better diffusion in fixed tissues than classical monoclonal antibodies. *Acta Neuropathol*. 118, 685-695 (2009). - Sukhanova, A. et al. Oriented conjugates single-domain antibodies and quantum dots: toward new generation of ultra-small diagnostic nanoprobes. *NanoMedicine: NBM* 8, 516-525 (2012). - Sukhanova, A. et al. Oriented conjugates of monoclonal and single-domain antibodies with quantum dots for flow cytometry and immunohistochemistry diagnostic applications. *Proc. SPIE* 8232, 82320T (2012). - Dumoulin, M. et al. Single-domain antibody fragments with high conformational stability. *Protein Sci*. 11, 500-515 (2002). - Olichon, A., Schweizer, D., Muyldermans, S. &amp; de Marco, A. Heating as a rapid purification method for recovering correctly-folded thermotolerant VH and VHH domains. *BMC Biotechnol*. 7, 7-14 (2007). - Zaman, M.B., Baral, T.N., Zhang, J., Whitfield, D. &amp; Yu, K. Single-domain antibody functionalized CdSe/ZnS quantum dots for cellular imaging of cancer cells. *J. Phys. Chem. C* 113, 496-499 (2009). - Zaman, M.B. et al. Single-domain antibody bioconjugated near-IR quantum dots for targeted cellular imaging of pancreatic cancer. *J. Nanosci. Nanotechnol*. 11, 3757-63 (2011). - Hammarstrom S. The carcinoembryonic antigen (CEA) family: structures, suggested functions and expression in normal and malignant tissues. *Semin Cancer Biol*. 9, 67-81 (1999). ### Acknowledgements We thank the members of the research group and associates, in particular Dr. T. Tabary, Mrs. B. Reveil, Dr. A. Kisserli, and Prof. J.M. Millot, who have contributed to the development of some stages of this protocol when working on their individual projects. We also thank Prof. M. Pluot and Prof. J.H.M. Cohen for advice and discussion. This study was partly supported by the European Commission through the FP7 Cooperation project NAMDIATREAM (grant NMP-2009-4.0-3-246479) and the Ministry of Education and Science of the Russian Federation (grant 11.G34.31.0050). ### Associated Publications 1. **Oriented conjugates of single-domain antibodies and quantum dots: toward a new generation of ultrasmall diagnostic nanoprobes**. Alyona Sukhanova, Klervi Even-Desrumeaux, Aymric Kisserli, Thierry Tabary, Brigitte Reveil, Jean-Marc Millot, Patrick Chames, Daniel Baty, Mikhail Artemyev, Vladimir Oleinikov, Michel Pluot, Jacques H.M. Cohen, and Igor Nabiev. *Nanomedicine: Nanotechnology, Biology and Medicine* 8 (4) 516 - 525 [doi:10.1016/j.nano.2011.07.007](http://dx.doi.org/10.1016/j.nano.2011.07.007) - **Oriented conjugates of monoclonal and single-domain antibodies with quantum dots for flow cytometry and immunohistochemistry diagnostic applications** [doi:10.1117/12.905896](http://dx.doi.org/10.1117/12.905896) ### Author information **Alyona Sukhanova &amp; Igor Nabiev**, Technological Platform “Semiconductor Nanocrystals,” Institute of Molecular Medicine, Trinity College Dublin, James’s Street, Dublin 8, Ireland and Laboratory of Nano-Bioengineering, Moscow Engineering Physics Institute,115409 Moscow, Russian Federation. **Klervi Even-Desrumeaux, Patrick Chames &amp; Daniel Baty**, Inserm, U1068, CRCM, Marseille, F-13009, France; Institut Paoli-Calmettes, Marseille, F-13009, France; Aix-Marseille Univ, Marseille, F-13284, France; CNRS, UMR7258, CRCM, Marseille, F-13009, France. **Mikhail Artemyev &amp; Vladimir Oleinikov**, Laboratory of Nano-Bioengineering, Moscow Engineering Physics Institute, 31 Kashirskoe sh., 115409 Moscow, Russian Federation. Correspondence to: Igor Nabiev (igor.nabiev@gmail.com) *Source: [Protocol Exchange](http://www.nature.com/protocolexchange/protocols/2463) (2012) doi:10.1038/protex.2012.042. Originally published online 22 August 2012*.

2021 is the fiftieth anniversary year for Japanese live-action superhero franchise Kamen Rider. For half a century, heroes bearing the name Kamen Rider have battled rubber suited monsters and defended the smiles of children. Unlike many superheroes, however, the Kamen Riders are grotesque heroes, usually drawing their powers from the same source as the villains they battle. Grotesque human-machine-animal hybrids, they differ from their opponents only in the kindness of their hearts and the strength of their spirits. Although the Kamen Rider franchise includes a variety of texts including manga, novels, movies, and stage musicals, the central text is the Sunday morning children’s television program. This article focusses exclusively on the television series. Each season of the television program is comprised of around fifty twenty-five-minute episodes, and each season features an entirely new cast, title, and premise. Kamen Rider was originally created at a time of economic downturn and social unrest, and the unease of the zeitgeist is reflected in the figure of the no longer human hero. A little over thirty years later Japan was again facing a variety of crises and intense debate over what, if any, role it should play in the wars in Afghanistan and Iraq. The 2002 television season, Kamen Rider Ryūki, tackles difficult questions about what justice, heroism, and monstrosity mean, through the medium of a children’s martial arts and live action special effects hero television program. This article explores the blurred boundaries between monster and hero in Kamen Rider, in the context of social attitudes toward children. The First Kamen Rider The inaugural Kamen Rider (protagonist of the 1971 television season), Hongo Takeshi, is a university student who gains superpowers after being abducted and experimented on by Shocker, a terrorist organisation founded by Nazis. Their medical experiments are part of a plan to produce an army capable of world domination. Takeshi’s body was modified with grasshopper DNA and cybernetic enhancements, but he was able to escape before the mind control portion of the operation. Although he appears human, Takeshi transforms via a special belt into Kamen (masked) Rider in order to fight. His face is obscured by an insectoid helmet with red compound eyes and antennae. The transformation scene is a highlight of every episode, and the transformation belt is the most important of the (many) tie-in toys. The primary audience of Kamen Rider is children between two and seven, and as a media-mix (Steinberg) franchise the sale of toys and branded products to the primary audience is vital. Anne Allison (105) identifies the transformation and blending or crossing of bodily borders it entails as the “money shot” children anticipate and enjoy. There is also a substantial tertiary audience, however, which includes older children and adults. During the early 1970s, when the first few seasons of Kamen Rider were broadcast, ‘employment trains’ were transporting Japanese teenagers (immediately following their graduation from middle school) from rural areas to the large cities, where they worked in factories and construction far from their families (Alt 54). Kamen Rider’s creator, Ishinomori Shōtarō, had debuted as a manga artist while still in school himself, and his works were particularly popular among this disenfranchised demographic. The figure of a young man taken and changed against his will and left to forge his own path in the aftermath may have been particularly resonant with these teenagers. Kamen Rider’s creator, Ishinomori Shōtarō, was a member of the yakeato (burnt ruins) generation, who were children during the Second World War and experienced the fire- and nuclear bombings of Japan and grew up amidst the burned-out ruins. Roman Rosenbaum (Redacting 97-98) argues that this generation (or perhaps more accurately, micro-generation), “later subconsciously released the bent-up trauma of their early childhood experiences throughout their adult lives in their body of work”. Ishinomori was not alone in this experience, of course; other members of the early Kamen Rider creative team were also motivated by childhood trauma. Hirayama Tōru, who helped Ishinomori bring the Rider concept to television as a producer, was sixteen when his hometown of Nagoya was firebombed. He and other schoolboys were dispatched to dispose of the bodies of civilians who had died while trying to escape the flames only to die in the river (Oda and Muraeda 41-2). Members of the yakeato generation were prominent in anti-war activism during the 1970s, opposing Japan’s entanglement in the Vietnam War (Rosenbaum Generation 284). Violence and the meaning of justice were urgent issues for this generation. This first season of Kamen Rider, along with many of the subsequent seasons, is classifiable as a horror text, with numerous Gothic elements (Staite). Many of the monsters Takeshi battles are “designed to elicit a specific reaction: that of abject horror” (Kim 28). While some of the prosthetic suits are quite silly-looking by contemporary standards, many remain compellingly disturbing in their fusion of animal-human-machine. Although he proceeds up the chain of command to eventually battle the leaders of Shocker, Takeshi is always aware when battling other victims of Shocker experimentation that the only difference between himself and them is that he was able to escape before losing his will. He, like them, is no longer entirely human, and has become as grotesque as the unfortunate monsters he must defeat. As Miura Shion (180) puts it (translation mine), “Kamen Rider was originally an entity created by evil. The reality is that the enemy in front of you and you are actually the same. The fate of Kamen Rider is to fight while struggling with this”. Noting that Kamen Rider was created during a time of social, economic, and political upheaval in Japan, Hirofumi Katsuno (37-38) links the rise of the ambiguous hero to the decline of the ‘grand narrative’ of modernity and the belief in the kind of absolute justice represented by more traditional superheroes. Kamen Rider instead inhabits “an ambiguous space between human and nonhuman, good and evil” (Katsuno 44). In the early years of the franchise the ambiguity remained largely centred on the figure of the hero. Members of the opposing Shocker organisation – who were responsible for the rise of the first two Kamen Riders – are unambiguously evil and unsympathetic. For ordinary people who have been subjected to mind control and experimentation there is compassion, but in terms of the central conflict there is no question that destroying Shocker is correct and moral. The villains battled by Kamen Riders remained predominantly fascists and cultists bent on world domination until the late 1980s, with the primary antagonist of 1987 season Kamen Rider Black the protagonist’s beloved brother. The following season, Kamen Rider Black RX, had environmental themes. The villains trying to take over the world in this season are doing so because their own planet has become too polluted to sustain life. They argue, somewhat persuasively, that since humans are on the path to global environmental destruction they are justified in taking over the planet before it is ruined. This gradual shift toward more sympathetic monsters became explicit in 2002 with Kamen Rider Ryūki’s ambivalent response to the Bush administration’s so-called War on Terror. Justice Is a Thing with Teeth and Claws Kamen Rider Ryūki (hereafter Ryūki) was in the planning stages when the 9/11 terrorist attacks occurred, destroying the twin towers. TV Asahi, the station that airs Kamen Rider, immediately sent a directive to producer Shirakura Shinichiro stating that “now more than ever we must teach children about justice” (Salas). Seemingly uncomfortable with the implications of this idea of “justice” in light of the Bush administration's subsequent actions, Shirakura says: in that mood I wondered if I could repeat the sort of hero story we had made so far, where the ‘good person’ beats the ‘bad person’ that appears one after another and finally hits the headquarters of evil. It is very dangerous to plant the mentality of the Cold War era in children at this time. ‘Ryuuki’ was created in the hope that children will have an eye for what justice means. (Cited in Uno 261-2, translation mine) Since its creation in the 1970s, Kamen Rider had been forging a new path for Japanese heroes in opposition to what Jonathan Abel identifies as an external attitude to justice in the hero programs of the 1950s and 1960s. In these programs, he argues, justice was represented as something imposed into Japan from outside (by alien superheroes, for example, or the Allied Occupation forces). American superheroes and their various approaches to questions of justice and vigilantism were also well known in Japan, as Timothy Peters has highlighted. In its depiction of a hero so closely resembling the monsters he battles, Kamen Rider rejected notions of an absolute distinction between the categories of hero and monster. As Katsuno (46) argues, “in this postmodern, liquid society, superheroes lack a unified, self-evident justice, but must navigate multiple conceptions of justice … . As embodiments of relativized justice, these grotesque heroes were the seeds for what have become enduring trends in Japanese popular culture”. 2002 season Ryūki takes the idea of relativised justice to its extreme, questioning the very existence of a ‘justice’ that exists independently from the people it impacts. It is impossible to summarise the plot of Ryūki both briefly and accurately; this attempt prioritises the former over the latter. Ryūki features thirteen Kamen Riders in a battle royale, competing for the granting of a single wish. The Riders gain their powers through forming a contract with a mirror monster, who they must feed by defeating other Riders or less powerful mirror monsters (who are themselves feeding on helpless humans). If a Rider is defeated and can no longer feed his contract monster, the creature will consume them. Mirror monsters are so called because they come from mirror world, a parallel dimension connected to ours by reflective surfaces including mirrors and, significantly, gleaming skyscrapers. The battle is controlled by antagonist Kanzaki Shiro, who is trying to save the life of his younger sister Yui. Protagonist Kido Shinji tries to stop the Riders from fighting one another, which delays Shiro’s plans and leads to Yui’s death. Shiro repeatedly loops time to restart the battle and save Yui, but Shinji disrupts each new timeline. There are multiple alternate endings to the story, including both televisual and print versions. Because the endings each involve uncovering the reason Shiro has created the battle as part of their resolution of the story, there are also multiple explanations for why and how the battle began. In some versions the origin of the mirror monsters lies in Shiro and Yui’s childhood experience of abuse at the hands of their parents, while in another Shinji inadvertently sets events in motion after breaking a childhood promise to Yui. Which origin, ending, or time-loop is ‘true’ is never resolved. Viewers were invited to vote on the ending of the television special by telephone; alternate endings had been prepared with the winning option inserted at the end of the broadcast (Uno 271). This moral ambiguity and confusion over what is ‘true’ is an intentional critique of simplistic ideas about justice. In Ryūki each of the Riders participates in the battle because they believe that their wish is important enough to justify the means employed to obtain it. The program problematises the idea that there is an objective division between good and evil by focusing on the subjective righteousness of the individual characters’ motivations, including the irony of Shinji’s battles for the sake of stopping the war. Although these feel like quite adult themes, Shirakura couches them firmly within his interpretation of teaching children about justice, explaining that children sometimes envision themselves as the heroes and think they might also be justice. There is also the idea that people often don’t accept themselves as being wrong, because in one’s mind ‘I am myself, so I’m not wrong’ is the prevailing thought process. These thoughts lead to selfish patterns because kids might not see themselves as themselves but as the heroes. (Salas) Uno Tsunehiro (263-4) argues that there is in fact no villain and no justice in Ryūki, simply competing desires. Ryūki does not make judgements about which desires are more or less worthy, he writes, but displays all of the Riders’ motivations equally, just like Google search results of products displayed on Amazon. Just like Capitalism, Uno (263-4) suggests, Ryūki treats every story (justice / evil) equally as a desire (as a product). The mirror monsters are quite frightening; using a combination of Godzilla-style rubber suits and CGI they are all based on animals including spiders, crabs, and cobras, combined with cyborg elements such as guns embedded in various body parts. However, their behaviour is straightforwardly animalistic. They are hungry; they kill to feed. The truly monstrous characters in Ryūki are clearly the Kamen Riders themselves, who use the mirror monsters to lend power to human motivations that are far more complex and twisted. Although many of the Riders have sympathetic motivations such as saving the life of a loved one, Kamen Rider Ōja simply enjoys violence. Uno points out that this character is essentially the same as The Joker in 2008’s The Dark Knight; like The Joker, Ōja tells a variety of stories explaining the origins of his psychopathy in past traumas only to mock the credulity of those so eager to believe these explanations (Uno 274). Crucially, Ōja is still a Kamen Rider, and appears alongside more sympathetic Kamen Riders in ensemble-cast films and games. The line between hero and monster has become blurred beyond comprehension. Monsters for Children, Children as Monsters Shirakura’s comment about the danger of children uncritically viewing their own actions as being just draws attention to an important shift taking place at the turn of the millennium. Monsters were no longer something to protect children from, but increasingly children themselves were becoming viewed as potentially monstrous. Five years before Ryūki’s release Japan had been rocked by the discovery that the murderer of two elementary school children was a fourteen-year-old child dubbed ‘Youth A’, who had described his behaviour as a game, taunting the police and media before his capture (Arai 370-1). Although violent crimes perpetrated by children are always shocking, what stands out from this particular incident is the response from other school children. Youth A had sent a manifesto to a local newspaper lambasting the education system that had created him. In a survey conducted by the Ministry of Education more than fifty percent of the students surveyed sympathised and identified with at Youth A (cited in Arai 371). Lindsay Nelson (4) notes the prevalence of child-monsters in Japanese horror films in the late 1990s and early 2000s, writing that “the many monstrous children of contemporary Japanese cinema stand at a crossroads of Japan’s past, present, and future, crying out for compassion even as they drag those around them into death” (Nelson 13). There is of course a world of difference between depictions of monstrous children in adult media, and depictions of monsters in children’s media. I do not mean to conflate or confuse the two. Both kinds of monsters are, however, influenced and in turn influence wider social discourses and anxieties. Kamen Rider is also a text characterised by dual address, a narrative mode which addresses both adults and children simultaneously (in contradistinction to double address, in which the adults talk over the heads of children in an exclusionary way (Wall). Although Kamen Rider Ryūki featured adult actors (teenagers began to appear in leading roles with increasing frequency from the mid-2000s), it foreshadows the shifting of social attitudes toward children through intertextual references to the film Battle Royale (2000), also distributed by Kamen Rider’s producer Toei. Battle Royale centres on a school class who have (without their prior knowledge) been selected by lottery to participate in a ‘survival game’ on an isolated island. They must kill one another until only one survives; they have all been fitted with explosive collars, and any child refusing to participate will have their collar remotely detonated, killing them. Director Fukasaku Kinji comments that he felt a connection to the thematic linking of violence and children in Battle Royale because of his own experiences as a member of the yakeato generation. He had worked in a munitions factory during the war that was frequently targeted by bombs, and he describes hiding under and later having to dispose of the bodies of his friends (Rose). The story is a biting commentary of the relationship between economic collapse, school-based violence, and failures of governance. In Andrea Arai’s (368) analysis, “the tropes of battle, survival, and the figure of the schoolchild, reflect and refract social anxieties about the Japanese future in an era of globalisation and neoliberal reform, and the enduring historical conundrums of Japan’s twentieth-century past”. The battle between Kamen Riders in Ryūki is also a battle royale; although the core audience of very young children would probably not have made the intertextual link to the film (or the 1999 novel the film was based on), the association would have been strengthened for older viewers by the use of "those who don't fight won't survive!" as a catchphrase for Kamen Rider Ryūki. Conclusion In the early 1970s, Kamen Rider stood out as a text rejecting externally imposed, objective ideas of justice enforced by unassailable virtue, in favour of a grotesque hero struggling to find a path to justice through a metaphorical forest of misadventure and victimisation. The first Kamen Rider was a grotesque, damaged hero who fought monsters to whom he was more alike than different. In the early 2000s this blurring of the heroic and monstrous was taken even further, questioning the very concepts of justice and monstrosity. Much as the original season of Kamen Rider responded to economic and social upheavals with its reassessment of the role and figure of the hero, Kamen Rider Ryūki draws attention to fears of and for its child audience in response to both domestic economic disaster and global events. In Kamen Rider Ryūki the trope of an unwitting victim being turned into a Kamen Rider through biomechanical enhancements is discarded entirely; anyone can become a Kamen Rider simply by entering into a contract with a mirror monster. No longer grotesque because of powers beyond their control, the new generation of Kamen Riders choose grotesquery and risk their lives to obtain their desire. Anyone can become a hero, Ryūki tells its viewers, and anyone can become a monster. And, perhaps, anyone can be both at the same time. References Abel, Jonathan E. "Masked Justice: Allegories of the Superhero in Cold War Japan." Japan Forum 26.2 (2014): 187–208. Allison, Anne. Millennial Monsters: Japanese Toys and the Global Imagination. Berkeley: U of California P, 2006. Alt, Matthew. Pure Invention: How Japan Conquered the World in Eight Fantasies. Brown Book Group, 2020. Arai, Andrea. "Killing Kids: Recession and Survival in Twenty-First-Century Japan." Postcolonial Studies 6.3 (2003): 367–79. Battle Royale. Dir. Kinji Fukasaku. Toei, 2000. Katsuno, Hirofumi. "The Grotesque Hero: Depictions of Justice in Tokusatsu Superhero Television Programs." Introducing Japanese Popular Culture. Eds. Alisa Freedman and Toby Slade. Routledge, 2018. 37–47. Kim, Se Young. "Kamen Rider vs. Spider-Man and Batman." Giant Creatures in Our World: Essays on Kaiju and American Popular Culture. Eds. Camille Mustachio and Jason Barr. McFarland, 2017. Nelson, Lindsay. "Ghosts of the Past, Ghosts of the Future: Monsters, Children, and Contemporary Japanese Horror Cinema." Cinemascope 13 (2009). Oda, Katsumi, and Kenichi Muraeda. The Men Who Made Kamen Rider: 1971-2011. Kodansha, 2011. Peters, Timothy. "'Holy Trans-Jurisdictional Representations of Justice, Batman!' Globalisation, Persona and Mask in Kuwata's Batmanga and Morrison's Batman, Incorporated." Law and Justice in Japanese Popular Culture: From Crime Fighting Robots to Duelling Pocket Monsters. Eds. Ashley Pearson, Thomas Giddens, and Kieran Tranter. Taylor &amp; Francis, 2018. Kamen Rider. Toei, 1971. Kamen Rider Black RX. Toei, 1988. Kamen Rider Ryūki. Toei, 2002. Rose, Steve. “The Kid Killers.” The Guardian 2001. Rosenbaum, Roman. “The ‘Generation of the Burnt-out Ruins’.” Japanese Studies 27.3 (2007): 281–293. ———. “Redacting Japanese History: Ishinomori Shōtarō’s Graphic Narratives.” Rewriting History in Manga: Stories for the Nation. Eds. Nissim Otmazgin and Rebecca Suter. Palgrave Macmillan US, 2016. Salas, Jorge. "Kamen Rider’s Reaction to 9/11." Tokusatsu Network 2018. 1 Oct. 2021 &lt;https://tokusatsunetwork.com/2018/08/kamen-riders-reaction-to-9-11/&gt;. Shion, Miura. Momoiro Towairaito. Paperback Bunko: Shinchosha, 2010. Staite, Sophia. "Playing the Bloody Rose: Deconstructing Childhood with Kamen Rider Kiva." Aeternum: The Journal of Contemporary Gothic Studies 6.1 (2019): 34–48 Steinberg, Marc. Anime's Media Mix: Franchising Toys and Characters in Japan. U of Minnesota P, 2012. The Dark Knight. Dir. Christopher Nolan. Warner Bros, 2008. Uno, Tsunehiro. The Era of Little People. Gentosha, 2015. Wall, Barbara. The Narrator's Voice: The Dilemma of Children's Fiction. Macmillan, 1991.

The whole problem of speaking about the end…is that you have to speak of what lies beyond the end and also, at the same time, of the impossibility of ending. Jean Baudrillard, The Illusion of the End(110) Jean Baudrillard’s insights into finality demonstrate that “ends” always prompt cultures to speculate on what can or will happen after these terminations and to fear those traumatic ends, in which the impossible actually occurs, may only be the beginning of chaos. In the absence of “rational” explanations for catastrophic ends and in the whirlwind of emotional responses that are their after-effects, the search for beginnings and origins – the antitheses of Baudrillard’s finality – characterises human response to tragedy. Strangely, Baudrillard’s engagement with the end is linked to an articulation predicated on our ability “to speak” events into existence, to conjure and to bridle those events in terms of recognisable, linear, and logical arrangements of words. Calling this verbal ordering “the poetry of initial conditions” (Baudrillard 113) in which memory imposes a structure so that the chaotic/catastrophic may be studied and its elements may be compared, Baudrillard suggests that this poetry “fascinates” because “we no longer possess a vision of final conditions” (113). The images of contemporary catastrophes and their subsequent visualisation serve as the ultimate reminders that we, as viewers and survivors, were not there – that visualisation itself involves a necessary distance between the horrified viewer and the viewed horror. In the case of the September 11, 2001, attacks on the World Trade Centre, the need to “be there,” to experience vicariously a trauma as similarly as possible to those who later became its victims, perhaps explains why images of the planes first slamming into each of the towers were played and repeated ad nauseam. As Baudrillard suggests, “it would be interesting to know whether…effects persist in the absence of causes … whether something can exist apart from any origin and reference” (111). The ongoing search for these causes – particularly in the case of the World Trade Centre’s obliteration – has manifested itself in a persistent cycle of image production and consumption, prompting those images to serve as the visible/visual join between our own survival and the lost lives of the attacks or as surrogates for those whose death we could not witness. These images frequently allowed the West to legitimise its mourning, served as the road map by which we could (re-)explore the halcyon days prior to September 11, and provided the evidence needed for collective retribution. Ultimately, images served as the fictive embodiments of unseen victims and provided the vehicle by which mourning could be transformed from an isolated act to a shared experience. Visitors on the Rooftop: Visualising Origins and the Moments before Destruction It goes without saying that most have seen the famous photograph of the bundled-up tourist standing on the observation deck of the World Trade Centre with one of the jets ready to strike the tower shortly thereafter (see Figure 1). Though the photograph was deemed a macabre photo-manipulation, it reached thousands of e-mail inboxes almost two weeks following the horrific attacks and led many to ponder excitedly whether this image truly was the “last” image of a pre-September 11 world. Many openly debated why someone would fabricate such an image, yet analysts believe that its creation was a means to heal and to return to the unruffled days prior to September 11, when terrorism was thought to be a phenomenon relegated to the “elsewhere” of the Middle East. A Website devoted to the analysis of cultural rumours, Urban Legends, somewhat melodramatically suggested that the photograph resurrects what recovery efforts could not re-construct – a better understanding of the moments before thousands of individuals perished: The online world is fraught with clever photo manipulations that often provoke gales of laughter in those who view them, so we speculate that whoever put together this particular bit of imaging did so purely as a lark. However, presumed lighthearted motives or not, the photo provokes sensations of horror in those who view it. It apparently captures the last fraction of a second of this man’s life ... and also of the final moment of normalcy before the universe changed for all of us. In the blink of an eye, a beautiful yet ordinary fall day was transformed into flames and falling bodies, buildings collapsing inwards on themselves, and wave upon wave of terror washing over a populace wholly unprepared for a war beginning in its midst…The photo ripped away the healing distance brought by the nearly two weeks between the attacks and the appearance of this digital manipulation, leaving the sheer horror of the moment once again raw and bared to the wind. Though the picture wasn’t real, the emotions it stirred up were. It is because of these emotions the photo has sped from inbox to inbox with the speed that it has. (“The Accidental Tourist”) While the photograph does help the viewer recall the times before our fears of terrorism, war, and death were realised, this image does not episodically capture “the last fraction of a second” in a man’s life, nor does it give credibility to the “blink-of-an-eye” shifts between beautiful and battered worlds. The photographic analysis provided by Urban Legends serves as a retrospective means of condensing the space of time in which we must imagine the inevitable suffering of unseen individuals. Yet, the video of the towers, from the initial impacts to their collapse, measured approximately 102 minutes – a massive space of time in which victims surely contemplated escape, the inevitability of escape, the possibility of their death, and, ultimately, the impossibility of their survival (“Remains of a Day” 58). Post-traumatic visualising serves as the basis for constructing the extended horror as instantaneous, a projection that reflects how we hoped the situation might be for those who experienced it, rather than an accurate representation of the lengthy period of time between the beginning and end of the attacks. The photograph of the “accidental tourist” does not subscribe to the usual tenets of photography that suggest the image we see is, to quote W.J.T. Mitchell, “a purely objective transcript of reality” (Mitchell 281). Rather, this image invites a Burginian “inva[sion] by language in the very moment it is looked at: in memory, in association, [where] snatches of words and images continually intermingle and exchange one for the other” (Burgin 51). One sees the tourist in the photograph as a smiling innocent, posing at the wrong place and at the wrong time. Through that ascription, viewers may justify their anger and melancholy as this singular, visible body (about to be harmed) stands in for countless, unseen others awaiting the same fate. Its discrepancies with the actual opening hours of the WTC observation deck and the positioning of the aircraft largely ignored, the “accidental tourist” photo-manipulation was visualised by countless individuals and forwarded to a plethora of in-boxes because September 11 realities could not be shared intimately on that day, because the death of aircraft passengers, WTC workers, and rescue personnel was an inevitable outcome that could not be visualised as even remotely “actual” or explainable. Computer-based art and design have shown us that approximations to reality often result in its overall conflation. Accordingly, our desperate hope that we have seen glimpses of the moments before tragedy is ultimately dismantled by an acknowledgement of the illogical or impossible elements that go against the basic rules of visualisation. The “accidental tourist” is a phenomenon that not only epitomises Baudrillard’s search for origins in the wake of catastrophic effects, but underscores a collective need to visualise bodies as once-living rather than presently and inevitably dead. Faces in the Smoke: Visualising the Unseen Although such photo-manipulations were rampant in the days and weeks following the attack, many people constructed their own realities in the untouched images that the media streamed to them. The World Trade Centre disaster seemed to implore photography, in particular, to resurrect both the unseen, unremembered moments prior to the airliners’ slamming into the building and to perform two distinct roles as the towers burned: to reaffirm the public’s perception of the attack as an act of evil and to catalyse a sense of hope that those who perished were touched by God or ushered peacefully to their deaths. Within hours of the attacks, photographic stills captured what many thought to be the image of Satan – complete with horns, face, eyes, nose, and mouth – within the plumes of smoke billowing from one of the towers (see Figure 2 and its detail in Figure 3). The Associated Press, whose footage was most frequently used to reference this visual phenomenon, quickly dismissed the speculation; as Vin Alabiso, an executive photo editor for AP, observed: AP has a very strict policy which prohibits the alteration of the content of a photo in any way…The smoke in this photo combined with light and shadow has created an image which readers have seen in different ways. (“Angel or Devil?”) Although Alabiso’s comments defended the authenticity of the photographs, they also suggested the ways in which visual representation and perception could be affected by catastrophic circumstances. While many observers openly questioned whether the photographs had been “doctored,” others all too willingly invested these images with ethereal qualities by asking if the “face” they saw was that of Satan – a question mirroring their belief that such an act of terrorism was clear evidence of evil masterminding. If, as Mitchell has theorised, photographs function through a dialogical exchange of connotative and denotative messages, the photographs of the burning towers instead bombarded viewers with largely connotative messages – in other words, nothing that could precisely link specific bodies to the catastrophe. The visualising of Satan’s face happens not because Satan actually dwells within the plumes of smoke, but because the photograph resists Mitchell’s dialogue with the melancholic eye. The photograph refuses to “speak” for the individuals we know are suffering behind the layers of smoke, so our own eye constructs what the photograph will not reveal: the “face” of a reality we wish to be represented as deplorably and unquestionably evil. Barthes has observed that such “variation in readings is not … anarchic, [but] depends on the different types of knowledge … invested in the image…” (Barthes 46). In traumatic situations, one might amend this analysis to state that these various readings occur because of gaps in this knowledge and because visualisation transforms into an act based on knowledge that we wish we had, that we wish we could share with victims and fellow mourners. These visualisations highlight a desperate need to bridge the viewer’s experience of survival and their concomitant knowledge of others’ deaths and to link the “safe” visualisation of the catastrophic with the utter submission to catastrophe likely felt by those who died. Explaining the faces in the smoke as “natural indentations” as Alabiso did may be the technical and emotionally neutral means of cataloguing these images; however, the spotting of faces in photographic stills is a mechanism of visualisation that humanises a tragedy in which physical bodies (their death, their mutilation) cannot be seen. Other people who saw photographic stills from other angles and degrees of proximity were quick to highlight the presence of angels in the smoke, as captured by WABC from a perspective entirely different from that in Figure 2 (instead, see Figure 3). In either scenario, photography allows the visual personification of redemptive or evil influences, as well as the ability to visualise the tragedy not just as the isolated destruction of an architectural marvel, but as a crime against humanity with cosmic importance. Sharing the Fall: Desperation and the Photographing of Falling Bodies Perhaps what became even more troubling than the imagistic conjuring of human forms within the smoke was the photographing of bodies falling from the upper floors of the North Tower (see Figure 5). Though newspapers (re-)published photographs of the debris and hysteria of the attacks and television networks (re-)broadcast video sequences of the planes’ crashing into the towers and their collapse, the pictures of people jumping from the building were rarely circulated by the media. Dennis Cauchon and Martha T. Moore characterised these consequences of the terrorist attacks as “the most sensitive aspect of the Sept. 11 tragedy … [that] shocked the nation” (Cauchon and Moore). A delicate balance certainly existed between the media’s desire to associate faces with the feelings of desperation we know those who died must have experienced and a now-numb general public who ascribed to the photographs an unequivocal “too-muchness.” To read about those who jumped to escape smoke and flames reveals a horrific and frightfully swift narrative of panic: For those who jumped, the fall lasted 10 seconds. They struck the ground at just less than 150 miles per hour – not fast enough to cause unconsciousness while falling, but fast enough to ensure instant death on impact. People jumped from all four sides of the north tower. They jumped alone, in pairs and in groups. (Cauchon and Moore) The text contextualises these leaps to death in terms that are understandable to survivors who read the story and later discover these descriptions can never approximate the trauma of “being there”: Why did they jump? How fast were they travelling? Did they feel anything when their bodies hit the ground? Were they conscious during their jump? Did they die alone? These questions and their answers put into motion the very moment that the photograph of the jumping man has frozen. Words act as extensions of the physical boundaries of the photograph and underscore the horror of that image, from the description of the conditions that prompted the jump to the pondering of the death that was its consequence. If, as Jonathan Crary’s analysis of photographic viewing might intimate, visualisation prompts both an “autonomy of vision” and a “standardisation and regulation of the observer” (Crary 150), the photograph of a man plummeting to his death fashions the viewer’s eye as autonomous and alive because the image he/she views is the undeniable representation of a now-deceased Other. Yet, as seen in the often-hysterical responses to the threats of terrorism in the days following September 11, this “Other” embodies the very possibility of our own demise. Suddenly, the man we see in mid-air becomes the visualised “Every(wo)man” whose photographic representation also represents our unacknowledged vulnerabilities. Thus, trauma is shared through a poignant visual negotiation of dying: the certainty of the photographed man’s death juxtaposed with the newly realised or conjured threat of the viewer’s own death. In terms of humanness, those who witnessed these falls firsthand recall the ways in which the falling people became objectified – their fall seemingly robbing them of any visible sense of humanity. Eric Thompson, an employee on the seventy-seventh floor of the South Tower, shared an instantaneous moment with one of the victims: Thompson looked the man in the face. He saw his tie flapping in the wind. He watched the man’s body strike the pavement below. “There was no human resemblance whatsoever,” Thompson says. (Cauchon and Moore) Obviously, the in-situ experience of viewing these individuals hopelessly jumping to their deaths served as the prompt to run away, to escape, but the photograph acts as the frozen-in-time re-visitation and sharing of – a turning back toward – this scenario. The act of viewing the photographs reinstates the humanness that the panic of the moment seemingly removed; yet, the disparity between the photograph’s foreground (the jumping man) and its background (the building’s façade) remains its greatest disconcerting element. Unlike those photographic portraits that script behaviours and capture us in our most presentable states of being, this photograph reveals the unwilling subject – he who has not consented to share his state of being with the camera. Though W.J.T. Mitchell suggests that “[p]hotographs…seem necessarily incomplete in their imposition of a frame that can never include everything that was there to be…‘taken’” (Mitchell 289), the eye in times of catastrophe shifts between its desire to maintain the frame (that does not visually engage the inferno from which the man jumped or the concrete upon which he died) and its inability to do so. This photograph, as Mitchell might assert, “speaks” because visualisation allows its total frame of reference to extend beyond its physical boundaries and, as evidenced by post-September 11 phobias and our responses to horrific images, to affect the very means by which catastrophe is imagined and visualised. Technically speaking, the negotiated balance between foreground and background in the photograph is lost: the desperation of the falling man juxtaposed with a seemingly impossible background that should not have been there. Lost, too, is the viewer’s ability to “connect” visually with – literally, to share – that experience, to see oneself within the contexts of that particular visual representation. This inability to see the viewing self in the photograph is an ironic moment of experiential possibility that lingers still in the Western world’s fears surrounding terrorism: when the supposedly impossible act is finally visualised, territorialised, and rendered as possible. Dead Art: The Destructions and Resurrections of Works by Rodin In many ways, the photographing of those experiences so divorced from our own contributed to intense discussions of perspective in visualisation: the viewer’s witnessing of trauma by means of a camera and photographer that captured the image from a “safe” distance. However, the recovery of artwork that actually suffered damage as a result of the World Trade Centre collapse prompted many art historians and theorists to ponder the possibilities of art’s death and to contemplate the fate of art that is physically victimised. In an anticipatory vein, J.M. Bernstein suggests that “art ends as it becomes progressively further distanced from truth and moral goodness, as it loses its capacity to speak the truth about our most fundamental categorical engagements…” (Bernstein 5). If Bernstein’s theory is applied to those works damaged at the World Trade Centre site, the sculptures of Rodin, so famously photographed in the weeks of excavation that followed September 11, could be categorised as “dead” – distanced from the “truth” of human form that Rodin cast, even further from the moral goodness and the striving toward global peace that the Cantor Fitzgerald collection aimed to embrace. While many art critics believed that the destroyed works should not be displayed again, many (including Fritz Koenig, who designed The Sphere, which was damaged in the terrorist attacks) believe that such “dead art” deserves, even requires, resuscitation (see Figure 6). Much like the American flags that survived the infernos at the World Trade Centre and Pentagon site, these lost and re-discovered artworks have served as rallying points to accomplish both the sharing of trauma and an artistically inspired foundation for the re-development of the lower Manhattan site. In the case of Rodin’s The Thinker, which was recovered at the site and later presumed stolen, the statue’s discovery alongside aircraft parts and twisted steel girders served as a unique and rare survival story, almost as the surrogate representative body for those human bodies that were never found, never seen. Dan Barry and William K. Rashbaum recall that in the days following the sculpture’s disappearance, “investigators have been at Fresh Kills [landfill] and at ground zero in recent weeks, flashing a photograph of ‘The Thinker’ and asking, in effect: Have you seen this symbol of humanity” (Barry and Rashbaum)? Given such symbolic weight, sculpture most certainly took on superhuman proportions. Yet, in the days that followed the discovery of artwork that survived the attacks, only passing references were made to those figurative paintings and drawings by Picasso, Hockney, Lichtenstein, and Miró that were lost – perhaps because their subject matter or manner of artistic representation did not (or could not) reflect a “true” infliction of damage and pain the way a three-dimensional, human-like sculpture could. Viewers visualised not only the possibility of their own cultural undoing by seeing damaged Rodins, but also the embodiment of unseen victims’ bodies that could not be recovered. In a rousing speech about September 11 as an attack upon the humanities and the production of culture, Bruce Cole stated that “the loss of artifacts and art, no matter how priceless and precious, is dwarfed by the loss of life” (Cole). Nevertheless, the visualisation of maimed, disfigured art was the lens through which many individuals understood the immensity of that loss of life and the finality of their loved ones’ disappearances. What the destruction and damaging of artwork on September 11 created was an atmosphere in which art, traditionally conjured as the studied and inanimate subject, transformed from a determined to a determining influence, a re-working of Paul Smith’s theory in which “the ‘subject’ … is determined – the object of determinant forces; whereas ‘the individual’ is assumed to be determining” (Smith xxxiv). Damaged sculptures gave representative form to the thousands of victims we, as a visualising public, knew were inside the towers, but their survival spoke to larger artistic issues: the impossibility of art’s end and the foiling of its death. Baudrillard’s notion of the “impossibility of ending” demonstrates that the destruction of art (in the capitalistic sense that is contingent on its undamaged condition and its prescribed worth and “value”) does not equate to the destruction of meaning as such, but that the new and re-negotiated meanings deployed by injured art frighteningly implicate us – viewers who once assigned meaning becoming the subjects who long to be assigned something, anything, be it solace, closure, or retribution. Importantly, the latest plans for the re-vitalised World Trade Centre site indicate that the damaged Rodin and Koenig sculptures will semiotically mediate the significations established when the original World Trade Centre was a vital nexus of activity in lower Manhattan, the shock and pain experienced when the towers collapsed and individuals were searching for meaning in art’s destruction and survival, and the hope many have invested in the new buildings and their role in the maintenance and recovery of memory. A Concluding Thought Digital manipulation, photography, and the re-contextualisation of artistic “masterpieces” from their hermetic placement in the gallery to their brutal dumping in a landfill have served as the humanistic prompts that actively determined the ways in which culture grappled with and shared unimaginable horror. Images have transformed in purpose from static re(-)presentations of reality to active, changing conduits by which pasts can be remembered, by which the intangibility of death can be given substance, by which unshared moments can be more intimately considered. Oddly, visualisation has performed simultaneously two disparate functions: separating the living from the dead through a panoply of re-affirming visual experiences and permitting the re-visitation of those times, events, and people that the human eye could not see itself. Ultimately, what the manipulations, misinterpretations, and destructions of art show us is that the conveyance of meaning between individuals, whether dead or alive, whether seen or unseen, is the image’s most pressing and difficult charge. Works Cited “Angel or Devil? Viewers See Images in Smoke.” Click on Detroit. 17 Sep. 2001. 10 February 2003 &lt;http://www.clickondetroit.com/sh/news/stories/nat-news-96283920010917-120936.php&gt;. Barry, Dan, and William K. Rashbaum. “Rodin Work from Trade Center Survived, and Vanished.” New York Times. 20 May 2002: B1. Barthes, Roland. Image, Music, Text. New York: Hill and Wang, 1977. Baudrillard, Jean. The Illusion of the End. Cambridge: Polity Press, 1994. Bernstein, J.M. The Fate of Art: Aesthetic Alienation from Kant to Derrida and Adorno. Cambridge: Polity Press, 1992. Burgin, Victor. The End of Art Theory: Criticism and Post-Modernity. Atlantic Highlands, N.J.: Humanities Press, 1986. Cauchon, Dennis and Martha T. Moore. “Desperation Drove Sept. 11 Victims Out World Trade Center Windows.” Salt Lake Tribune Online. 4 September 2002. 19 Jan. 2003 &lt;http://www.sltrib.com/2002/sep/09042002/nation_w/768120.htm&gt;. Crary, Jonathan. Techniques of the Observer: On Vision and Modernity in the Nineteenth Century. Cambridge: MIT Press, 1990. Mitchell, W.J.T. Picture Theory. Chicago: University of Chicago P, 1994. “Remains of a Day.” Time 160.11 (9 Sep. 2002): 58. Smith, Paul. Discerning the Subject. Minneapolis: U of Minnesota P, 1988. “The Accidental Tourist.” Urban Legends. 20 Nov. 2001. 21 Feb. 2003 &lt;http://www.snopes2.com/rumors/crash.htm&gt;. Links http://www.clickondetroit.com/sh/news/stories/nat-news-96283920010917-120936.html http://www.sltrib.com/2002/sep/09042002/nation_w/768120.htm http://www.snopes2.com/rumors/crash.htm Citation reference for this article Substitute your date of access for Dn Month Year etc... MLA Style Smith, Royce W.. "The Image Is Dying" M/C: A Journal of Media and Culture&lt; http://www.media-culture.org.au/0304/09-imageisdying.php&gt;. APA Style Smith, R. W. (2003, Apr 23). The Image Is Dying. M/C: A Journal of Media and Culture, 6,&lt; http://www.media-culture.org.au/0304/09-imageisdying.php&gt;

Magic and art are products of human connection with the universe, offering answers to questions of meaning and working in interstices between fiction and reality. Magic can and does permeate all forms of media and is depicted as both entertaining and dangerous, as shaping world views, and as practised by a vast array of individuals and groups across cultures. Creative practices in cinema, radio, and installation art suggest that deceptive illusions created through magic techniques can be an effective means of creating compelling and engaging media experiences. It is not surprising, then, that in contemporary art forms involving mixed media and mixed (or augmented) reality the study of magic can offer valuable insights into how technologies mediate audience experiences and how artists can manipulate audience perceptions. Despite art often being described as ‘magical’ (Jones; Charlesworth), there is limited scholarly research applying the philosophical and socio-cultural construct of magic to contemporary art, leaving much to explore with regard to the intersections between magic and art. Scholars and artists have instead preferred to draw from more established bodies of theory in theatre and performance studies (Laurel), cinema (Marsh), and narrative (Murray). This article hones in on that intersection by applying the understudied principles and techniques of magicians to the interpretation and analysis of artworks by Canadian artists Janet Cardiff and George Bures Miller. Making ‘magic’ here is not about the supernatural but refers to the refined practice of ‘doing tricks’, developed over thousands of years across many cultures. The aim of this article therefore is to introduce the reader to two interactive artworks through the lens of magic. Through these examples, we demonstrate the direct correlations between the principles of illusion in magic and media-based illusions in art, inviting the recognition of common ground between the equally niche spheres of magicians and contemporary artists. Cardiff and Miller are a well-known contemporary artist duo whose work exemplifies trends in audio-based performance work (Collins) and site specificity (Ross). However, their work is not generally analysed through the lens of magic. Here, we focus on it as ‘mixed reality’ art, specifically ‘augmented reality’ (in contrast to augmented virtuality), a concept that was defined by Milgram and Kishino as any case in which an otherwise real environment is ‘augmented’ by means of virtual (computer graphic) objects. Since the introduction of these terms—‘mixed reality’ and ‘augmented reality’—technologies have made many leaps across innumerable modes of media. Yet their distinction remains useful to categorise artworks and describe any mixed reality approaches that work towards “the existence of a combined pair of a real and virtual space”. In augmented reality, while “the visual as the dominant mode of perception and integration of real and virtual space” (Strauss, Fleischmann et al.), sound can be used for sensory immersion, and to play tricks on the minds of audiences. These distinctions are often critical in discussions of art, especially when “illusion plays a crucial role as it makes permeable the perceptual limit between the represented objects and the material spaces we inhabit” (Avram). Mixed reality artworks often make unique combinations of audio-visual elements, and sometimes activate other senses such as tactile and olfactory. In these works, artists use illusion to connect the embodied experience of the audience members to the electronically mediated experience of their design, which brings us back to magic. Introduction to Conjuring and Deception It is worthwhile to briefly visit the key principles of magic that most clearly tie together conjuring and mixed reality artworks: framing context, consistency, continuity, conviction, justification, surprise, and disguise. These principles are routinely used in combination by magicians to deceive audiences and are commonly referred to under the umbrella term of ‘misdirection’, defined as “that which directs the audience towards the effect and away from the method” (Lamont and Wiseman 3). Conjuring consists of “creating illusions of the impossible” (Nelms), which are comprised of a method (how the trick is achieved) and an effect (what the audience perceives). The principles that form the foundation of conjuring are centred on the creation of illusions in a theatrical context, either on stage or via close-up magic. Think of the famous genius pair of stage magicians Penn &amp; Teller and their blockbuster magic competition television series Fool Us. Now research has revealed how these techniques can also be examined in a broader context than entertainment and across many scholarly disciplines. This research has occurred within the fields of cognitive science (Macknik et al.; Macknik &amp; Martinez-Conde; Macknik, Martinez-Conde, et al.), psychology (Polidoro; Tatler and Kuhn) and interaction design (de Jongh Hepworth; Marchak; Tognazzini). These investigations demonstrate the significance and value of techniques drawn from conjuring across various fields. Indeed, as Macknik states, “there are specific cases in which the magician’s intuitive knowledge is superior to that of the neuroscientist” (Macknik, Mac King, et al.). A successful magic trick requires the audience to experience the effect while unaware of the method (Lamont and Wiseman). Examining the creation of illusions in terms of method and effect is not only applicable to conjuring but also resonates with other forms of media that rely on suspension of disbelief. For example, in the context of cinema, the audience should be engaged with the content on the screen rather than the presentation apparatus. In virtual environments, the aim of the developer is also generally to ensure that the user experiences the effect (immersion in the virtual world) while suppressing awareness of the medium (method). In conjuring, many approaches to deception rely on indirect reinforcement in which a situation is implied rather than stated. When magician and theorist Dariel Fitzkee describes conjuring, he suggests that implication is effective because it “seems to the spectator to be a voluntary decision on his part, uninfluenced by the magician. It is also stronger because such conclusions, reached in this manner, do not seem to be of particular importance to the performer” (97). Both these elements significantly increase conviction, reduce suspicion and are very relevant to the technique of ‘suspending disbelief’ often applied to cinema. Through suggestion, the filmmakers ensured that viewers who themselves had previously constructed a false frame would readily interpret the film document as authentic, so long as the experience did not drastically deviate from expectations. This form of deception is evident in two works by Cardiff and Miller that rely primarily on sound in careful combination with visual and spatial elements to create ambiguous elements that can make the audience question what is real and virtual. The Paradise Institute (Cardiff and Miller) and Walks (Cardiff 1991–2006) utilise the process of binaural recording whereby two microphones are placed inside the ears of a dummy head to convey realistic spatial sound simulations via headphone playback. Next, we look at these artworks as a mode of conjuring taking up methods and desired effects of the art of magic. The Paradise Institute The Paradise Institute was originally produced for the 2001 Canadian Pavilion at the Venice Biennale. The work draws on the language and experience of cinema, creating a film-like experience using the illusory principles of magic. To experience the work, viewers approach a simple plywood pavilion, mount a set of stairs, and enter. We first experienced The Paradise Institute at PS1 Gallery, New York in 2001. The first illusion in a series is that this tiny dimly lit interior, complete with red carpet and two rows of velvet-covered seats, is an actual theatre. Once seated, we peer over the balcony onto a miniature replica of a grand old movie theatre created with techniques of hyper-perspective (accentuated depth and extreme angles as in a theatre set). Then we put on the headphones provided, and the projection begins. Beyond the perceptual illusion of the theatre space itself, the primary illusionary device is sound design that combines audio from the fragmented narrative depicted on screen with simulated sounds from the theatre audience. This technique is analogous to offscreen sound in cinema (Davies). Several stories run simultaneously. There is the ‘visual film’ and its accompanying soundtrack; layered over this is the ‘aural action’ of a supposed audience. The film is a mix of genres: part noir, part thriller, part sci-fi, and part experimental. What is more particular about the installation is the personal binaural surround sound that every individual in the audience experiences through the headphones. The sense of isolation each person might feel is disrupted by intrusions seemingly coming from inside the theatre. A mobile phone belonging to a member of the audience rings. A close ‘female friend’ whispers intimately in your ear: “Did you check the stove before we left?” Fiction and reality become intermingled as absorption in the film is suspended, and other realities flow in. Not knowing what to believe, you hear a collage of sounds from the soundtrack of the film you are watching, as well as from people sitting beside you. Was that really a cell phone? At one point the characters you have watched on the screen are talking behind you. (Christov-Bakargiev and Cardiff 151) The multi-layered acoustic space combines chattering and rustling from the virtual audience members seated around you, characters from the film that are sporadically transported to the objective position of the audience, all co-existing with the soundtrack of the film itself. This complex layering of sound, combined with the live ambience, creates a mixed reality environment in which the various virtual elements constantly intrude upon the audience’s perception of reality. The artists conjure an audience and theatre which are not in fact there, but the illusion is so seamless, that your perception combines reality and mediated experience. One of the principles of effective illusions within magic is the capacity to reduce suspicion during the presentation. The work effectively achieves this through a variety of methods. The most compelling aspects of the deception are the intimate conversations and incidental sounds created by the virtual audience members, particularly those seated behind you (as the source cannot be immediately verified). You cannot see, feel, smell, or touch other audience members, but you can hear them. The content is perceived as familiar (therefore suspicion regarding its veracity is reduced), and even within the hyper-real context of the microcinema, irresistibly compelling. The mechanics of the work effectively support the illusion. The installation provides a controlled acoustic space, and volume levels can be precisely adjusted. The layered sound design further assists in masking deficiencies in the technical process in much the same manner as the use of atmospheres and music in a film soundtrack. These characteristics assist in establishing a palpable simulation of acoustic reality. In The Paradise Institute, rather than place the audience in a passive position in relation to their work, Cardiff and Miller use spatial sound as a means of active engagement: “I want people to be inside the filmic experience… I want the pieces to be disconcerting in several ways so that the audience can’t just forget about their bodies for the duration of their involvement, like we do in film” (Beil and Mari 78). Walks Janet Cardiff and George Bures Miller designed 24 audio and video walks between 1996 and 2019. Like magicians executing conjuring tricks, the artists use the affordances of electronic media to reveal an alternate reality. The walks, like conjuring tricks, manipulate your perceptions of reality through illusion. The walks are between five minutes and one hour long. As the artists write on their Website, the audio playback is layered with various background sounds all recorded in binaural audio which gives the feeling that those recorded sounds are present in the actual environment. In a video walk, viewers are provided with a video screen which they use to follow a film recorded in the past along the same route they are traversing in the present. Also using binaural microphones and edited to create a sense of continuous motion, the fictional world of the film blends seamlessly with the reality of the architecture and body in motion. The perceptive confusion is deepened by the dream-like narrative elements that occur in the pre-recorded film. Audience members are given a listening device and headphones at the beginning of the walk, similar to the experience of using an audio guide in a museum. At a predefined location, the audience member presses play and is guided by Cardiff’s voice narrating events that occur along a route through the physical environment. Instructions are integrated within a narrative soundscape that shapes the audiences’ perceptions of their immediate environment. The importance of this hybrid reality is highlighted by Cardiff’s own description of the work: “the sound of my footsteps, traffic, birds, and miscellaneous sound effects that have been pre-recorded on the same site as they are being heard … . The virtual recorded soundscape has to mimic the real physical one in order to create a new world as a seamless combination of the two” (Cardiff and Miller). All the walks are recorded as a spatially encoded binaural soundscape, created using microphones fitted to both ears of a mannequin. The intent is that the recording perfectly replicates the sensation of listening with two human ears. Listening back through headphones, the recording feels as ‘live’ as possible. During playback, the audience experiences the illusion of being in the same room as Cardiff’s voice and other sounds in the recording. They perceive a realistic multi-layered sonic environment comprised of the actual acoustic space they inhabit (via aural transparency of the headphones), artefacts from the same environment at a prior time, and narration provided by Cardiff’s voice, all interwoven with creative sound design. Unlike The Paradise Institute, audience members can adjust the playback level, and hence, the mix between the real and virtual elements. In other words, they may be able to hear the sound of their own footsteps or breathing in combination with the designed soundscape. Due to the intimate nature of the binaural recordings (and the timbre of Cardiff’s voice), the audience has the impression that Cardiff is present, an invisible co-traveller on the journey. The walks are successful magic tricks not only because of the perceptual realism of the sonic environments they represent but also because they are narrative-driven, propelling the audience through unknown spaces and stories. The audience, on the one hand, exists in a fictional world, while on the other hand they are placed in a paradoxical position of being at times uncertain if the sound they heard was present in physical reality or was a simulation. Discussion: Reframing Fiction as Fact in an Act of Magic These works indicate how the mechanics of the illusion (in this instance, spatial sound and visual trickery) combined with plausible virtual elements can effectively reframe an experience from a fictional simulation to fact. Even if the experience is clearly framed as fiction, the appropriate use of mechanics can present stimuli that are so compellingly real that they disrupt, even if momentarily, the way the audience interprets a mediated experience, whether it is constructed as a set (in the case of The Paradise Institute) or a streetscape (in the Walks). The conjuring trick at work here, as with The Paradise Institute, is multisensory reinforcement, “the way in which a spectator’s belief about specific matters central to the effect are reinforced” (Lamont and Wiseman 69). The audience’s suspicion may be reduced if each modality works in unison to advance the illusion. For instance, the visual representation of a virtual character is reinforced by corresponding sound, and their actions are further indicated via mechanical devices in physical space. Scholars argue that the more sensory inputs in the mediated experience, the higher the degree of perceptual realism, so long as “the information from various sources is globally consistent” (Christou and Parker 53). This is because “senses do not just provide information but also serve to confirm the ‘perceptions’ of other senses” (England 168). Multisensory integration occurs innately within the individual, and, as Macknik suggests, it “is an ongoing and dynamic property of your brain that occurs outside conscious awareness” (Macknik, Martinez-Conde, et al. 104). The multimodal nature of mixed reality experiences like Cardiff and Miller’s walks provide an example of magic applied in art. Audience members’ eyes and ears are activated, convincing their brains that fiction is reality. To be clear, the artworks discussed here are technically elegant but not overly complex or dependent on technology. This is consistent with magic acts whereby sometimes a deck of cards and a small table are the only props. In conjuring, for the most part, magicians rely on “little technology more complex than a rubber band, a square of black fabric or length of thread” (Steinmeyer 7). Identifying how the adaptability of magic can also be applied to media arts is integral to understanding its power. Effects of illusion can be achieved with relatively simple methods, such as binaural recording or hyper-perspective (not to undermine the skill in such acts of magic). As with a magician’s sleight-of-hand techniques (think of a playing card being perfectly hidden up a sleeve), an accomplished media artist also needs to use techniques of illusion flawlessly. In other words, rather than being device-centric, the principles of misdirection can be applied to suit a specific purpose but must be done skilfully. This is the very reason that Cardiff and Miller’s conjuring strategies are highly adaptive and highly successful. Conclusion: When Art Is Magic, We Are All Deceived What do these examples of magic in mixed reality artworks indicate? The works discussed draw from vast lineages of creative practice, including radio, cinema, installation, and locative media. They demonstrate that applying principles of magic to the design of artworks can create convincing mediated deceptions. They also demonstrate direct correlations between the principles of illusion in magic and media-based illusions in art. Even when an event is framed as fiction, the mechanics of the illusion could make the audience believe in an alternate reality, the very foundation of magic. Just as in conjuring, Cardiff and Miller’s tricks transform an experience into an illusion via elements of showmanship such as drama and atmosphere. In art, however, unlike a conventional magic trick, there is no climactic flurry in which the alternate reality is revealed, such as pulling a rabbit out of a seemingly empty hat. Instead, if the works succeed, the illusion is sustained and virtual characters and spaces are no longer perceived as a simulation, thus bridging reality and virtuality. Janet Cardiff is walking with you, or you are sitting in a cinema. References Avram, Horea. “The Convergence Effect: Real and Virtual Encounters in Augmented Reality Art.” M/C Journal 16.6 (2013). &lt;https://doi.org/10.5204/mcj.735&gt;. Beil, Ralf, and Bartomeu Marí. The Killing Machine and Other Stories 1995-2007: Janet Cardiff &amp; George Bures Miller. Hatje Cantz, Darmstadt, 2007. Cardiff, Janet, and George Bures Miller. 2023. &lt;https://cardiffmiller.com/&gt;. ———. “The Affective Experience of Space.” The Oxford Handbook of Sound and Image in Western Art. 2016. 214. Cardiff, Janet, George Bures Miller, and Carolyn Christov-Bakargiev. Janet Cardiff: A Survey of Works Including Collaborations with George Bures Miller. New York: PS1, 2001. Charlesworth, J.J. “The Return of Magic in Art.” Art Review 30 May 2022. &lt;https://artreview.com/the-return-of-magic-in-art&gt;. Collins, Rebecca Louise. “Sound, Space and Bodies: Building Relations in the Work of Invisible Flock and Atelier Bildraum.” M/C Journal 20.2 (2017). &lt;https://doi.org/10.5204/mcj.1222&gt;. Davies, Alexander. Magic, Mixed Realities &amp; Misdirection. PhD Dissertation. Sydney: UNSW, 2013. Davies, Alex, and Jeffrey Koh. “Häusliches Glück: A Case Study on Deception in a Mixed Reality Environment.” Handbook of Digital Games and Entertainment Technologies. Eds. Ryohei Nakatsu, Matthias Rauterberg, and Paolo Ciancarini. Singapore: Springer Singapore, 2017. &lt;https://doi.org/10.1007/978-981-4560-52-8_18-1&gt;. De Jongh Hepworth, Sam. “Magical Experiences in Interaction Design.” Proceedings of the 2007 Conference on Designing Pleasurable Products and Interfaces. 2007. Fitzkee, Dariel. Magic by Misdirection. London: Ravenio, 1975. Hyman, Ray. “The Psychology of Deception.” Annual Review of Psychology 40.1 (1989): 133-154. Ishii, Hiroshi, and Brygg Ullmer. “Tangible Bits: Towards Seamless Interfaces between People, Bits and Atoms.” Proceedings of the ACM SIGCHI Conference on Human Factors in Computing Systems. 1997. Jacobson, Marjory. “Janet Cardiff and George Bures Miller.” Sensorium: Embodied Experience, Technology, and Contemporary Art (2006): 56-61. Jones, Jonathon. “The Top 10 Magical Artworks” The Guardian 5 June 2014. &lt;https://www.theguardian.com/artanddesign/2014/jun/05/top-10-magical-artworks&gt;. Lamont, Peter, and Richard Wiseman. Magic in Theory: An Introduction to the Theoretical and Psychological Elements of Conjuring. U of Hertfordshire P, 2005. Laurel, Brenda. Computers as Theatre. Addison-Wesley, 2013. Macknik, Stephen L., et al. “Attention and Awareness in Stage Magic: Turning Tricks into Research.” Nature Reviews Neuroscience 9.11 (2008): 871-879. Macknik, Stephen L., and Susana Martinez-Conde. “A Perspective on 3-D Visual Illusions.” Scientific American Mind 19.5 (2008): 20-23. ———. “Real Magic: Future Studies of Magic Should Be Grounded in Neuroscience.” Nature Reviews Neuroscience 10.3 (2009): 241-241. Macknik, Stephen, Susana Martinez-Conde, and Sandra Blakeslee. Sleights of Mind: What the Neuroscience of Magic Reveals about Our Everyday Deceptions. New York: Henry Holt, 2010. Marchak, Frank M. “The Magic of Visual Interaction Design.” ACM SIGCHI Bulletin 32.2 (2000): 13-14. Marsh, Tim. “Presence as Experience: Film Informing Ways of Staying There.” Presence: Teleoperators &amp; Virtual Environments 12.5 (2003): 11. ———. “Presence as Experience: Framework to Assess Virtual Corpsing.” Presence 2001: 4th International Workshop on Presence. Philadelphia, 2001. ———. “Staying There: An Activity-Based Approach to Narrative Design and Evaluation as an Antidote to Virtual Corpsing.” Being There: Concepts, Effects and Measurements of User Presence in Synthetic Environments. Amsterdam: Ios, 2003. 85-96. Milgram, Paul, and Fumio Kishino. “A Taxonomy of Mixed Reality Visual Displays.” IEICE TRANSACTIONS on Information and Systems 77.12 (1994): 1321-1329. Murray, Janet H. Hamlet on the Holodeck: The Future of Narrative in Cyberspace. Updated ed. Boston: MIT P, 2017. Polidoro, Massimo. “The Magic in the Brain: How Conjuring Works to Deceive Our Minds.” Tall Tales about the Mind &amp; Brain: Separating Fact from Fiction. Ed. Sergio Della Sala. Oxford: Oxford UP, 2007. 36-44. Ross, Christine. “Movement That Matters Historically: Janet Cardiff and George Bures Miller’s 2012 Alter Bahnhof Video Walk.” Discourse 35.2 (2013): 212-227. Strauss, Wolfgang, et al. Linking between Real and Virtual Spaces. GMD Report 75, GMD – Forschungszentrum Informationstechnik GmbH, Sienna. CID, 1999. Tatler, Benjamin W., and Gustav Kuhn. “Don’t Look Now: The Magic of Misdirection.” Eye Movements. Amsterdam: Elsevier, 2007. 697-714. Tognazzini, Bruce. “Principles, Techniques, and Ethics of Stage Magic and Their Application to Human Interface Design.” Proceedings of the INTERACT'93 and CHI'93 Conference on Human Factors in Computing Systems. 1993. 355-62.

Photo by 187929822 © Victor Moussa | Dreamstime.com INTRODUCTION The nonconsensual taking of a human organ to use in transplantation medicine violates ethical principles, including autonomy, informed consent, and human rights, as well as criminal laws. When such an organ harvesting is not just nonconsensual, but performed in a way that causes a death or uses the pretense of brain death without meeting the criteria, it also violates the dead donor[1] rule.[2] The dead donor rule is both ethical and legal. It prevents organ retrieval that would predictably cause the death of the organ donor.[3] Retrieval of a vital organ is permissible only after a declaration of death.[4] Forced organ harvesting may breach the dead donor rule as it stands. A reimagined, broader dead donor rule could consider a larger timeframe in the forced organ harvesting context. In doing so, the broad dead donor rule could cover intent, premeditation, aiding and abetting, and due diligence failures. A broad definition of forced organ harvesting is ‘‘the removal of one or more organs from a person by means of coercion, abduction, deception, fraud, or abuse of power. . .’’[5] A more targeted definition is “[t]he killing of a person so that their organs may be removed without their free, voluntary and informed consent and transplanted into another person.”[6] In the global organ harvesting context, forced organ harvesting violates the World Health Organization (WHO) Guiding Principle 3, which says “live organ donors should be acting willingly, free of any undue influence or coercion.”[7] Furthermore, WHO states live donors should be “genetically, legally, or emotionally” attached to the recipient. Guiding Principle 1 applies to deceased donors, covers consent, and permits donation absent any known objections by the deceased.[8] Principle 7 says, “Physicians and other health professionals should not engage in transplantation procedures, and health insurers and other payers should not cover such procedures if the cells, tissues or organs concerned have been obtained through exploitation or coercion of, or payment to, the donor or the next of kin of a deceased donor.”[9] There are underground markets in which organ hunters prey on the local poor in countries with low wages and widespread poverty[10] and human trafficking that targets migrants for the purpose of organ harvesting.[11] This paper explores forced harvesting under the backdrop of the dead donor rule, arguing that a human rights violation so egregious requires holding even distant participants in the chain of events accountable. By interfering with resources necessary to carry out bad acts, legislation and corporate and institutional policies can act as powerful deterrents. A broader dead donor rule would highlight the premeditation and intent evidenced well before the act of organ retrieval. I. Background and Evidence In China, there is evidence that people incarcerated for religious beliefs and practices (Falun Gong) and ethnic minorities (Uyghurs) have been subjects of forced organ harvesting. A tribunal (the China Tribunal) found beyond a reasonable doubt that China engaged in forced organ harvesting.[12] Additionally, eight UN Special Rapporteurs found a system of subjecting political prisoners and prisoners of conscience to blood tests and radiological examinations to determine the fitness of their organs.[13] As early as 2006, investigators found evidence of forced organ harvesting from Falun Gong practitioners. [14] Over a million Uyghurs are in custody there, and there is ample evidence of biometric data collection.[15] An Uyghur tribunal found evidence of genocide.[16] “China is the only country in the world to have an industrial-scale organ trafficking practice that harvests organs from executed prisoners of conscience.”[17] Witnesses testified to the removal of organs from live people without ample anesthesia,[18] summonses to the execution grounds for organ removal,[19] methods of causing death for the purpose of organ procurement,[20] removing eyes from prisoners who were alive,[21] and forcing live prisoners into operating rooms.[22] The current extent of executions to harvest organs from prisoners of conscience in China is unknown. The Chinese press has suggested surgeons in China will perform 50,000 organ transplants this year.[23] Doctors Against Forced Organ Harvesting (DAFOR) concluded, “[f]orced organ harvesting from living people has occurred and continues to occur unabated in China.”[24] China continues to advertise in multiple languages to attract transplant tourists.[25] Wait times for organs seem to remain in the weeks.[26] In the United States, it is common to wait three to five years.[27] II. The Nascent System of Voluntary Organ Donation in China In China, throughout the 1990s and early 2000s, the supply of organs for transplant was low, and there was not a national system to register as a donor. A 1984 act permitted death row prisoners to donate organs.[28] In 2005, a Vice Minister acknowledged that 95 percent of all organ transplants used organs from death row prisoners.[29] In 2007 the planning of a voluntary system to harvest organs after cardiac death emerged. According to a Chinese publication, China adopted brain death criteria in 2013.[30] There had been public opposition due partly to cultural unfamiliarity with it.[31] Cultural values about death made it more difficult to adopt a universal brain death definition. Both Buddhist and Confucian beliefs contradicted brain death.[32] Circulatory death was traditionally culturally accepted.[33] The Ministry of Health announced that by 2015 organ harvesting would be purely voluntary and that prisoners would not be the source of organs.[34] There are cultural barriers to voluntary donation partly due to a Confucian belief that bodies return to ancestors intact and other cultural and religious beliefs about respect for the dead.[35] An emphasis on family and community over the individual posed another barrier to the Western approach to organ donation. Public awareness and insufficient healthcare professional knowledge about the process of organ donation are also barriers to voluntary donation.[36] Although the Chinese government claims its current system is voluntary and no longer exploits prisoners,[37] vast evidence contradicts the credibility of the voluntary transplant program in China.[38] III. Dead Donor Rule: A Source of Bioethical Debate It seems tedious to apply this ethical foundation to something as glaring as forced organ harvesting. But the dead donor rule is a widely held recognition that it is not right to kill one person to save another.[39] It acts as a prohibition on killing for the sake of organ retrieval and imposes a technical requirement which influences laws on how death is declared. The dead donor rule prevents organ harvesting that causes death by prohibiting harvesting any organ which the donor agreed to donate only after death prior to an official declaration of death. There is an ongoing ethical debate about the dead donor rule. Many in bioethics and transplant medicine would justify removing organs in specific situations prior to a declaration of death, abandoning the rule.[40] Some use utilitarian arguments to justify causing the death of someone who is unconscious and on life support irreversibly. Journal articles suggest that the discussion has moved to one of timing and organ retrieval.[41] Robert Truog and Franklin Miller are critics of the dead donor rule, arguing that, in practice, it is not strictly obeyed: removing organs while a brain-dead donor is still on mechanical ventilation and has a beating heart and removing organs right after life support is removed and cardio-pulmonary death is declared both might not truly meet the requirement of the dead donor rule, making following the rule “a dubious norm.”[42] Miller and Truog question the concept of brain death, citing evidence of whole body integrated functions that continue indefinitely. They challenge cardio-pulmonary death, asserting that the definition includes as dead, those who could be resuscitated. Their hearts could resume beating with medical intervention. Stopping life support causes death only in those whose lives are sustained by it. Some stipulate that the organ retrieval must not itself cause the death. Some would rejigger the cause of death: Daniel Callahan suggests that the underlying condition causes the death despite removal of life support.[43] But logically, a person could continue life support and be alive, so clearly, removing life support does cause death. Something else would have caused brain death or the circumstance that landed the person on mechanical ventilation. To be more accurate, one could say X caused the irreversible coma and removing life support caused the death itself. Miller and Truog take the position that because withdrawal of life support does cause death, the dead donor rule should be defunct as insincere. To them, retrieving vital organs from a technically alive donor should be permissible under limited conditions. They look to the autonomous choices of the donor or the surrogate (an autonomy-based argument). They appreciate the demand for organs and the ability to save lives, drawing attention to those in need of organs. Live donor organ retrieval arguably presents a slippery slope, especially if a potential donor is close to death, but not so close to label it imminent. They say physicians would not be obligated to follow the orders of a healthy person wishing to have vital organs removed, perhaps to save a close friend or relative. Similarly, Radcliffe-Richards, et al. argue that there is no reason to worry about the slippery slope of people choosing death so they can sell their vital organs, whether for money for their decedents or their creditors.[44] The movement toward permissibility and increased acceptance of medical aid in dying also influence the organ donation arena. The slippery slope toward the end of life has potential to become a realistic concern. Older adults or other people close to death may want to donate a vital organ, like their heart, to a young relative in need. That could greatly influence the timing of a decision to end one’s life. IV. Relating the Dead Donor Rule to Forced Organ Harvesting There is well documented evidence that in China organs have been removed before a declaration of death.[45] But one thing the dead donor rule does not explicitly cover is intent and the period prior to the events leading to death. It tends to apply to a near-death situation and is primarily studied in its relationship to organ donation. It is about death more than it is about life. Robertson and Lavee investigated data on transplantation of vital organs in China and they document cases where the declaration of death was a pretense, insincere, and incorrect. Their aim was to investigate whether the prisoners were in fact dead prior to organ harvesting.[46] (The China Tribunal found that organs have been removed from live prisoners and that organ harvesting has been the cause of death.) They are further concerned with the possible role of doctors as executioners, or at least as complicit in the execution as the organ harvesting so closely follows it. V. A Broader Dead Donor Rule A presumed ethical precursor to the dead donor rule may also be an important ethical extension of the rule: the dead donor rule must also prohibit killing a person who is not otherwise near death for the purpose of post-death organ harvesting. In China, extra-judicial killings of prisoners of conscience are premeditated ― there is ample evidence of blood tests and radiology to ensure organ compatibility and health.[47] To have effective ethical force, the dead donor rule should have an obvious application in preventing intentional killing for an organ retrieval, not just killing by way of organ retrieval. When we picture the dead donor rule, bioethicists tend to envision a person on life support who will either be taken off it and stop breathing or who will be declared brain dead. But the dead donor rule should apply to healthy people subject to persecution at the point when the perpetrator lays the ground for the later killing. At that point, many organizations and people may be complicit or unknowingly contributing to forced organ harvesting. In this iteration of the dead donor rule, complicity in its violations would be widespread. The dead donor rule could address the initial action of ordering a blood or radiology test or collecting any biometric data. Trained physicians and healthcare technicians perform such tests. Under my proposed stretch of the dead donor rule, they too would be complicit in the very early steps that eventually lead to killing a person for their organs. I argue these steps are part of forced organ harvesting and violate the dead donor rule. The donor is very much alive in the months and years preceding the killing. A conspiracy of indifference toward life, religious persecution, ethnic discrimination, a desire to expand organ transplant tourism, and intent to kill can violate this broader dead donor rule. The dead donor rule does not usually apply to the timing of the thought of organ removal, nor the beginning of the chain of events that leads to it. It is usually saved for the very detailed determination of what may count as death so that physicians may remove vital and other organs, with the consent of the donor.[48] But I argue that declaring death at the time of retrieval may not be enough. Contributing to the death, even by actions months or years in advance, matter too. Perhaps being on the deathbed awaiting a certain death must be distinguished from going about one’s business only to wind up a victim of forced organ harvesting. Both may well be declared dead before organ retrieval, but the likeness stops there. The person targeted for future organ retrieval to satisfy a growing transplant tourism business or local demand is unlike the altruistic person on his deathbed. While it may seem like the dead donor rule is merely a bioethics rule, it does inform the law. And it has ethical heft. It may be worth expanding it to the arena of human trafficking for the sake of organ removal and forced organ harvesting.[49] The dead donor rule is really meant to ensure that death was properly declared to protect life, something that must be protected from an earlier point. VI. Complicity: Meaning and Application Human rights due diligence refers to actions that people or institutions must take to ensure they are not contributing to a human rights violation. To advise on how to mitigate risk of involvement or contribution to human rights violations, Global Rights Compliance published an advisory that describes human rights due diligence as “[t]he proactive conduct of a medical institution and transplant-associated entity to identify and manage human rights risks and adverse human rights impacts along their entire value and supply chain.”[50] Many people and organizations enable forced organ harvesting. They may be unwittingly complicit or knowingly aiding and abetting criminal activity. For example, some suppliers of medical equipment and immunosuppressants may inadvertently contribute to human rights abuses in transplantation in China, or in other countries where organs were harvested without consent, under duress, or during human trafficking. According to Global Rights Compliance, “China in the first half of 2021 alone imported ‘a total value of about 24 billion U.S. dollars’ worth of medical technology equipment’, with the United States and Germany among the top import sources.”[51] The companies supplying the equipment may be able to slow or stop the harm by failing to supply necessary equipment and drugs. Internal due diligence policies would help companies analyze their suppliers and purchasers. Corporations, educational institutions, and other entities in the transplantation supply chain, medical education, insurance, or publishing must engage in human rights due diligence. The Global Rights Compliance advisory suggests that journals should not include any ill-gotten research. Laws should regulate corporations and target the supply chain also. All actors in the chain of supply, etc. are leading to the death of the nonconsenting victim. They are doing so while the victim is alive. The Stop Forced Organ Harvesting Act of 2023, pending in the United States, would hold any person or entity that “funds, sponsors, or otherwise facilitates forced organ harvesting or trafficking in persons for purposes of the removal of organs” responsible. The pending legislation states that: It shall be the policy of the United States—(1) to combat international trafficking in persons for purposes of the removal of organs;(2) to promote the establishment of voluntary organ donation systems with effective enforcement mechanisms in bilateral diplomatic meetings and in international health forums;(3) to promote the dignity and security of human life in accordance with the Universal Declaration of Human Rights, adopted on December 10, 1948; and(4) to hold accountable persons implicated, including members of the Chinese Communist Party, in forced organ harvesting and trafficking in persons for purposes of the removal of organs.[52] The Act calls on the President to provide Congress a list of such people or entities and to sanction them by property blocking, and, in the case of non-US citizens, passport and visa denial or revocation. The Act includes a reporting requirement under the Foreign Assistance Act of 1961 that includes an assessment of entities engaged in or supporting forced organ harvesting.[53] The law may have a meaningful impact on forced organ harvesting. Other countries have taken or are in the process of legal approaches as well.[54] Countries should consider legislation to prevent transplant tourism, criminalize complicity, and require human rights due diligence. An expanded dead donor rule supports legal and policy remedies to prevent enabling people to carry out forced organ harvesting. VII. Do Bioethicists Mention Human Rights Abuses and Forced Organ Harvesting Enough? As a field, bioethics literature often focuses on the need for more organs, the pain and suffering of those on organ transplant waitlists, and fairness in allocating organs or deciding who belongs on which waitlist and why. However, some bioethicists have drawn attention to forced organ harvesting in China. Notably, several articles noted the ethical breaches and called on academic journals to turn away articles on transplantation from China as they are based on the unethical practice of executing prisoners of conscience for their organs.[55] The call for such a boycott was originally published in a Lancet article in 2011.[56] There is some acknowledgement that China cares about how other countries perceive it,[57] which could lead to either improvements in human rights or cover-ups of violations. Ill-gotten research has long been in the bioethics purview with significant commentary on abuses in Tuskegee and the Holocaust.[58] Human research subjects are protected by the Declaration of Helsinki, which requires acting in the best interests of research subjects and informed consent among other protections.[59] The Declaration of Helsinki is directed at physicians and requires subjects enroll in medical research voluntarily. The Declaration does not explicitly cover other healthcare professionals, but its requirements are well accepted broadly in health care. CONCLUSION The dead donor rule in its current form really does not cover the life of a non-injured healthy person at an earlier point. If it could be reimagined, we could highlight the link between persecution for being a member of a group like Falun Gong practitioners or Uyghurs as the start of the process that leads to a nonconsensual organ retrieval whether after a proper declaration of death or not. It is obviously not ethically enough to ensure an execution is complete before the organs are harvested. It is abuse of the dead donor rule to have such a circumstance meet its ethical requirement. And obviously killing people for their beliefs or ethnicity (and extra-judicial killings generally) is not an ethically acceptable action for many reasons. The deaths are intentionally orchestrated, but people and companies who may have no knowledge of their role or the role of physicians they train or equipment they sell are enablers. An expanded dead donor rule helps highlight a longer timeframe and expanded scope of complicity. The organ perfusion equipment or pharmaceuticals manufactured in the United States today must not end up enabling forced organ harvesting. With an expanded ethical rule, the “donor is not dead” may become “the donor would not be dead if not for. . .” the host of illegal acts, arrests without cause, forced detention in labor camps, extra-judicial killings, lacking human rights due diligence, and inattention to this important topic. The expanded dead donor rule may also appeal to the bioethics community and justify more attention to laws and policies like the Stop Forced Organ Harvesting Act of 2023. - [1] The word “donor” in this paper describes any person from whom organs are retrieved regardless of compensation, force, or exploitation in keeping with the bioethics literature and the phrase “dead donor rule.” [2] Robertson, M.P., Lavee J. (2022). Execution by organ procurement: Breaching the dead donor rule in China. Am J Transplant, Vol.22,1804– 1812. doi:10.1111/ajt.16969. [3] Robertson, J. A. (1999). Delimiting the donor: the dead donor rule. Hastings Center Report, 29(6), 6-14. [4] Retrieval of non-vital organs which the donor consents to donate post-death (whether opt-in, opt-out, presumed, or explicit according to local law) also trigger the dead donor rule. [5] The Stop Forced Organ Harvesting Act of 2023, H.R. 1154, 118th Congress (2023), https://www.congress.gov/bill/118th-congress/house-bill/1154. [6] Do No Harm: Mitigating Human Rights Risks when Interacting with International Medical Institutions &amp; Professionals in Transplantation Medicine, Global Rights Compliance, Legal Advisory Report, April 2022, https://globalrightscompliance.com/project/do-no-harm-policy-guidance-and-legal-advisory-report/. [7] WHO Guiding Principles on Human Cell, Tissue and Organ Transplantation, as endorsed by the sixty-third World Health Assembly in May 2010, in Resolution WHA63.22 https://apps.who.int/iris/bitstream/handle/10665/341814/WHO-HTP-EHT-CPR-2010.01-eng.pdf?sequence=1. [8] WHO Guiding Principles on Human Cell, Tissue and Organ Transplantation (2010). [9] WHO Guiding Principles on Human Cell, Tissue and Organ Transplantation (2010). [10] Promchertchoo, Pichayada (Oct. 19, 2019). Kidney for sale: Inside Philippines’ illegal organ trade. https://www.channelnewsasia.com/asia/kidney-for-sale-philippines-illegal-organ-trade-857551; Widodo, W. and Wiwik Utami (2021), The Causes of Indonesian People Selling Covered Kidneys from a Criminology and Economic Perspective: Analysis Based on Rational Choice Theory. European Journal of Political Science Studies, Vol 5, Issue 1. [11] Van Reisen, M., &amp; Mawere, M. (Eds.). (2017). Human trafficking and trauma in the digital era: The ongoing tragedy of the trade in refugees from Eritrea. African Books Collective. [12] The Independent Tribunal into Forced Organ Harvesting from Prisoners of Conscience in China (China Tribunal) (2020). https://chinatribunal.com/wp-content/uploads/2020/03/ChinaTribunal_JUDGMENT_1stMarch_2020.pdf [13] UN Office of the High Commissioner, Press Release, China: UN human Rights experts alarmed by ‘organ harvesting’ allegations (UN OTHCHR, 14 June 2021), https://www.ohchr.org/en/press-releases/2021/06/china-un-human-rights-experts-alarmed-organ-harvesting-allegations. [14] David Matas and David Kilgour, Bloody Harvest. The killing of Falun Gong for their organs (Seraphim Editions 2009). [15] How China is crushing the Uyghurs, The Economist, video documentary, July 9, 2019, https://youtu.be/GRBcP5BrffI. [16] Uyghur Tribunal, Judgment (9 December 2021) (Uyghur Tribunal Judgment) para 1, https://uyghurtribunal.com/wp-content/uploads/2022/01/Uyghur-Tribunal-Judgment-9th-Dec-21.pdf. [17] Ali Iqbal and Aliya Khan, Killing prisoners for transplants: Forced organ harvesting in China, The Conversation Published: July 28, 2022. https://theconversation.com/killing-prisoners-for-transplants-forced-organ-harvesting-in-china-161999 [18] Testimony demonstrated surgeries to remove vital organs from live people, killing them, sometimes without ample anesthesia to prevent wakefulness and pain. China Tribunal (2020), p. 416-417. https://chinatribunal.com/wp-content/uploads/2020/03/ChinaTribunal_JUDGMENT_1stMarch_2020.pdf; Robertson MP, Lavee J. (2022), Execution by organ procurement: Breaching the dead donor rule in China. Am J Transplant, Vol.22,1804– 1812. doi:10.1111/ajt.16969. [19] Doctors reported being summoned to execution grounds and told to harvest organs amid uncertainty that the prisoner was in fact dead. China Tribunal (2020), p. 52-53. [20]In testimony to the China Tribunal, Dr. Huige Li noted four methods of organ harvesting from live prisoners: incomplete execution by shooting, after lethal injection prior to death, execution by removal of the heart, and after a determination of brain death prior to an intubation (pretense of brain death). China Tribunal (2020), pp. 54-55. https://chinatribunal.com/wp-content/uploads/2020/03/ChinaTribunal_JUDGMENT_1stMarch_2020.pdf [21] A former military medical student described removing organs from a live prisoner in the late 1990s. He further described his inability to remove the eyes of a live man and his witnessing another doctor forcefully remove the man’s eyes. China Tribunal (2020), p. 330. [22] In 2006, a nurse testified that her ex-husband, a surgeon, removed the eyes of 2,000 Falun Gong practitioners in one hospital between 2001 and 2003. She described the Falun Gong labor-camp prisoners as being forced into operating rooms where they were given a shot to stop their hearts. Other doctors removed other organs. DAFOH Special Report, 2022. https://epochpage.com/wp-content/uploads/sites/3/2022/12/DAFOH-Special-Report-2022.pdf [23] Robertson MP, Lavee J. (2022), Execution by organ procurement: Breaching the dead donor rule in China. Am J Transplant, Vol.22,1804– 1812. doi:10.1111/ajt.16969. [24] DAFOH Special Report, 2022. https://epochpage.com/wp-content/uploads/sites/3/2022/12/DAFOH-Special-Report-2022.pdf; DAFOH’s physicians were nominated for a Nobel Prize for their work to stop forced organ harvesting. Šućur, A., &amp; Gajović, S. (2016). Nobel Peace Prize nomination for Doctors Against Forced Organ Harvesting (DAFOH) - a recognition of upholding ethical practices in medicine. Croatian medical journal, 57(3), 219–222. https://doi.org/10.3325/cmj.2016.57.219 [25] Robertson and Lavee (2022). [26] Stop Organ Harvesting in China, website (organization of the Falun Dafa). https://www.stoporganharvesting.org/short-waiting-times/ [27] National Kidney Foundation, The Kidney Transplant Waitlist – What You Need to Know, https://www.kidney.org/atoz/content/transplant-waitlist [28] Wu, Y., Elliott, R., Li, L., Yang, T., Bai, Y., &amp; Ma, W. (2018). Cadaveric organ donation in China: a crossroads for ethics and sociocultural factors. Medicine, 97(10). [29] Wu, Elliott, et al., (2018). [30] Su, Y. Y., Chen, W. B., Liu, G., Fan, L. L., Zhang, Y., Ye, H., ... &amp; Jiang, M. D. (2018). An investigation and suggestions for the improvement of brain death determination in China. Chinese Medical Journal, 131(24), 2910-2914. [31] Huang, J., Millis, J. M., Mao, Y., Millis, M. A., Sang, X., &amp; Zhong, S. (2012). A pilot programme of organ donation after cardiac death in China. The Lancet, 379(9818), 862-865. [32] Yang, Q., &amp; Miller, G. (2015). East–west differences in perception of brain death: Review of history, current understandings, and directions for future research. Journal of bioethical inquiry, 12, 211-225. [33] Huang, J., Millis, J. M., Mao, Y., Millis, M. A., Sang, X., &amp; Zhong, S. (2015). Voluntary organ donation system adapted to Chinese cultural values and social reality. Liver Transplantation, 21(4), 419-422. [34] Huang, Millis, et al. (2015). [35] Wu, X., &amp; Fang, Q. (2013). Financial compensation for deceased organ donation in China. Journal of Medical Ethics, 39(6), 378-379. [36] An, N., Shi, Y., Jiang, Y., &amp; Zhao, L. (2016). Organ donation in China: the major progress and the continuing problem. Journal of biomedical research, 30(2), 81. [37] Shi, B. Y., Liu, Z. J., &amp; Yu, T. (2020). Development of the organ donation and transplantation system in China. Chinese medical journal, 133(07), 760-765. [38] Robertson, M. P., Hinde, R. L., &amp; Lavee, J. (2019). Analysis of official deceased organ donation data casts doubt on the credibility of China’s organ transplant reform. BMC Medical Ethics, 20(1), 1-20. [39] Miller, F.G. and Sade, R. M. (2014). Consequences of the Dead Donor Rule. The Annals of thoracic surgery, 97(4), 1131–1132. https://doi.org/10.1016/j.athoracsur.2014.01.003 [40] For example, Miller and Sade (2014) and Miller and Truog (2008). [41] Omelianchuk, A. How (not) to think of the ‘dead-donor’ rule. Theor Med Bioeth 39, 1–25 (2018). https://doi-org.ezproxy.cul.columbia.edu/10.1007/s11017-018-9432-5 [42] Miller, F.G. and Truog, R.D. (2008), Rethinking the Ethics of Vital Organ Donations. Hastings Center Report. 38: 38-46. [43] Miller and Truog, (2008), p. 40, citing Callahan, D., The Troubled Dream of Life, p. 77. [44] Radcliffe-Richards, J., Daar, A.S., Guttman, R.D., Hoffenberg, R., Kennedy, I., Lock, M., Sells, R.A., Tilney, N. (1998), The Case for Allowing Kidney Sales, The Lancet, Vol 351, p. 279. (Authored by members of the International Forum for Transplant Ethics.) [45] Robertson and Lavee, (2022). [46] Robertson and Lavee, (2022). [47] China Tribunal (2020). [48] Consent varies by local law and may be explicit or presumed and use an opt-in or opt-out system and may or may not require the signoff by a close family member. [49] Bain, Christina, Mari, Joseph. June 26, 2018, Organ Trafficking: The Unseen Form of Human Trafficking, ACAMS Today, https://www.acamstoday.org/organ-trafficking-the-unseen-form-of-human-trafficking/; Stammers, T. (2022), "2: Organ trafficking: a neglected aspect of modern slavery", Modern Slavery and Human Trafficking, Bristol, UK: Policy Press. https://bristoluniversitypressdigital.com/view/book/978144736. [50] Do No Harm: Mitigating Human Rights Risks when Interacting with International Medical Institutions &amp; Professionals in Transplantation Medicine, Global Rights Compliance, Legal Advisory Report, April 2022, https://globalrightscompliance.com/project/do-no-harm-policy-guidance-and-legal-advisory-report/. [51] Global Rights Compliance, p. 22. [52] The Stop Forced Organ Harvesting Act of 2023, H.R. 1154, 118th Congress (2023). https://www.congress.gov/bill/118th-congress/house-bill/1154. [53] The Stop Forced Organ Harvesting Act of 2023, H.R. 1154, 118th Congress (2023), https://www.congress.gov/bill/118th-congress/house-bill/1154. [54] Global Rights Compliance notes that Belgium, France (passed law on human rights due diligence in the value supply chain), United Kingdom, United States, Canada, Australia, and New Zealand have legal approaches, resolutions, and pending laws. p. 45. [55] For example, Caplan, A.L. (2020), The ethics of the unmentionable Journal of Medical Ethics 2020;46:687-688. [56] Caplan, A.L. , Danovitch, G., Shapiro M., et al. (2011) Time for a boycott of Chinese science and medicine pertaining to organ transplantation. Lancet, 378(9798):1218. doi:10.1016/S0140-6736(11)61536-5 [57] Robertson and Lavee. [58] Smolin, D. M. (2011). The Tuskegee syphilis experiment, social change, and the future of bioethics. Faulkner L. Rev., 3, 229; Gallin, S., &amp; Bedzow, I. (2020). Holocaust as an inflection point in the development of bioethics and research ethics. Handbook of research ethics and scientific integrity, 1071-1090. [59] World Medical Association Declaration of Helsinki: Ethical Principles for Medical Research Involving Human Subjects, adopted by the 18th WMA General Assembly, Helsinki, Finland, June 1964, and amended multiple times, most recently by the 64th WMA General Assembly, Fortaleza, Brazil, October 2013. https://www.wma.net/policies-post/wma-declaration-of-helsinki-ethical-principles-for-medical-research-involving-human-subjects/

&#x0D; &#x0D; &#x0D; From elephants to ABBA fans, silicon to hormone, the following discussion uses a new research method to look at printed text, motion pictures and a teenage rebel icon. If by ‘print’ we mean a mechanically reproduced impression of a cultural symbol in a medium, then printing has been with us since before microdot security prints were painted onto cars, before voice prints, laser prints, network servers, record pressings, motion picture prints, photo prints, colour woodblock prints, before books, textile prints, and footprints. If we accept that higher mammals such as elephants have a learnt culture, then it is possible to extend a definition of printing beyond Homo sapiens. Poole reports that elephants mechanically trumpet reproductions of human car horns into the air surrounding their society. If nothing else, this cross-species, cross-cultural reproduction, this ‘ability to mimic’ is ‘another sign of their intelligence’. Observation of child development suggests that the first significant meaningful ‘impression’ made on the human mind is that of the face of the child’s nurturer – usually its mother. The baby’s mind forms an ‘impression’, a mental print, a reproducible memory data set, of the nurturer’s face, voice, smell, touch, etc. That face is itself a cultural construct: hair style, makeup, piercings, tattoos, ornaments, nutrition-influenced skin and smell, perfume, temperature and voice. A mentally reproducible pattern of a unique face is formed in the mind, and we use that pattern to distinguish ‘familiar and strange’ in our expanding social orbit. The social relations of patterned memory – of imprinting – determine the extent to which we explore our world (armed with research aids such as text print) or whether we turn to violence or self-harm (Bretherton). While our cultural artifacts (such as vellum maps or networked voice message servers) bravely extend our significant patterns into the social world and the traversed environment, it is useful to remember that such artifacts, including print, are themselves understood by our original pattern-reproduction and impression system – the human mind, developed in childhood. The ‘print’ is brought to mind differently in different discourses. For a reader, a ‘print’ is a book, a memo or a broadsheet, whether it is the Indian Buddhist Sanskrit texts ordered to be printed in 593 AD by the Chinese emperor Sui Wen-ti (Silk Road) or the US Defense Department memo authorizing lower ranks to torture the prisoners taken by the Bush administration (Sanchez, cited in ABC). Other fields see prints differently. For a musician, a ‘print’ may be the sheet music which spread classical and popular music around the world; it may be a ‘record’ (as in a ‘recording’ session), where sound is impressed to wax, vinyl, charged silicon particles, or the alloys (Smith, “Elpida”) of an mp3 file. For the fine artist, a ‘print’ may be any mechanically reproduced two-dimensional (or embossed) impression of a significant image in media from paper to metal, textile to ceramics. ‘Print’ embraces the Japanese Ukiyo-e colour prints of Utamaro, the company logos that wink from credit card holographs, the early photographs of Talbot, and the textured patterns printed into neolithic ceramics. Computer hardware engineers print computational circuits. Homicide detectives investigate both sweaty finger prints and the repeated, mechanical gaits of suspects, which are imprinted into the earthy medium of a crime scene. For film makers, the ‘print’ may refer to a photochemical polyester reproduction of a motion picture artifact (the reel of ‘celluloid’), or a DVD laser disc impression of the same film. Textualist discourse has borrowed the word ‘print’ to mean ‘text’, so ‘print’ may also refer to the text elements within the vision track of a motion picture: the film’s opening titles, or texts photographed inside the motion picture story such as the sword-cut ‘Z’ in Zorro (Niblo). Before the invention of writing, the main mechanically reproduced impression of a cultural symbol in a medium was the humble footprint in the sand. The footprints of tribes – and neighbouring animals – cut tracks in the vegetation and the soil. Printed tracks led towards food, water, shelter, enemies and friends. Having learnt to pattern certain faces into their mental world, children grew older and were educated in the footprints of family and clan, enemies and food. The continuous impression of significant foot traffic in the medium of the earth produced the lines between significant nodes of prewriting and pre-wheeled cultures. These tracks were married to audio tracks, such as the song lines of the Australian Aborigines, or the ballads of tramping culture everywhere. A typical tramping song has the line, ‘There’s a track winding back to an old-fashion shack along the road to Gundagai,’ (O’Hagan), although this colonial-style song was actually written for radio and became an international hit on the airwaves, rather than the tramping trails. The printed tracks impressed by these cultural flows are highly contested and diverse, and their foot prints are woven into our very language. The names for printed tracks have entered our shared memory from the intersection of many cultures: ‘Track’ is a Germanic word entering English usage comparatively late (1470) and now used mainly in audio visual cultural reproduction, as in ‘soundtrack’. ‘Trek’ is a Dutch word for ‘track’ now used mainly by ecotourists and science fiction fans. ‘Learn’ is a Proto-Indo-European word: the verb ‘learn’ originally meant ‘to find a track’ back in the days when ‘learn’ had a noun form which meant ‘the sole of the foot’. ‘Tract’ and ‘trace’ are Latin words entering English print usage before 1374 and now used mainly in religious, and electronic surveillance, cultural reproduction. ‘Trench’ in 1386 was a French path cut through a forest. ‘Sagacity’ in English print in 1548 was originally the ability to track or hunt, in Proto-Indo-European cultures. ‘Career’ (in English before 1534) was the print made by chariots in ancient Rome. ‘Sleuth’ (1200) was a Norse noun for a track. ‘Investigation’ (1436) was Latin for studying a footprint (Harper). The arrival of symbolic writing scratched on caves, hearth stones, and trees (the original meaning of ‘book’ is tree), brought extremely limited text education close to home. Then, with baked clay tablets, incised boards, slate, bamboo, tortoise shell, cast metal, bark cloth, textiles, vellum, and – later – paper, a portability came to text that allowed any culture to venture away from known ‘foot’ paths with a reduction in the risk of becoming lost and perishing. So began the world of maps, memos, bills of sale, philosophic treatises and epic mythologies. Some of this was printed, such as the mechanical reproduction of coins, but the fine handwriting required of long, extended, portable texts could not be printed until the invention of paper in China about 2000 years ago. Compared to lithic architecture and genes, portable text is a fragile medium, and little survives from the millennia of its innovators. The printing of large non-text designs onto bark-paper and textiles began in neolithic times, but Sui Wen-ti’s imperial memo of 593 AD gives us the earliest written date for printed books, although we can assume they had been published for many years previously. The printed book was a combination of Indian philosophic thought, wood carving, ink chemistry and Chinese paper. The earliest surviving fragment of paper-print technology is ‘Mantras of the Dharani Sutra’, a Buddhist scripture written in the Sanskrit language of the Indian subcontinent, unearthed at an early Tang Dynasty site in Xian, China – making the fragment a veteran piece of printing, in the sense that Sanskrit books had been in print for at least a century by the early Tang Dynasty (Chinese Graphic Arts Net). At first, paper books were printed with page-size carved wooden boards. Five hundred years later, Pi Sheng (c.1041) baked individual reusable ceramic characters in a fire and invented the durable moveable type of modern printing (Silk Road 2000). Abandoning carved wooden tablets, the ‘digitizing’ of Chinese moveable type sped up the production of printed texts. In turn, Pi Sheng’s flexible, rapid, sustainable printing process expanded the political-cultural impact of the literati in Asian society. Digitized block text on paper produced a bureaucratic, literate elite so powerful in Asia that Louis XVI of France copied China’s print-based Confucian system of political authority for his own empire, and so began the rise of the examined public university systems, and the civil service systems, of most European states (Watson, Visions). By reason of its durability, its rapid mechanical reproduction, its culturally agreed signs, literate readership, revered authorship, shared ideology, and distributed portability, a ‘print’ can be a powerful cultural network which builds and expands empires. But print also attacks and destroys empires. A case in point is the Spanish conquest of Aztec America: The Aztecs had immense libraries of American literature on bark-cloth scrolls, a technology which predated paper. These libraries were wiped out by the invading Spanish, who carried a different book before them (Ewins). In the industrial age, the printing press and the gun were seen as the weapons of rebellions everywhere. In 1776, American rebels staffed their ‘Homeland Security’ units with paper makers, knowing that defeating the English would be based on printed and written documents (Hahn). Mao Zedong was a book librarian; Mao said political power came out of the barrel of a gun, but Mao himself came out of a library. With the spread of wireless networked servers, political ferment comes out of the barrel of the cell phone and the internet chat room these days. Witness the cell phone displays of a plane hitting a tower that appear immediately after 9/11 in the Middle East, or witness the show trials of a few US and UK lower ranks who published prints of their torturing activities onto the internet: only lower ranks who published prints were arrested or tried. The control of secure servers and satellites is the new press. These days, we live in a global library of burning books – ‘burning’ in the sense that ‘print’ is now a charged silicon medium (Smith, “Intel”) which is usually made readable by connecting the chip to nuclear reactors and petrochemically-fired power stations. World resources burn as we read our screens. Men, women, children burn too, as we watch our infotainment news in comfort while ‘their’ flickering dead faces are printed in our broadcast hearths. The print we watch is not the living; it is the voodoo of the living in the blackout behind the camera, engaging the blood sacrifice of the tormented and the unfortunate. Internet texts are also ‘on fire’ in the third sense of their fragility and instability as a medium: data bases regularly ‘print’ fail-safe copies in an attempt to postpone the inevitable mechanical, chemical and electrical failure that awaits all electronic media in time. Print defines a moral position for everyone. In reporting conflict, in deciding to go to press or censor, any ‘print’ cannot avoid an ethical context, starting with the fact that there is a difference in power between print maker, armed perpetrators, the weak, the peaceful, the publisher, and the viewer. So many human factors attend a text, video or voice ‘print’: its very existence as an aesthetic object, even before publication and reception, speaks of unbalanced, and therefore dynamic, power relationships. For example, Graham Greene departed unscathed from all the highly dangerous battlefields he entered as a novelist: Riot-torn Germany, London Blitz, Belgian Congo, Voodoo Haiti, Vietnam, Panama, Reagan’s Washington, and mafia Europe. His texts are peopled with the injustices of the less fortunate of the twentieth century, while he himself was a member of the fortunate (if not happy) elite, as is anyone today who has the luxury of time to read Greene’s works for pleasure. Ethically a member of London and Paris’ colonizers, Greene’s best writing still electrifies, perhaps partly because he was in the same line of fire as the victims he shared bread with. In fact, Greene hoped daily that he would escape from the dreadful conflicts he fictionalized via a body bag or an urn of ashes (see Sherry). In reading an author’s biography we have one window on the ethical dimensions of authority and print. If a print’s aesthetics are sometimes enduring, its ethical relationships are always mutable. Take the stylized logo of a running athlete: four limbs bent in a rotation of action. This dynamic icon has symbolized ‘good health’ in Hindu and Buddhist culture, from Madras to Tokyo, for thousands of years. The cross of bent limbs was borrowed for the militarized health programs of 1930s Germany, and, because of what was only a brief, recent, isolated yet monstrously horrific segment of its history in print, the bent-limbed swastika is now a vilified symbol in the West. The sign remains ‘impressed’ differently on traditional Eastern culture, and without the taint of Nazism. Dramatic prints are emotionally charged because, in depicting Homo sapiens in danger, or passionately in love, they elicit a hormonal reaction from the reader, the viewer, or the audience. The type of emotions triggered by a print vary across the whole gamut of human chemistry. A recent study of three genres of motion picture prints shows a marked differences in the hormonal responses of men compared to women when viewing a romance, an actioner, and a documentary (see Schultheiss, Wirth, and Stanton). Society is biochemically diverse in its engagement with printed culture, which raises questions about equality in the arts. Motion picture prints probably comprise around one third of internet traffic, in the form of stolen digitized movie files pirated across the globe via peer-to-peer file transfer networks (p2p), and burnt as DVD laser prints (BBC). There is also a US 40 billion dollar per annum legitimate commerce in DVD laser pressings (Grassl), which would suggest an US 80 billion per annum world total in legitimate laser disc print culture. The actively screen literate, or the ‘sliterati’ as I prefer to call them, research this world of motion picture prints via their peers, their internet information channels, their television programming, and their web forums. Most of this activity occurs outside the ambit of universities and schools. One large site of sliterate (screen literate) practice outside most schooling and official research is the net of online forums at imdb.com (International Movie Data Base). Imdb.com ‘prints’ about 25,000,000 top pages per month to client browsers. Hundreds of sliterati forums are located at imdb, including a forum for the Australian movie, Muriel’s Wedding (Hogan). Ten years after the release of Muriel’s Wedding, young people who are concerned with victimization and bullying still log on to http://us.imdb.com/title/tt0110598/board/&gt; and put their thoughts into print: I still feel so bad for Muriel in the beginning of the movie, when the girls ‘dump’ her, and how much the poor girl cried and cried! Those girls were such biartches…I love how they got their comeuppance! bunniesormaybemidgets’s comment is typical of the current discussion. Muriel’s Wedding was a very popular film in its first cinema edition in Australia and elsewhere. About 30% of the entire over-14 Australian population went to see this photochemical polyester print in the cinemas on its first release. A decade on, the distributors printed a DVD laser disc edition. The story concerns Muriel (played by Toni Collette), the unemployed daughter of a corrupt, ‘police state’ politician. Muriel is bullied by her peers and she withdraws into a fantasy world, deluding herself that a white wedding will rescue her from the torments of her blighted life. Through theft and deceit (the modus operandi of her father) Muriel escapes to the entertainment industry and finds a ‘wicked’ girlfriend mentor. From a rebellious position of stubborn independence, Muriel plays out her fantasy. She gets her white wedding, before seeing both her father and her new married life as hollow shams which have goaded her abandoned mother to suicide. Redefining her life as a ‘game’ and assuming responsibility for her independence, Muriel turns her back on the mainstream, image-conscious, female gang of her oppressed youth. Muriel leaves the story, having rekindled her friendship with her rebel mentor. My methodological approach to viewing the laser disc print was to first make a more accessible, coded record of the entire movie. I was able to code and record the print in real time, using a new metalanguage (Watson, “Eyes”). The advantage of Coding is that ‘thinks’ the same way as film making, it does not sidetrack the analyst into prose. The Code splits the movie print into Vision Action [vision graphic elements, including text] (sound) The Coding splits the vision track into normal action and graphic elements, such as text, so this Coding is an ideal method for extracting all the text elements of a film in real time. After playing the film once, I had four and a half tightly packed pages of the coded story, including all its text elements in square brackets. Being a unique, indexed hard copy, the Coded copy allowed me immediate access to any point of the Muriel’s Wedding saga without having to search the DVD laser print. How are ‘print’ elements used in Muriel’s Wedding? Firstly, a rose-coloured monoprint of Muriel Heslop’s smiling face stares enigmatically from the plastic surface of the DVD picture disc. The print is a still photo captured from her smile as she walked down the aisle of her white wedding. In this print, Toni Collette is the Mona Lisa of Australian culture, except that fans of Muriel’s Wedding know the meaning of that smile is a magical combination of the actor’s art: the smile is both the flush of dreams come true and the frightening self deception that will kill her mother. Inserting and playing the disc, the text-dominant menu appears, and the film commences with the text-dominant opening titles. Text and titles confer a legitimacy on a work, whether it is a trade mark of the laser print owners, or the household names of stars. Text titles confer status relationships on both the presenters of the cultural artifact and the viewer who has entered into a legal license agreement with the owners of the movie. A title makes us comfortable, because the mind always seeks to name the unfamiliar, and a set of text titles does that job for us so that we can navigate the ‘tracks’ and settle into our engagement with the unfamiliar. The apparent ‘truth’ and ‘stability’ of printed text calms our fears and beguiles our uncertainties. Muriel attends the white wedding of a school bully bride, wearing a leopard print dress she has stolen. Muriel’s spotted wild animal print contrasts with the pure white handmade dress of the bride. In Muriel’s leopard textile print, we have the wild, rebellious, impoverished, inappropriate intrusion into the social ritual and fantasy of her high-status tormentor. An off-duty store detective recognizes the printed dress and calls the police. The police are themselves distinguished by their blue-and-white checked prints and other mechanically reproduced impressions of cultural symbols: in steel, brass, embroidery, leather and plastics. Muriel is driven in the police car past the stenciled town sign (‘Welcome To Porpoise Spit’ heads a paragraph of small print). She is delivered to her father, a politician who presides over the policing of his town. In a state where the judiciary, police and executive are hijacked by the same tyrant, Muriel’s father, Bill, pays off the police constables with a carton of legal drugs (beer) and Muriel must face her father’s wrath, which he proceeds to transfer to his detested wife. Like his daughter, the father also wears a spotted brown print costume, but his is a batik print from neighbouring Indonesia (incidentally, in a nation that takes the political status of its batik prints very seriously). Bill demands that Muriel find the receipt for the leopard print dress she claims she has purchased. The legitimate ownership of the object is enmeshed with a printed receipt, the printed evidence of trade. The law (and the paramilitary power behind the law) are legitimized, or contested, by the presence or absence of printed text. Muriel hides in her bedroom, surround by poster prints of the pop group ABBA. Torn-out prints of other people’s weddings adorn her mirror. Her face is embossed with the clown-like primary colours of the marionette as she lifts a bouquet to her chin and stares into the real time ‘print’ of her mirror image. Bill takes the opportunity of a business meeting with Japanese investors to feed his entire family at ‘Charlie Chan’’s restaurant. Muriel’s middle sister sloppily wears her father’s state election tee shirt, printed with the text: ‘Vote 1, Bill Heslop. You can’t stop progress.’ The text sets up two ironic gags that are paid off on the dialogue track: “He lost,’ we are told. ‘Progress’ turns out to be funding the concreting of a beach. Bill berates his daughter Muriel: she has no chance of becoming a printer’s apprentice and she has failed a typing course. Her dysfunction in printed text has been covered up by Bill: he has bribed the typing teacher to issue a printed diploma to his daughter. In the gambling saloon of the club, under the arrays of mechanically repeated cultural symbols lit above the poker machines (‘A’ for ace, ‘Q’ for queen, etc.), Bill’s secret girlfriend Diedre risks giving Muriel a cosmetics job. Another text icon in lights announces the surf nightclub ‘Breakers’. Tania, the newly married queen bitch who has made Muriel’s teenage years a living hell, breaks up with her husband, deciding to cash in his negotiable text documents – his Bali honeymoon tickets – and go on an island holiday with her girlfriends instead. Text documents are the enduring site of agreements between people and also the site of mutations to those agreements. Tania dumps Muriel, who sobs and sobs. Sobs are a mechanical, percussive reproduction impressed on the sound track. Returning home, we discover that Muriel’s older brother has failed a printed test and been rejected for police recruitment. There is a high incidence of print illiteracy in the Heslop family. Mrs Heslop (Jeannie Drynan), for instance, regularly has trouble at the post office. Muriel sees a chance to escape the oppression of her family by tricking her mother into giving her a blank cheque. Here is the confluence of the legitimacy of a bank’s printed negotiable document with the risk and freedom of a blank space for rebel Muriel’s handwriting. Unable to type, her handwriting has the power to steal every cent of her father’s savings. She leaves home and spends the family’s savings at an island resort. On the island, the text print-challenged Muriel dances to a recording (sound print) of ABBA, her hand gestures emphasizing her bewigged face, which is made up in an impression of her pop idol. Her imitation of her goddesses – the ABBA women, her only hope in a real world of people who hate or avoid her – is accompanied by her goddesses’ voices singing: ‘the mystery book on the shelf is always repeating itself.’ Before jpeg and gif image downloads, we had postcard prints and snail mail. Muriel sends a postcard to her family, lying about her ‘success’ in the cosmetics business. The printed missal is clutched by her father Bill (Bill Hunter), who proclaims about his daughter, ‘you can’t type but you really impress me’. Meanwhile, on Hibiscus Island, Muriel lies under a moonlit palm tree with her newly found mentor, ‘bad girl’ Ronda (Rachel Griffiths). In this critical scene, where foolish Muriel opens her heart’s yearnings to a confidante she can finally trust, the director and DP have chosen to shoot a flat, high contrast blue filtered image. The visual result is very much like the semiabstract Japanese Ukiyo-e woodblock prints by Utamaro. This Japanese printing style informed the rise of European modern painting (Monet, Van Gogh, Picasso, etc., were all important collectors and students of Ukiyo-e prints). The above print and text elements in Muriel’s Wedding take us 27 minutes into her story, as recorded on a single page of real-time handwritten Coding. Although not discussed here, the Coding recorded the complete film – a total of 106 minutes of text elements and main graphic elements – as four pages of Code. Referring to this Coding some weeks after it was made, I looked up the final code on page four: taxi [food of the sea] bq. Translation: a shop sign whizzes past in the film’s background, as Muriel and Ronda leave Porpoise Spit in a taxi. Over their heads the text ‘Food Of The Sea’ flashes. We are reminded that Muriel and Ronda are mermaids, fantastic creatures sprung from the brow of author PJ Hogan, and illuminated even today in the pantheon of women’s coming-of-age art works. That the movie is relevant ten years on is evidenced by the current usage of the Muriel’s Wedding online forum, an intersection of wider discussions by sliterate women on imdb.com who, like Muriel, are observers (and in some cases victims) of horrific pressure from ambitious female gangs and bullies. Text is always a minor element in a motion picture (unless it is a subtitled foreign film) and text usually whizzes by subliminally while viewing a film. By Coding the work for [text], all the text nuances made by the film makers come to light. While I have viewed Muriel’s Wedding on many occasions, it has only been in Coding it specifically for text that I have noticed that Muriel is a representative of that vast class of talented youth who are discriminated against by print (as in text) educators who cannot offer her a life-affirming identity in the English classroom. Severely depressed at school, and failing to type or get a printer’s apprenticeship, Muriel finds paid work (and hence, freedom, life, identity, independence) working in her audio visual printed medium of choice: a video store in a new city. Muriel found a sliterate admirer at the video store but she later dumped him for her fantasy man, before leaving him too. One of the points of conjecture on the imdb Muriel’s Wedding site is, did Muriel (in the unwritten future) get back together with admirer Brice Nobes? That we will never know. While a print forms a track that tells us where culture has been, a print cannot be the future, a print is never animate reality. At the end of any trail of prints, one must lift one’s head from the last impression, and negotiate satisfaction in the happening world. References Australian Broadcasting Corporation. “Memo Shows US General Approved Interrogations.” 30 Mar. 2005 http://www.abc.net.au&gt;. British Broadcasting Commission. “Films ‘Fuel Online File-Sharing’.’’ 22 Feb. 2005 http://news.bbc.co.uk/1/hi/technology/3890527.stm&gt;. Bretherton, I. “The Origins of Attachment Theory: John Bowlby and Mary Ainsworth.” 1994. 23 Jan. 2005 http://www.psy.med.br/livros/autores/bowlby/bowlby.pdf&gt;. Bunniesormaybemidgets. Chat Room Comment. “What Did Those Girls Do to Rhonda?” 28 Mar. 2005 http://us.imdb.com/title/tt0110598/board/&gt;. Chinese Graphic Arts Net. Mantras of the Dharani Sutra. 20 Feb. 2005 http://www.cgan.com/english/english/cpg/engcp10.htm&gt;. Ewins, R. Barkcloth and the Origins of Paper. 1991. 20 Feb. 2005 http://www.justpacific.com/pacific/papers/barkcloth~paper.html&gt;. Grassl K.R. The DVD Statistical Report. 14 Mar. 2005 http://www.corbell.com&gt;. Hahn, C. M. The Topic Is Paper. 20 Feb. 2005 http://www.nystamp.org/Topic_is_paper.html&gt;. Harper, D. Online Etymology Dictionary. 14 Mar. 2005 http://www.etymonline.com/&gt;. Mask of Zorro, The. Screenplay by J McCulley. UA, 1920. Muriel’s Wedding. Dir. PJ Hogan. Perf. Toni Collette, Rachel Griffiths, Bill Hunter, and Jeannie Drynan. Village Roadshow, 1994. O’Hagan, Jack. On The Road to Gundagai. 1922. 2 Apr. 2005 http://ingeb.org/songs/roadtogu.html&gt;. Poole, J.H., P.L. Tyack, A.S. Stoeger-Horwath, and S. Watwood. “Animal Behaviour: Elephants Are Capable of Vocal Learning.” Nature 24 Mar. 2005. Sanchez, R. “Interrogation and Counter-Resistance Policy.” 14 Sept. 2003. 30 Mar. 2005 http://www.abc.net.au&gt;. Schultheiss, O.C., M.M. Wirth, and S.J. Stanton. “Effects of Affiliation and Power Motivation Arousal on Salivary Progesterone and Testosterone.” Hormones and Behavior 46 (2005). Sherry, N. The Life of Graham Greene. 3 vols. London: Jonathan Cape 2004, 1994, 1989. Silk Road. Printing. 2000. 20 Feb. 2005 http://www.silk-road.com/artl/printing.shtml&gt;. Smith, T. “Elpida Licenses ‘DVD on a Chip’ Memory Tech.” The Register 20 Feb. 2005 http://www.theregister.co.uk/2005/02&gt;. —. “Intel Boffins Build First Continuous Beam Silicon Laser.” The Register 20 Feb. 2005 http://www.theregister.co.uk/2005/02&gt;. Watson, R. S. “Eyes And Ears: Dramatic Memory Slicing and Salable Media Content.” Innovation and Speculation, ed. Brad Haseman. Brisbane: QUT. [in press] Watson, R. S. Visions. Melbourne: Curriculum Corporation, 1994. &#x0D; &#x0D; &#x0D; &#x0D; Citation reference for this article&#x0D; &#x0D; MLA Style&#x0D; Watson, Robert. "E-Press and Oppress: Audio Visual Print Drama, Identity, Text and Motion Picture Rebellion." M/C Journal 8.2 (2005). echo date('d M. Y'); ?&gt; &lt;http://journal.media-culture.org.au/0506/08-watson.php&gt;. APA Style&#x0D; Watson, R. (Jun. 2005) "E-Press and Oppress: Audio Visual Print Drama, Identity, Text and Motion Picture Rebellion," M/C Journal, 8(2). Retrieved echo date('d M. Y'); ?&gt; from &lt;http://journal.media-culture.org.au/0506/08-watson.php&gt;. &#x0D;

Introduction: Bubbles and Sport The ephemeral materiality of bubbles – beautiful, spectacular, and distracting but ultimately fragile – when applied to protect or conserve in the interests of sport-media profit, creates conditions that exacerbate existing inequalities in sport and society. Bubbles are usually something to watch, admire, and chase after in their brief yet shiny lives. There is supposed to be, technically, nothing inside them other than one or more gasses, and yet we constantly refer to people and objects being inside bubbles. The metaphor of the bubble has been used to describe the life of celebrities, politicians in purpose-built capital cities like Canberra, and even leftist, environmentally activist urban dwellers. The metaphorical and material qualities of bubbles are aligned—they cannot be easily captured and are liable to change at any time. In this article we address the metaphorical sporting bubble, which is often evoked in describing life in professional sport. This is a vernacular term used to capture and condemn the conditions of life of elite sportspeople (usually men), most commonly after there has been a sport-related scandal, especially of a sexual nature (Rowe). It is frequently paired with connotatively loaded adjectives like pampered and indulged. The sporting bubble is rarely interrogated in academic literature, the concept largely being left to the media and moral entrepreneurs. It is represented as involving a highly privileged but also pressurised life for those who live inside it. A sporting bubble is a world constructed for its most prized inhabitants that enables them to be protected from insurgents and to set the terms of their encounters with others, especially sport fans and disciplinary agents of the state. The Covid-19 pandemic both reinforced and reconfigured the operational concept of the bubble, re-arranging tensions between safety (protecting athletes) and fragility (short careers, risks of injury, etc.) for those within, while safeguarding those without from bubble contagion. Privilege and Precarity Bubble-induced social isolation, critics argue, encourages a loss of perspective among those under its protection, an entitled disconnection from the usual rules and responsibilities of everyday life. For this reason, the denizens of the sporting bubble are seen as being at risk to themselves and, more troublingly, to those allowed temporarily to penetrate it, especially young women who are first exploited by and then ejected from it (Benedict). There are many well-documented cases of professional male athletes “behaving badly” and trying to rely on institutional status and various versions of the sporting bubble for shelter (Flood and Dyson; Reel and Crouch; Wade). In the age of mobile and social media, it is increasingly difficult to keep misbehaviour in-house, resulting in a slew of media stories about, for example, drunkenness and sexual misconduct, such as when then-Sydney Roosters co-captain Mitchell Pearce was suspended and fined in 2016 after being filmed trying to force an unwanted kiss on a woman and then simulating a lewd act with her dog while drunk. There is contestation between those who condemn such behaviour as aberrant and those who regard it as the conventional expression of youthful masculinity as part of the familiar “boys will be boys” dictum. The latter naturalise an inequitable gender order, frequently treating sportsmen as victims of predatory women, and ignoring asymmetries of power between men and women, especially in homosocial environments (Toffoletti). For those in the sporting bubble (predominantly elite sportsmen and highly paid executives, also mostly men, with an array of service staff of both sexes moving in and out of it), life is reflected for those being protected via an array of screens (small screens in homes and indoor places of entertainment, and even smaller screens on theirs and others’ phones, as well as huge screens at sport events). These male sport stars are paid handsomely to use their skill and strength to perform for the sporting codes, their every facial expression and bodily action watched by the media and relayed to audiences. This is often a precarious existence, the usually brief career of an athlete worker being dependent on health, luck, age, successful competition with rivals, networks, and club and coach preferences. There is a large, aspirational reserve army of athletes vying to play at the elite level, despite risks of injury and invasive, life-changing medical interventions. Responsibility for avoiding performance and image enhancing drugs (PIEDs) also weighs heavily on their shoulders (Connor). Professional sportspeople, in their more reflective moments, know that their time in the limelight will soon be up, meaning that getting a ticket to the sporting bubble, even for a short time, can make all the difference to their post-sport lives and those of their families. The most vulnerable of the small minority of participants in sport who make a good, short-term living from it are those for whom, in the absence of quality education and prior social status, it is their sole likely means of upward social mobility (Spaaij). Elite sport performers are surrounded by minders, doctors, fitness instructors, therapists, coaches, advisors and other service personnel, all supporting athletes to stay focussed on and maximise performance quality to satisfy co-present crowds, broadcasters, sponsors, sports bodies and mass media audiences. The shield offered by the sporting bubble supports the teleological win-at-all-costs mentality of professional sport. The stakes are high, with athlete and executive salaries, sponsorships and broadcasting deals entangled in a complex web of investments in keeping the “talent” pivotal to the “attention economy” (Davenport and Beck)—the players that provide the content for sale—in top form. Yet, the bubble cannot be entirely secured and poor behaviour or performance can have devastating effects, including permanent injury or disability, mental illness and loss of reputation (Rowe, “Scandals and Sport”). Given this fragile materiality of the sporting bubble, it is striking that, in response to the sudden shutdown following the economic and health crisis caused by the 2020 global pandemic, the leaders of professional sport decided to create more of them and seek to seal the metaphorical and material space with unprecedented efficiency. The outcome was a multi-sided tale of mobility, confinement, capital, labour, and the gendering of sport and society. The Covid-19 Gilded Cage Sociologists such as Zygmunt Bauman and John Urry have analysed the socio-politics of mobilities, whereby some people in the world, such as tourists, can traverse the globe at their leisure, while others remain fixed in geographical space because they lack the means to be mobile or, in contrast, are involuntarily displaced by war, so-called “ethnic cleansing”, famine, poverty or environmental degradation. The Covid-19 global pandemic re-framed these matters of mobilities (Rowe, “Subjecting Pandemic Sport”), with conventional moving around—between houses, businesses, cities, regions and countries—suddenly subjected to the imperative to be static and, in perniciously unreflective technocratic discourse, “socially distanced” (when what was actually meant was to be “physically distanced”). The late-twentieth century analysis of the “risk society” by Ulrich Beck, in which the mysterious consequences of humans’ predation on their environment are visited upon them with terrifying force, was dramatically realised with the coming of Covid-19. In another iteration of the metaphor, it burst the bubble of twenty-first century global sport. What we today call sport was formed through the process of sportisation (Maguire), whereby hyper-local, folk physical play was reconfigured as multi-spatial industrialised sport in modernity, becoming increasingly reliant on individual athletes and teams travelling across the landscape and well over the horizon. Co-present crowds were, in turn, overshadowed in the sport economy when sport events were taken to much larger, dispersed audiences via the media, especially in broadcast mode (Nicholson, Kerr, and Sherwood). This lucrative mediation of professional sport, though, came with an unforgiving obligation to generate an uninterrupted supply of spectacular live sport content. The pandemic closed down most sports events and those that did take place lacked the crucial participation of the co-present crowd to provide the requisite event atmosphere demanded by those viewers accustomed to a sense of occasion. Instead, they received a strange spectacle of sport performers operating in empty “cathedrals”, often with a “faked” crowd presence. The mediated sport spectacle under the pandemic involved cardboard cut-out and sex doll spectators, Zoom images of fans on large screens, and sampled sounds of the crowd recycled from sport video games. Confected co-presence produced simulacra of the “real” as Baudrillardian visions came to life. The sporting bubble had become even more remote. For elite sportspeople routinely isolated from the “common people”, the live sport encounter offered some sensory experience of the social – the sounds, sights and even smells of the crowd. Now the sporting bubble closed in on an already insulated and insular existence. It exposed the irony of the bubble as a sign of both privileged mobility and incarcerated athlete work, both refuge and prison. Its logic of contagion also turned a structure intended to protect those inside from those outside into, as already observed, a mechanism to manage the threat of insiders to outsiders. In Australia, as in many other countries, the populace was enjoined by governments and health authorities to help prevent the spread of Covid-19 through isolation and immobility. There were various exceptions, principally those classified as essential workers, a heterogeneous cohort ranging from supermarket shelf stackers to pharmacists. People in the cultural, leisure and sports industries, including musicians, actors, and athletes, were not counted among this crucial labour force. Indeed, the performing arts (including dance, theatre and music) were put on ice with quite devastating effects on the livelihoods and wellbeing of those involved. So, with all major sports shut down (the exception being horse racing, which received the benefit both of government subsidies and expanding online gambling revenue), sport organisations began to represent themselves as essential services that could help sustain collective mental and even spiritual wellbeing. This case was made most aggressively by Australian Rugby League Commission Chairman, Peter V’landys, in contending that “an Australia without rugby league is not Australia”. In similar vein, prominent sport and media figure Phil Gould insisted, when describing rugby league fans in Western Sydney’s Penrith, “they’re lost, because the football’s not on … . It holds their families together. People don’t understand that … . Their life begins in the second week of March, and it ends in October”. Despite misgivings about public safety and equality before the pandemic regime, sporting bubbles were allowed to form, re-form and circulate. The indefinite shutdown of the National Rugby League (NRL) on 23 March 2020 was followed after negotiation between multiple entities by its reopening on 28 May 2020. The competition included a team from another nation-state (the Warriors from Aotearoa/New Zealand) in creating an international sporting bubble on the Central Coast of New South Wales, separating them from their families and friends across the Tasman Sea. Appeals to the mental health of fans and the importance of the NRL to myths of “Australianness” notwithstanding, the league had not prudently maintained a financial reserve and so could not afford to shut down for long. Significant gambling revenue for leagues like the NRL and Australian Football League (AFL) also influenced the push to return to sport business as usual. Sport contests were needed in order to exploit the gambling opportunities – especially online and mobile – stimulated by home “confinement”. During the coronavirus lockdowns, Australians’ weekly spending on gambling went up by 142 per cent, and the NRL earned significantly more than usual from gambling revenue—potentially $10 million above forecasts for 2020. Despite the clear financial imperative at play, including heavy reliance on gambling, sporting bubble-making involved special licence. The state of Queensland, which had pursued a hard-line approach by closing its borders for most of those wishing to cross them for biographical landmark events like family funerals and even for medical treatment in border communities, became “the nation's sporting hub”. Queensland became the home of most teams of the men’s AFL (notably the women’s AFLW season having been cancelled) following a large Covid-19 second wave in Melbourne. The women’s National Netball League was based exclusively in Queensland. This state, which for the first time hosted the AFL Grand Final, deployed sport as a tool in both national sports tourism marketing and internal pre-election politics, sponsoring a documentary, The Sporting Bubble 2020, via its Tourism and Events arm. While Queensland became the larger bubble incorporating many other sporting bubbles, both the AFL and the NRL had versions of the “fly in, fly out” labour rhythms conventionally associated with the mining industry in remote and regional areas. In this instance, though, the bubble experience did not involve long stays in miners’ camps or even the one-night hotel stopovers familiar to the popular music and sport industries. Here, the bubble moved, usually by plane, to fulfil the requirements of a live sport “gig”, whereupon it was immediately returned to its more solid bubble hub or to domestic self-isolation. In the space created between disciplined expectation and deplored non-compliance, the sporting bubble inevitably became the scrutinised object and subject of scandal. Sporting Bubble Scandals While people with a very low risk of spreading Covid-19 (coming from areas with no active cases) were denied entry to Queensland for even the most serious of reasons (for example, the death of a child), images of AFL players and their families socialising and enjoying swimming at the Royal Pines Resort sporting bubble crossed our screens. Yet, despite their (players’, officials’ and families’) relative privilege and freedom of movement under the AFL Covid-Safe Plan, some players and others inside the bubble were involved in “scandals”. Most notable was the case of a drunken brawl outside a Gold Coast strip club which led to two Richmond players being “banished”, suspended for 10 matches, and the club fined $100,000. But it was not only players who breached Covid-19 bubble protocols: Collingwood coaches Nathan Buckley and Brenton Sanderson paid the $50,000 fine imposed on the club for playing tennis in Perth outside their bubble, while Richmond was fined $45,000 after Brooke Cotchin, wife of team captain Trent, posted an image to Instagram of a Gold Coast day spa that she had visited outside the “hub” (the institutionally preferred term for bubble). She was subsequently distressed after being trolled. Also of concern was the lack of physical distancing, and the range of people allowed into the sporting bubble, including babysitters, grandparents, and swimming coaches (for children). There were other cases of players being caught leaving the bubble to attend parties and sharing videos of their “antics” on social media. Biosecurity breaches of bubbles by players occurred relatively frequently, with stern words from both the AFL and NRL leaders (and their clubs) and fines accumulating in the thousands of dollars. Some people were also caught sneaking into bubbles, with Lekahni Pearce, the girlfriend of Swans player Elijah Taylor, stating that it was easy in Perth, “no security, I didn’t see a security guard” (in Barron, Stevens, and Zaczek) (a month later, outside the bubble, they had broken up and he pled guilty to unlawfully assaulting her; Ramsey). Flouting the rules, despite stern threats from government, did not lead to any bubble being popped. The sport-media machine powering sporting bubbles continued to run, the attendant emotional or health risks accepted in the name of national cultural therapy, while sponsorship, advertising and gambling revenue continued to accumulate mostly for the benefit of men. Gendering Sporting Bubbles Designed as biosecurity structures to maintain the supply of media-sport content, keep players and other vital cogs of the machine running smoothly, and to exclude Covid-19, sporting bubbles were, in their most advanced form, exclusive luxury camps that illuminated the elevated socio-cultural status of sportsmen. The ongoing inequalities between men’s and women’s sport in Australia and around the world were clearly in evidence, as well as the politics of gender whereby women are obliged to “care” and men are enabled to be “careless” – or at least to manage carefully their “duty of care”. In Australia, the only sport for women that continued during the height of the Covid-19 lockdown was netball, which operated in a bubble that was one of sacrifice rather than privilege. With minimum salaries of only $30,000 – significantly less than the lowest-paid “rookies” in the AFL – and some being mothers of small children and/or with professional jobs juggled alongside their netball careers, these elite sportswomen wanted to continue to play despite the personal inconvenience or cost (Pavlidis). Not one breach of the netballers out of the bubble was reported, indicating that they took their responsibilities with appropriate seriousness and, perhaps, were subjected to less scrutiny than the sportsmen accustomed to attracting front-page headlines. National Netball League (also known after its Queensland-based naming rights sponsor as Suncorp Super Netball) players could be regarded as fortunate to have the opportunity to be in a bubble and to participate in their competition. The NRL Women’s (NRLW) Premiership season was also completed, but only involved four teams subject to fly in, fly out and bubble arrangements, and being played in so-called curtain-raiser games for the NRL. As noted earlier, the AFLW season was truncated, despite all the prior training and sacrifice required of its players. Similarly, because of their resource advantages, the UK men’s and boy’s top six tiers of association football were allowed to continue during lockdown, compared to only two for women and girls. In the United States, inequalities between men’s and women’s sports were clearly demonstrated by the conditions afforded to those elite sportswomen inside the Women’s National Basketball Association (WNBA) sport bubble in the IMG Academy in Florida. Players shared photos of rodent traps in their rooms, insect traps under their mattresses, inedible food and blocked plumbing in their bubble accommodation. These conditions were a far cry from the luxury usually afforded elite sportsmen, including in Florida’s Walt Disney World for the men’s NBA, and is just one of the many instances of how gendered inequality was both reproduced and exacerbated by Covid-19. Bursting the Bubble As we have seen, governments and corporate leaders in sport were able to create material and metaphorical bubbles during the Covid-19 lockdown in order to transmit stadium sport contests into home spaces. The rationale was the importance of sport to national identity, belonging and the routines and rhythms of life. But for whom? Many women, who still carry the major responsibilities of “care”, found that Covid-19 intensified the affective relations and gendered inequities of “home” as a leisure site (Fullagar and Pavlidis). Rates of domestic violence surged, and many women experienced significant anxiety and depression related to the stress of home confinement and home schooling. During the pandemic, women were also more likely to experience the stress and trauma of being first responders, witnessing virus-related sickness and death as the majority of nurses and care workers. They also bore the brunt of much of the economic and employment loss during this time. Also, as noted above, livelihoods in the arts and cultural sector did not receive the benefits of the “bubble”, despite having a comparable claim to sport in contributing significantly to societal wellbeing. This sector’s workforce is substantially female, although men dominate its senior roles. Despite these inequalities, after the late March to May hiatus, many elite male sportsmen – and some sportswomen - operated in a bubble. Moving in and out of them was not easy. Life inside could be mentally stressful (especially in long stays of up to 150 days in sports like cricket), and tabloid and social media troll punishment awaited those who were caught going “over the fence”. But, life in the sporting bubble was generally preferable to the daily realities of those afflicted by the trauma arising from forced home confinement, and for whom watching moving sports images was scant compensation for compulsory immobility. The ethical foundation of the sparkly, ephemeral fantasy of the sporting bubble is questionable when it is placed in the service of a voracious “media sports cultural complex” (Rowe, Global Media Sport) that consumes sport labour power and rolls back progress in gender relations as a default response to a global pandemic. Covid-19 dramatically highlighted social inequalities in many areas of life, including medical care, work, and sport. For the small minority of people involved in sport who are elite professionals, the only thing worse than being in a sporting bubble during the pandemic was not being in one, as being outside precluded their participation. Being inside the bubble was a privilege, albeit a dubious one. But, as in wider society, not all sporting bubbles are created equal. Some are more opulent than others, and the experiences of the supporting and the supported can be very different. The surface of the sporting bubble may be impermanent, but when its interior is opened up to scrutiny, it reveals some very durable structures of inequality. Bubbles are made to burst. They are, by nature, temporary, translucent structures created as spectacles. As a form of luminosity, bubbles “allow a thing or object to exist only as a flash, sparkle or shimmer” (Deleuze, 52). In echoing Deleuze, Angela McRobbie (54) argues that luminosity “softens and disguises the regulative dynamics of neoliberal society”. The sporting bubble was designed to discharge that function for those millions rendered immobile by home confinement legislation in Australia and around the world, who were having to deal with the associated trauma, risk and disadvantage. Hence, the gender and class inequalities exacerbated by Covid-19, and the precarious and pressured lives of elite athletes, were obscured. We contend that, in the final analysis, the sporting bubble mainly serves those inside, floating tantalisingly out of reach of most of those outside who try to grasp its elusive power. Yet, it is a small group beyond who wield that power, having created bubbles as armoured vehicles to salvage any available profit in the midst of a global pandemic. References AAP. “NRL Makes Desperate Plea to Government as It Announces Season Will Go Ahead.” 7News.com.au 15 Mar. 2020. 8 Mar. 2021 &lt;https://7news.com.au/sport/rugby-league/nrl-makes-desperate-plea-to-government-as-it-announces-season-will-go-ahead-c-745711&gt;. Al Jazeera English. “Sports TV: Faking Spectators and Spectacles.” The Listening Post 26 Sep. 2020 &lt;https://www.youtube.com/watch?v=0AlD63s26sQ&amp;feature=youtu.be&amp;t=827&gt;. Barron, Jackson, Kylie Stevens, and Zoe Zaczek. “WAG Who Broke into COVID-19 Bubble for an Eight-Hour Rendezvous with Her AFL Star Boyfriend Opens Up on ‘How Easy It Was’—and Apologises for ‘Really Big Mistake’ That Cost Club $50,000.” The Daily Mail 19 Aug. 2020. 8 Mar. 2021 &lt;https://www.dailymail.co.uk/news/article-8638959/WAG-AFL-star-sacked-season-coronavirus-breach-reveals-easy-sneak-in.html&gt;. Bauman, Zygmunt. Liquid Modernity. Cambridge: Polity Press, 2000. Beck, Ulrich. Risk Society: Towards a New Modernity. London: Sage, 1992. Benedict, Jeff. Public Heroes, Private Felons: Athletes and Crimes against Women. Boston: Northeastern Uni. Press, 1999. Benfante, Agata, Marialaura di Tella, Annunziata Romeo, and Lorys Castelli. “Traumatic Stress in Healthcare Workers during COVID-19 Pandemic: A Review of the Immediate Impact.” Frontiers in Psychology 11 (23 Oct. 2020). Blaine, Lech. “The Art of Class War.” The Monthly. 17 Aug. 2020. 8 Mar. 2021 &lt;https://www.themonthly.com.au/issue/2020/august/1596204000/lech-blaine/art-class-war#mtr&gt;. Brooks, Samantha K., Rebecca K. Webster, Louise E. Smith, Lisa Woodland, Simon Wessely, Neil Greenberg, and Gideon J. Rubin. “The Psychological Impact of Quarantine and How to Reduce It: Rapid Review of the Evidence.” The Lancet 26 Feb. 2020. 8 Mar. 2021 &lt;https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)30460-8/fulltext&gt;. Caust, Jo. “Coronavirus: 3 in 4 Australians Employed in the Creative and Performing Arts Could Lose Their Jobs.” The Conversation 20 Apr. 2020. 8 Mar. 2021 &lt;https://theconversation.com/coronavirus-3-in-4-australians-employed-in-the-creative-and-performing-arts-could-lose-their-jobs-136505&gt;. Connor, James. “The Athlete as Widget: How Exploitation Explains Elite Sport.” Sport in Society 12.10 (2009): 1369–77. Courage, Cara. “Women in the Arts: Some Questions.” The Guardian 5 Mar. 2012. 8 Mar. 2021 &lt;https://www.theguardian.com/culture-professionals-network/culture-professionals-blog/2012/mar/05/women-in-the-arts-introduction&gt;. Davenport, Thomas H., and John C. Beck. The Attention Economy: Understanding the New Currency of Business. Cambridge, MA: Harvard Business Review Press, 2001. Deleuze, Gilles. Foucault. Trans. and ed. S. Hand. Minneapolis: University of Minnesota Press, 1986. Dennien, Matt, and Lydia Lynch. “Footage Shows Relaxed Scenes from AFL Hub amid Calls for Exception Overhaul.” Brisbane Times 3 Sep. 2020. 8 Mar. 2021 &lt;https://www.brisbanetimes.com.au/national/queensland/footage-shows-relaxed-scenes-from-afl-hub-amid-calls-for-exemption-overhaul-20200903-p55s74.html&gt;. Dobeson, Shanee. “Bailey Defends Qld Border Rules after Grieving Mother Denied Entry to Bury Son.” MyGC.com.au 12 Sep. 2020. 8 Mar. 2021 &lt;https://www.mygc.com.au/bailey-defends-qld-border-rules-after-grieving-mother-denied-exemption-to-bury-son&gt;. Dunn, Amelia. “Who Is Deemed an ‘Essential’ Worker under Australia’s COVID-19 Rules?” SBS News 26 Mar. 2020. 8 Mar. 2021 &lt;https://www.youtube.com/watch?v=0AlD63s26sQ&amp;feature=youtu.be&amp;t=827&gt;. Emiko. “Women’s Unpaid Care Work in Australia.” YWCA n.d. 8 Mar. 2021 &lt;https://www.ywca.org.au/opinion/womens-unpaid-care-work-in-australia&gt;. Fullagar, Simone, and Adele Pavlidis. “Thinking through the Disruptive Effects and Affects of the Coronavirus with Feminist New Materialism.” Leisure Sciences (2020). 8 Mar. 2021 &lt;https://www.tandfonline.com/doi/abs/10.1080/01490400.2020.1773996?journalCode=ulsc20&gt;. Flood, Michael, and Sue Dyson. “Sport, Athletes, and Violence against Women.” NTV Journal 4.3 (2007): 37–46. Goodwin, Sam. “AFL Boss Left Fuming over ‘Out of Control’ Quarantine Party.” Yahoo! Sport 8 Sep. 2020. 8 Mar. 2021 &lt;https://au.sports.yahoo.com/afl-2020-uproar-out-of-control-quarantine-party-224251554.html&gt;. Griffith News. “New Research Shows Why Musicians among the Hardest Hit by COVID-19.” 18 June 2020. 8 Mar. 2021 &lt;https://news.griffith.edu.au/2020/06/18/new-research-shows-why-musicians-among-the-hardest-hit-by-COVID-19&gt;. Hart, Chloe. “‘This Is the Hardest It’s Going to Get’: NZ Warriors Open Up about Relocating to Australia for NRL.” ABC News 8 Aug. 2020. 8 Mar. 2021 &lt;https://www.abc.net.au/news/2020-08-08/nz-warriors-open-up-about-relocation-to-australia-for-nrl/12531074&gt;. Hooper, James. “10 Broncos Hit with Fines as Club Cops Huge Sanction over Pub Bubble Breach.” Fox Sports 18 Aug. 2020. 8 Mar. 2021 &lt;https://www.foxsports.com.au/nrl/nrl-premiership/teams/broncos/nrl-2020-brisbane-broncos-pub-covid19-bubble-breach-fine-sanctions-who-was-at-the-pub/news-story/d3bd3c559289a8b83bc3fccbceaffe78&gt;. Hytner, Mike. “AFL Suspends Season and Cancels AFLW amid Coronavirus Crisis.” The Guardian 22 Mar. 2020. 8 Mar. 2021 &lt;https://www.theguardian.com/sport/2020/mar/22/afl-nrl-and-a-league-press-on-despite-restrictions&gt;. Jones, Wayne. “Ray of Hope for Medical Care across Border.” Echo Netdaily 14 Aug. 2020. 8 Mar. 2021 &lt;https://www.echo.net.au/2020/08/ray-of-hope-for-medical-care-across-border&gt;. Jouavel, Levi. “Women’s Football Shutdowns: ‘It’s Unfair Boys’ Academies Can Still Play’.” BBC News 10 Nov. 2020. 8 Mar. 2021 &lt;https://www.bbc.com/news/newsbeat-54876198&gt;. Keh, Andrew. “We Hope Your Cheers for This Article Are for Real.” The New York Times 16 June 2020. 8 Mar. 2021 &lt;https://www.nytimes.com/2020/06/16/sports/coronavirus-stadium-fans-crowd-noise.html&gt;. Kennedy, Else. “‘The Worst Year’: Domestic Violence Soars in Australia during COVID-19.” The Guardian 1 Dec. 2020. 8 Mar. 2021 &lt;https://www.theguardian.com/society/2020/dec/01/the-worst-year-domestic-violence-soars-in-australia-during-COVID-19&gt;. Keoghan, Sarah. “‘Everyone’s Concerned’: Players Cop 70% Pay Cut.” Sydney Morning Herald 28 Mar. 2020. 8 Mar. 2021 &lt;https://www.smh.com.au/sport/netball/everyone-s-concerned-players-cop-70-per-cent-pay-cut-20200328-p54esz.html&gt;. Knox, Malcolm. “Gambling’s Share of NRL Revenue Could Well Double: That Brings Power.” Sydney Morning Herald. 15 May 2020. 8 Mar. 2021 &lt;https://www.smh.com.au/sport/gambling-s-share-of-nrl-revenue-could-well-double-that-brings-power-20200515-p54tbg.html&gt;. McGrath, Pat. “Racing Victoria Got $16.6 Million in Emergency COVID Funding: Then Online Horse Racing Gambling Revenue Skyrocketed.” ABC News 3 Nov. 2020. 8 Mar. 2021 &lt;https://www.abc.net.au/news/2020-11-03/racing-victoria-emergency-coronavirus-COVID-funding/12838012&gt;. McRobbie, Angela. The Aftermath of Feminism: Gender, Culture and Social Change. Thousand Oaks, CA: Sage, 2009. Madden, Helena. “Lebron James’s Suite in the NBA Bubble Is Fit for a King.” Robb Report 16 Sep. 2020. 8 Mar. 2021 &lt;https://robbreport.com/travel/hotels/lebron-james-nba-bubble-suite-1234569303&gt;. Maguire, Joseph. “Sportization.” The Blackwell Encyclopedia of Sociology. Ed. George Ritzer. Oxford: Blackwell, 2007. 4710–11. Mathieson, Craig. “Michael Jordan Pierces the Bubble of Elite Sport in Juicy ESPN Doco.” Sydney Morning Herald. 13 May 2020. 8 Mar. 2021 &lt;https://www.smh.com.au/culture/tv-and-radio/michael-jordan-pierces-the-bubble-of-elite-sport-in-juicy-espn-doco-20200511-p54rwc.html&gt;. Maurice, Megan. “Australia’s Summer of Cricket during COVID Is about Money and Power—and Men”. 6 Jan. 2021. 8 Mar. 2021 &lt;https://www.theguardian.com/sport/2021/jan/06/australias-summer-of-cricket-during-COVID-is-about-money-and-power-and-men&gt;. Murphy, Catherine. “Cricket Australia Contributed to Circumstances Surrounding Ball-Tampering Scandal, Review Finds”. ABC News 20 Oct. 2018. 8 Mar. 2021 &lt;https://www.abc.net.au/news/2018-10-29/scathing-report-released-into-cricket-australia-culture/10440972&gt;. News.com.au. “How an AFL Star Wide’s Instagram Post Led to a Hefty Fine and a Journalist Being Stood Down.” NZ Herald 3 Aug. 2020. 8 Mar. 2021 &lt;https://www.nzherald.co.nz/sport/how-an-afl-star-wifes-instagram-post-led-to-a-hefty-fine-and-a-journalist-being-stood-down/7IDR4SXQ6QW5WDFBV42BK3M7YQ&gt;. Nicholson, Matthew, Anthony Kerr, and Merryn Sherwood. Sport and the Media: Managing the Nexus. 2nd ed. London: Routledge, 2015. Pavlidis, Adele. “Being Grateful: Materialising ‘Success’ in Women’s Contact Sport.” Emotion, Space and Society 35 (2020). 8 Mar. 2021 &lt;https://www.sciencedirect.com/science/article/abs/pii/S1755458620300207&gt;. Phillips, Sam. “‘The Future of the Season Is in Their Hands’: Palaszczuk’s NRL Warning.” Sydney Morning Herald 10 Aug. 2020. 8 Mar. 2021 &lt;https://www.smh.com.au/sport/nrl/the-future-of-the-season-is-in-their-hands-palaszczuk-s-nrl-warning-20200810-p55k7j.html&gt;. Pierik, Jon, and Ryan, Peter. “‘I Own the Consequences’: Stack, Coleman-Jones Apologise for Gold Coast Incident.” The Age 5 Sep. 2020. 8 Mar. 2021 &lt;https://www.theage.com.au/sport/afl/i-own-the-consequences-stack-apologises-for-gold-coast-incident-20200905-p55spq.html&gt;. Poposki, Claudia, and Louise Ayling. “AFL Star’s Wife Who Caused Uproar by Breaching Quarantine to Go to a Spa Reveals She’s Been Smashed by Vile Trolls.” Daily Mail Australia 29 Aug. 2020. 8 Mar. 2021 &lt;https://www.dailymail.co.uk/news/article-8674083/AFL-WAG-Brooke-Cotchin-breached-COVID-19-quarantine-spa-cops-abuse-trolls.html&gt;. Ramsey, Michael. “Axed Swan Spared Jail over Ex-Girlfriend Assault.” AFL.com.au 2 Dec. 2020. 8 Mar. 2021 &lt;https://www.afl.com.au/news/526677/axed-swan-spared-jail-over-ex-girlfriend-assault&gt;. Read, Brent. “The NRL Is Set to Finish the Season on a High after Stunning Financial Results.” The Australian 1 Dec. 2020. 8 Mar. 2021 &lt;https://www.theaustralian.com.au/sport/nrl/the-nrl-is-set-to-finish-the-season-on-a-high-after-stunning-financial-results/news-story/1ce9c2f9b598441d88daaa8cc2b44dc1&gt;. Reel, Justine, J., and Emily Crouch. “#MeToo: Uncovering Sexual Harassment and Assault in Sport.” Journal of Clinical Sport Psychology 13.2 (2018): 177–79. Rogers, Michael. “Buckley, Sanderson to Pay Pies’ Huge Fine for COVID Breach.” AFL.com.au 1 Aug. 2020. 8 Mar. 2021 &lt;https://www.afl.com.au/news/479118/buckley-sanderson-to-pay-pies-huge-fine-for-COVID-breach&gt;. Richardson, David, and Richard Denniss. “Gender Experiences during the COVID-19 Lockdown: Women Lose from COVID-19, Men to Gain from Stimulus.” The Australia Institute June 2020. 8 Mar. 2021 &lt;https://australiainstitute.org.au/report/gender-experiences-during-the-COVID-19-lockdown&gt;. Rowe, David. “All Sport Is Global: A Hard Lesson from the Pandemic.” Open Forum 28 Mar. 2020. 8 Mar. 2021 &lt;https://www.openforum.com.au/all-sport-is-global-a-hard-lesson-from-the-pandemic&gt;. ———. “And the Winner Is … Television: Spectacle and Sport in a Pandemic.” Open Forum 19 Sep. 2020. 8 Mar. 2021 &lt;https://www.openforum.com.au/and-the-winner-istelevision-spectacle-and-sport-in-a-pandemic&gt;. ———. Global Media Sport: Flows, Forms and Futures. London: Bloomsbury, 2011. ———. “Scandals and Sport.” Routledge Companion to Media and Scandal. Eds. Howard Tumber and Silvio Waisbord. London: Routledge, 2019. 324–32. ———. “Subjecting Pandemic Sport to a Sociological Procedure.” Journal of Sociology 56.4 (2020): 704–13. Schout, David. “Cricket Prepares for Mental Health Challenges Thrown Up by Bubble Life.” The Guardian 8 Nov. 2020. 8 Mar. 2021 &lt;https://www.theguardian.com/sport/2020/nov/08/cricket-prepares-for-mental-health-challenges-thrown-up-by-bubble-life&gt;. Spaaij, Ramón. Sport and Social Mobility: Crossing Boundaries. London: Routledge, 2011. The Sporting Bubble. Dir. Peter Dickson. Nine Network Australia, 2020. Swanston, Tim. “With Coronavirus Limiting Interstate Movement, Queensland Is the Nation’s Sporting Hub—Is That Really Safe?” ABC News 29 Aug. 2020. 8 Mar. 2021 &lt;https://www.abc.net.au/news/2020-08-29/coronavirus-queensland-rules-for-sports-teams-explainer/12542634&gt;. Toffoletti, Kim. “How Is Gender-Based Violence Covered in the Sporting News? An Account of the Australian Football League Sex Scandal.” Women's Studies International Forum 30.5 (2007): 427–38. Urry, John. Mobilities. Cambridge: Polity Press, 2007. Walter, Brad. “From Shutdown to Restart: How NRL Walked Tightrope to Get Season Going Again.” NRL.com 25 May 2020. 8 Mar. 2021 &lt;https://www.nrl.com/news/2020/05/25/from-shutdown-to-restart-how-nrl-walked-tightrope-to-get-season-going-again&gt;. Wade, Lisa. “Rape on Campus: Athletes, Status, and the Sexual Assault Crisis.” The Conversation 7 Mar. 2017. 8 Mar. 2021 &lt;https://theconversation.com/rape-on-campus-athletes-status-and-the-sexual-assault-crisis-72255&gt;. Webster, Andrew. “Sydney Roosters’ Mitchell Pearce Involved in a Drunken Incident with a Dog? And Your Point Is ...?” Sydney Morning Herald 28 Jan. 2016. 8 Mar. 2021 &lt;https://www.smh.com.au/sport/nrl/sydney-roosters-mitchell-pearce-involved-in-a-drunken-incident-with-a-dog-and-your-point-is--20160127-gmfemh.html&gt;. Whittaker, Troy. “Three-Peat Not Driving Broncos in NRLW Grand Final.” NRL.com 24 Oct. 2020. 8 Mar. 2021 &lt;https://www.nrl.com/news/2020/10/24/three-peat-not-driving-broncos-in-nrlw-grand-final&gt;. Yahoo! Sport Staff. “‘Not Okay’: Uproar over ‘Disgusting’ Find inside Quarantine.” Yahoo! Sport 9 July 2020. 8 Mar. 2021 &lt;https://au.sports.yahoo.com/wnba-disturbing-conditions-coronavirus-bubble-slammed-003557243.html&gt;.

Introduction: Our current obsession with the lives of others “Biography—that is to say, our creative and non-fictional output devoted to recording and interpreting real lives—has enjoyed an extraordinary renaissance in recent years,” writes Nigel Hamilton in Biography: A Brief History (1). Ian Donaldson agrees that biography is back in fashion: “Once neglected within the academy and relegated to the dustier recesses of public bookstores, biography has made a notable return over recent years, emerging, somewhat surprisingly, as a new cultural phenomenon, and a new academic adventure” (23). For over a decade now, commentators having been making similar observations about our obsession with the intimacies of individual people’s lives. In a lecture in 1994, Justin Kaplan asserted the West was “a culture of biography” (qtd. in Salwak 1) and more recent research findings by John Feather and Hazel Woodbridge affirm that “the undiminished human curiosity about other peoples lives is clearly reflected in the popularity of autobiographies and biographies” (218). At least in relation to television, this assertion seems valid. In Australia, as in the USA and the UK, reality and other biographically based television shows have taken over from drama in both the numbers of shows produced and the viewers these shows attract, and these forms are also popular in Canada (see, for instance, Morreale on The Osbournes). In 2007, the program Biography celebrated its twentieth anniversary season to become one of the longest running documentary series on American television; so successful that in 1999 it was spun off into its own eponymous channel (Rak; Dempsey). Premiered in May 1996, Australian Story—which aims to utilise a “personal approach” to biographical storytelling—has won a significant viewership, critical acclaim and professional recognition (ABC). It can also be posited that the real home movies viewers submit to such programs as Australia’s Favourite Home Videos, and “chat” or “confessional” television are further reflections of a general mania for biographical detail (see Douglas), no matter how fragmented, sensationalized, or even inane and cruel. A recent example of the latter, the USA-produced The Moment of Truth, has contestants answering personal questions under polygraph examination and then again in front of an audience including close relatives and friends—the more “truthful” their answers (and often, the more humiliated and/or distressed contestants are willing to be), the more money they can win. Away from television, but offering further evidence of this interest are the growing readerships for personally oriented weblogs and networking sites such as MySpace and Facebook (Grossman), individual profiles and interviews in periodical publications, and the recently widely revived newspaper obituary column (Starck). Adult and community education organisations run short courses on researching and writing auto/biographical forms and, across Western countries, the family history/genealogy sections of many local, state, and national libraries have been upgraded to meet the increasing demand for these services. Academically, journals and e-mail discussion lists have been established on the topics of biography and autobiography, and North American, British, and Australian universities offer undergraduate and postgraduate courses in life writing. The commonly aired wisdom is that published life writing in its many text-based forms (biography, autobiography, memoir, diaries, and collections of personal letters) is enjoying unprecedented popularity. It is our purpose to examine this proposition. Methodological problems There are a number of problems involved in investigating genre popularity, growth, and decline in publishing. Firstly, it is not easy to gain access to detailed statistics, which are usually only available within the industry. Secondly, it is difficult to ascertain how publishing statistics are gathered and what they report (Eliot). There is the question of whether bestselling booklists reflect actual book sales or are manipulated marketing tools (Miller), although the move from surveys of booksellers to electronic reporting at point of sale in new publishing lists such as BookScan will hopefully obviate this problem. Thirdly, some publishing lists categorise by subject and form, some by subject only, and some do not categorise at all. This means that in any analysis of these statistics, a decision has to be made whether to use the publishing list’s system or impose a different mode. If the publishing list is taken at face value, the question arises of whether to use categorisation by form or by subject. Fourthly, there is the bedeviling issue of terminology. Traditionally, there reigned a simple dualism in the terminology applied to forms of telling the true story of an actual life: biography and autobiography. Publishing lists that categorise their books, such as BookScan, have retained it. But with postmodern recognition of the presence of the biographer in a biography and of the presence of other subjects in an autobiography, the dichotomy proves false. There is the further problem of how to categorise memoirs, diaries, and letters. In the academic arena, the term “life writing” has emerged to describe the field as a whole. Within the genre of life writing, there are, however, still recognised sub-genres. Academic definitions vary, but generally a biography is understood to be a scholarly study of a subject who is not the writer; an autobiography is the story of a entire life written by its subject; while a memoir is a segment or particular focus of that life told, again, by its own subject. These terms are, however, often used interchangeably even by significant institutions such the USA Library of Congress, which utilises the term “biography” for all. Different commentators also use differing definitions. Hamilton uses the term “biography” to include all forms of life writing. Donaldson discusses how the term has been co-opted to include biographies of place such as Peter Ackroyd’s London: The Biography (2000) and of things such as Lizzie Collingham’s Curry: A Biography (2005). This reflects, of course, a writing/publishing world in which non-fiction stories of places, creatures, and even foodstuffs are called biographies, presumably in the belief that this will make them more saleable. The situation is further complicated by the emergence of hybrid publishing forms such as, for instance, the “memoir-with-recipes” or “food memoir” (Brien, Rutherford and Williamson). Are such books to be classified as autobiography or put in the “cookery/food &amp; drink” category? We mention in passing the further confusion caused by novels with a subtitle of The Biography such as Virginia Woolf’s Orlando. The fifth methodological problem that needs to be mentioned is the increasing globalisation of the publishing industry, which raises questions about the validity of the majority of studies available (including those cited herein) which are nationally based. Whether book sales reflect what is actually read (and by whom), raises of course another set of questions altogether. Methodology In our exploration, we were fundamentally concerned with two questions. Is life writing as popular as claimed? And, if it is, is this a new phenomenon? To answer these questions, we examined a range of available sources. We began with the non-fiction bestseller lists in Publishers Weekly (a respected American trade magazine aimed at publishers, librarians, booksellers, and literary agents that claims to be international in scope) from their inception in 1912 to the present time. We hoped that this data could provide a longitudinal perspective. The term bestseller was coined by Publishers Weekly when it began publishing its lists in 1912; although the first list of popular American books actually appeared in The Bookman (New York) in 1895, based itself on lists appearing in London’s The Bookman since 1891 (Bassett and Walter 206). The Publishers Weekly lists are the best source of longitudinal information as the currently widely cited New York Times listings did not appear till 1942, with the Wall Street Journal a late entry into the field in 1994. We then examined a number of sources of more recent statistics. We looked at the bestseller lists from the USA-based Amazon.com online bookseller; recent research on bestsellers in Britain; and lists from Nielsen BookScan Australia, which claims to tally some 85% or more of books sold in Australia, wherever they are published. In addition to the reservations expressed above, caveats must be aired in relation to these sources. While Publishers Weekly claims to be an international publication, it largely reflects the North American publishing scene and especially that of the USA. Although available internationally, Amazon.com also has its own national sites—such as Amazon.co.uk—not considered here. It also caters to a “specific computer-literate, credit-able clientele” (Gutjahr: 219) and has an unashamedly commercial focus, within which all the information generated must be considered. In our analysis of the material studied, we will use “life writing” as a genre term. When it comes to analysis of the lists, we have broken down the genre of life writing into biography and autobiography, incorporating memoir, letters, and diaries under autobiography. This is consistent with the use of the terminology in BookScan. Although we have broken down the genre in this way, it is the overall picture with regard to life writing that is our concern. It is beyond the scope of this paper to offer a detailed analysis of whether, within life writing, further distinctions should be drawn. Publishers Weekly: 1912 to 2006 1912 saw the first list of the 10 bestselling non-fiction titles in Publishers Weekly. It featured two life writing texts, being headed by an autobiography, The Promised Land by Russian Jewish immigrant Mary Antin, and concluding with Albert Bigelow Paine’s six-volume biography, Mark Twain. The Publishers Weekly lists do not categorise non-fiction titles by either form or subject, so the classifications below are our own with memoir classified as autobiography. In a decade-by-decade tally of these listings, there were 3 biographies and 20 autobiographies in the lists between 1912 and 1919; 24 biographies and 21 autobiographies in the 1920s; 13 biographies and 40 autobiographies in the 1930s; 8 biographies and 46 biographies in the 1940s; 4 biographies and 14 autobiographies in the 1950s; 11 biographies and 13 autobiographies in the 1960s; 6 biographies and 11 autobiographies in the 1970s; 3 biographies and 19 autobiographies in the 1980s; 5 biographies and 17 autobiographies in the 1990s; and 2 biographies and 7 autobiographies from 2000 up until the end of 2006. See Appendix 1 for the relevant titles and authors. Breaking down the most recent figures for 1990–2006, we find a not radically different range of figures and trends across years in the contemporary environment. The validity of looking only at the top ten books sold in any year is, of course, questionable, as are all the issues regarding sources discussed above. But one thing is certain in terms of our inquiry. There is no upwards curve obvious here. If anything, the decade break-down suggests that sales are trending downwards. This is in keeping with the findings of Michael Korda, in his history of twentieth-century bestsellers. He suggests a consistent longitudinal picture across all genres: In every decade, from 1900 to the end of the twentieth century, people have been reliably attracted to the same kind of books […] Certain kinds of popular fiction always do well, as do diet books […] self-help books, celebrity memoirs, sensationalist scientific or religious speculation, stories about pets, medical advice (particularly on the subjects of sex, longevity, and child rearing), folksy wisdom and/or humour, and the American Civil War (xvii). Amazon.com since 2000 The USA-based Amazon.com online bookselling site provides listings of its own top 50 bestsellers since 2000, although only the top 14 bestsellers are recorded for 2001. As fiction and non-fiction are not separated out on these lists and no genre categories are specified, we have again made our own decisions about what books fall into the category of life writing. Generally, we erred on the side of inclusion. (See Appendix 2.) However, when it came to books dealing with political events, we excluded books dealing with specific aspects of political practice/policy. This meant excluding books on, for instance, George Bush’s so-called ‘war on terror,’ of which there were a number of bestsellers listed. In summary, these listings reveal that of the top 364 books sold by Amazon from 2000 to 2007, 46 (or some 12.6%) were, according to our judgment, either biographical or autobiographical texts. This is not far from the 10% of the 1912 Publishers Weekly listing, although, as above, the proportion of bestsellers that can be classified as life writing varied dramatically from year to year, with no discernible pattern of peaks and troughs. This proportion tallied to 4% auto/biographies in 2000, 14% in 2001, 10% in 2002, 18% in 2003 and 2004, 4% in 2005, 14% in 2006 and 20% in 2007. This could suggest a rising trend, although it does not offer any consistent trend data to suggest sales figures may either continue to grow, or fall again, in 2008 or afterwards. Looking at the particular texts in these lists (see Appendix 2) also suggests that there is no general trend in the popularity of life writing in relation to other genres. For instance, in these listings in Amazon.com, life writing texts only rarely figure in the top 10 books sold in any year. So rarely indeed, that from 2001 there were only five in this category. In 2001, John Adams by David McCullough was the best selling book of the year; in 2003, Hillary Clinton’s autobiographical Living History was 7th; in 2004, My Life by Bill Clinton reached number 1; in 2006, Nora Ephron’s I Feel Bad About My Neck: and Other Thoughts on Being a Woman was 9th; and in 2007, Ishmael Beah’s discredited A Long Way Gone: Memoirs of a Boy Soldier came in at 8th. Apart from McCulloch’s biography of Adams, all the above are autobiographical texts, while the focus on leading political figures is notable. Britain: Feather and Woodbridge With regard to the British situation, we did not have actual lists and relied on recent analysis. John Feather and Hazel Woodbridge find considerably higher levels for life writing in Britain than above with, from 1998 to 2005, 28% of British published non-fiction comprising autobiography, while 8% of hardback and 5% of paperback non-fiction was biography (2007). Furthermore, although Feather and Woodbridge agree with commentators that life writing is currently popular, they do not agree that this is a growth state, finding the popularity of life writing “essentially unchanged” since their previous study, which covered 1979 to the early 1990s (Feather and Reid). Australia: Nielsen BookScan 2006 and 2007 In the Australian publishing industry, where producing books remains an ‘expensive, risky endeavour which is increasingly market driven’ (Galligan 36) and ‘an inherently complex activity’ (Carter and Galligan 4), the most recent Australian Bureau of Statistics figures reveal that the total numbers of books sold in Australia has remained relatively static over the past decade (130.6 million in the financial year 1995–96 and 128.8 million in 2003–04) (ABS). During this time, however, sales volumes of non-fiction publications have grown markedly, with a trend towards “non-fiction, mass market and predictable” books (Corporall 41) resulting in general non-fiction sales in 2003–2004 outselling general fiction by factors as high as ten depending on the format—hard- or paperback, and trade or mass market paperback (ABS 2005). However, while non-fiction has increased in popularity in Australia, the same does not seem to hold true for life writing. Here, in utilising data for the top 5,000 selling non-fiction books in both 2006 and 2007, we are relying on Nielsen BookScan’s categorisation of texts as either biography or autobiography. In 2006, no works of life writing made the top 10 books sold in Australia. In looking at the top 100 books sold for 2006, in some cases the subjects of these works vary markedly from those extracted from the Amazon.com listings. In Australia in 2006, life writing makes its first appearance at number 14 with convicted drug smuggler Schapelle Corby’s My Story. This is followed by another My Story at 25, this time by retired Australian army chief, Peter Cosgrove. Jonestown: The Power and Myth of Alan Jones comes in at 34 for the Australian broadcaster’s biographer Chris Masters; the biography, The Innocent Man by John Grisham at 38 and Li Cunxin’s autobiographical Mao’s Last Dancer at 45. Australian Susan Duncan’s memoir of coping with personal loss, Salvation Creek: An Unexpected Life makes 50; bestselling USA travel writer Bill Bryson’s autobiographical memoir of his childhood The Life and Times of the Thunderbolt Kid 69; Mandela: The Authorised Portrait by Rosalind Coward, 79; and Joanne Lees’s memoir of dealing with her kidnapping, the murder of her partner and the justice system in Australia’s Northern Territory, No Turning Back, 89. These books reveal a market preference for autobiographical writing, and an almost even split between Australian and overseas subjects in 2006. 2007 similarly saw no life writing in the top 10. The books in the top 100 sales reveal a downward trend, with fewer titles making this band overall. In 2007, Terri Irwin’s memoir of life with her famous husband, wildlife warrior Steve Irwin, My Steve, came in at number 26; musician Andrew Johns’s memoir of mental illness, The Two of Me, at 37; Ayaan Hirst Ali’s autobiography Infidel at 39; John Grogan’s biography/memoir, Marley and Me: Life and Love with the World’s Worst Dog, at 42; Sally Collings’s biography of the inspirational young survivor Sophie Delezio, Sophie’s Journey, at 51; and Elizabeth Gilbert’s hybrid food, self-help and travel memoir, Eat, Pray, Love: One Woman’s Search for Everything at 82. Mao’s Last Dancer, published the year before, remained in the top 100 in 2007 at 87. When moving to a consideration of the top 5,000 books sold in Australia in 2006, BookScan reveals only 62 books categorised as life writing in the top 1,000, and only 222 in the top 5,000 (with 34 titles between 1,000 and 1,999, 45 between 2,000 and 2,999, 48 between 3,000 and 3,999, and 33 between 4,000 and 5,000). 2007 shows a similar total of 235 life writing texts in the top 5,000 bestselling books (75 titles in the first 1,000, 27 between 1,000 and 1,999, 51 between 2,000 and 2,999, 39 between 3,000 and 3,999, and 43 between 4,000 and 5,000). In both years, 2006 and 2007, life writing thus not only constituted only some 4% of the bestselling 5,000 titles in Australia, it also showed only minimal change between these years and, therefore, no significant growth. Conclusions Our investigation using various instruments that claim to reflect levels of book sales reveals that Western readers’ willingness to purchase published life writing has not changed significantly over the past century. We find no evidence of either a short, or longer, term growth or boom in sales in such books. Instead, it appears that what has been widely heralded as a new golden age of life writing may well be more the result of an expanded understanding of what is included in the genre than an increased interest in it by either book readers or publishers. What recent years do appear to have seen, however, is a significantly increased interest by public commentators, critics, and academics in this genre of writing. We have also discovered that the issue of our current obsession with the lives of others tends to be discussed in academic as well as popular fora as if what applies to one sub-genre or production form applies to another: if biography is popular, then autobiography will also be, and vice versa. If reality television programming is attracting viewers, then readers will be flocking to life writing as well. Our investigation reveals that such propositions are questionable, and that there is significant research to be completed in mapping such audiences against each other. This work has also highlighted the difficulty of separating out the categories of written texts in publishing studies, firstly in terms of determining what falls within the category of life writing as distinct from other forms of non-fiction (the hybrid problem) and, secondly, in terms of separating out the categories within life writing. Although we have continued to use the terms biography and autobiography as sub-genres, we are aware that they are less useful as descriptors than they are often assumed to be. In order to obtain a more complete and accurate picture, publishing categories may need to be agreed upon, redefined and utilised across the publishing industry and within academia. This is of particular importance in the light of the suggestions (from total sales volumes) that the audiences for books are limited, and therefore the rise of one sub-genre may be directly responsible for the fall of another. Bair argues, for example, that in the 1980s and 1990s, the popularity of what she categorises as memoir had direct repercussions on the numbers of birth-to-death biographies that were commissioned, contracted, and published as “sales and marketing staffs conclude[d] that readers don’t want a full-scale life any more” (17). Finally, although we have highlighted the difficulty of using publishing statistics when there is no common understanding as to what such data is reporting, we hope this study shows that the utilisation of such material does add a depth to such enquiries, especially in interrogating the anecdotal evidence that is often quoted as data in publishing and other studies. Appendix 1 Publishers Weekly listings 1990–1999 1990 included two autobiographies, Bo Knows Bo by professional athlete Bo Jackson (with Dick Schaap) and Ronald Reagan’s An America Life: An Autobiography. In 1991, there were further examples of life writing with unimaginative titles, Me: Stories of My Life by Katherine Hepburn, Nancy Reagan: The Unauthorized Biography by Kitty Kelley, and Under Fire: An American Story by Oliver North with William Novak; as indeed there were again in 1992 with It Doesn’t Take a Hero: The Autobiography of Norman Schwarzkopf, Sam Walton: Made in America, the autobiography of the founder of Wal-Mart, Diana: Her True Story by Andrew Morton, Every Living Thing, yet another veterinary outpouring from James Herriot, and Truman by David McCullough. In 1993, radio shock-jock Howard Stern was successful with the autobiographical Private Parts, as was Betty Eadie with her detailed recounting of her alleged near-death experience, Embraced by the Light. Eadie’s book remained on the list in 1994 next to Don’t Stand too Close to a Naked Man, comedian Tim Allen’s autobiography. Flag-waving titles continue in 1995 with Colin Powell’s My American Journey, and Miss America, Howard Stern’s follow-up to Private Parts. 1996 saw two autobiographical works, basketball superstar Dennis Rodman’s Bad as I Wanna Be and figure-skater, Ekaterina Gordeeva’s (with EM Swift) My Sergei: A Love Story. In 1997, Diana: Her True Story returns to the top 10, joining Frank McCourt’s Angela’s Ashes and prolific biographer Kitty Kelly’s The Royals, while in 1998, there is only the part-autobiography, part travel-writing A Pirate Looks at Fifty, by musician Jimmy Buffet. There is no biography or autobiography included in either the 1999 or 2000 top 10 lists in Publishers Weekly, nor in that for 2005. In 2001, David McCullough’s biography John Adams and Jack Welch’s business memoir Jack: Straight from the Gut featured. In 2002, Let’s Roll! Lisa Beamer’s tribute to her husband, one of the heroes of 9/11, written with Ken Abraham, joined Rudolph Giuliani’s autobiography, Leadership. 2003 saw Hillary Clinton’s autobiography Living History and Paul Burrell’s memoir of his time as Princess Diana’s butler, A Royal Duty, on the list. In 2004, it was Bill Clinton’s turn with My Life. In 2006, we find John Grisham’s true crime (arguably a biography), The Innocent Man, at the top, Grogan’s Marley and Me at number three, and the autobiographical The Audacity of Hope by Barack Obama in fourth place. Appendix 2 Amazon.com listings since 2000 In 2000, there were only two auto/biographies in the top Amazon 50 bestsellers with Lance Armstrong’s It’s Not about the Bike: My Journey Back to Life about his battle with cancer at 20, and Dave Eggers’s self-consciously fictionalised memoir, A Heartbreaking Work of Staggering Genius at 32. In 2001, only the top 14 bestsellers were recorded. At number 1 is John Adams by David McCullough and, at 11, Jack: Straight from the Gut by USA golfer Jack Welch. In 2002, Leadership by Rudolph Giuliani was at 12; Master of the Senate: The Years of Lyndon Johnson by Robert Caro at 29; Portrait of a Killer: Jack the Ripper by Patricia Cornwell at 42; Blinded by the Right: The Conscience of an Ex-Conservative by David Brock at 48; and Louis Gerstner’s autobiographical Who Says Elephants Can’t Dance: Inside IBM’s Historic Turnaround at 50. In 2003, Living History by Hillary Clinton was 7th; Benjamin Franklin: An American Life by Walter Isaacson 14th; Dereliction of Duty: The Eyewitness Account of How President Bill Clinton Endangered America’s Long-Term National Security by Robert Patterson 20th; Under the Banner of Heaven: A Story of Violent Faith by Jon Krakauer 32nd; Leap of Faith: Memoirs of an Unexpected Life by Queen Noor of Jordan 33rd; Kate Remembered, Scott Berg’s biography of Katharine Hepburn, 37th; Who’s your Caddy?: Looping for the Great, Near Great and Reprobates of Golf by Rick Reilly 39th; The Teammates: A Portrait of a Friendship about a winning baseball team by David Halberstam 42nd; and Every Second Counts by Lance Armstrong 49th. In 2004, My Life by Bill Clinton was the best selling book of the year; American Soldier by General Tommy Franks was 16th; Kevin Phillips’s American Dynasty: Aristocracy, Fortune and the Politics of Deceit in the House of Bush 18th; Timothy Russert’s Big Russ and Me: Father and Son. Lessons of Life 20th; Tony Hendra’s Father Joe: The Man who Saved my Soul 23rd; Ron Chernow’s Alexander Hamilton 27th; Cokie Roberts’s Founding Mothers: The Women Who Raised our Nation 31st; Kitty Kelley’s The Family: The Real Story of the Bush Dynasty 42nd; and Chronicles, Volume 1 by Bob Dylan was 43rd. In 2005, auto/biographical texts were well down the list with only The Year of Magical Thinking by Joan Didion at 45 and The Glass Castle: A Memoir by Jeanette Walls at 49. In 2006, there was a resurgence of life writing with Nora Ephron’s I Feel Bad About My Neck: and Other Thoughts on Being a Woman at 9; Grisham’s The Innocent Man at 12; Bill Buford’s food memoir Heat: an Amateur’s Adventures as Kitchen Slave, Line Cook, Pasta-Maker, and Apprentice to a Dante-Quoting Butcher in Tuscany at 23; more food writing with Julia Child’s My Life in France at 29; Immaculée Ilibagiza’s Left to Tell: Discovering God amidst the Rwandan Holocaust at 30; CNN anchor Anderson Cooper’s Dispatches from the Edge: A Memoir of War, Disasters and Survival at 43; and Isabella Hatkoff’s Owen &amp; Mzee: The True Story of a Remarkable Friendship (between a baby hippo and a giant tortoise) at 44. In 2007, Ishmael Beah’s discredited A Long Way Gone: Memoirs of a Boy Soldier came in at 8; Walter Isaacson’s Einstein: His Life and Universe 13; Ayaan Hirst Ali’s autobiography of her life in Muslim society, Infidel, 18; The Reagan Diaries 25; Jesus of Nazareth by Pope Benedict XVI 29; Mother Teresa: Come be my Light 36; Clapton: The Autobiography 40; Tina Brown’s The Diana Chronicles 45; Tony Dungy’s Quiet Strength: The Principles, Practices &amp; Priorities of a Winning Life 47; and Daniel Tammet’s Born on a Blue Day: Inside the Extraordinary Mind of an Autistic Savant at 49. Acknowledgements A sincere thank you to Michael Webster at RMIT for assistance with access to Nielsen BookScan statistics, and to the reviewers of this article for their insightful comments. Any errors are, of course, our own. References Australian Broadcasting Commission (ABC). “About Us.” Australian Story 2008. 1 June 2008. ‹http://www.abc.net.au/austory/aboutus.htm&gt;. Australian Bureau of Statistics. “1363.0 Book Publishers, Australia, 2003–04.” 2005. 1 June 2008 ‹http://www.abs.gov.au/ausstats/abs@.nsf/mf/1363.0&gt;. Bair, Deirdre “Too Much S &amp; M.” Sydney Morning Herald 10–11 Sept. 2005: 17. Basset, Troy J., and Christina M. Walter. “Booksellers and Bestsellers: British Book Sales as Documented by The Bookman, 1891–1906.” Book History 4 (2001): 205–36. Brien, Donna Lee, Leonie Rutherford, and Rosemary Williamson. “Hearth and Hotmail: The Domestic Sphere as Commodity and Community in Cyberspace.” M/C Journal 10.4 (2007). 1 June 2008 ‹http://journal.media-culture.org.au/0708/10-brien.php&gt;. Carter, David, and Anne Galligan. “Introduction.” Making Books: Contemporary Australian Publishing. St Lucia: U of Queensland P, 2007. 1–14. Corporall, Glenda. Project Octopus: Report Commissioned by the Australian Society of Authors. Sydney: Australian Society of Authors, 1990. Dempsey, John “Biography Rewrite: A&amp;E’s Signature Series Heads to Sib Net.” Variety 4 Jun. 2006. 1 June 2008 ‹http://www.variety.com/article/VR1117944601.html?categoryid=1238&amp;cs=1&gt;. Donaldson, Ian. “Matters of Life and Death: The Return of Biography.” Australian Book Review 286 (Nov. 2006): 23–29. Douglas, Kate. “‘Blurbing’ Biographical: Authorship and Autobiography.” Biography 24.4 (2001): 806–26. Eliot, Simon. “Very Necessary but not Sufficient: A Personal View of Quantitative Analysis in Book History.” Book History 5 (2002): 283–93. Feather, John, and Hazel Woodbridge. “Bestsellers in the British Book Industry.” Publishing Research Quarterly 23.3 (Sept. 2007): 210–23. Feather, JP, and M Reid. “Bestsellers and the British Book Industry.” Publishing Research Quarterly 11.1 (1995): 57–72. Galligan, Anne. “Living in the Marketplace: Publishing in the 1990s.” Publishing Studies 7 (1999): 36–44. Grossman, Lev. “Time’s Person of the Year: You.” Time 13 Dec. 2006. Online edition. 1 June 2008 ‹http://www.time.com/time/magazine/article/0%2C9171%2C1569514%2C00.html&gt;. Gutjahr, Paul C. “No Longer Left Behind: Amazon.com, Reader Response, and the Changing Fortunes of the Christian Novel in America.” Book History 5 (2002): 209–36. Hamilton, Nigel. Biography: A Brief History. Cambridge, MA: Harvard UP, 2007. Kaplan, Justin. “A Culture of Biography.” The Literary Biography: Problems and Solutions. Ed. Dale Salwak. Basingstoke: Macmillan, 1996. 1–11. Korda, Michael. Making the List: A Cultural History of the American Bestseller 1900–1999. New York: Barnes &amp; Noble, 2001. Miller, Laura J. “The Bestseller List as Marketing Tool and Historical Fiction.” Book History 3 (2000): 286–304. Morreale, Joanne. “Revisiting The Osbournes: The Hybrid Reality-Sitcom.” Journal of Film and Video 55.1 (Spring 2003): 3–15. Rak, Julie. “Bio-Power: CBC Television’s Life &amp; Times and A&amp;E Network’s Biography on A&amp;E.” LifeWriting 1.2 (2005): 1–18. Starck, Nigel. “Capturing Life—Not Death: A Case For Burying The Posthumous Parallax.” Text: The Journal of the Australian Association of Writing Programs 5.2 (2001). 1 June 2008 ‹http://www.textjournal.com.au/oct01/starck.htm&gt;.

<strong>Dolomatov S.I., Zukow W. </strong><strong>Эпигенетика почек</strong><strong> = Kidney</strong><strong>s</strong><strong> epigenetics</strong><strong>. </strong><strong>RSW. Radom,</strong><strong> 144 </strong><strong>p. ISBN </strong><strong>9780359774524</strong><strong>.</strong><strong> DOI </strong><strong>http://dx.doi.org/10.5281/zenodo.3270699</strong><strong> PBN Poland </strong><strong>https://pbn.nauka.gov.pl/sedno-webapp/works/917606</strong> &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; <strong>Radomska Szkoła Wyższa w Radomiu, Radom, Poland</strong> &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; <strong>С.И. Доломатов, В.А. Жуков </strong> <strong>S.I. </strong><strong>Dolomatov, </strong><strong>W. </strong><strong>Zukow</strong> &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; <strong>Эпигенетика почек</strong> <strong>Kidneys epigenetics</strong> &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; <strong>Radom, 2019</strong> <strong>Dolomatov S.I., Zukow W. </strong><strong>Эпигенетика почек</strong><strong> = Kidneys epigenetics</strong><strong>. </strong><strong>RSW. Radom,</strong><strong> 144 </strong><strong>p. ISBN </strong><strong>9780359774524</strong><strong>.</strong><strong> DOI </strong><strong>http://dx.doi.org/10.5281/zenodo.3270699</strong><strong> PBN Poland </strong><strong>https://pbn.nauka.gov.pl/sedno-webapp/works/917606</strong> &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; <strong>Radomska Szkoła Wyższa w Radomiu, Radom, Poland</strong> &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; <strong>С.И. Доломатов, В.А. Жуков </strong> <strong>S.I. </strong><strong>Dolomatov, </strong><strong>W. </strong><strong>Zukow</strong> &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; <strong>Эпигенетика почек</strong> <strong>Kidneys epigenetics</strong> &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; <strong>Radom, 2019</strong> <strong>Dolomatov S.I., Zukow W. </strong><strong>Эпигенетика почек</strong><strong> = Kidneys epigenetics</strong><strong>. </strong><strong>RSW. Radom,</strong><strong> 144 </strong><strong>p. ISBN </strong><strong>9780359774524</strong><strong>.</strong><strong> DOI </strong><strong>http://dx.doi.org/10.5281/zenodo.3270699</strong><strong> PBN Poland </strong><strong>https://pbn.nauka.gov.pl/sedno-webapp/works/917606</strong> &nbsp; <strong>Reviewers:</strong> <strong>dr hab. </strong><strong>R</strong><strong>. </strong><strong>Muszkieta, prof. nadzw.</strong><strong> (</strong><strong>Poland</strong><strong>)</strong> <strong>dr hab. M</strong><strong>. </strong><strong>Napierała, prof. nadzw</strong><strong> (</strong><strong>Poland</strong><strong>)</strong> &nbsp; <strong>АННОТАЦИЯ</strong> В книге представлены сведения о роли эпигенетических механизмов в системе контроля функции почек в норме и при патологии. Результаты анализа роли эпигенетического контроля экспрессии генов транспортных и регуляторных белков почки в норме указывают, во-первых, на высокую пластичность процессов изменения экспрессии генов. Во-вторых, иллюстрируют их способность адекватно реагировать на изменения параметров гомеостатических функций почек, что, в свою очередь, позволяет рассматривать данные процессы в качестве еще одного звена управления деятельностью органа наряду с нейро-эндокринными и внутриорганными уровнями гуморального контроля водно-солевого баланса организма. Приведены факты, подчеркивающие вовлеченность гуморальных факторов системного действия и внутрипочечных систем гуморального контроля в процессы эпигенетической перестройки экспрессии генов ренальной паренхимы в норме и при патологии. Также анализируется роль факторов среды в регуляции экспрессии генов. &nbsp; <strong>ANNOTATION</strong> The book provides information about the role of epigenetic mechanisms in the system of monitoring renal function in normal and pathological conditions. The results of the analysis of the role of epigenetic control of gene expression of kidney transport and regulatory proteins normally indicate, firstly, the high plasticity of gene expression change processes. Secondly, they illustrate their ability to adequately respond to changes in the parameters of homeostatic functions of the kidneys, which, in turn, makes it possible to consider these processes as another element in the management of organ activity along with neuro-endocrine and intraorgan levels of the humoral control of the body&rsquo;s water-salt balance. The facts that emphasize the involvement of humoral factors of systemic action and intrarenal systems of humoral control in the processes of epigenetic rearrangement of the expression of renal parenchyma genes in normal and pathological conditions are presented. The role of environmental factors in the regulation of gene expression is also analyzed. &nbsp; <strong>Ключевые слова: почки, эпигенетика.</strong> <strong>Key words: kidneys, epigenetics.</strong> &nbsp; &copy; The Author(s) 2019. This monograph is published with Open Access. Open Access This monograph is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited. &nbsp; &nbsp; Attribution &mdash; You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work). Noncommercial &mdash; You may not use this work for commercial purposes. Share Alike &mdash; If you alter, transform, or build upon this work, you may distribute the resulting work only under the same or similar license to this one. &nbsp; Zawartość jest objęta licencją Creative Commons Uznanie autorstwa-Użycie niekomercyjne-Na tych samych warunkach 4.0 &nbsp; <strong>ISBN 9780359774524</strong> &nbsp; <strong>DOI </strong><strong>http://dx.doi.org/10.5281/zenodo.</strong><strong>3270699</strong> &nbsp; <strong>PBN Poland </strong><strong>https://pbn.nauka.gov.pl/sedno-webapp/works/917606</strong> &nbsp; Radomska Szkoła Wyższa w Radomiu, Polska ul. 1905 roku 26/28 26-600 Radom Tel: 048 383 66 05 mail: med@rsw.edu.pl &nbsp; <strong>144</strong><strong> p. Number of characters: 2</strong><strong>50</strong><strong> 000 (with abstracts). Number of images:</strong><strong> 4 </strong><strong>x 1000 characters (lump sum) =</strong><strong> 4 </strong><strong>000 characters.</strong> <strong>Total: Number of characters: 2</strong><strong>54</strong><strong> 000 (with abstracts, summaries and graphics) = 6,</strong><strong>35</strong><strong> sheet publications.</strong> <strong>СОДЕРЖАНИЕ</strong> &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; <strong>ВВЕДЕНИЕ</strong> <strong>7</strong> <strong>ОБЩИЕ СВЕДЕНИЯ ОБ ЭПИГЕНЕТИЧЕСКИХ МЕХАНИЗМАХ</strong> <strong>8</strong> <strong>INTRODUCTION</strong> <strong>11</strong> <strong>GENERAL INFORMATION ON EPIGENETIC MECHANISMS</strong> <strong>13</strong> <strong>СПИСОК ЛИТЕРАТУРЫ К ГЛАВЕ &laquo;ВВЕДЕНИЕ И ОБЩИЕ СВЕДЕНИЯ ОБ ЭПИГЕНЕТИЧЕСКИХ МЕХАНИЗМАХ&raquo;</strong> <strong>16</strong> &nbsp; &nbsp; <strong>ГЛАВА 1. </strong><strong>ЭПИГЕНЕТИЧЕСКИЕ</strong><strong> </strong><strong>МЕХАНИЗМЫ В СИСТЕМЕ КОНТРОЛЯ</strong><strong> </strong><strong>ФУНКЦИИ</strong><strong> </strong><strong>ПОЧЕК</strong><strong> </strong><strong>В</strong><strong> </strong><strong>НОРМЕ</strong> <strong>2</strong><strong>1</strong> <strong>1.1. ПЛАСТИЧНОСТЬ СИСТЕМ ЭПИГЕНЕТИЧЕСКОЙ МОДУЛЯЦИИ ЭКСПРЕССИИ ГЕНОВ РЕНАЛЬНОЙ ПАРЕНХИМЫ</strong> <strong>23</strong> <strong>1.2. ЭНДОКРИННЫЕ ФАКТОРЫ РЕГУЛЯЦИИ ВОДНО-СОЛЕВОГО БАЛАНСА ОРГАНИЗМА В СИСТЕМЕ ЭПИГЕНЕТИЧЕСКИХ МЕХАНИЗМОВ КОНТРОЛЯ ГОМЕОСТАЗА</strong> <strong>27</strong> <strong>1.2.1. АРГИНИН-ВАЗОПРЕССИН (АВП)</strong> <strong>27</strong> <strong>1.2.2. НАТРИЙУРЕТИЧЕСКИЕ ПЕПТИДЫ</strong> <strong>30</strong> <strong>СПИСОК ЛИТЕРАТУРЫ К ГЛАВЕ &laquo;ЭПИГЕНЕТИЧЕСКИЕ</strong><strong> </strong><strong>МЕХАНИЗМЫ </strong><strong>В СИСТЕМЕ КОНТРОЛЯ ФУНКЦИИ ПОЧЕК В НОРМЕ&raquo;</strong> <strong>33</strong> <strong>ГЛАВА 2. НЕКОТОРЫЕ ФАКТОРЫ АКТИВАЦИИ </strong><strong>ЭПИГЕНЕТИЧЕСКИХ МЕХАНИЗМОВ</strong> <strong>47</strong> <strong>2.1. ИЗМЕНЕНИЕ ТЕМПЕРАТУРНОГО РЕЖИМА, КАК ФАКТОР ИНДУКЦИИ ЭПИГЕНЕТИЧЕСКИХ МЕХАНИЗМОВ</strong> <strong>49</strong> <strong>2.2. ГИПОКСИЯ</strong> <strong>50</strong> <strong>2.3. ГИПЕРГЛИКЕМИЯ</strong> <strong>52</strong> <strong>2.4. ТЯЖЕЛЫЕ МЕТАЛЛЫ</strong> <strong>54</strong> <strong>2.5. ЭНДОКРИНОПАТИИ</strong> <strong>57</strong> <strong>2.6. </strong><strong>ЭПИГЕНЕТИЧЕСКИЕ ПРОЦЕССЫ, ИНДУЦИРОВАННЫЕ ПАТОГЕННЫМИ МИКРООРГАНИЗМАМИ</strong> <strong>59</strong> <strong>СПИСОК ЛИТЕРАТУРЫ К ГЛАВЕ &laquo;НЕКОТОРЫЕ ФАКТОРЫ АКТИВАЦИИ ЭПИГЕНЕТИЧЕСКИХ МЕХАНИЗМОВ&raquo;</strong> <strong>61</strong> &nbsp; &nbsp; <strong>ГЛАВА 3. ФАКТОРЫ ВНУТРИОРГАННОЙ ГУМОРАЛЬНОЙ РЕГУЛЯЦИИ ДЕЯТЕЛЬНОСТИ ПОЧЕК. ИХ МЕСТО И РОЛЬ В ЭПИГЕНЕТИЧЕСКИХ МЕХАНИЗМАХ НАРУШЕНИЯ ФУНКЦИОНАЛЬНОГО СОСТОЯНИЯ РЕНАЛЬНОЙ ПАРЕНХИМЫ</strong> <strong>69</strong> <strong>3.1. РЕНИН-АНГИОТЕНЗИНОВАЯ СИСТЕМА (РАС)</strong> <strong>70</strong> <strong>3.2. МИНЕРАЛОКОРТИКОИДЫ.</strong> <strong>76</strong> <strong>3.3. ТРАНСФОРМИРУЮЩИЙ ФАКТОР РОСТА-бета1 </strong> <strong>79</strong> <strong>3.4. МОЛЕКУЛА ОКСИДА АЗОТА (</strong><strong>NO</strong><strong>)</strong> <strong>83</strong> <strong>3.5. ПАТОФИЗИОЛОГИЧЕСКОЕ ЗНАЧЕНИЕ ЭПИГЕНЕТИЧЕСКОЙ ТРАНСФОРМАЦИИ СИСТЕМЫ ВНУТРИОРГАННОЙ ГУМОРАЛЬНОЙ РЕГУЛЯЦИИ ДЕЯТЕЛЬНОСТИ ПОЧЕК</strong> <strong>87</strong> <strong>СПИСОК ЛИТЕРАТУРЫ К ГЛАВЕ &laquo;ФАКТОРЫ ВНУТРИОРГАННОЙ ГУМОРАЛЬНОЙ РЕГУЛЯЦИИ ДЕЯТЕЛЬНОСТИ ПОЧЕК. ИХ МЕСТО И РОЛЬ В ЭПИГЕНЕТИЧЕСКИХ МЕХАНИЗМАХ НАРУШЕНИЯ ФУНКЦИОНАЛЬНОГО СОСТОЯНИЯ РЕНАЛЬНОЙ ПАРЕНХИМЫ&raquo;</strong> <strong>89</strong> &nbsp; &nbsp; <strong>ГЛАВА 4. БЕЛКИ РЕНИН-АНГИОТЕНЗИНОВОЙ СИСТЕМЫ ПРИ ОНКОЛОГИЧЕСКИХ ЗАБОЛЕВАНИЯХ </strong> <strong>105</strong> <strong>4.1. ДИАГНОСТИЧЕСКАЯ ЦЕННОСТЬ АНАЛИЗА ЭКСПРЕССИИ БЕЛКОВ-КОМПОНЕНТОВ РАС В ОНКОЛОГИИ</strong> <strong>107</strong> <strong>4.1.1. Рецепторы к А-</strong><strong>II</strong> <strong>107</strong> <strong>4.1.2. Ангиотензин-</strong><strong>I</strong><strong>-превращающий фермент (АСЕ-1)</strong> <strong>108</strong> <strong>4.1.3. Ангиотензин-</strong><strong>I</strong><strong>-превращающий фермент-2 (АСЕ-2) и ось ACE2/Ang-(1&ndash;7)/M</strong><strong>AS</strong><strong>1</strong> <strong>110</strong> <strong>4.1.4. Ангиотензиноген</strong> <strong>111</strong> <strong>4.1.5. (Про)Ренин</strong> <strong>112</strong> <strong>4.2. ЭПИГЕНЕТИЧЕСКИЕ МЕХАНИЗМЫ, КАК ВОЗМОЖНЫЕ РЕГУЛЯТОРЫ ЭКСПРЕССИИ ПРОТЕИНОВ-КОМПОНЕНТОВ РАС ПРИ ОНКОЛОГИЧЕСКИХ ЗАБОЛЕВАНИЯХ</strong> <strong>114</strong> <strong>4.3. ОНКОЛОГИЧЕСКИЕ АСПЕКТЫ ЭКСПРЕССИИ КОМПОНЕНТОВ РАС И ЛОКАЛЬНАЯ РЕНИН-АНГИОТЕНЗИНОВАЯ СИСТЕМА</strong> <strong>116</strong> <strong>СПИСОК ЛИТЕРАТУРЫ К ГЛАВЕ &laquo;БЕЛКИ РЕНИН-АНГИОТЕНЗИНОВОЙ СИСТЕМЫ ПРИ ОНКОЛОГИЧЕСКИХ ЗАБОЛЕВАНИЯХ&raquo;</strong> <strong>120</strong> &nbsp; &nbsp; <strong>ВВЕДЕНИЕ</strong> &nbsp; Заболевание почек является одной из наиболее актуальных глобальных проблем современной медицины. Данные медицинской статистики показывают неуклонный рост числа нефрологических пациентов, нуждающихся в диализе и трансплантации органа (Reddy M.A, Natarajan R., 2015; Uwaezuoke S.N. et al., 2016; Zununi Vahed S. et al., 2016). Дополняет драматичность картины тот факт, что данная тенденция демонстрирует актуальность и в отношении детей, включая новорожденных (Woroniecki R. et al., 2011; Uwaezuoke S.N. et al., 2016; Lee-Son K., Jetton J.G., 2016). Проблема носит серьезный характер, но даже привлечение к ее преодолению подходов генетики, основанных на законах моногенного наследования Г. Менделя, не в полной мере решает поставленную задачу. Выводы специалистов по медицинской генетике, изучающих наследование патологических признаков, способствующих повышению рисков возникновения почечной недостаточности, сопровождаются констатацией практической значимости выяснения эпигенетических механизмов поражения ткани почек (K&ouml;ttgen A. et al., 2010; Lee-Son K., Jetton J.G., 2016; Ma R.C.W., 2016). Действительно, обзоры результатов экспериментальных и клинических исследований, указывают на необходимость более глубокого развития научного направления, связанного с эпигенетическими механизмами патогенеза почечной недостаточности (Thomas M.C., 2016; Witasp A. et al., 2017). Вместе с тем, особенность деятельности почки заключается в том, что различные сегменты ее структурно-функциональной единицы &ndash; нефрона, обладают существенными отличиями между собой, связанными с их транспортными возможностями, набором гуморальных факторов регуляции их активности и физико-химическими параметрами среды микроокружения. Действительно, гомеостатические функции разных отделов нефрона, координируются достаточно сложной системой гуморальных факторов, определяющих физиологические и патофизиологические механизмы реакции почек на изменения параметров водных бассейнов организма и внешних неблагоприятных воздействий. К числу таких гуморальных факторов следует отнести ренин-ангиотензин-альдостероновую систему (РААС) (Lee-Son K., Jetton J.G, 2016), оксид азота (Shirodkar A.V., Marsden P.A., 2011), трансформирующий фактор роста-бета (Shi M. et al., 2011) и т.д. Перечисленные гуморальные факторы контроля органогенеза и гомеостатических функций почек требуют более глубокого изучения, поскольку могут также являться медиаторами структурно-функциональных нарушений ренальной паренхимы, связанных, в том числе и с эпигенетическими преобразованиями процессов транскрипции и трансляции в условиях острой и хронической почечной недостаточности. С этих позиций, актуальность эпигенетического подхода обусловлена тем, что, во-первых, сведения об изменениях экспрессии генов, осуществляющих контроль над биосинтезом и экспрессией протеинов ренальной паренхимы, а также системных и внутрипочечных гуморальных факторов регуляции гомеостатической функции почек могут быть использованы в совершенствовании методов современной лабораторной диагностики заболеваний почек (Kobori H. et al., 2008). Во-вторых, выяснение эпигенетических механизмов патогенеза почечной недостаточности открывает перспективу в разработке принципиально новых фармакологических препаратов, в том числе, контролирующих синтез ренальной паренхимой различных физиологически активных молекул (Marumo T. et al., 2008; Reddy M.A, Natarajan R., 2015). В-третьих, выяснение эпигенетических механизмов прогрессирования почечной недостаточности позволяет по-новому оценить спектр применения и нефропротекторных свойств уже известных и широко применяемых препаратов, действие которых основано на коррекции активности гуморальных систем контроля гомеостатических функций органа (Reddy M.A. et al., 2014; Hayashi K. et al., 2015). Таким образом, мы видим свою задачу в том, чтобы попытаться интегрировать современные достижения молекулярной биологии и биохимии в уже существующую систему научных представлений о физиологических механизмах регуляции деятельности почек и патофизиологических процессах патогенеза становления и прогрессирования почечной недостаточности. Следовательно, цель нашей работы сводится к выяснению нескольких вопросов. Во-первых, какова роль эпигенетической трансформации хроматина и микро РНК в физиологических механизмах регуляции деятельности почек? Во-вторых, какова роль эпигенетических процессов нарушения баланса системного и внутрипочечного метаболизма гуморальных факторов регуляции функции почек в становлении и прогрессировании почечной недостаточности? <strong>ОБЩИЕ СВЕДЕНИЯ ОБ ЭПИГЕНЕТИЧЕСКИХ МЕХАНИЗМАХ</strong> &nbsp; Эпигенетика &mdash; современное научное направление, изучающее механизмы регуляции экспрессии генов. Эпигенетические механизмы не оказывают влияния на первичную структуру нуклеиновых кислот (Beckerman P. et al., 2014) и реализуются процессами метилирования и деметилирования ДНК (van der Wijst M.G.P. et al., 2015), РНК (Saletore Y. et al., 2013) и посттрансляционным процессингом гистоновых белков (Voon H.P.J., Wong L.H., 2016; Jamal A. et al., 2012). По нашему мнению, важно отметить, что процессы синтеза и постранскрипционного процессинга микро РНК находятся под жестким контролем энзимов (Treiber T. et al., 2019; Michlewski G., C&aacute;ceres J.F., 201(). Помимо этого, микро РНК могут выполнять важную функцию в регуляции биосинтеза белка на уровне транскрипции или трансляции (Petrillo F. et al., 2017; Thomas M.J. et al., 2018). По данным авторов цитируемых обзоров, изучение метаболизма микро РНК в различных биологических средах организма способствует разработке принципиально новых методов диагностики и лечения заболеваний почек. Помимо этого, эпигенетические механизмы принимают участие в адаптивных реакциях организма и популяции в ответ на изменения факторов среды через модуляцию экспрессии генов (Zama A.M., Uzumcu M., 2010). Одним из наиболее изученных эпигенетических механизмов регуляции экспрессии генов является процесс метилирования ДНК. Данный процесс заключается в присоединении метиловых групп (CH₃) к одному из четырех видов нуклеотидов ДНК путем образования между ними ковалентной связи, однако, порядок последовательности нуклеотидов в цепи ДНК при этом не меняется (Lister R. et al., 2009;Woroniecki R. et al., 2011). За присоединение метиловых групп к нуклеотидам отвечает один из четырех изоферментов ядерных ДНК-метилтрансфераз (DNMT) &ndash; а именно DNMT1, DNMT2, DNMT3a или DNMT3b (Reddy M.A., Natarajan R., 2015; Efimova O.A. et al., 2012). DNMT1 распознает полуметилированную ДНК (каждую из её цепей) во время репликации (Bechtel W. et al., 2010). DNMT3a и DNMT3b обеспечивают метилирование ДНК de novo, т. е. повторно, в новых сайтах. Функция DNMT2 до сих пор является предметом дискуссии (Jamal A. et al., 2012). ДНК-метилтрансферазы обладают способностью встраивать особые &laquo;метки&raquo; в нуклеиновые кислоты, что приводит к изменению экспрессии данных генов (van der Wijst M.G.P. et al., 2015). Высказывается предположение о том, что эпигенетические &laquo;метки&raquo; в цепи ДНК блокируют процесс транскрипции более двух третей объема ДНК (Ponnaluri V.K.C. et al., 2016). Таким образом, клетки организма применяют ковалентную модификацию ДНК с целью регуляции экспрессии генов по так называемому принципу &ldquo;on/off&rdquo; (Quarta C. et al., 2016). Метилирование ДНК в большинстве случаев происходит на цитозиновом азотистом основании (С), располагающимся в паре с гуанином (G), на так называемых CpG-участках, или CpG-кластерах (Dwivedi R.S. et al., 2011). В человеческом организме около 70-80% CpG-динуклеотидов находятся в метилированном состоянии (Ziller M.J. et al., 2013). Участки цепи ДНК, где плотность CpG-кластеров особенно высока, называют CpG-островками (Zhang D. et al., 2009). Однако процесс метилирования ДНК осуществляется на участках с пониженной плотностью CpG-динуклеотидов (Ziller M.J. et al., 2013). Наряду с процессом метилирования ДНК большое значение в эпигенетической регуляции экспрессии генов имеет процесс деметилирования (van der Wijst M.G.P. et al., 2015; Yefimova O.A. et al., 2012). Деметилирование ДНК &ndash; процесс высвобождения ДНК от метильных групп, который осуществляется при помощи специальных ферментов демиталаз (Auclair G., Weber M., 2012). Кроме того, к эпигенетическим механизмам относят также модификации белков-гистонов в результате процессов ацетилирования, деацетилирования, фосфорилирования, убиквитинирования и др. (Ganai S.A. et al., 2016; Araki Y., Mimura T., 2017;). Процессы ацетилирования и деацетилирования возможны благодаря ряду специфических ферментов &mdash; гистонацетилазам (ацетилтрансферазам, HAT) и гистондеацетилазам (HDAC) (Gong F. et al., 2016). Фосфорилирование же происходит за счет ферментов киназ (фосфотрансфераз) (Araki Y., Mimura T., 2017; Nathan D. et al., 2012). Ковалентная модификация гистонов, как правило, ослабляет связь гистонового кора нуклеосомы и ДНК, что способствует доступности молекулы ДНК для процесса транскрипции (Rossetto D. et al., 2012). Однако, это правило не носит универсальный характер. Например, ацетилирование лизина в положении 27 гистона H3 (H3K27ac) ведёт к усилению экспрессии генов. Сочетание ацетилированного лизина 14 (H3K14ac) и фосфорилированного серина 10 гистона H3 (H3S10ph) так же говорит о повышенной экспрессии генов (Chen K.W., Chen L., 2017). Наряду с этим другие модификации, а именно ацетилирование лизина H2AK5, H2BK20, H3K14, H4K5 и др. и фосфорилирование треонина H3T3 и серина H3S28 и H4S1 аналогично приводят к активированию гена (Araki Y., Mimura T., 2017; Wang Z. et al., 2008; Rossetto D. et al., 2012). Деацетилирование гистонов, напротив, сопровождается инактивацией гена, поскольку влечет за собой конденсацию ДНК и невозможность протекания транскрипции (Ganai S.A. et al., 2016). Посттранскрипционная экспрессия генов регулируется таким эпигенетическим механизмом как интерференция РНК. Интерференция РНК &mdash; это процесс подавления процесса биосинтеза белка (транскрипция, трансляция) при помощи микро РНК (Nabzdyk C.S. et al., 2017). При этом микро РНК может оказывать непосредственное влияние на состояние трансляции (Dwivedi R.S. et al., 2011; Cui J. et al., 2017). Собственно процесс подавления экспрессии генов именуется сайленсингом (Cui J. et al., 2017). МикроРНК &mdash; это класс коротких одноцепочечных некодирующих РНК длиной в 21-24 нуклеотида (Dwivedi R.S. et al., 2011; Zhang D. et al., 2009). За производство микро РНК ответственны эндогенные некодирующие участки ДНК. Помимо трансляции микро РНК обладает способностью подавлять экспрессию генов на стадии транскрипции (Dwivedi R.S. et al., 2011). Все регуляторные эффекты микро РНК встроены в определенную систему эпигенетического контроля функций данной популяции клеток (Dwivedi R.S. et al., 2011). Анализируя современные данные литературы, можно предположить, что эпигенетические механизмы являются важным элементом адаптации на популяционном и организменном уровне, осуществляющим координацию экспрессии генов адекватно изменениям факторов внешней среды. В нашем сознании понятие &laquo;эпигенетические механизмы&raquo; чаще ассоциируются с феноменом фетального программирования. Между тем, их деятельность активно протекает и в постнатальный период онтогенеза. Сложно сказать в чем именно может иметь место несовершенство этой формы адаптивного ответа, однако, ее реализация зачастую сопряжена с активацией патогенетических механизмов различных систем органов. <strong>INTRODUCTION</strong> &nbsp; Kidney disease is one of the most pressing global problems of modern medicine. Medical statistics show a steady increase in the number of nephrological patients in need of dialysis and organ transplantation (Reddy M.A, Natarajan R., 2015; Uwaezuoke S.N. et al., 2016; Zununi Vahed S. et al., 2016). The drama of the picture complements the fact that this trend also shows relevance for children, including newborns (Woroniecki R. et al., 2011; Uwaezuoke S.N. et al., 2016; Lee-Son K., Jetton J.G., 2016). The problem is serious, but even the attraction of genetics approaches based on the monogenic inheritance laws of G. Mendel to its overcoming does not fully solve the problem posed. The findings of specialists in medical genetics who study the inheritance of pathological signs that increase the risk of renal failure are accompanied by a statement of the practical importance of finding out the epigenetic mechanisms of kidney tissue damage (K&ouml;ttgen A. et al., 2010; Lee-Son K., Jetton JG, 2016; Ma RCW, 2016). Indeed, reviews of the results of experimental and clinical studies indicate the need for a deeper development of the scientific direction related to the epigenetic mechanisms of the pathogenesis of renal failure (Thomas M.C., 2016; Witasp A. et al., 2017). At the same time, the peculiarity of the kidney activity is that the various segments of its structural and functional unit, the nephron, have significant differences among themselves related to their transport capabilities, a set of humoral factors regulating their activity and the physicochemical parameters of the microenvironment. Indeed, the homeostatic functions of different parts of the nephron are coordinated by a rather complex system of humoral factors that determine the physiological and pathophysiological mechanisms of the reaction of the kidneys to changes in the parameters of the body&rsquo;s water basins and external adverse effects. These humoral factors include the renin-angiotensin-aldosterone system (RAAS) (Lee-Son K., Jetton JG, 2016), nitric oxide (Shirodkar AV, Marsden PA, 2011), transforming growth factor-beta (Shi M. et al., 2011), etc. The listed humoral factors controlling organogenesis and homeostatic functions of the kidneys require further study, since they can also mediate structural and functional disorders of the renal parenchyma, including epigenetic transformations of transcription and translation in conditions of acute and chronic renal failure. From this point of view, the relevance of the epigenetic approach is due to the fact that, firstly, information on changes in the expression of genes that control biosynthesis and expression of renal parenchyma proteins, as well as systemic and intrarenal humoral factors regulating the homeostatic function of the kidneys can be used to improve modern methods. laboratory diagnosis of kidney disease (Kobori H. et al., 2008). Secondly, the clarification of the epigenetic mechanisms of renal failure pathogenesis opens up the prospect of developing fundamentally new pharmacological drugs, including those controlling the synthesis of renal parenchyma of various physiologically active molecules (Marumo T. et al., 2008; Reddy MA, Natarajan R., 2015) . Third, clarifying the epigenetic mechanisms of progression of renal failure allows us to re-evaluate the range of applications and the nephroprotective properties of already known and widely used drugs, which are based on correcting the activity of the humoral control systems of homeostatic organ functions (Reddy MA et al., 2014; Hayashi K . et al., 2015). Thus, we see our task in trying to integrate modern advances in molecular biology and biochemistry into the already existing system of scientific ideas about the physiological mechanisms of regulating kidney activity and the pathophysiological processes of the pathogenesis of renal failure and progression. Consequently, the goal of our work comes down to clarifying a few questions. First, what is the role of epigenetic transformation of chromatin and micro RNA in the physiological mechanisms of regulation of kidney activity? Secondly, what is the role of the epigenetic processes of imbalance of the systemic and intrarenal metabolism of humoral factors regulating the function of the kidneys in the formation and progression of renal failure? <strong>GENERAL INFORMATION ON EPIGENETIC MECHANISMS</strong> &nbsp; Epigenetics is a modern scientific direction that studies the mechanisms of regulation of gene expression. Epigenetic mechanisms do not affect the primary structure of nucleic acids (Beckerman P. et al., 2014) and are implemented by DNA methylation and demethylation processes (van der Wijst MGP et al., 2015), RNA (Saletore Y. et al., 2013) and post-translational processing of histone proteins (Voon HPJ, Wong LH, 2016; Jamal A. et al., 2012). In our opinion, it is important to note that the processes of synthesis and post-transcriptional processing of micro RNA are tightly controlled by enzymes (Treiber T. et al., 2019; Michlewski G., C&aacute;ceres JF, 201 (). In addition, micro RNA can perform an important function in the regulation of protein biosynthesis at the level of transcription or translation (Petrillo F. et al., 2017; Thomas MJ et al., 2018). According to the authors of the cited reviews, the study of the metabolism of micro RNA in various biological media of the body contributes to the development of fundamentally new diagnostic methods and kidney disease treatment. of this, epigenetic mechanisms are involved in adaptive responses of the organism and population in response to changes in environmental factors through modulation of gene expression (Zama A.M., Uzumcu M., 2010). One of the most studied epigenetic mechanisms of regulation of gene expression is the process of DNA methylation. This process involves the addition of methyl groups (CH3) to one of four types of DNA nucleotides by forming a covalent bond between them, however, the order of the sequence of nucleotides in the DNA chain does not change (Lister R. et al., 2009; Woroniecki R. et al., 2011). One of the four nuclear DNA methyltransferase isoenzymes (DNMT), namely DNMT1, DNMT2, DNMT3a or DNMT3b, is responsible for the addition of methyl groups to nucleotides (Reddy M.A., Natarajan R., 2015; Efimova O.A. et al., 2012). DNMT1 recognizes semi-methylated DNA (each of its chains) during replication (Bechtel W. et al., 2010). DNMT3a and DNMT3b provide de novo methylation of DNA, i.e., repeatedly, in new sites. The DNMT2 function is still under discussion (Jamal A. et al., 2012). DNA methyltransferases have the ability to embed specific &ldquo;tags&rdquo; in nucleic acids, which leads to changes in the expression of these genes (van der Wijst M.G.P. et al., 2015). It is suggested that epigenetic &ldquo;tags&rdquo; in the DNA chain block the transcription process for more than two thirds of the DNA volume (Ponnaluri V.K.C. et al., 2016). Thus, the cells of an organism use covalent modification of DNA in order to regulate gene expression according to the so-called &ldquo;on / off&rdquo; principle (Quarta C. et al., 2016). DNA methylation in most cases occurs on the cytosine nitrogen base (C), which is paired with guanine (G), on the so-called CpG sites, or CpG clusters (Dwivedi R.S. et al., 2011). In the human body, about 70-80% of CpG dinucleotides are in the methylated state (Ziller M.J. et al., 2013). The portions of the DNA chain where the density of CpG clusters is particularly high are called CpG islands (Zhang D. et al., 2009). However, the process of DNA methylation is carried out in areas with low density of CpG dinucleotides (Ziller M.J. et al., 2013). Along with the process of DNA methylation, the process of demethylation is of great importance in the epigenetic regulation of gene expression (van der Wijst M.G.P. et al., 2015; Yefimova O.A. et al., 2012). DNA demethylation is the process of DNA release from methyl groups, which is carried out with the help of special enzymes of demetallas (Auclair G., Weber M., 2012). In addition, modifications of histone proteins as a result of acetylation, deacetylation, phosphorylation, ubiquitination, etc. are also considered epigenetic mechanisms (Ganai S.A. et al., 2016; Araki Y., Mimura T., 2017;). Acetylation and deacetylation processes are possible due to a number of specific enzymes - histone acetylases (acetyltransferases, HAT) and histone deacetylases (HDAC) (Gong F. et al., 2016). Phosphorylation occurs at the expense of enzymes of kinases (phosphotransferases) (Araki Y., Mimura T., 2017; Nathan D. et al., 2012). Covalent modification of histones, as a rule, weakens the connection between the histone core of the nucleosome and DNA, which contributes to the availability of the DNA molecule for the transcription process (Rossetto D. et al., 2012). However, this rule is not universal. For example, acetylation of lysine at position 27 of histone H3 (H3K27ac) leads to increased gene expression. The combination of acetylated lysine 14 (H3K14ac) and phosphorylated serine 10 histone H3 (H3S10ph) also indicates increased gene expression (Chen K.W., Chen L., 2017). Along with this, other modifications, namely acetylation of lysine H2AK5, H2BK20, H3K14, H4K5, etc., and threonine H3T3 and serine H3S28 and H4S1 phosphorylation similarly lead to gene activation (Araki Y., Mimura T., 2017; Wang Z. et al ., 2008; Rossetto D. et al., 2012). On the contrary, histone deacetylation is accompanied by gene inactivation, as it entails DNA condensation and the impossibility of transcription (Ganai S.A. et al., 2016). Post-transcriptional gene expression is regulated by such an epigenetic mechanism as RNA interference. RNA interference is the process of suppressing the process of protein biosynthesis (transcription, translation) using micro RNA (Nabzdyk C.S. et al., 2017). At the same time, micro RNA can have a direct impact on the state of translation (Dwivedi R.S. et al., 2011; Cui J. et al., 2017). The actual process of suppressing gene expression is called silencing (Cui J. et al., 2017). MicroRNA is a class of short single-stranded non-coding RNAs of 21-24 nucleotides in length (Dwivedi R.S. et al., 2011; Zhang D. et al., 2009). Endogenous noncoding regions of DNA are responsible for the production of micro RNA. In addition to translation, micro RNA has the ability to suppress gene expression at the transcription stage (Dwivedi R.S. et al., 2011). All regulatory effects of micro RNA are embedded in a specific system of epigenetic control of the functions of a given cell population (Dwivedi R.S. et al., 2011). Analyzing modern literature data, it can be assumed that epigenetic mechanisms are an important element of adaptation at the population and organism level, coordinating the expression of genes adequately to changes in environmental factors. In our consciousness, the concept of &ldquo;epigenetic mechanisms&rdquo; is more often associated with the phenomenon of fetal programming. Meanwhile, their activity is actively proceeding in the postnatal period of ontogenesis. It is difficult to say exactly what the imperfection of this form of adaptive response can take place, however, its implementation often involves activation of the pathogenetic mechanisms of various organ systems. <strong>СПИСОК ЛИТЕРАТУРЫ К ГЛАВЕ &laquo;ВВЕДЕНИЕ&raquo;</strong> &nbsp; 1.Reddy M.A, Natarajan R. Recent Developments in Epigenetics of Acute and Chronic Kidney Diseases Kidney Int. 2015 88(2): 250&ndash;261 doi:10.1038/ki.2015.148 &nbsp; 2.Uwaezuoke S.N., Okafor H.U., Muoneke V.N. et al. Chronic kidney disease in children and the role of epigenetics: Future therapeutic trajectories. Biomed Rep. 2016; 5(6): 660&ndash;664 doi: 10.3892/br.2016.781 &nbsp; 3.Zununi Vahed S., Samadi N., Mostafidi E. et al. Genetics and Epigenetics of Chronic Allograft Dysfunction in Kidney Transplants. Iran J Kidney Dis. 2016;10(1):1-9 &nbsp; 4.Lee-Son K., Jetton J.G. AKI and Genetics: Evolving Concepts in the Genetics of Acute Kidney Injury: Implications for Pediatric AKI. J Pediatr Genet. 2016; 5(1): 61&ndash;68 doi:10.1055/s-0035-1557112 &nbsp; 5.Woroniecki R., Gaikwad A., Susztak K. Fetal environment, epigenetics, and pediatric renal disease. Pediatr Nephrol. 2011; 26(5): 705&ndash;711 doi: 10.1007/s00467-010-1714-8 &nbsp; 6.K&ouml;ttgen A., Pattaro C., B&ouml;ger C.A. et al. Multiple New Loci Associated with Kidney Function and Chronic Kidney Disease: The CKDGen consortium. Nat Genet. 2010; 42(5): 376&ndash;384 doi: 10.1038/ng.568 &nbsp; 7.Ma R.C.W. Genetics of cardiovascular and renal complications in diabetes. J Diabetes Investig. 2016; 7(2): 139&ndash;154 doi: 10.1111/jdi.12391 &nbsp; 8.Thomas M.C. Epigenetic Mechanisms in Diabetic Kidney Disease. Curr Diab Rep. 2016;16:31 doi 10.1007/s11892-016-0723-9 &nbsp; 9.Witasp A., Van Craenenbroeck A.H., Shiels P.G. et al. Current epigenetic aspects the clinical kidney researcher should embrace. Clinical Science. 2017; 131:1649&ndash;1667 doi:10.1042/CS20160596 &nbsp; 10.Shirodkar A.V., Marsden P.A. Epigenetics in cardiovascular disease. Curr Opin Cardiol. 2011; 26(3): 209&ndash;215 doi:10.1097/HCO.0b013e328345986e &nbsp; 11.Shi M., Zhu J., Wang R. et al. Latent TGF-&beta; structure and activation. Nature. 2011; 474(7351): 343&ndash;349 doi: 10.1038/nature10152 &nbsp; 12.Kobori H., Katsurada A., Miyata K. et al. Determination of plasma and urinary angiotensinogen levels in rodents by newly developed ELISA. Am J Physiol Renal Physiol. 2008; 294(5): F1257&ndash;F1263 doi: 10.1152/ajprenal.00588.2007 &nbsp; 13.Marumo T., Hishikawa K., Yoshikawa M., Fujita T. Epigenetic Regulation of BMP7 in the Regenerative Response to Ischemia. J Am Soc Nephrol. 2008; 19(7): 1311&ndash;1320 doi: 10.1681/ASN.2007091040 &nbsp; 14.Hayashi K., Sasamura H., Nakamura M. et al. Renin-angiotensin blockade resets podocyte epigenome through Kruppel-like Factor 4 and attenuates proteinuria. Kidney Int. 2015;88(4):745-753 doi: 10.1038/ki.2015.178 &nbsp; 15.Reddy M.A., Sumanth P., Lanting L. et al. Losartan reverses permissive epigenetic changes in renal glomeruli of diabetic db/db mice. Kidney Int. 2014; 85(2): 362&ndash;373 doi: 10.1038/ki.2013.387 &nbsp; 16.Kobori H., Kamiyama M., Harrison-Bernard L.M., Navar L.G. Cardinal Role of the Intrarenal Renin-Angiotensin System in the Pathogenesis of Diabetic Nephropathy. J Investig Med. 2013; 61(2): 256&ndash;264 doi:10.231/JIM.0b013e31827c28bb &nbsp; 17.Beckerman P., Ko Y.-A., Susztak K. Epigenetics: a new way to look at kidney diseases. Nephrol Dial Transplant. 2014; 29(10): 1821&ndash;1827 doi: 10.1093/ndt/gfu026 &nbsp; 18.van der Wijst M.G.P., Venkiteswaran M., Chen H. et al. Local chromatin microenvironment determines DNMT activity: from DNA DNMT activity: from DNA methyltransferase to DNA demethylase or DNA dehydroxymethylase. Epigenetics. 2015; 10(8): 671&ndash;676 doi:10.1080/15592294.2015.1062204 &nbsp; 19.Saletore Y.,Chen-Kiang S., Mason C.E. Novel RNA regulatory mechanisms revealed in the epitranscriptome. RNA Biol. 2013; 10(3): 342&ndash;346 doi: 10.4161/rna.23812 &nbsp; 20.Voon H.P.J., Wong L.H. New players in heterochromatin silencing: histone variant H3.3 and the ATRX/DAXX chaperone. Nucleic Acids Res. 2016; 44(4): 1496&ndash;1501 doi: 10.1093/nar/gkw012 &nbsp; 21.Jamal A., Man H.S.J., Marsden P.A. Gene Regulation in the Vascular Endothelium: Why Epigenetics Is Important for the Kidney. Semin Nephrol. 2012; 32(2): 176&ndash;184 doi: 10.1016/j.semnephrol.2012.02.009 &nbsp; 22.Treiber T., Treiber N., Meister G. Publisher Correction: Regulation of microRNA biogenesis and its crosstalk with other cellular pathways. Nat Rev Mol Cell Biol. 2019;20(5):321 doi: 10.1038/s41580-019-0106-6 23.Michlewski G., C&aacute;ceres J.F. Post-transcriptional control of miRNA biogenesis. RNA. 2019;25(1):1-16 doi: 10.1261/rna.068692.118 &nbsp; 24.Petrillo F., Iervolino A., Zacchia M., Simeoni A., Masella C., Capolongo G., Perna A., Capasso G., Trepiccione F. MicroRNAs in Renal Diseases: A Potential Novel Therapeutic Target. Kidney Dis (Basel). 2017;3(3):111-119 doi: 10.1159/000481730 25.Thomas M.J., Fraser D.J., Bowen T. Biogenesis, Stabilization, and Transport of microRNAs in Kidney Health and Disease. Noncoding RNA. 2018;4(4). pii: E30 doi: 10.3390/ncrna4040030 &nbsp; 26.Zama A.M., Uzumcu M. Epigenetic effects of endocrine-disrupting chemicals on female reproduction: An ovarian perspective. Front Neuroendocrinol. 2010; 31(4): 420&ndash;439 doi:10.1016/j.yfrne.2010.06.003 &nbsp; 27.Lister R., Pelizzola M., Dowen R.H. et al. Human DNA methylomes at base resolution show widespread epigenomic differences. Nature. 2009; 462: 315-322 doi: 10.1038/nature08514 &nbsp; 28.Efimova O.A., Pendina A.A., Tikhonov A.V. et al. DNA methylation - a major mechanism of human genome reprogramming and regulation. Medical Genetics. 2012; 4(118): 10-18 &nbsp; 29.Bechtel W., McGoohan S., Zeisberg E.M. et al. Methylation determines fibroblast activation and fibrogenesis in the kidney. Nat Med. 2010; 16(5): 544&ndash;550 doi: 10.1038/nm.2135 &nbsp; 30.Ponnaluri V.K.C., Ehrlich K.C., Zhang G., Lacey M., Johnston D., Pradhan S., Ehrlich M. Association of 5-hydroxymethylation and 5-methylation of DNA cytosine with tissue-specific gene expression. Epigenetics. 2016; 12(2): 123-138 doi: 10.1080/15592294.2016.1265713 &nbsp; 31.Quarta C., Shneider R., Tschӧp M.H. Epigenetic ON/OFF Switches for Obesity. Cell. 2016; 164(3): 341-342 doi: 10.1016/j.cell.2016.01.006 &nbsp; 32.Dwivedi R.S., Herman J.G., McCaffrey T. et al. Beyond genetics: epigenetic code in chronic kidney disease. Kidney Int. 2011; 79(1): 23-32 doi: 10.1038/ki.2010.335 &nbsp; 33.Ziller M.J., Gu H., M&uuml;ller F., Donaghey J. et al. Charting a dynamic DNA methylation landscape of the human genome. Nature. 2013; 500(7463): 477-481. doi: 10.1038/nature12433 <strong>ГЛАВА 1. </strong><strong>ЭПИГЕНЕТИЧЕСКИЕ</strong><strong> </strong><strong>МЕХАНИЗМЫ </strong> <strong>В СИСТЕМЕ КОНТРОЛЯ</strong><strong> </strong><strong>ФУНКЦИИ</strong><strong> </strong><strong>ПОЧЕК</strong><strong> </strong><strong>В</strong><strong> </strong><strong>НОРМЕ</strong><strong> </strong> &nbsp; &nbsp; Эпигенетические системы управления экспрессии генов выполняют принципиально важную функцию на разных этапах онтогенеза. Например, у плода они координируют нормальное течение нефрогенеза. В зрелом возрасте эпигенетические механизмы тесно вовлечены в систему контроля гомеомтатических функций органа. Процессы снижения функции почек у пожилых людей также тесно связаны с эпигенетическими механизмами. Оценивая роль эпигенетических механизмов в процессах органогенеза почки, необходимо отметить роль метилирования гистонов в цитодифференцировке эмбриональных клеток (Adli M. et al., 2015). Наряду с этим, подчеркивается роль баланса активности гистоновых ацетилтрансфераз и деацетилаз в регуляции экспрессии генов на ранних стадиях органогенеза почки (Hilliard S.A, El-Dahr S.S., 2016). Высказывается мнение о том, что некоторые деацетилазы гистоновых белков (HDAC1 and HDAC2) могут быть критически важны для процессов развития канальцевого и сосудистого компонентов нефрона на ранних стадиях онтогенеза почки (Liu H. et al., 2018). Наряду с этим, в литературе имеются даные о том, что синтез некодидурющих РНК и реакции ацетилирования гистонов выполняют важную роль в формировании юкста-гломерулярного аппарата (ЮГА) в процессе нефрогенеза (Martini A.G., Danser A.H.J., 2017). С другой стороны, внутриорганная продукция компонентов ренин-ангиотензиновой системы (РАС) на ранних этапах онтогенеза также критически важна для координации гисто- и органогенеза. Установлено, что избыточное потребление хлорида натрия во время беременности может нарушать эти процессы через изменения активности внутриорганной экспрессии компонентов РАС и продукции оксида азота в тканях плода (Stocher D.P. et al., 2018). Анализ роли метилтрансфераз и деметилаз, а также гистон-ацетилтрансфераз и гистон-деацетилаз в процессах нефрогенеза позволил выявить определенные закономерности динамики активности данных групп ферментов по мере формирования нефрона (Hilliard S.A., El-Dah S.S., 2016). Авторы цитируемого обзора сопоставляют процессы нефрогенеза с топологией и динамикой во времени активности систем ковалентной модификации хроматина: остатков лизина в составе гистонов (H3K), остатков аргинина в составе гистонов (H3R) и молекулы ДНК. Наряду с процессами ковалентной модификации хроматина, механизмы транскрипции и метаболизма некодирующих РНК также могут иметь принципиально важное значение для нормального течения морфогенеза почки млекопитающих (Ho J., Kreidberg J.A., 2012). В настоящее время роль микро РНК в процессах органогенеза почки изучено достаточно подробно. В литературе имеются сведения о том, что некоторые семейства микро РНК критически важны для морфогенеза сосудисто-клубочкового и канальцевого отделов почки (Trionfini P., Benigni A., 2017). Возможно, эпигенетические механизмы органогенеза почки находятся под контролем гормонов системного действия материнского организма. В частности, показано, что такой способностью может обладать мелатонин (Tain Y.-L. et al., 2017). По мнению авторов, мелатонин обладает способностью контролировать не только формирование архитектуры нефрона, но и регулировать уровень активности внутрипочечной системы NO-синтаз и ренин-ангиотензиновой системы плода через интенсивность метилирования ДНК и ацетилирования белков гистонов. Кроме того, показано, что инсулин также обладает выраженным влиянием на состояние эпигенетических механизмов в тканях почки человека (Lay A.C., Coward R.J.M., 2018). В литературе приводятся данные о том, что гипометилирование хроматина на уровне нейро-эндокринного звена контроля деятельности почки &mdash; одна из причин увядания гомеостатической функции органа в преклонном возрасте (Murgatroyd C. et al., 2010). Дальнейшие исследования позволили установить важное значение роли метилирования хроматина в возрастных изменениях системы контроля водно-солевого баланса у млекопитающих (Greenwood M.P. et al., 2018). В литературе уделяется внимание роли микро РНК и ковалентной модификации хроматина в процессах возрастных нарушений функции почек человека (Shiels P.G. et al., 2017). На основе анализа роли деацетилаз гистонов SIRT1 и SIRT3 в регуляции обменных процессов почки, делается вывод о том, что данная группа ферментов обладает выраженным нефропротекторным свойством, обеспечивая сдерживание процессов старения тканей органа (Morigi M. et al., 2018). <strong>1.1. ПЛАСТИЧНОСТЬ СИСТЕМ ЭПИГЕНЕТИЧЕСКОЙ МОДУЛЯЦИИ ЭКСПРЕССИИ ГЕНОВ РЕНАЛЬНОЙ ПАРЕНХИМЫ </strong> &nbsp; Как уже отмечалось выше, в зрелом возрасте эпигенетические механизмы сохраняют за собой важное место в регуляции функции почек, в частности, адаптивных реакций ренальной паренхимы. Необходимо подчеркнуть, что эпигенетические механизмы контроля биосинтеза белка сохраняют высокий уровень пластичности в зрелом возрасте. Иллюстрируя высокие показатели пластичности обсуждаемых процессов, можно упомянуть роль метилирования ДНК в формировании суточного ритма поведенческой активности млекопитающих (Azzi A. et al., 2014). Следовательно, есть основания полагать, что молекулярные механизмы регуляции экспрессии генов могут непосредственно координировать адаптивные реакции ренальной паренхимы. Возможно, эпигенетические механизмы, наряду с нейро-гуморальными системами контроля водно-солевого обмена, принимают участие в регуляции гомеостатических функций почек. В ряде публикаций указывается, что стимулом для молекулярных механизмов управления экспрессии генов, как правило, является динамика параметров констант водно-солевого баланса организма. Результаты более ранних исследований показали, что метилтрансфераза гистонов Dot1a непосредственно определяет альдостерон-зависимую транскрипцию гена EnaC-альфа в дистальных отделах нефрона (Zhang D. et al., 2009). Согласно данным литературы, состояние посттранскрипционного процессинга предшественника микроРНК в проксимальных нефроцитах может выполнять ключевую роль в адаптации канальцевого эпителия к ишемии, возможно, участвуя в патогенезе реперфузионного поражения S3-сегмента (Wei Q. et al., 2010). Подчеркивается, что интенсивность репаративных реакций ренальной паренхимы может контролироваться некодирующими РНК и состоянием метилирования Н2А и Н3 гистонов (Chou Y.-H. et al., 2017). В литературе имеются сведения о том, что у некоторых видов млекопитающих в адаптивных реакциях почки на острые изменения системных параметров водно-солевого обмена могут принимать участие механизмы регуляции экспрессии генов (MacManes M.D., 2017). Наряду с этим, в проксимальном сегменте нефрона объектом регуляторного влияния эпигенетических механизмов являются гены субъединиц натрий\калиевой АТФазы базолатеральной мембраны эпителия (Taub M., 2018). По мнению автора цитируемого обзора, сигналом для активации/инктивации транскрипции указанных генов может служить концентрация натрия в люминальной жидкости, а непосредственная реализация поступающих сигналов определяется интенсивностью ацетилирования гистонов. Наряду с этим, изменения внутриклеточной концентрации натрия в эпителии проксимального сегмента нефрона и тонкой восходящей петли Генле также может оказывать прямое влияние на состояние транскрипции генов транспортных белков, экспрессируемых данной популяцией нефроцитов (Gildea J.J. et al., 2018). Приводятся данные о том, что содержание натрия в рационе питания оказывает влияние на экспрессию генов белков-транспортеров натрия (ENaC и Na-Cl-котранспортер) в дистальном отделе нефрона (Ivy J.R. et al., 2018). С другой стороны, показано, что гипонатриевая диета стимулирует гипометилирование гена альдостерон-синтазы через активацию РАС (Takeda Y. et al., 2018). Привлекает внимание тот факт, что ядерные деацетилазы ренальной паренхимы (SIRT1,3,6,7) обладают способностью регулировать экспрессию ряда белков в тканях почки, имеющих фундаментальное значение для гомеостатических функций органа (Morigi M. et al., 2018). В частности, авторы обзора сообщают, что SIRT1 непосредственно регулирует экспрессию альфа-субъединицы эпителиального натриевого канала, эндотелиальной NO-синтазы и рецептора к ангиотензину-2 (AT1R) в подоцитах и гладкомышечных волокнах кровеносных сосудов почки. По данным авторов SIRT3 участвует в регуляции обменных процессов в митохондриях, обладает противовоспалительным и противосклерозирующим действием. Белок SIRT6 также необходим для сдерживания просклерозирующих факторов. Следует отметить, что, наряду с ковалентной модификацией хроматина, важная роль в эпигенетическом контроле ренального транспорта веществ отводится некодирующим РНК (Hua J.X. et al., 2012). Показана важная роль микро РНК в регуляции транспорта натрия в эпителии нефрона (Mladinov D. et al., 2013). Наряду с ионорегулирующей функцией почек, установлено, что некодирующие РНК могут принимать участие в управлении осморегулирующей функцией почек млекопитающих (Huang W. et al., 2011; Luo Y. et al., 2014). Авторы цитируемых публикаций указывают на роль микро РНК в регуляции экспрессии транспортных белков медуллярных сегментов нефрона в ответ на острый гиперосмотический стимул. Следует отметить, что в норме экспрессия некоторых типов микро РНК в корковом и мозговом слое почки имеет четкие отличия (Chandrasekaran K. et al., 2012; Ichii O., Horino T., 2018). Приводится информация о непосредственном влиянии гиперосмотического стимула на экспрессию строго определенных типов микро РНК во внутренней медулле почки (Chandrasekaran K. et al., 2012). Вместе с тем, авторы обращают внимание на тот факт, что состояние метаболизма микро РНК в ренальной паренхиме может регулироваться гуморальными факторами нейро-эндокринного звена контроля гомеостатических функций почек. При этом микро РНК осуществляют контроль транспорта ионов не только в почке, но и системные параметры ионного гомеостаза (Hua J.X. et al., 2012). В ряде публикаций подчеркивается тезис о том, что микро РНК могут осуществлять постоянную тонкую регуляцию обменных процессов в ренальной паренхиме. Например, имеются сообщения о роли микро РНК в регуляции обменных процессов в подоцитах, в зависимости от возможных изменений величины гидростатического давления в клубочке и химического состава ультрафильтрата (Trionfini P., Benigni A., 2017). Одним из наиболее перспективных направлений исследований роли микро РНК в регуляции деятельности почки является анализ взаимосвязи внутриорганного метаболизма микро РНК и их содержания в биологических средах организма (Thomas M.J. et al., 2018). С точки зрения практической медицины, ценность таких исследований обусловлена необходимостью внедрения новых методов диагностики и терапии заболеваний почек (Trionfini P., Benigni A., 2017; Thomas M.J. et al., 2018). Вместе с тем, значительное внимание уделяется роли гуморальных систем контроля гомеостатических функций почек в регуляции эспрессии генов в ренальной паренхиме (Hirohama D. et al., 2018; Lu C.C. et al., 2018). Приводятся данные о молекулярных механизмах регуляции локальной экспрессии белков-компонентов РАС (Martini A.G. et al., 2017; Lu C.C. et al., 2018). Ранее была показана роль микро РНК в регуляции экспрессии генов ренина (Sequeira-Lopez M.L.S. et al., 2010). В настоящее время установлена роль метилирования ДНК, ацетилирования и метилирования гистонов канальцевого эпителия в управлении экспрессией гена ангиотензиногена (Marumo T. et al., 2015). Показано участие метилирования ДНК, ковалентной модификации гистонов и метаболизма микро РНК в экспрессии генов ренина в почке (Martini A.G., Danser A.H.J., 2017). С другой стороны, выявлено значение ренин-ангиотензин-альдостероновой системы в регуляции экспрессии генов транспортных белков канальцевого отдела нефрона в ответ на изменение физиологических констант водно-солевого баланса (Hirohama D. et al., 2018). Установлено, что ковалентная модификация гистонов (метилирование и ацетилирование) может принимать участие в контроле экспрессии гена атриального натрийуретического пептида (Hohl M. et al., 2013). Сообщается, что эпигенетический контроль экспрессии гена атриального натрийуретического пептида способствует адаптивным изменениям продукции гормона (Sergeeva I.A. et al., 2016). При этом, атриальный натрийуретический пептид также рассматривается в качестве индуктора эпигенетических механизмов, реализуемых через специфические микро РНК (Li Y. et al., 2016). Не меньший интерес привлекают сведения о влиянии острого осмотического стимула на эпигенетические системы контроля синтеза аргинин-вазопрессина - АВП (Hayashi M. et al., 2006; Greenwood M.P. et al., 2016). Необходимо отметить, что половые стероидные гормоны также могут оказывать влияние на экспрессию гена АВП при участии эпигенетических механизмов (Augera C.J. et al., 2011). Поскольку канальцевые эффекты АВП реализуются при участии специфических поробразующих белков &mdash; аквапоринов, в частности, при участии аквапорина-2 (AQP2), привлекают интерес сведения о значении эпигенетического контроля данного белка (Park E.-J., Kwon T.H.; 2015; Jung H.J., Kwon T.-H.; 2016). <strong>1.2. ЭНДОКРИННЫЕ ФАКТОРЫ РЕГУЛЯЦИИ ВОДНО-СОЛЕВОГО БАЛАНСА ОРГАНИЗМА В СИСТЕМЕ ЭПИГЕНЕТИЧЕСКИХ МЕХАНИЗМОВ КОНТРОЛЯ ГОМЕОСТАЗА </strong> &nbsp; Предполагая определенную роль эпигенетических механизмов в регуляции гомеостатических функций почек и адаптивных изменениях органа, по нашему мнению, необходимо проанализировать, во-первых, информацию о роли эпигенетических механизмов в модуляции экспрессии генов белковых гормонов-регуляторов водно-солевого обмена. Во-вторых, свойства гуморальных факторов системного действия, как возможных индукторов эпигенетической трансформации ренальной паренхимы. Общеизвестна роль аргинин-вазопрессина, как системного регулятора осмотического гомеостаза, определяющего острую и точную реакцию организма на изменение пищевого и внутривенного поступления жидкости осмотически активных веществ (Bourque C.W., 2008; Thornton S.N.; 2010; Greenwood M.P. et al., 2015; Park E.-J., Kwon T.-H., 2015). Физиологическая роль ренин-ангиотензиновой системы определяется, как контролем реабсорбции весьма значительного объема ультрафильтрата, растворенных в нем натрия и калия, а также других жизненно важных компонентов ультрафильтрата (Zhuo J.L., Li X.C., 2001; Kurtz A., 2012; Gomez R.A., Sequeira-Lopez M.L.S., 2018). Таким образом, Ангиотензин-II принимает участие в регуляции показателей ионного, осмотического, волемического, кислотно-основного гомеостаза, а также регулирует тонус кровеносных сосудов. Атриальный (мозговой) натрий уретический пептид &mdash; важнейший гуморальный регулятор волемического гомеостаза, определяющий выведение натрия и жидкости на уровне дистального отдела нефрона (Kuwahara К., Nakao К., 2010; Nakagawa Y. et al., 2019). &nbsp; 1.2.1. АРГИНИН-ВАЗОПРЕССИН (АВП) &nbsp; Результаты более ранних исследований позволили установить, что изменения физиологических констант осмотического и волемического гомеостаза оказывают влияние на уровни транскрипции гена аргинин вазопрессина (АВП) (Kondo N. et al., 2004). Кроме того, авторами цитируемой публикации была выявлена корреляция между концентрацией катионов натрия во внеклеточной жидкости и уровнем экспрессии гена аргинин вазопрессина. Было продемонстрировано также резкое усиление транскрипции гена АВП под влиянием осмотического стимула (Hindmarch C.C.T., Murphy D., 2010). Наряду с этим, было показано, что гиперосмотический стимул усиливает транскрипцию ряда генов, белки которых аккумулируются в задней доли гипофиза (Hindmarch C. et al., 2006). Выявлено, что активация транскрипции гена аргинин вазопрессина, под влиянием осмотического воздействия, демонстрирует более выраженную чувствительность к стимулу, в сравнении с другими нейропептидами задней доли гипофиза (Yue C. et al., 2008). Сложность вопроса в том, что к осмотическому стимулу чувствительны также гены гипоталамо-гипофизарной оси, принимающие участие в регуляции репродуктивной сферы (Qiu J. et al., 2007). В то же время, было установлено, что осмотические нагрузки оказывают специфическое влияние на экспрессию вполне определенной группы генов в супраоптическом ядре крысы (Johnson K.R. et al., 2015). При этом, необходимо отметить, что, вероятно, ген аргинин вазопрессина содержит нуклеотидную последовательность в области промотора, обладающей чувствительностью к изменениям показателей осмотического гомеостаза (Ponzio T.A. et al., 2012). Авторами установлено отличие в первичной последовательности нуклеотидов данного участка генов аргинин вазопрессина и окситоцина. Далее, сопоставляя классическую схему физиологического контроля осмотического гомеостаза и факты, подтверждающие участие эпигенетических механизмов, опираясь на выше изложенные результаты исследований, мы констатируем, что показатель экспрессии гена аргинин вазопрессина обладает чувствительностью к сдвигам осмоляльности внеклеточной жидкости организма. Вероятный механизм влияния физико-химических условий внеклеточной жидкости (концентрации хлорида натрия во внеклеточной жидкости) на состояние транскрипции гена аргинин вазопрессина, в основном, подтвердили ранее выполненные наблюдения (Kondo N. et al., 2004; Hindmarch C.C., Murphy D., 2010). При этом отмечается, что АВП, помимо регуляции осмотического гомеостаза, может отвечать за поведенческие реакции, поэтому, с точки зрения авторов, нарушения осмотического гомеостаза могут негативно отражаться на адаптивных поведенческих реакциях (Mitchell N.C. et al., 2018). Показано, что экспрессия гена аргинин вазопрессина демонстрирует высокий уровень пластичности, и что интенсивность метилирования ДНК в области помотора гена гормона может существенно изменяться в зависимости от состояния показателей осмотического гомеостаза организма (Greenwood M.P. et al., 2016). Сообщается о видоспецифических молекулярных механизмах, вовлеченных в индукцию транскрипции аргинин вазопрессина, на фоне дегидратации организма (Stewart L. et al., 2011). Высокий уровень пластичности эпигенетических систем контроля биосинтеза аргинин вазопрессина подтверждается тем фактом, что усиление транскрипции гена гормона регистрируется в условиях острого гиперосмотического стимула раствором хлорида натрия (Kawasaki M. et al., 2009). В настоящее время имеются данные и о том, какие энзиматические системы, отвечающие за ковалентную трансформацию хроматина принимают участие в изменении транскрипции гена аргинин вазопрессина (Archer T., 2015). Дальнейшие исследования, проведенные научными сотрудниками групппы Murphy D. показали, что к чувствительностью к осмотическому стимулу обладают целый ряд генов (Caprin2), белки которых могут быть важны в формировании адаптивного ответа супраоптических ядер гипоталамуса на изменения осмотического гомеостаза организма (Loh S.-Y. et al., 2017). При том, что показана роль гена Caprin2 в механизмах стабилизации матричной РНК аргинин вазопрессина (Konopacka A. et al., 2015). Высказанный тезис можно дополнить сведениями о том, что микро РНК также принимают участие в эпигенетической модуляции активности нейро-эндокринного контроля осмотического гомеостаза (Luo Y. et al., 2014). В этом блоке анализа данных литературы необходимо выделить тот факт, что аргинин вазопрессин может непосредственно контролировать экспрессию транспортного белка Na+,K+,2Cl- котранспортера в восходящей петле Генле нефрона (Konopacka A. et al., 2015). Однако, непосредственно усиление экспрессии гена Na+,K+,2Cl-котранспортера по влиянием аргинин вазопрессина, рассматривается в качестве долговременной АВП- зависимой стимуляции белка (Knepper M.A. et al., 2015). Вместе с тем, авторы обзора подчеркивают, что аргинин вазопрессин может контролировать в дистальных сегментах нефрона экспрессию таких транспортных белков, как: натрий-хлор котранспортирующий протеин, переносчик мочевины, некоторые субъединицы эпителиального натриевого канала порообразующих белков аквапоринов. Подчеркивается актуальность данных механизмов в изучении патогенеза заболеваний почек и сердечно-сосудистой системы (Qian Q., 2018). Также анализируется АВП-зависимые системы внутриклеточной передачи сигнала (через протеин киназы) в эпителии собирательных трубочек канальцевого отдела нефрона, как звено индукции эпигенетического контроля экспрессии генов транспортных белков (Sanghi A. et al., 2014). С другой стороны, анализируется взаимосвязь различных изоформ аденилатциклаз и протеинкиназ в системе регуляции генов транспортных белков в эпителии собирательных трубочек (Roos K.P. et al., 2013). Завершая рассмотрение роли эпигенетических механизмов в поддержании осмотического гомеостаза, необходимо отметить участие АВП в долговременной стимуляции биосинтеза и экспрессии аквапорина-2 в эпителии собирательных трубочек канальцевого отдела нефрона (Wilson J.L.L. et al., 2013). Были установлены механизмы активации транскрипции гена аквапорина-2, включающие в себя механизмы внутриклеточной передачи сигнала, а также идентифицированы участки ДНК предполагаемого связывания регулятора транскрипции (Yua M.-J. et al., 2009). Проведен анализ метаболизма белка аквапорина-2 в эпителии собирательных трубочек канальцевого отдела нефрона и роль АВП в управлении транскрипции гена AQP2 (Jung H.J., Kwon T.H., 2016). Наряду с этим, авторы цитируемого обзор указывают на роль микро РНК (miR-32 и miR-137) в процессах внутриклеточного метаболизма протеина аквапорина-2. Оценивая роль эпигенетического контроля физиологических функций собирательных трубочек (Xiao Z. et al., 2016), авторы приходят к выводу, что баланс активности ядерных метилтрансфераз (Dot1lAC и Dot1lf/f) в эпителии данного сегмента нефрона, может оказывать существенное влияние на экспрессию белка аквапорин-2. Поскольку изменения в продукции и биологических эффектах аргинин вазопрессина имеют отношение не только к регуляции водно-солевого гомеостаза, но и к поведенческим реакциям человека, изучение эпигенетических процессов контроля, например, рецепторов АВП также является объектом междисциплинарных исследований (Bodden C. et al., 2017). &nbsp; 1.2.2. НАТРИЙУРЕТИЧЕСКИЕ ПЕПТИДЫ &nbsp; Интерес к эпигенетическим системам контроля АНП также в некоторой степени обусловлен нейротропными эффектами гормона (Frieling H. et al., 2008). Были достаточно подробно изучены физиологически активные вещества, способные индуцировать транскрипцию генов атриального (АНП), мозгового (БНП) и С-типа натрийуретических пептидов, структура генов и самих натрийуретических гормонов (Gardner D.G. et al., 2007; Kuwahara К., Nakao К., 2010; Ichiki T., Burnett J.C., 2017; Nakagawa Y. et al., 2019). Вместе с тем, имеются данные о том, что АНП может синтезироваться эпителием канальцевого отдела нефрона (Dong L. et al., 2016; Pandey K.N., 2018). При этом, в некоторых обзорных публикациях высказывается тезис о важной практической значимости исследований эпигенетического контроля экспрессии генов натрийуретических пептидов (DiSalvo T.G., 2015; Man J. et al., 2018). Поскольку представляет интерес несколько аспектов данной проблемы: эффективность использования параметров синтеза и секреции натрийуретических пептидов в качестве диагностических маркеров ряда актуальных нозологий, исследования собственно механизмов контроля экспрессии генов этих гормонов и вовлеченность в этот процесс некоторых гормонов и цитокинов, участвующих в патогенезе заболеваний сердечно-сосудистой системы и почек: ангиотензин-2, трансформирующий фактор роста-бета1, гормоны щитовидной железы (Sergeeva I.A., Christoffels V.M., 2013). Вместе с тем, данные литературы подчеркивают значение уровня экспрессии рецепторов натрийуретических пептидов в сердечно-сосудистой системе и ренальной паренхиме для понимания физиологических и патофизиологических эффектов гормонов (Pandey K.N., 2011; Kumar P. et al., 2014). Результаты экспериментальных исследований показали, что гипертрофия кардиомиоцитов токсического генеза сопровождается снижением продукции miR-133a на фоне усиления метилирования ДНК метилтрансферазами ДНК DNMT1 и DNMT3b, а также дозозависимым увеличением уровня м-РНК АНП и БНП (Huang L. et al., 2016). Снижение уровня miR-133a в миокарде было обнаружено у лабораторных крыс, подвергавшихся продолжительной инфузии ангиотензина-2 (Li Y. et al., 2016). Вместе с тем, авторы сообщают, что предварительное введение животным рекомбинантного АНП благоприятно сказывалось на динамике miR-133a. Показано, что в условиях неишемической кардиомиопатии наблюдается снижение экспрессии генов АНП и БНП в кардиомиоцитах на фоне усиления метилирования остатка лизина H3 гистона нуклеосомы (Ito E. et al., 2017). Наряду с этим, авторами публикации выявлена взаимосвязь биосинтеза АНП в кардиомиоцитах и продукции (miR-133a) микро РНК. Результаты дальнейших наблюдений показали, что микро РНК-30 может принимать участие в регуляции синтеза БНП (Nakagawa Y. et al., 2019). Важная роль в регуляторном эффекте гормона отводится его рецепторам. В этом смысле, привлекают внимание сведения о том, что уровень экспрессии рецептора популяции А к натрийуретическому пептиду, наиболее физиологически активных рецепторов к АНП (БНП), негативно коррелирует с параметрами энзиматической активности изоформы ДНК-метилтрансферазы DNMT3B (Shen K. et al., 2017). Наряду с этим, высказывается мнение о ключевой роли деацетилаз гистоновых белков (HDAC4) в регуляции экспрессии генов АНП И БНП в норме и при патологии (Hohl M. et al., 2013). В результате экспериментальных исследований установлено, что нарушения функционального состояния миокарда сопровождаются изменениями продукции АНП и БНП на фоне деметилирования H3K9 в промоторных областях генов данных белков и умеренного повышения ацетилирования Н3 гистона (H3K27ac) (Sergeeva I.A. et al., 2016). Тогда показатели ацетилирования H3K9 существенно не были изменены. Ранее полученные сведения также подчеркивают роль ацетилирования белков гистонов в регуляции экспрессии рецептора популяции А к натрийуретическому пептиду в ренальной паренхиеме, (Kumar P., Pandey K.N., 2009). По мнению авторы цитируемой публикации, ацетилтрансфераза белков гистонов (Р300), при участии специализированной микро РНК, может регулировать экспрессию гена гуанилил циклазы-А/рецептора-А натрийуретического пептида. В дальнейших исследованиях авторами было показано, что эпигенетический механизм регуляции экспрессии гуанилил циклазы-А/рецептора-А натрийуретического пептида (<em>Npr1</em>) на основе баланса ацетилирования гистонов (ацетилтрансфераза Р300 и деацетилазы гистонов HDAC1/2), может выполнять важную роль в поддержании физиологических констант волемического гомеостаза организма (Kumar P. et al., 2014). Вместе с тем, авторами высказывается мысль о том, что величина осмотического давления во неклеточной жидкости, уровень продукции ангиотензина-II и витамин Д могут оказывать влияние на показатели экспрессии гена <em>Npr1</em>. Подчеркивается, что амплификация генов (Nppa и Nppb), а также рецепторов натрийуретических пептидов, препятствует повышению кровяного давления, способствует усилению почечного кровотока, увеличению скорости клубочковой фильтрации, ограничивает процессы воспаления и фиброза в ренальной паренхме (Pandey K.N., 2018). Авторы цитируемого обзора также указывают, что натрийуретические пептиды обладают способностью сдерживать активность ренин-ангиотензин-альдостероновой системы. Обращает на себя внимание тот факт, что значительное количество публикаций по данной тематике отмечают антагонизм физиологических эффектов натрийуретических пептидов и трансформирующего фактора роста бета1 (ТФР бета1). Причина такого внимания, по нашему мнению, объясняется фундаментальной ролью ТФР бета1 в ряде патогенетических механизмов нарушения функций органов сердечно-сосудистой системы и почек (Chen L. et al., 2018). В этом смысле, уместно привести данные о том, что ТФР бета1 может оказывать влияние на систему натрийуретических пептидов, подавляя транскрипцию гена <em>Npr1 -</em> основного рецептора гормонов<em> </em>в мышечном слое стенки аорты лабораторных мышей (Sen A. et al., 2016). <strong>СПИСОК ЛИТЕРАТУРЫ К ГЛАВЕ</strong> <strong>&laquo;ЭПИГЕНЕТИЧЕСКИЕ</strong><strong> </strong><strong>МЕХАНИЗМЫ </strong><strong>В СИСТЕМЕ КОНТРОЛЯ ФУНКЦИИ ПОЧЕК В НОРМЕ&raquo; </strong> &nbsp; 1.Adli M., Parlak M., Li Y., El-Dahr S. Epigenetic States of Nephron Progenitors and Epithelial Differentiation. J Cell Biochem. 2015;116(6): 893&ndash;902 doi:10.1002/jcb.25048 &nbsp; 2.Hilliard S.A, El-Dahr S.S. Epigenetics mechanisms in renal development. Pediatr Nephrol. 2016;31(7):1055&ndash;1060 doi:10.1007/s00467-015-3228-x &nbsp; 3.Liu H., Chen S., Yao X., Li Y., Chen C.-H., Liu J., Saifudeen Z., El-Dahr S.S. Histone deacetylases 1 and 2 regulate the transcriptional programs of nephron progenitors and renal vesicles.Development. 2018;145,dev153619 doi:10.1242/dev.153619 &nbsp; 4.Martini A.G., Danser A.H.J. Juxtaglomerular Cell Phenotypic Plasticity. High Blood Press Cardiovasc Prev, 2017;24:231&ndash;242 doi 10.1007/s40292-017-0212-5 &nbsp; 5.Stocher D.P., Klein C.P., Saccomori A.B., August P.M., Martins N.C., Couto P.R.G, Hagen M.E.K., Mattй C. Maternal high-salt diet alters redox state and mitochondrial function in newborn rat offspring&rsquo;s brain. British Journal of Nutrition, 2018;119: 1003&ndash;1011 doi:10.1017/S0007114518000235 &nbsp; 6.Hilliard S.A., El-Dah S.S. Epigenetics of Renal Development and Disease. Yale Journal of Biology and Medicine,2016;89(4):565-573 PMC5168832 &nbsp; 7.Mugatroyd C., Wu Y., Bockmuhl Y., Spengler D. The Janus face of DNA methylation in aging. Aging,2010;2(2):107-110 doi:10.18632/aging.100124 &nbsp; 8.Greenwood M.P., Greenwood M., Romanova E.V., Mecawi A.S., Paterson A., Sarenac O., Japundzic-Zigon N., Antunes-Rodrigues J., Paton J.F.R., Sweedler J.V., Murphy D. The effects of aging on biosynthetic processes in the rat hypothalamic osmoregulatory neuroendocrine system. Neurobiology of Aging, 2018; 65:178-191 doi.org/10.1016/j.neurobiolaging.2018.01.008 &nbsp; 9.Ho J., Kreidberg J.A. The Long and Short of MicroRNAs in the Kidney. J Am Soc Nephrol,2012;23: 400&ndash;404 doi: 10.1681/ASN.2011080797 &nbsp; 10.Trionfini P., Benigni A. MicroRNAs as Master Regulators of Glomerular Function in Health and Disease. J Am Soc Nephrol,2017;28:1686&ndash;1696 doi: https://doi.org/10.1681/ASN.2016101117 &nbsp; 11.Tain Y.-L., Huang L.-T., Hsu C.-N. Developmental Programming of Adult Disease: Reprogramming by Melatonin? Int. J. Mol. Sci., 2017; 18: 426 doi:10.3390/ijms18020426 &nbsp; 12.Lay A.C., Coward R.J.M. The Evolving Importance of Insulin Signaling in Podocyte Health and Disease. Front. Endocrinol,2018;9:693 doi: 10.3389/fendo.2018.00693 &nbsp; 13.Shiels P.G., McGuinness D., Eriksson M., Kooman J.P., Stenvinkel P. The role of epigenetics in renal ageing. Nature Reviews Nephrology, 2017;13:471-482 doi:10.1038/nrneph.2017.78 &nbsp; 14.Morigi M., Perico L., Benigni A. Sirtuins in Renal Health and Disease. Journal of the American Society of Nephrology, 2018;29(7):1799-1809 doi: 10.1681/ASN.2017111218 &nbsp; 15.Azzi A., Dallmann R., Casserly A., Rehrauer H., Patrignani A., Maier B., Kramer A., Brown S.A. Circadian behavior is light-reprogrammed by plastic DNA methylation, Nature Neuroscience,2014;17:377&ndash;382 doi:10.1038/nn.3651 &nbsp; 16.Zhang D., Yu Z., Cruz P., Kong Q., Li S., Kone B.C Epigenetics and the control of epithelial sodium channel expression in collecting duct. Kidney International, 2009; 75:260&ndash;267 doi:10.1038/ki.2008.475 &nbsp; 17.Wei Q., Bhatt K., He H.-Z., Mi Q.-S., Haase V.H., Dong Z. Targeted Deletion of Dicer from Proximal Tubules Protects against Renal Ischemia-Reperfusion Injury. J Am Soc Nephrol, 2010;21:756&ndash;761 doi: 10.1681/ASN.2009070718 &nbsp; 18.Chou Y.-H., Huang T.-M., Chu T.-S. Novel insights into acute kidney injury&ndash;chronic kidney disease continuum and the role of renin&ndash;angiotensin system. Journal of the Formosan Medical Association,2017;116:652e659 http://dx.doi.org/10.1016/j.jfma.2017.04.026 19.MacManes M.D. Severe acute dehydration in a desert rodent elicits a transcriptional response that effectively prevents kidney injury. Am J Physiol Renal Physiol, 2017; 313:F262&ndash;F272 doi:10.1152/ajprenal.00067.2017 &nbsp; 20.Taub M. Gene Level Regulation of Na,K-ATPase in the Renal Proximal Tubule Is Controlled by Two Independent but Interacting Regulatory Mechanisms Involving Salt Inducible Kinase 1 and CREB-Regulated Transcriptional Coactivators. Int. J. Mol. Sci, 2018;19:2086 doi:10.3390/ijms19072086 &nbsp; 21.Gildea J.J., Xu P., Kemp B.A., Carlson J,M., Tran HT, Bigler Wang D, et al. Sodium bicarbonate cotransporter NBCe2 gene variants increase sodium and bicarbonate transport in human renal proximal tubule cells. PLoS ONE, 2018;13(4): e0189464 https://doi.org/10.1371/journal.pone.0189464 &nbsp; 22.Ivy J.R., Evans L.C., Moorhouse R., Richardson RV, Al-Dujaili E.A.S., Flatman P.W., Kenyon C.J., Chapman K.E., Bailey M.A. Renal and Blood Pressure Response to a High-Salt Diet in Mice With Reduced Global Expression of the Glucocorticoid Receptor. Front. Physiol, 2018;9:848 doi: 10.3389/fphys.2018.00848 &nbsp; 23.Takeda Y., Demura M., Wang F., Karashima S., Yoneda T., Kometani M., Hashimoto A., Aono D., Horike S., Meguro-Horike M., Yamagishi M., Takeda Y. Epigenetic Regulation of Aldosterone Synthase Gene by Sodium and Angiotensin II. J Am Heart Assoc, 2018;7:e008281 doi: 10.1161/JAHA.117.008281 &nbsp; 24.Hua J.X., Ting Z.J., Chan C.H. Ion channels/transporters as epigenetic regulators? A microRNA perspective. Science china Life Sciences,2012;55(9):753&ndash;760 doi: 10.1007/s11427-012-4369-9 &nbsp; 25.Mladinov D., Liu Y., Mattson D.L., Liang M. MicroRNAs contribute to the maintenance of cell-type-specific physiological characteristics: miR-192 targets Na+/K+-ATPase b1. Nucleic Acids Research, 2013:41, No. 2 1273&ndash;1283 doi:10.1093/nar/gks1228 &nbsp; 26.Huang W., Liu H., Wang T., Zhang T., Kuang J., Luo Y., Chung S.S.M., Yuan L., Yang J.Y. Tonicity-responsive microRNAs contribute to the maximal induction of osmoregulatory transcription factor OREBP in response to high-NaCl hypertonicity. Nucleic Acids Research, 2011;39(2):475&ndash;485 doi:10.1093/nar/gkq818 &nbsp; 27.Luo Y., Liu Y., Liu M., Wei J., Zhang Y., Hou J., Huang W., Wang T., Li X., He Y., Ding F., Yuan L., Cai J., Zheng F., Yang J.Y. Sfmbt2 10th intron-hosted miR-466(a/e)-3p are important epigenetic regulators of Nfat5 signaling, osmoregulation and urine concentration in mice. Biochimica et Biophysica Acta, 2014;1839:97&ndash;106 http://dx.doi.org/10.1016/j.bbagrm.2013.12.005 &nbsp; 28.Chandrasekaran K., Karolina D.S., Sepramaniam S., Armugam A., Wintour E.M., Bertram J.F., Jeyaseelan K. Role of microRNAs in kidney homeostasis and disease. Kidney International,2012;81:617&ndash;627 doi:10.1038/ki.2011.448 &nbsp; 29.Ichii O., Horino T. MicroRNAs associated with the development of kidney diseases in humans and animals. J Toxicol Pathol,2018;31(1):23&ndash;34 doi:10.1293/tox.2017-0051 &nbsp; 30.Thomas M.J., Fraser D.J., Bowen T.Biogenesis, Stabilization, and Transport of microRNAs in Kidney Health and Disease. Non-coding RNA,2018;4(4):E30 doi:10.3390/ncrna4040030 &nbsp; 31.Hirohama D., Ayuzawa N., Ueda K., Nishimoto M., Kawarazaki W., Watanabe A., Shimosawa T., Marumo T., Shibata S., Fujita T. Aldosterone Is Essential for Angiotensin II-Induced Upregulation of Pendrin. J Am Soc Nephrol, 2018;29:57&ndash;68 doi: https://doi.org/10.1681/ASN.2017030243 &nbsp; 32.Lu C.C., Ma K.L., Ruan X.Z., Liu B.C. Intestinal dysbiosis activates renal renin-angiotensin system contributing to incipient diabetic nephropathy. Int. J. Med. Sci.,2018;15(8):816-822 doi: 10.7150/ijms.25543 &nbsp; 33.Martini A.G., Xa L.K., Lacombe M.-J., Blanchet-Cohen A., Mercure C., Haibe-Kains B., Friesema E.C.H.., van den Meiracker A.H., Gross K.W., Azizi M., Corvol P., Nguyen G., Reudelhuber T.L., Danser A.H.J. Transcriptome Analysis of Human Reninomas as an Approach to Understanding Juxtaglomerular Cell Biology. Hypertension. 2017;69:1145-1155 doi:10.1161/HYPERTENSIONAHA.117.09179 &nbsp; 34.Sequeira-Lopez M.L.S., Weatherford E.T., Borges G.R., Monteagudo M.C., Pentz E.C., Harfe B.D., Carretero O., Sigmund C.D., Gomez R.A. The MicroRNA-Processing Enzyme Dicer Maintains Juxtaglomerular Cells. J Am Soc Nephrol,2010;21:460&ndash;467 doi: 10.1681/ASN.2009090964 &nbsp; 35.Marumo T., Yagi S., Kawarazaki W., Nishimoto M., Ayuzawa N., Watanabe A., Ueda K., Hirahashi J., Hishikawa K., Sakurai H., Shiota K., Fujita T. Diabetes Induces Aberrant DNA Methylation in the Proximal Tubules of the Kidney. J Am Soc Nephrol,2015;26:2388&ndash;2397 doi: 10.1681/ASN.2014070665 &nbsp; 36.Martini A.G., Danser A.H.J. Juxtaglomerular Cell Phenotypic Plasticity. High Blood Press Cardiovasc Prev,2017;24:231&ndash;242 doi 10.1007/s40292-017-0212-5 &nbsp; 37.Hohl M., Wagner M., Reil J.-C., Mьller S.-A., Tauchnitz M., Zimmer A.M., Lehmann L.H., Thiel G., Bцhm M., Backs J., Maack C. HDAC4 controls histone methylation in response to elevated cardiac load. J Clin Invest.2013;123(3):1359&ndash;1370 doi:10.1172/JCI61084 &nbsp; 38.Sergeeva I.A., Hooijkaas I.B., Ruijter J.M., van der Made I., de Groot N.E., van de Werken H.J.G., Creemers E.E., Christoffels V.M. Identification of a regulatory domain controlling the Nppa-Nppb gene cluster during heart development and stress. Development,2016;143:2135-2146 doi:10.1242/dev.132019 &nbsp; 39.Li Y., Cai X., Guan Y., Wang L., Wang S., Li Y. et al. Adiponectin Upregulates MiR-133a in Cardiac Hypertrophy through AMPK Activation and Reduced ERK1/2 Phosphorylation. PLoS ONE,2016;11(2):e0148482 doi:10.1371/journal.pone.0148482 &nbsp; 40.Hayashi M., Arima H., Goto M., Banno R., Watanabe M., Sato I., Nagasaki H., Oiso Y. Vasopressin gene transcription increases in response to decreases in plasma volume, but not to increases in plasma osmolality, in chronically dehydrated rats. Am J Physiol Endocrinol Metab,2006;290:E213&ndash;E217 doi:10.1152/ajpendo.00158.2005 &nbsp; 41.Greenwood M.P., Greenwood M., Gillard B.T., Loh S.Y., Paton J.F.R., Murphy D. Epigenetic Control of the Vasopressin Promoter Explains Physiological Ability to Regulate Vasopressin Transcription in Dehydration and Salt Loading States in the Rat. Journal of Neuroendocrinology, 2016;28(4):10.1111/jne.12371 doi: 10.1111/jne.12371 &nbsp; 42.Augera C.J., Cossa D., Augera A.P., Forbes-Lorman R.M. Epigenetic control of vasopressin expression is maintained by steroid hormones in the adult male rat brain. PNAS,2011;108(10):4242&ndash;4247 doi:10.1073/pnas.1100314108 &nbsp; 43.Park E.-J., Kwon T.H. A Minireview on Vasopressin-regulated Aquaporin-2 in Kidney Collecting Duct Cells. Electrolyte Blood Press,2015;13:1-6 doi.org/10.5049/EBP.2015.13.1.1 &nbsp; 44.Jung H.J., Kwon T.-H. Molecular mechanisms regulating aquaporin-2 in kidney collecting duct. Am J Physiol Renal Physiol,2016,311:F1318&ndash;F1328 doi:10.1152/ajprenal.00485.2016 &nbsp; 45.Bourque C.W. Central mechanisms of osmosensation and systemic osmoregulation. Nat Rev Neurosci. 2008;9(7):519-531 doi: 10.1038/nrn2400 &nbsp; 46.Thornton S.N. Thirst and hydration: physiology and consequences of dysfunction. Physiol Behav. 2010;100(1):15-21 doi:10.1016/j.physbeh.2010.02.026 &nbsp; 47.Greenwood M.P., Mecawi A.S.,Hoe S.Z., Mustafa M.R., Johnson K.R., Al-Mahmoud G.A., Elias L.L.K., Paton J.F.R., Antunes-Rodrigues J., Gainer H., Murphy D., Hindmarch C.C.T. A comparison of physiological and transcriptome responses to water deprivation and salt loading in the rat supraoptic nucleus. Am J Physiol Regul Integr Comp Physiol. 2015;<em> </em>308: R559&ndash;R568 doi:10.1152/ajpregu.00444.2014 &nbsp; 48.Park E.-J., Kwon T.-H. A Minireview on Vasopressin-regulated Aquaporin-2 in Kidney Collecting Duct Cells. Electrolyte Blood Press. 2015; 13(1): 1&ndash;6 doi: 10.5049/EBP.2015.13.1.1 &nbsp; 49.Zhuo J.L., Li X.C. New Insights and Perspectives on Intrarenal Renin-Angiotensin System: Focus on Intracrine/Intracellular Angiotensin II. Peptides. 2011; 32(7): 1551&ndash;1565 doi: 10.1016/j.peptides.2011.05.012 &nbsp; 50.Kurtz A. Control of renin synthesis and secretion. Am J Hypertens. 2012;25(8):839-847 doi: 10.1038/ajh.2011.246 &nbsp; 51.Gomez R.A., Sequeira-Lopez M.L.S. Renin cells in homeostasis, regeneration and immune defence mechanisms. Nat Rev Nephrol. 2018;14(4):231-245 doi:10.1038/nrneph.2017.186 &nbsp; 52.Kuwahara К., Nakao К. Regulation and signifcance of atrial and brain natriuretic peptides as cardiac hormones. Endocrine Journal<em> </em>2010;57(7):555-565 PMID: 20571250 &nbsp; 53.Nakagawa Y., Nishikimi T., Kuwahara K.Atrial and brain natriuretic peptides: Hormones secreted from the heart. Peptides. 2019;111:18-25 doi: 10.1016/j.peptides.2018.05.012 &nbsp; 54.Kondo N., Arima H., Banno R., Kuwahara S., Sato I., Oiso Y. Osmoregulation of vasopressin release and gene transcription under acute and chronic hypovolemia in rats. Am J Physiol Endocrinol Metab. 2004;<em> </em>286(3): E337&ndash;E346 PMID:14613925 doi:10.1152/ajpendo.00328.2003 &nbsp; 55.Hindmarch C.C.T., Murphy D. The Transcriptome and the Hypothalamo Neurohypophyseal System. Pediatric Neuroendocrinology. Endocr Dev. 2010;17:1&ndash;10 https://doi.org/10.1159/000262523 &nbsp; 56.Hindmarch C., Yao S., Beighton G., Paton J., Murphy D. A comprehensive description of the transcriptome of the hypothalamoneurohypophyseal system in euhydrated and dehydrated rats. PNAS, 2006;103(5): 1609&ndash;1614 PMID:16432224 PMCID:PMC1360533 doi:10.1073/pnas.0507450103 &nbsp; 57.Mitchell N.C., Gilman T.L., Daws L.C., Toney G.M. High Salt Intake Enhances Swim Stress-Induced PVN Vasopressin Cell Activation and Active Stress Coping Psychoneuroendocrinology. 2018;93:29-38 https://doi.org/10.1016/j.psyneuen.2018.04.003 &nbsp; 58.Yue C., Mutsuga N., Sugimura Y., Verbalis J., Gainer H. Differential Kinetics of Oxytocin and Vasopressin Heteronuclear RNA Expression in the Rat Supraoptic Nucleus in Response to Chronic Salt Loading In vivo. Journal of Neuroendocrinology. 2008;20:227&ndash;232 PMID:18088359 doi: 10.1111/j.1365-2826.2007.01640.x &nbsp; 59.Hindmarch C.C., Murphy D. The transcriptome and the hypothalamo-neurohypophyseal system. Endocr Dev. 2010;17:1-10 Doi: 10.1159/000262523 &nbsp; 60.Qiu J., Yao S., Hindmarch C., Antunes V., Paton J., Murphy D. Transcription Factor Expression in the HypothalamoNeurohypophyseal System of the Dehydrated Rat: Upregulation of Gonadotrophin Inducible Transcription Factor 1 mRNA Is Mediated by cAMP-Dependent Protein Kinase A. J. Neurosci.2007;27(9):2196&ndash;2203 doi:10.1523/JNEUROSCI.5420-06.2007 &nbsp; 61.Johnson K.R., Hindmarch C.C.T., Salinas Y.D., Shi Y., Greenwood M., Hoe S.Z., et al. (2015) A RNASeq Analysis of the Rat Supraoptic Nucleus Transcriptome: Effects of Salt Loading on Gene Expression. PLoS ONE. 2015;10(4): e0124523 doi:10.1371/journal.pone.0124523 &nbsp; 62.Ponzio T.A., Fields R.L., Rashid O.M., Salinas Y.D., Lubelski D., Gainer H. Cell-Type Specific Expression of the Vasopressin Gene Analyzed by AAV Mediated Gene Delivery of Promoter Deletion Constructs into the Rat SON In Vivo. PloS One. 2012;7(11):e48860 doi: 10.1371/journal.pone.0048860 &nbsp; 63.Kawasaki M., Ponzio T.A., Yue C., Fields R.L., Gainer H. Neurotransmitter regulation of c-<em>fos </em>and vasopressin gene expression in the rat supraoptic nucleus. Exp Neurol. 2009; 219(1): 212&ndash;222 doi:10.1016/j.expneurol.2009.05.019 &nbsp; 64.Stewart L., Hindmarch C.C.T., Qiu J., Tung Y.-C. L., Yeo G.S.H., Murphy D. Hypothalamic Transcriptome Plasticity in Two Rodent Species Reveals Divergent Differential Gene Expression But Conserved Pathways. Journal of Neuroendocrinology. 2011; 23:177&ndash;185 PMID:21070396 doi: 10.1111/j.1365-2826.2010.02093.x &nbsp; 65.Archer T. Epigenetic Changes Induced by Exercise. Journal of Reward Defciency Syndrome. 2015;1(2):71-74 &nbsp; 66.Loh S.-Y., Jahans-Price T., Greenwood M.P., Greenwood M., Hoe S.-Z., Konopacka A., Campbell C., Murphy D., Hindmarch C.C.T. Unsupervised Network Analysis of the Plastic Supraoptic Nucleus Transcriptome Predicts Caprin2 Regulatory Interactions. eNeuro.2017;4(6). pii: ENEURO.0243-17.2017 doi: 10.1523/ENEURO.0243-17.2017 &nbsp; 67.Konopacka A., Greenwood M., Loh S.-Y., Paton J., Murphy D. RNA binding protein Caprin-2 is a pivotal regulator of the central osmotic defense response. eLife 2015;4:e09656 doi: 10.7554/eLife.09656 PMID:26559902 &nbsp; 68.Konopacka A., Qiu J., Yao S.T., Greenwood M.P., Greenwood M., Lancaster T., Inoue W., Mecawi A.S., Vechiato F.M., de Lima J.B., Coletti R., Hoe S.Z., Martin A., Lee J., Joseph M., Hindmarch C., Paton J., Antunes-Rodrigues J., Bains J., Murphy D. Osmoregulation requires brain expression of the renal Na-K-2Cl cotransporter NKCC2. J Neurosci.2015;35(13):5144-5155 doi: 10.1523/JNEUROSCI.4121-14.2015 &nbsp; 69.Knepper M.A., Kwon T.-H., Nielsen S. Molecular Physiology of Water Balance. N Engl J Med. 2015; 372(14): 1349&ndash;1358 doi:10.1056/NEJMra1404726 &nbsp; 70.Qian Q. Salt, water and nephron: Mechanisms of action and link to hypertension and chronic kidney disease. Nephrology (Carlton). 2018; 23(Suppl Suppl 4): 44&ndash;49 doi:10.1111/nep.13465 PMID: 30298656 &nbsp; 71.Sanghi A., Zaringhalam M., Corcoran C.C., Saeed F., Hoffert J.D., Sandoval P., Pisitkun T., Knepper M.A.<strong> </strong>A knowledge base of vasopressin actions in the kidney. Am J Physiol Renal Physiol. 2014;307: F747&ndash;F755 doi:10.1152/ajprenal.00012.2014 &nbsp; 72.Roos K.P., Bugaj V., Mironova E., Stockand J.D., Ramkumar N., Rees S., KohanD.E.Adenylyl Cyclase VI Mediates Vasopressin-Stimulated ENaC Activity. J Am Soc Nephrol. 2013; 24(2): 218&ndash;227 doi:10.1681/ASN.2012050449 PMCID: PMC3559481 PMID: 23264685 &nbsp; 73.Wilson J.L.L., Miranda C.A., Knepper M.A. Vasopressin and the Regulation of Aquaporin-2. Clin Exp Nephrol. 2013; 17(6): 10.1007/s10157-013-0789-5 doi:10.1007/s10157-013-0789-5 PMID: 23584881 &nbsp; 74.Yua M.-J., Miller R.L., Uawithya P., Rinschen M.M., Khositseth S., Braucht D.W.W., Chou C.L., Pisitkun T., Nelson R.D., Knepper M.A. Systems-level analysis of cell-specific AQP2 gene expression in renal collecting duct. PNAS. 2009;106(7): 2441&ndash;2446 https://doi.org/10.1073/pnas.0813002106 &nbsp; 75.Jung H.J., Kwon T.H.<strong> </strong>Molecular mechanisms regulating aquaporin-2 in kidney collecting duct. Am J Physiol Renal Physiol. 2016;<em> </em>311: F1318 &ndash;F1328 doi:10.1152/ajprenal.00485.2016 &nbsp; 76.Xiao Z., Chen L., Zhou Q., Zhang W. Dot1l deficiency leads to increased intercalated cells and upregulation of V-ATPase B1 in mice. Exp Cell Res. 2016; 344(2): 167&ndash;175. doi:10.1016/j.yexcr.2015.09.014 &nbsp; 77.Bodden C., van den Hove D., Lesch K.-P., Sachser N. Impact of varying social experiences during life history on behaviour, gene expression, and vasopressin receptor gene methylation in mice. Sci Rep. 2017; 7: 8719 doi:10.1038/s41598-017-09292-0 PMID: 28821809 &nbsp; 78.Frieling H., Bleich S., Otten J., Ro&uml;mer K.D., Kornhuber J., de Zwaan M., Jacoby G.E., Wilhelm J., Hillemacher T. Epigenetic Downregulation of Atrial Natriuretic Peptide but not Vasopressin mRNA Expression in Females with Eating Disorders is Related to Impulsivity. Neuropsychopharmacology. 2008;33:2605&ndash;2609 doi:10.1038/sj.npp.1301662 &nbsp; 79.Gardner D.G., Chen S., Glenn D.J., Grigsby C.L. Molecular Biology of the Natriuretic Peptide System Implications for Physiology and Hypertension. Hypertension. 2007;49:419-426 doi: 10.1161/01.HYP.0000258532.07418.fa &nbsp; 80.Ichiki T., Burnett J.C. Atrial Natriuretic Peptide. Old But New Therapeutic in Cardiovascular Diseases. Circ J.<em> </em>2017; 81:<strong> </strong>913&ndash;919 doi:10.1253/circj.CJ-17-0499 &nbsp; 81.Nakagawa Y., Nishikimi T., Kuwahara K. Atrial and brain natriuretic peptides: Hormones secreted from the heart. Peptides. 2019;111:18-25 doi: 10.1016/j.peptides.2018.05.012 PMID:29859763 &nbsp; 82.Sergeeva I.A., Christoffels V.M. Regulation of expression of atrial and brain natriuretic peptide, biomarkers for heart developmentand disease. Biochim Biophys Acta. 2013;1832(12):2403-2413 doi: 10.1016/j.bbadis.2013.07.003 &nbsp; 83.Dong L., Wang H., Dong N., Zhang Ce., Xue B., Wu Q. Localization of corin and atrial natriuretic peptide expression in human renal segments. Clin Sci (Lond). 2016; 130(18): 1655&ndash;1664 doi:10.1042/CS20160398 &nbsp; 84.Pandey K.N. Molecular and genetic aspects of guanylyl cyclase natriuretic peptide receptor-A in regulation of blood pressure and renal function. Physiol Genomics. 2018;50(11):913-928 doi: 10.1152/physiolgenomics.00083.2018 &nbsp; 85.DiSalvo T.G. Epigenetic regulation in heart failure: part II DNA and chromatin. Cardiol Rev. 2015;23(6):269-281 doi:10.1097/CRD.0000000000000074 &nbsp; 86.Man J., Barnett P., Christofels V.M. Structure and function of the <em>Nppa</em>&ndash;<em>Nppb </em>cluster locus during heart development and disease. Cell Mol Life Sci. 2018;75(8):1435-1444 doi: 10.1007/s00018-017-2737-0 &nbsp; 87.Pandey K.N. Guanylyl Cyclase/Atrial Natriuretic Peptide Receptor-A: Role in the Pathophysiology of Cardiovascular Regulation. Can J Physiol Pharmacol. 2011; 89(8): 557&ndash;573 doi:10.1139/y11-054 &nbsp; 88.Kumar P., Periyasamy R., Das S., Neerukonda S., Mani I., Pandey K.N. All-Trans Retinoic Acid and Sodium Butyrate Enhance Natriuretic Peptide Receptor A Gene Transcription: Role of Histone Modification. Mol Pharmacol. 2014; 85(6):946-957 doi: 10.1124/mol.114.092221 &nbsp; 89.Huang L., Xi Z., Wang C, Zhang Y., Yang Z., Zhang S., Chen Y., Zuo Z. Phenanthrene exposure induces cardiac hypertrophy via reducing miR-133a expression by DNAmethylation. Sci Rep. 2016;6:20105 doi: 10.1038/srep20105 &nbsp; 90.Ito E., Miyagawa S., Fukushima S., Yoshikawa Y., Saito S., Saito T., Harada A., Takeda M., Kashiyama N., Nakamura Y., Shiozaki M., Toda K., Sawa Y. Histone Modification Is Correlated With Reverse Left Ventricular Remodeling in Nonischemic Dilated Cardiomyopathy. Ann Thorac Surg 2017;104:1531&ndash;1539 doi: 10.1016/j.athoracsur.2017.04.046 &nbsp; 91.Shen K., Tu T., Yuan Z., Yi J., Zhou Y., Liao X., Liu Q., Zhou X. DNA methylation dysregulations in valvular atrial fibrillation. Clinical Cardiology. 2017;40:686&ndash;691 doi: 10.1002/clc.22715 &nbsp; 92.Hohl M., Wagner M., Reil J.-C., M&uuml;ller S.A., Tauchnitz M., Zimmer A.M., Lehmann L.H., Thiel G., B&ouml;hm M., Backs J., Maack C. HDAC4 controls histone methylation in response to elevated cardiac load. J Clin Invest<em>. </em>2013;123(3):1359&ndash;137 doi:10.1172/JCI61084 &nbsp; 93.Sergeeva I.A., Hooijkaas I.B., Ruijter J. M., van der Made I., de Groot N.E., van de Werken H.J.G., Creemers E.E. Christoffels V.M. Identification of a regulatory domain controlling the Nppa-Nppb gene cluster during heart development and stress. Development. 2016; 143(12):2135-2146 doi:10.1242/dev.132019 &nbsp; 94.Kumar P., Pandey K.N. Cooperative activation of <em>npr1</em> gene transcription and expression by interaction of ets-1 and P300. Hypertension. 2009; 54(1): 172&ndash;178 doi:10.1161/HYPERTENSIONAHA.109.133033 PMID: 19487584 &nbsp; 95.Kumar P., Tripathi S., Pandey K.N. Histone Deacetylase Inhibitors Modulate the Transcriptional Regulation of Guanylyl Cyclase/Natriuretic Peptide Receptor-A Gene. Interactive roles of modified histones, histone acetyltransferase, p300, and Sp1. Journal of biological chemistry. 2014; 289(10):6991-7002 doi: 10.1074/jbc.M113.511444 &nbsp; 96.Chen L., Yang T., Lu D.W., Zhao H., Feng Y.L., Chen H., Chen D.Q., Vaziri N.D., Zhao Y.Y. Central role of dysregulation of TGF-&beta;/Smad in CKD progression and potential targets of its treatment. Biomed Pharmacother. 2018;101:670-681 doi: 10.1016/j.biopha.2018.02.090 &nbsp; 97.Sen A., Kumar P., Garg R., Lindsey S.H., Katakam P.V.G., Bloodworth M., Pandey K.N. Transforming growth factor b1 antagonizes the transcription, expression and vascular signaling of guanylyl cyclase/natriuretic peptide receptor A &ndash; role of dEF1. FEBS Journal. 2016; 283(9):1767&ndash;1781 doi:10.1111/febs.13701 PMID:26934489 &nbsp; <strong>ГЛАВА 2. НЕКОТОРЫЕ ФАКТОРЫ АКТИВАЦИИ </strong> <strong>ЭПИГЕНЕТИЧЕСКИХ МЕХАНИЗМОВ</strong> &nbsp; Приступая к обсуждению данной темы, считаем необходимым подчеркнуть, что, во-первых, в отличие от предыдущих разделов, при рассмотрении большинства факторов, включая факторы внешней среды, способных оказывать влияние на экспрессию генов, речь идет о надорганизменном уровне, чаще всего, о популяции. Во-вторых, косвенно затронуты вопросы участия эпигенетических механизмов в процессах наследования приобретенных признаков и их роли в эволюционных преобразований. Возможно, сочетание новых признаков, обусловленных не только мутациями, но и эпигенетическими механизмами внутри популяции, может оказать влияние на процессы микроэволюции. Необходимо отметить, что в современной литературе уделяется внимание поставленным вопросам. В частности, указывается, что предполагаемые глобальные изменения климатических условий учитывают актуальность эпигенетических преобразований для динамики адаптивных изменений популяций человека (Hu J., Barrett R.D.H., 2017). Поэтому, экспериментальные данные, полученные в исследованиях на животных позволяют, с одной стороны, расширить наши представления о роли эпигенетических система контроля адаптивных реакций на изменения факторов среды. С другой стороны, предположить возможность закрепления этих адаптивных преобразований экспрессии генов в ряду поколений. При этом, авторы цитируемого обзора, во-первых, подчеркивают важное значение эпигенетических механизмов для экологической пластичности различных видов животных. Во-вторых, приводят конкретные примеры передачи в последующие поколения эпигенетических изменений хроматина у некоторых видов млекопитающих. Наряду с этим, привлекают внимание сведения об устойчивых сочетаниях генов, выполняющих ведущую роль в формировании экологической пластичности животных к изменениям, например, температурного режима окружающей среды (Wollenberg Valero K.C. et al., 2014). Заслуживает внимания и тот факт, что комбинация данных генов в ряду позвоночных животных обладает достаточно высокой эволюционной консервативностью. Поэтому, необходимо отметить, что в современной литературе высказываются мнения о том, что эпигенетические преобразования, сформированные в генотипе родительских особей, могут выполнять принципиально важную функцию в эволюционном процессе, поскольку могут передаваться потомству и играть существенную роль в адаптивных реакциях потомства (Wang Y. et al., 2017). Авторы приводят ряд аргументов, подтверждающих возможность наследования эпигенетических трансформаций хроматина и у человека. Аналогичная точка зрения, относительно возможности наследования в поколениях эпигенетической модуляции экспрессии генов, обусловленной, в первую очередь, ковалентной модификацией хроматина, высказывается и в последующих публикациях (Norouzitallab P. et al., 2019). Вместе с тем, приведенные сведения о наследовании эпигенетических модификаций генома, во-первых, не являются общепризнанными. Во-вторых, возможный тип наследования эпигенетических трансформаций также мало изучен. Тем не менее, мы посчитали необходимым включить в обзор краткое упоминание об этих аспектах эпигенетики, поскольку возможность их реализации существует. Следовательно, рассматривая роль эпигенетических механизмов в адаптивных реакциях почки на факторы среды (не только внешних) в масштабе популяций, уместно принять к сведению возможность наследования эпигенетических перестроек в системе регуляции экспрессии генов, равно, как и их возможное участие в эволюционных процессах. Также, на наш взгляд, необходимо учитывать интересы практической медицины, особенно, если речь идет об участии эпигенетических процессов в патофизиологических механизмах заболеваний почек. В данном разделе, в качестве тем для обсуждения нами выбраны факторы внешней среды, в том числе и антропогенной природы. Наряду с этим, некоторые факторы, связанные с устойчивыми нарушениями физиологических констант организма также достаточно широко распространены в популяциях человека и заслуживают рассмотрения. <strong>2.1. ИЗМЕНЕНИЕ ТЕМПЕРАТУРНОГО РЕЖИМА, КАК ФАКТОР ИНДУКЦИИ ЭПИГЕНЕТИЧЕСКИХ МЕХАНИЗМОВ</strong> &nbsp; Даже принимая к сведению тот факт, что представители биологического вида Homo sapiens sapiens проживают в искусственно созданной среде и используют различные способы формирования микроклимата своих жилищ, климатические факторы среды, в частности, температура среды, до настоящего времени оказывает исключительно важное влияние на человека (Cheshire W.P. Jr., 2016; Beker B.M. et al., 2018). Обсуждение вероятности стремительных изменений климатических условий на планете Земля не входит в круг наших задач. Вместе стем, мы исходим из того, что уже существующее разнообразие климатических условий различных географических широт, а также межсезонные флуктуации климатических условий можно рассматривать, как важный стимул в изучении роли эпигенетических процессов в адаптации организма к изменению температурного режима среды (Franks S.J., Hoffmann A.A., 2012; Wollenberg Valero K.C. et al., 2014). В данном случае, температурный режим рассматривается в качестве одного из основных факторов среды, способных вызывать устойчивые эпигенетические изменения структуры ДНК человека, которые, направлены на повышение адаптивных возможностей популяции и, вероятно, могут передаваться по наследству (Giuliani C. et al., 2015). Вместе с тем, авторы иллюстрируют адаптивный характер эпигенетических изменений, адекватных геофизическим условиям проживания данных популяций человека. Почки наземных позвоночных животных (амниот) выполняют жизненно важную функцию поддержания постоянства внутренней среды организма. При этом, с одной стороны, физиологические и патофизиологические аспекты адаптации почек человека к изменению температурного режима среды постоянно находятся в центре внимания современной науки (Johnson R.J. et al., 2016; de Lorenzo A., Lia&ntilde;o F., 2017). С другой стороны, участие эпигенетических механизмов в этих процессах требует более глубокого изучения. Тем не менее, установлено, что, в частности, тепловой стресс оказывает мощное влияние на перестройку метаболизма микро РНК в почках (Permenter M.G. et al., 2019). Вместе с тем, авторы цитируемой публикации отмечают органоспецифический характер изменений метаболизма микро РНК под влиянием повышения температуры. Ранее было показано, что белки семейства аквапорины также могут изменять свою экспрессию в почках и слюнных железах под влиянием температурного фактора (как повышение, так и понижение температуры) у позвоночных животных (Wollenberg Valero K.C. et al., 2014). <strong>2.2. </strong><strong>ГИПОКСИЯ.</strong> &nbsp; Наряду с температурным фактором, одним из важнейших факторов среды, способным оказать влияние на состояние эпигенетических механизмов человека, является гипоксия (Giuliani C. et al., 2015). Гипоксическая гипоксия может оказывать влияние на структурные показатели и функциональное состояние ренальной паренхимы через систему HIFs-протеинов, контролируя экспрессию генов, белки которых критически важны для регуляции деятельности почек (Poonit N.D. et al., 2018). С другой стороны, гипоксия ренальной паренхимы различного генеза рассматривается в качестве одного из базовых индукторов эпигенетических механизмов трансформации гуморальных систем контроля гомеостатических функций почек человека (Clarke N.E., Turner A.J., 2012; Macconi D. et al., 2014). Известно, что, стимулируемый гипоксией HIF-1альфа, является одним из ведущих активаторов эпигенетических механизмов (Perez-Perri J.I. et al., 2011). Являясь важным звном в системе адаптации почки к гипоксии, HIF-1альфа может быть непосредственно вовлечен в патогенетические механизмы хронизации и прогрессирования почечной недостаточности (Shoji K. et al., 2014). Установлено, что HIFs-зависимое угнетение метилирования гистонов (H3K9me3 и H3K27me3) может сопутствовать прогрессированию почечной недостаточности (Nangaku M. et al., 2017). Сообщается, что эпигенетические механизмы активации ренин-ангиотензиновой системы могут выполнять ключевую роль в хронизации и прогрессирования почечной недостаточности (Chou Y.H. et al., 2017). Вместе с тем, показано, что HIF-1альфа на уровне транскрипции изменяет баланс экспрессии компонентов РАС в направлении стимуляции биосинтеза компонентов оси Ангиотензин-I-превращающий фермент (АСЕ)/Ангиотензин-2/АТ1-рецепторы против угнетения контура отрицательной обратной связи РАС АСЕ-2/Ангиотензин-1-7/MASS1-рецепторов (Clarke N.E., Turner A.J., 2012; Macconi D. et al., 2014). Помимо того, что HIF-1альфа усиливает экспрессию АТ1-рецепторов и АСЕ, в условиях гипоксии в почке наблюдается резкая активация АСЕ-независимого пути образования Ангиотензин-I в присутствии индуцированного гипоксией лактат-химаза-зависимого механизма (Xie G. et al., 2017). В совокупности, индуцированное гипоксией смещение баланса в пользу оси Ангиотензин-I-превращающего фермента (АСЕ)/Ангиотензин-2/АТ1-рецептор против угнетения контура отрицательной обратной связи РАС АСЕ-2/Ангиотензин-1-7/MASS1 способствует активации воспаления, нарушению клеточного цикла клеток ренальной паренхимы, состоянию энергетического обмена нефроцитов, а также активации эпителиально-мезенхимальной трансформации (Macconi D. et al., 2014; Chou Y.H. et al., 2017). Эпигенетические механизмы, стимулированные гипоксией, выполняют важную роль в хронизации и прогрессирования почечной недостаточности, индуцируя нарушение функции подоцитов (Lin C.-L. et al., 2014) и мезангиума (Lu Z. et al., 2017). По мнению ряда исследователей, ключевым звеном в этом процессе является поражение проксимального отдела нефрона (Matsusaka T. et al., 2012; Kobori H. et al., 2013). Наряду с этим приводятся аргументы о том, что стимулируемые семейством HIF-протеинов эпигенетический процессы являются перспективным объектом фармакологических методов сдерживания прогрессирующей почечной недостаточности (Shoji K. et al., 2014). <strong>2.3. ГИПЕРГЛИКЕМИЯ</strong> &nbsp; Гипергликемия, в подавляющем большинстве случаев, рассматривается в качестве симптома, сопутствующего течению сахарного диабета. Тем не менее, устойчиво повышенный уровень глюкозы во внеклеточной жидкости выступает в качестве самостоятельного патогенетического фактора ренальных дисфункций (Dounousi E. et al., 2015), способного инициировать дальнейшее прогрессирование почечной недостаточности при участии ковалентной трансформации хроматина (Reddy M.A, Natarajan R., 2015; Lu Z. et al., 2017). Обсуждая роль гипергликемии в эпигенетических механизмах перестройки функции почки, необходимо отметить, что данному симптому сахарного диабета 2-го типа сопутствует также изменения секреции инсулина, нарушения обменных процессов, усиление продукции активных форм кислорода, нарушение параметров системной и внутриорганной гемодинамики, повышение уровня HIF-1 (Reddy M.A, Natarajan R., 2015). По мнению цитируемых авторов, HIF-1 обладает способностью стимулировать эпигенетические механизмы активации экспрессии ферментов деметилаз гистонов. Высказывается мнение о том, что гипергликемия в значительной степени ответственна за ряд характерных изменений систем передачи внутриклеточного сигнала в целом ряде различных популяций клеток почки, включая клетки канальцевого эптелия, фибробласты, эндотелиоциты, клетки мезангиума и подоциты (Reddy M.A, Natarajan R., 2015). В обзоре указывается, что стимуляция фиброза тканей почки может усиливаться TGF-&beta;, индуцирующего повышение таких эпигенетических меток, как miR-29, H3K9/14Ac,<strong> </strong>H3K9Ac, H3K4me1 и H3K4me3, на фоне снижения H3K9me3. Указанные изменения могут сопровождаться усилением экспрессии гена <em>Agt</em> (ангиотензиногена) в проксимальных нефроцитах, вызванной ингибированием DNMT и повышением активности HDAC. С другой стороны, следует учитывая роль сопутствующих сахарному диабету изменений гемодинамических параметров на эпигенетические процессы. Известно, что устойчивое повышение кровяного давления может способствовать повышению экспрессии гена Асе (ангиотензин-превращающего фермента) в том числе и в почках через повышение уровня меток H3KAc и H3K4me, на фоне снижения экспрессии метки H3K9me2 (Liang M. et al., 2013; Reddy M.A, Natarajan R., 2015). Эпигенетические механизмы патогенеза и прогрессирования гипертонической болезни рассмотрены в ряде обзорных публикаций (Friso S. et al., 2013; Wise I.A., Charchar F.J., 2016). Авторами цитируемых работ указан ряд генов, экспрессия которых тесно связана с течением гипертонии, включая гены ренина, АСЕ, рецепторов ангиотензина-2 и эндотелиальной NO-синтазы. Эпигенетическая перестройка экспрессии генов системы NO-синтаз может индуцироваться гипоксией (Fish J.E. et al., 2010) и гипергликемией (Advani A. et al., 2011; Schmidt Dellamea B. et al., 2014). Показано, что ингибитор ферментов деацетилаз белков гистонов vorinostat способствует снижению албуминурии, отложению коллагена IV клетками мезангиума, а также оксидативный стресс в экспериментальной модели сахарного диабета 1 типа (Advani A. et al., 2011). <strong>2.4. ТЯЖЕЛЫЕ МЕТАЛЛЫ</strong> &nbsp; Широко известно нефротоксическое действие тяжелых металлов. Наряду с этим в литературе имеются отдельные сведения об их эпигенетических эффектах (Ruiz-Hernandez A. et al., 2015). В частности, авторами показано усиление метилирование ДНК в зависимости от продолжительности экспозиции к кадмию, a также общая тенденция к гипометилированию ДНК на фоне повышения свинца в крови. Относительно ртути, экспериментальные исследования свидетельствуют о том, что ртуть может изменить характер метилирования ДНК. В эмбриональных стволовых клетках крысы метилртуть уменьшала пролиферацию нервных клеток, в связи с гипометилированием ДНК. Также авторы цитируемой публикации сообщают, что механизмы индукции тяжелыми металлами эпигенетической перестройки ДНК остаются крайне мало изучены. Поскольку высоко токсичные тяжелые металлы (ртуть, кадмий и свинец) в организм человека поступают, как правило, в следовых количествах не вызывая острого токсического эффекта, представляет интерес анализ их влияния на изменение обменных процессов в организме, эндокринных функций поджелудочной железы, в патогенезе резистентности тканей к инсулину и избыточной массы тела (Kuo C.-C. et al., 2013). Действительно, эпигенетические эффекты тяжелых металлов могут быть индуцированы достаточно низкими уровнями поступления ксенобиотиков, как правило, не превышающие санитарные нормы. Наиболее ранние публикации, посвященные данной тематике, содержат информацию о том, что, например, тяжелый металл Со2+ может стимулировать процессы транскрипции некоторых белков независимо от внутриклеточной эндогенной продукции активных форм кислорода (Salnikow K. et al., 2000). В дальнейшем были непосредственно указаны индуцированные Со2+, HIF‐1&alpha;-зависимые эпигенетические механизмы, связанные с ферментными системами метилирования ДНК и ацетилирования гистонов (Maxwell P., Salnikow K., 2004). В современной литературе роль эпигенетических механизмов в реализации токсических и канцерогенных эффектов тяжелых металлов широко признана (Salnikow K., Zhitkovich A., 2008; Chervona Y, Costa M., 2012; Brocato J.,<strong> </strong>Costa M., 2013). Также широко признана важность роли HIF‐1&alpha;-зависимых эпигенетических механизмов, индуцируемых тяжелыми металлами (Salnikow K. et al., 2008; Nagasawa H., 2011; Brocato J.,<strong> </strong>Costa M., 2013; Eskandani M. et al., 2017). Было также показано, что стимуляция кобальтом отложений белков внеклеточного матрикса, а также индукция регуляторных пептидов VEGF и эритропоэтина связаны с HIF‐1&alpha; (Tanaka T. et al., 2005). По нашему мнению, научная новизна предлагаемого подхода, состоит в том, что впервые было предложено теоретически обоснованное эпигенетическими механизмами контроля экспрессии генов объяснение патогенеза смертельно опасных онкологических заболеваний, индуцированных тяжелыми металлами. При этом, патогенез этих заболеваний не рассматривался, как результат прямого повреждения ДНК. Был разработан подход, основанный на малигнизирующих эффектах тяжелых металлов, обусловленных специфической ковалентной модификацией хроматина, изменяющей экспрессию генов (Salnikow K., Zhitkovich A., 2008; Salnikow K. et al., 2008). Продуктивность такого подхода была подтверждена последующими результатами исследований (Chervona Y, Costa M., 2012; Brocato J.,<strong> </strong>Costa M., 2013). Результаты исследований in vitro на культуре малигнизированных клеток показали, что присутствие в среде тяжелых металлов оказывает существенное влияние на уровни HIF-1&alpha; в клетках, а также на состояние экспрессии генов, идентифицированных, как гены факторов транскрипции, маркеров дифференциации клеток, цитокинов и факторов роста, протеинкиназ, супрессоров опухолей и онкогенов (Bae S. et al., 2012). По данным авторов, им удалось выделить группу генов, чувствительных, в частности, к ионам Со2+. Установлено также, что тяжелые металлы, через процессы ацетилирования белков-гистонов, регулирует экспрессию гена внеклеточной супероксид дисмутазы<strong> </strong> (Hattori S. et al., 2016). С другой стороны, показано, что применение в эксперименте ингибитора деацетилаз гистоновых белков (valproic acid), способствует ослаблению патофизиологических эффектов HIF-1&alpha; (Luo H.-M. et al., 2013; Kim Y.J. et al., 2017). Наряду с этим, показано, что HIF-1&alpha; может регулировать не только ковалентную модификацию хроматина, но и биосинтез малых некодирующих РНК, способных определять биосинтез белка на уровне транскрипции или трансляции (Kwak J. et al., 2018). Действительно, в литературе имеются данные о том, что HIF могут оказывать влияние на системы метаболизма некодирующих малых РНК (Ho J.J. et al., 2012; Ibrahim A.A. et al., 2017). При этом, в исследованиях in vitro установлена связь между присутствием в среде дихлорида кобальта, HIFs протеинами и показателями экспрессии клетками микро РНК (Silakit R. et al., 2018). Приводятся данные о том, что HIF-зависимые механизмы, через систему микро РНК принимают участие в регуляции экспрессии провоспалительных цитокинов (Kwak J. et al., 2018). Механизмы индукции Со2+ процессов воспаления занимают важное место в патогенезе кобальтовой интоксикации, однако роль эпигенетических механизмов, определяющих синтез (в том числе и микро РНК) провоспалительных факторов белковой природы изучены пока не достаточно (Kumanto M. et al., 2017). По нашему мнению, в литературе проведен достаточно детальный анализ роли тяжелых металлов в индукции базовых механизмов эпигенетической трансформации систем контроля экспрессии генов. В тоже время, нельзя исключить определенных органоспецифических особенностей их реализации. Например, в почках. При том, что ренальная паренхима является одной из основных мишеней для данной группы ксенобиотиков. <strong>2.5. ЭНДОКРИНОПАТИИ</strong> &nbsp; Течение эндокринопатий связано с тем, что на состояние эпигенетических механизмов может одновременно оказывать существенное влияние несколько факторов. Пример такого комбинированного влияния мы уже рассматривали, анализируя эпигенетические эффекты гипергликемии. Вместе с тем, фактор неадекватной секреции инсулина и изменение чувствительности тканей к гормону не является второстепенным и может участвовать в эпигенетических механизмах регуляции деятельности почки (Shiels P.G. et al., 2017). Авторы цитируемого обзора рассматривают роль инсулина в эпигенетической системе контроля деятельности почек в процессе возрастных изменений функции органа. В этом смысле, представляют интерес сведения о базовых эпигенетических механизмах, способных детерминировать резистентность тканей к регуляторному воздействию инсулина (Seok S. et al., 2018). Сложность точной оценки степени влияния различных факторов (гипергликемия, изменение чувствительности тканей к инсулину, оксидативный стресс и т.д) течения сахарного диабета второго типа на перестройку экспрессии генов &mdash; вполне объективная проблема. Вместе с тем, в литературе имеются данные о том, что собственно резистентность к инсулину может, через регуляцию метилирования гистонов, принимать участие в патофизиологических механизмах нарушении целостности слоя подоцитов, провоцируя усиление альбуминурии и прогрессирование нефропатии (Lizotte F. et al., 2016). Действительно, ранее экспериментально было подтверждено участие инсулина в регуляции экспрессии генов мыши и человека через систему метилирования ДНК (Kuroda A. et al., 2009). Известно также, что альдостерон через систему метилирования гистонов может непосредственно регулировать экспрессию гена альфа-субъединицы эпителиального натриевого канала дистального отдела нефрона &alpha;<em>ENaC</em> (Kone B.C., 2013), а также эндотелина-1 (Welch A.K. et al., 2016). Высказывается мнение, что понимание этих эпигенетических механизмов альдостерона представляет интерес, как в лечении гипертонической болезни, так и в борьбе с избыточным весом (Kawarazaki W., Fujita T., 2016). В качестве потенциального индуктора эпигенетической трансформации гуморальных систем контроля гомеостатических функций почек можно упомянуть гормоны щитовидной железы. В литературе имеются указания на регуляторные эффеты гормонов щитовидной железы, рассматриваемых, как природные ингибиторы ацетилазы белков-гистонов (Re A. et al., 2016). Также установлено, что эпигенетические эффекты тироксина стимуляции деацетилазы гистонов-5 (HDAC5) могут реализовываться через путь передачи сигнала, сопряженный с интегрином &alpha;v&beta;3/PKD/HDAC5 (Liu X. et al., 2014). В литературе представлены данные и о том, что в условиях гипофункции щитовидной железы также наблюдается закономерное изменение экспрессии некоторых генов через механизм импринтинга (Hu Z. et al., 2014; Leow M.K., 2016). Следовательно, как гипо- так и гипертиреоз могут рассматриваться в качестве потенциальных индукторов эпигенетической перестройки гуморальных систем контроля деятельности почки. Поскольку широко известен тот факт, что нарушение тиреоидного статуса организма усиливает риск заболевания почек через активацию РАС (Kobori H. et al., 1999). <strong>2.6. </strong><strong>ЭПИГЕНЕТИЧЕСКИЕ ПРОЦЕССЫ, ИНДУЦИРОВАННЫЕ ПАТОГЕННЫМИ МИКРООРГАНИЗМАМИ</strong> &nbsp; Воспалительные реакции тканей почки человека в ответ на инфекционные и неинфекционные заболевания, анализируются с учетом их популяционных особенностей с позиций современных взглядов на филогенез выделительной системы и принципы антропогенеза (Chevalier R.L., 2017). В литературе подчеркивается роль эпигенетических механизмов в эволюционных аспектах формирования адаптивных реакций иммунной системы и тканей почки. При этом, особое внимание уделяется механизмам иммунопатологии почки. В связи с этим в ряде публикаций высказывается мнение о том, что у человека эпигенетическая перестройка (метилирование и ацетилирование гистонов) клеток моноцитарного ряда, направленная на регуляцию выработки провоспалительных факторов, может сохранятся и передаваться дочерним клеткам, определяя особенности течения заболевания (Venet F., Monneret G., 2018). По мнению некоторых исследователей, эпигенетические изменения в иммунной системе, вызванные хроническим воспалением и повышенным окислительным стрессом, могут рассматриваться в качестве базового патогенетического механизма патологии почек и могут приводить к необратимым нарушениям ренальной паренхимы (Syed-Ahmed M., Narayanan M., 2019). Помимо этого, на основе результатов популяционных исследований была проанализирована возможная роль микрофлоры организма человека в эпигенетической перестройке иммунных реакций, связанных с риском заболеваний почек (Uy N. et al., 2015). Дальнейшие исследования показали, что состояние микрофлоры организма может оказывать влияние на риск заболевания почек через эпигенетические механизмы перестройки внутрипочечной РАС (Marques F.Z. et al., 2017). По мнению некоторых авторов, нарушения функции почек могут быть тесно связаны с нарушениями микрофлоры кишечника, поскольку данный показатель оказывает влияние на состояние иммунитета кишечника таким образом, что он больше не может поддерживать физиологический контроль микробиоты (Syed-Ahmed M., Narayanan M., 2019). Авторы цитируемого обзора рассматривают эпигенетическую активацию провоспалительных реакций, возможно, за пределами почечной паренхимы, как мощный индуктор патологических изменений органа. Аналогичную точку зрения высказывают и другие авторы, обращая внимание на тот факт, что эпигенетические механизмы могут выполнять определенную роль в патогенезе прогрессирующей почечной недостаточности на фоне нарушений микрофлоры кишечника (Lu C.C. et al., 2018). Наряду с эим, привлекают внимание сведения о том, что метаболиты микрофлоры кишечника могут оказывать влияние на состояние внутрипочечной ренин-ангиотензиновой системы. Предполагая наличие патогенетических механизмов активации внутрипочечных систем гуморального контроля гомеостатических функций почек &mdash; ренин-ангиотензиновой системы. Показана актуальность эпигенетической индукции РАС и при вирусной инвазии (Chandel N. et al., 2013). <strong>СПИСОК ЛИТЕРАТУРЫ К ГЛАВЕ</strong> &laquo;<strong>НЕКОТОРЫЕ ФАКТОРЫ АКТИВАЦИИ ЭПИГЕНЕТИЧЕСКИХ МЕХАНИЗМОВ&raquo;</strong> &nbsp; 1.Hu J., Barrett R.D.H. Epigenetics in natural animal populations. J Evol Biol. 2017;30(9):1612-1632 doi: 10.1111/jeb.13130 2.Wollenberg Valero K.C., Pathak R., Prajapati I., Bankston S., Thompson A., Usher J., Isokpehi R.D. A candidate multimodal functional genetic network for thermal adaptation. PeerJ. 2014;2:e578 doi: 10.7717/peerj.578 &nbsp; 3.Wang Y., Liu H., Sun Z. Lamarck rises from his grave: parental environment-induced epigenetic inheritance in modelorganisms and humans. Biol Rev Camb Philos Soc. 2017;92(4):2084-2111 doi: 10.1111/brv.12322 &nbsp; 4.Norouzitallab P., Baruah K, Vanrompay D., Bossier P. Can epigenetics translate environmental cues into phenotypes? Sci Total Environ. 2019;647:1281-1293 doi: 10.1016/j.scitotenv.2018.08.063 &nbsp; 5.Cheshire W.P. Jr. Thermoregulatory disorders and illness related to heat and cold stress. Auton Neurosci. 2016;196:91-104 doi: 10.1016/j.autneu.2016.01.001 &nbsp; 6.Beker B.M., Cervellera C., De Vito A., Musso C.G. Human Physiology in Extreme Heat and Cold. Int Arch Clin Physiol. 2018;1:001 &nbsp; 7.Franks S.J., Hoffmann A.A. Genetics of climate change adaptation. Annu Rev Genet. 2012;46:185-208 doi: 10.1146/annurev-genet-110711-155511 &nbsp; 8.Giuliani C., Bacalini M.G., Sazzini M., Pirazzini C., Franceschi C., Garagnani P., Luiselli D. The epigenetic side of human adaptation: hypotheses, evidences and theories. Ann Hum Biol, 2015; 42(1): 1&ndash;9 doi: 10.3109/03014460.2014.961960 &nbsp; 9.Johnson R.J., Stenvinkel P., Jensen T., Lanaspa M.A., Roncal C., Song Z., Bankir L., S&aacute;nchez-Lozada L.G.Metabolic and Kidney Diseases in the Setting of Climate Change, Water Shortage, and Survival Factors. J Am Soc Nephrol. 2016;27(8):2247-2256 doi: 10.1681/ASN.2015121314 &nbsp; 10.de Lorenzo A., Lia&ntilde;o F. High temperatures and nephrology: The climate change problem. Nefrologia. 2017;37(5):492-500 doi: 10.1016/j.nefro.2016.12.008 &nbsp; 11.Permenter M.G., McDyre B.C., Ippolito D.L., Stallings J.D. Alterations in tissue microRNA after heat stress in the conscious rat: potential biomarkers of organ-specific injury. BMC Genomics. 2019;20(1):141 doi: 10.1186/s12864-019-5515-6 &nbsp; 12.Poonit N.D., Zhang Y.C., Ye C.Y., Cai H.L., Yu C.Y., Li T., Cai X.H. Chronic intermittent hypoxia exposure induces kidney injury in growing rats. Sleep Breath. 2018;22(2):453-461 doi: 10.1007/s11325-017-1587-1 &nbsp; 13.Clarke N.E., Turner A.J. Angiotensin-ConvertingEnzyme2: The first Decade. International Journal of Hypertension.2012; 2012: 307315 Article ID 07315 doi:10.1155/2012/307315 &nbsp; 14.Perez-Perri J.I., Acevedo J.M., Wappner P. Epigenetics: New Questions on the Response to Hypoxia. Int J Mol Sci. 2011; 12(7): 4705&ndash;4721 doi: 10.3390/ijms12074705 &nbsp; 15.Shoji K., Tanaka T., Nangaku M. Role of hypoxia in progressive chronic kidney disease and implications for therapy. Curr Opin Nephrol Hypertens. 2014;23(2):161-168 doi: 10.1097/01.mnh.0000441049.98664.6c &nbsp; 16.Nangaku M., Hirakawa Y., Mimura I. et al. Epigenetic Changes in the Acute Kidney Injury-to-Chronic Kidney Disease Transition. Nephron. 2017;137:256&ndash;259 doi.org/10.1159/000476078 &nbsp; 17.Chou Y.H., Huang T.M., Chu T.S. Novel insights into acute kidney injury-chronic kidney disease continuum and the role of renin-angiotensin system. J Formos Med Assoc. 2017;116(9):652-659 doi: 10.1016/j.jfma.2017.04.026 &nbsp; 18.Xie G., Liu Y., Yao Q. et al. Hypoxia-induced angiotensin II by the lactate-chymase-dependent mechanism mediates radioresistance of hypoxic tumor cells. Sci Rep. 2017; 7: 42396. doi: 10.1038/srep42396 &nbsp; 19.Lin C.-L., Lee P.-H., Hsu Y.-C. et al. MicroRNA-29a Promotion of Nephrin Acetylation Ameliorates Hyperglycemia-Induced Podocyte Dysfunction. J Am Soc Nephrol. 2014; 25(8):1698&ndash;1709 doi: 10.1681/ASN.2013050527 &nbsp; 20.Lu Z.,Liu N., Wang F. Epigenetic Regulations in Diabetic Nephropathy. J. Diabetes Res. 2017; 2017: 780505 doi: 10.1155/2017/7805058 &nbsp; 21.Dounousi E., Duni A., Leivaditis K. et al. Improvements in the Management of Diabetic Nephropathy. Rev Diabet Stud. 2015; 12(1-2): 119&ndash;133 doi: 10.1900/RDS.2015.12.119 &nbsp; 22.Schmidt Dellamea B., Bauermann Leit&atilde;o C., Friedman R., Canani L.H. Nitric oxide system and diabetic nephropathy. Diabetol. Metab. Syndr. 2014; 6: 17 doi: 10.1186/1758-5996-6-17 &nbsp; 23.Ruiz-Hernandez A., Kuo C.-C., Rentero-Garrido P. et al. Environmental chemicals and DNA methylation in adults: a systematic review of the epidemiologic evidence. Clin Epigenetics. 2015; 7(1): 55 doi: 10.1186/s13148-015-0055-7 &nbsp; 24.Kuo C.-C., Moon K., Thayer K.A., Navas-Acien A. Environmental Chemicals and Type 2 Diabetes: An Updated Systematic Review of the Epidemiologic Evidence. Curr Diab Rep. 2013; 13(6): 831&ndash;849 doi: 10.1007/s11892-013-0432-6 &nbsp; 25.Salnikow K., Su W., Blagosklonny M.V., Costa M. Carcinogenic metals induce hypoxia-inducible factor-stimulated transcription by reactive oxygen species-independent mechanism. Cancer Res. 2000;60(13):3375-3378 PMID: 10910041 &nbsp; 26.Tanaka T., Kojima I., Ohse T, Ingelfinger J.R., Adler S., Fujita T., Nangaku M.Cobalt promotes angiogenesis via hypoxia-inducible factor and protects tubulointerstitium in the remnant kidney model. Lab Invest. 2005;85(10):1292-1307 doi:10.1038/labinvest.3700328 &nbsp; 27.Shrivastava K., Ram M.S., Bansal A., Singh S.S., Ilavazhagan G.Cobalt supplementation promotes hypoxic tolerance and facilitates acclimatization to hypobaric hypoxia in rat brain. High Alt Med Biol. 2008;9(1):63-75 doi: 10.1089/ham.2008.1046 &nbsp; 28.Chai Y.C., Mendes L.F., van Gastel N., Carmeliet G., Luyten F.P. Fine-tuning pro-angiogenic effects of cobalt for simultaneous enhancement of vascular endothelial growth factor secretion and implant neovascularization. Acta Biomater. 2018;72:447-460 doi: 10.1016/j.actbio.2018.03.048 &nbsp; 29.Karaczyn A., Ivanov S., Reynolds M., Zhitkovich A., Kasprzak K.S., Salnikow K. Ascorbate depletion mediates up-regulation of hypoxia-associated proteins by cell density and nickel. J Cell Biochem. 2006;97(5):1025-1035 doi:10.1002/jcb.20705 &nbsp; 30.Yuan Y., Hilliard G., Ferguson T., Millhorn D.E. Cobalt inhibits the interaction between hypoxia-inducible factor-alpha and von Hippel-Lindau protein by direct binding to hypoxia-inducible factor-alpha. J Biol Chem. 2003;278(18):15911-15916 doi:10.1074/jbc.M300463200 &nbsp; 31.Stenger C., Naves T., Verdier M., Ratinaud M.H.The cell death response to the ROS inducer, cobalt chloride, in neuroblastoma cell lines according to p53 status. Int J Oncol. 2011;39(3):601-609 doi:10.3892/ijo.2011.1083 &nbsp; 32.Chimeh U., Zimmerman M.A., Gilyazova N., Li P.A. B355252, A Novel Small Molecule, Confers Neuroprotection Against Cobalt Chloride Toxicity In Mouse Hippocampal Cells Through Altering Mitochondrial Dynamics And Limiting Autophagy Induction. Int J Med Sci. 2018;15(12):1384-1396 doi:10.7150/ijms.24702 &nbsp; 33.Shrivastava K., Ram M.S., Bansal A., Singh S.S., Ilavazhagan G.Cobalt supplementation promotes hypoxic tolerance and facilitates acclimatization to hypobaric hypoxia in rat brain. High Alt Med Biol. 2008;9(1):63-75 doi: 10.1089/ham.2008.1046 34.Jeon E.S., Shin J.H., Hwang S.J., Moon G.J., Bang O.Y., Kim H.H.Cobalt chloride induces neuronal differentiation of human mesenchymal stem cells through upregulation of microRNA-124a. Biochem Biophys Res Commun. 2014;444(4):581-587 doi: 10.1016/j.bbrc.2014.01.114 &nbsp; 35.Chen Y., Zhao Q., Yang X., Yu X., Yu D., Zhao W.. Effects of cobalt chloride on the stem cell marker expression and osteogenic differentiation of stem cells from human exfoliated deciduous teeth. Cell Stress Chaperones. 2019 doi: 10.1007/s12192-019-00981-5 &nbsp; 36.Matsumoto M., Makino Y., Tanaka T., Tanaka H., Ishizaka N., Noiri E., Fujita T., Nangaku M. Induction of Renoprotective Gene Expression by Cobalt Ameliorates Ischemic Injury of the Kidney in Rats. J Am Soc Nephrol 14: 1825&ndash;1832, 2003 PMID:12819242 &nbsp; 37.Tanaka T., Kojima I., Ohse T., Ingelfinger J.R., Adler S., Fujita T., Nangaku M. Cobalt promotes angiogenesis via hypoxia-inducible factor and protects tubulointerstitium in the remnant kidney model. Laboratory Investigation. 2005;85: 1292&ndash;1307 doi:10.1038/labinvest.3700328 &nbsp; 38.Tan L., Lai X., Zhang M., Zeng T., Liu Y., Deng X., Qiu M., Li J., Zhou G., Yu M., Geng X., Hu J., Li A. A stimuli-responsive drug release nanoplatform for kidney-specific anti-fibrosis treatment. Biomater Sci. 2019;7(4):1554-1564 doi: 10.1039/c8bm01297k 39.Nagasawa H. Pathophysiological response to hypoxia - from the molecular mechanisms of malady to drug discovery: drug discovery for targeting the tumor microenvironment. J Pharmacol Sci. 2011;115(4):446-452 PMID: 21422725 &nbsp; 40.Eskandani M., Vandghanooni S., Barar J., Nazemiyeh H., Omidi Y. Cell physiology regulation by hypoxia inducible factor-1: Targeting oxygen-related nanomachineries of hypoxic cells. Int J Biol Macromol. 2017;99:46-62 doi: 10.1016/j.ijbiomac.2016.10.113 &nbsp; 41.Czarnek K., Terpiłowska S., Siwicki A.K.Selected aspects of the action of cobalt ions in the human body. Cent Eur J Immunol. 2015;40(2):236-242 doi:10.5114/ceji.2015.52837 &nbsp; 42.Lawrence H., Deehan D.J., Holland J.P., Anjum S.A., Mawdesley A.E., Kirby J.A., Tyson-Capper A.J.. Cobalt ions recruit inflammatory cells <em>in vitro</em> through human Toll-like receptor 4. Biochem Biophys Rep. 2016;7:374-378 doi: 10.1016/j.bbrep.2016.07.003 &nbsp; 43.Anjum S.A., Lawrence H., Holland J.P., Kirby J.A., Deehan D.J., Tyson-Capper A.J. Effect of cobalt-mediated Toll-like receptor 4 activation on inflammatory responses in endothelial cells. Oncotarget. 2016;7(47):76471-76478 doi: 10.18632/oncotarget.13260 &nbsp; 44.Shweta, Mishra K.P., Chanda S., Singh S.B., Ganju L.A comparative immunological analysis of CoCl2 treated cells with in vitro hypoxic exposure. Biometals. 2015;28(1):175-185 doi: 10.1007/s10534-014-9813-9 &nbsp; 45.Liang Y., Zhen X., Wang K., Ma J. Folic acid attenuates cobalt chloride-induced PGE2 production in HUVECs via the NO/HIF-1alpha/COX-2 pathway. Biochem Biophys Res Commun. 2017;490(2):567-573 doi:10.1016/j.bbrc.2017.06.079 &nbsp; 46.Kumanto M., Paukkeri E.-L., Nieminen R., Moilanen E. Cobalt(II) Chloride Modifies the Phenotype of Macrophage Activation. Basic &amp; Clinical Pharmacology &amp; Toxicology, 2017;121:98&ndash;105 doi: 10.1111/bcpt.12773 &nbsp; 47.Friso S., Carvajal C.A., Fardella C.E., Olivieri O. Epigenetics and arterial hypertension: the challenge of emerging evidence. Transl Res. 2015;165(1):154-165 doi: 10.1016/j.trsl.2014.06.007 &nbsp; 48.Wise I.A., Charchar F.J. Epigenetic Modifications in Essential Hypertension. Int J Mol Sci. 2016; 17(4): 451 doi: 10.3390/ijms17040451 &nbsp; 49.Shiels P.G., McGuinness D., Eriksson M. et al. The role of epigenetics in renal ageing. Nat Rev Nephrol. 2017;13(8):471-482 doi: 10.1038/nrneph.2017.78 &nbsp; 50.Seok S., Kim Y.C., Byun S., Choi S., Xiao Z., Iwamori N., Zhang Y., Wang C., Ma J., Ge K., Kemper B., Kemper J.K. Fasting-induced JMJD3 histone demethylase epigenetically activates mitochondrial fatty acid &beta;-oxidation. J Clin Invest. 2018;128(7):3144-3159 doi: 10.1172/JCI97736 &nbsp; 51.Lizotte F., Denhez B., Guay A., G&eacute;vry N., C&ocirc;t&eacute; A.M., Geraldes P. Persistent Insulin Resistance in Podocytes Caused by Epigenetic Changes of SHP-1 in Diabetes. Diabetes. 2016;65(12):3705-3717 doi:10.2337/db16-0254 &nbsp; 52.Kuroda A., Rauch T.A., Todorov I. et al. Insulin Gene Expression Is Regulated by DNA Methylation. PLoS One. 2009; 4(9): e6953 doi: 10.1371/journal.pone.0006953 &nbsp; 53.Kone B.C. Epigenetics and the Control of the Collecting Duct Epithelial Sodium Channel. Semin Nephrol. 2013; 33(4): 383&ndash;391 doi: 10.1016/j.semnephrol.2013.05.010 &nbsp; 54.Welch A.K., Jeanette Lynch I., Gumz M.L. et al. Aldosterone alters the chromatin structure of the murine endothelin-1 gene. Life Sci. 2016;159:121-126 doi: 10.1016/j.lfs.2016.01.019 &nbsp; 55.Kawarazaki W., Fujita T.The Role of Aldosterone in Obesity-Related Hypertension. Am J Hypertens. 2016; 29(4): 415&ndash;423 doi: 10.1093/ajh/hpw003 &nbsp; 56.Hu Z., Zhuo X., Shi Y. et al. Iodine deficiency up-regulates monocarboxylate transporter 8 expression of mouse thyroid gland. Chin Med J (Engl). 2014;127(23):4071-4076 &nbsp; 57.Leow M.K. A Review of the Phenomenon of Hysteresis in the Hypothalamus&ndash;Pituitary&ndash;Thyroid Axis. Front Endocrinol (Lausanne). 2016; 7: 64 doi: 10.3389/fendo.2016.00064 &nbsp; 58.Kobori H., Ichihara A., Miyashita Y. et al. Local renin-angiotensin system contributes to hyperthyroidism-induced cardiac hypertrophy. J Endocrinol. 1999;160(1):43-47 &nbsp; 59.Chevalier R.L. Evolutionary Nephrology. Kidney Int Rep. 2017; 2(3): 302&ndash;317 doi: 10.1016/j.ekir.2017.01.012 &nbsp; 60.Venet F., Monneret G. Advances in the understanding and treatment of sepsis-induced immunosuppression. Nat Rev Nephrol. 2018;14(2):121-137 doi: 10.1038/nrneph.2017.165 &nbsp; 61.Syed-Ahmed M., Narayanan M. Immune Dysfunction and Risk of Infection in Chronic Kidney Disease. Adv Chronic Kidney Dis. 2019;26(1):8-15 doi: 10.1053/j.ackd.2019.01.004 &nbsp; 62.Uy N., Graf L., Lemley K., Kaskel F. Effects of Gluten-Free, Dairy-Free Diet on Childhood Nephrotic Syndrome and Gut Microbiota. Pediatr Res. 2015; 77(1-2): 252&ndash;255 doi: 10.1038/pr.2014.159 &nbsp; 63.Marques F.Z., Nelson E., Chu P.Y. et al. High-Fiber Diet and Acetate Supplementation Change the Gut Microbiota and Prevent the Development of Hypertension and Heart Failure in Hypertensive Mice. Circulation. 2017;135(10):964-977 doi: 10.1161/CIRCULATIONAHA.116.024545 &nbsp; 64.Lu C.C., Ma K.L., Ruan X.Z., Liu B.C. Intestinal dysbiosis activates renal renin-angiotensin system contributing to incipient diabeticnephropathy. Int J Med Sci. 2018;15(8):816-822 doi: 10.7150/ijms.25543 &nbsp; 65.Chandel N., Husain M., Goel H. et al. VDR hypermethylation and HIV-induced T cell loss. J Leukoc Biol. 2013; 93(4): 623&ndash;631 doi: 10.1189/jlb.0812383 <strong>ГЛАВА 3. ФАКТОРЫ ВНУТРИОРГАННОЙ ГУМОРАЛЬНОЙ РЕГУЛЯЦИИ ДЕЯТЕЛЬНОСТИ ПОЧЕК. ИХ МЕСТО И РОЛЬ В ЭПИГЕНЕТИЧЕСКИХ МЕХАНИЗМАХ НАРУШЕНИЯ ФУНКЦИОНАЛЬНОГО СОСТОЯНИЯ РЕНАЛЬНОЙ ПАРЕНХИМЫ</strong> &nbsp; Обсуждая физиологические и патофизиологические аспекты эпигенетического контроля экспрессии генов клеток ренальной паренхимы, необходимо учитывать, что почки обладают автономной системой продукции тканевых гормонов, с одной стороны, принимающих участие в системе ауторегуляции гомеостатических функций и внутриорганного кровотока. С другой стороны, способных индуцировать эпигенетическую трансформацию экспрессии регуляторных и транспортных белков в интересах системного контроля гомеостаза. Вместе с тем, данным эпигенетическим системам контроля экспрессии генов отводится важная патофизиологическая роль в индукции патогенеза почечной недостаточности. Следовательно, еще одним объектом исследований молекулярной биологии и генетики в изучении патогенеза заболеваний почек являются принципиально новые фармакологические методы сдерживания прогрессирования почечной недостаточности. <strong>3.1. РЕНИН-АНГИОТЕНЗИНОВАЯ СИСТЕМА (РАС)</strong> &nbsp; Для того чтобы более полно охарактеризовать результаты эпигенетической перестройки локальной внутрипочечной РАС для функции почек, мы позволим себе кратко упомянуть широко известную схему функционирования внутрипочечной РАС. Согласно существующим представлениям, утвердившимся в мировой литературе, в почке основным местом синтеза ренина являются специализированные клетки ЮГА. Субстрат ренина &ndash; ангиотензиноген, синтезируется в печени. Основные регуляторные эффекты ангиотензина-II, образующегося в результате поступательной конверсии ангиотензиногена в ангиотензин-I при участии ренина, а затем и в ангиотензин-II при участии ангиотензин-превращающего фермента-1 (АПФ-1), сосредоточены на уровне проксимального сегмента нефрона и кровеносных сосудов почки, главным образом, через АТ1-популяцию рецепторов. Благодаря этим эффектам ангиотензин-II осуществляет контроль кровяного давления, волемического гомеостаза, параметров ионного и кслотно-основного гомеостаза организма, а также принимает участие в ауторегуляции почечного кровотока. Некоторые авторы не исключают, что в норме ангиотензиноген может в небольших количествах синтезироваться нефроцитами проксимального отдела нефрона (Kobori H. et al., 2013). Вместе с тем, результаты экспериментальных исследований указывают, что главным источником ангиотензиногена в норме является печень (Matsusaka T. et al., 2012). Помимо АПФ-1, в почке достаточно высокие уровни активности АПФ-2, отвечающего за образование ангиотензина-1-7, отвечающего за механизмы отрицательной обратной связи к ангиотензину-II, хотя, строго говоря, ангиотензин-1-7 антагонистом октапептида не является. В указанной схеме преобразования ангиотензиногена в ангиотензин-II регуляторным ферментом является ренин. При этом, более ранние источники литературы указывали роль процесса ацитилирования гистонов в контроле прогрессирования заболеваний почек, сердца, легких (Bush E.W., McKinsey T.A., 2010). В обсуждении роли преобразований экспрессии компонентов ренин-ангиотензиновой системы почки в процессах патогенеза почечной недостаточности, высказывается мысль о том, что индукцию экспрессии ренина/проренина в канальцевом эпителии следует рассматривать в качестве одного из ключевых событий (Prieto M.C. et al., 2013). Рассматривается роль усиления экспрессии ренина в канальцевом отделе нефрона в патогенезе фиброза почки и гипертонической болезни (Prieto M.C. et al., 2013; Gonzalez A.A., Prieto M.C., 2015). В литературе анализируются возможные молекулярные механизмы индукции экспрессии гена ренина в почках, включая механизмы экспансии ренин-секретирующих клеток за пределы юкста-гломерулярного аппарата (Sequeira Lopez M.L., Gomez R.A., 2010; Kurtz A., 2012). В настоящее время экспансия экспрессии гена ренина (за счет рекрутирования новых, ранее не синтезировавших ренин клеток) рассматривается, как результат, в основном, деятельности эпигенетических механизмов (Gomez R.A., 2017). С другой стороны, эпигенетические системы контроля экспрессии гена ренина сохраняют свою актуальность не только для тканей почки, но и для процессов кроветворения, иммунокомпетентных клеток и т. д. (Gomez R.A., Sequeira-Lopez M.L.S., 2018). Необходимо отметить, что, по мнению ряда авторов, ангиотензин-II следует рассматривать в качестве одного из основных факторов, способствующих прогрессированию почечной недостаточности, через нарушение внутриорганной гемодинамики, стимуляцию фиброза органа, активацию провоспалительных факторов, ограничение клеточного цикла канальцевого эпителия и нарушение обменных процессов в нефроцитах (Kobori H. et al., 2013). Указывается, что по мере прогрессирования почечной недостаточности концентрации ангиотензина-II в тканях почки могут существенно повышаться, на фоне незначительных изменений уровня октапептида в системном кровотоке (Matsusaka T. et al., 2012; Kobori H. et al., 2013). Привлекает внимание тот факт, что существенному увеличению внутриренальной продукции ангиотензина-II, на фоне прогрессирования почечной недостаточности, сопутствует отчетливый прирост биосинтеза белков-компонентов РАС: ангиотензиногена, проренина, АПФ-1 и АТ1-рецепторов ангиотензина-II (основной популяции рецепторов, отвечающих за большинство физиологических и патофизиологических эффектов ангиотензина-II), не только в проксимальных нефроцитах, но и в атипичных очагах активности РАС - эпителии дистальных отделов нефрона (Kobori H. et al., 2013). Авторы цитируемой публикации детально не обсуждают возможную роль эпигенетических механизмов в перестройке внутрипочечной РАС по мере нарастания патологических изменений ренальной паренхимы. Тем не менее, сама логика излагаемых фактов подводит к этому вопросу. Постараемся выяснить, насколько обосновано такое предположение. Действительно, дальнейшие исследования показали, что экспрессия компонентов РАС может регулироваться эпигенетическими механизмами на разных этапах онтогенеза (Tain Y.-L. et al., 2017; Tain Y.L., Hsu C.N., 2017, Witasp A. et al., 2017). При этом, эпигенетическая модуляция экспрессии компонентов РАС рассматривается, в качестве одного из ведущих патогенетических механизмов целого ряда опасных заболеваний (Tain Y.-L. et al., 2017). В частности, показано, что эпигенетические изменения критически важны для понимания перехода острой почечной недостаточности в хроническую форму (Rodr&iacute;guez-Romo R. et al., 2015). В литературе мы встречаем данные о том, что в условиях экспериментальной модели фетального программирования подтверждено участие эпигенетических факторов в регуляции уровней экспрессии АТ1 рецепторов ангиотензина-II (Bogdarina I. et al., 2007; Wu L. et al., 2016). Важным является тот факт, что эпигенетические механизмы, усиливая синтез компонентов РАС, создают условия для активации внутриклеточных (аутокринных) эффектов ангиотензина-II, что, по мнению некоторых авторов, является базовым патогенетическим механизмом РАС-зависимых повреждений тканей почек и сердца (De Mello W.C., 2015). В качестве иллюстрации к высказанному мнению можно привести данные о том, что ацетилирование гистонов 3 (H3Ac), а также их триметилирование (H3K4me3) и диметилирование (H3K9me2) может способствовать высвобождению промотора гена АПФ-1 в почечной паренхиме, обеспечивая биосинтез фермента (Liang M. et al., 2013). С одной стороны, в соответствии с классическим представлением о деятельности РАС, АПФ-1 в нашем организме присутствует в избытке и не является лимитирующим фактором в процессах образования ангиотензина-II. Но если оценивать упомянутый факт с позиций формирования полноценно функционирующей внутриклеточной РАС, то он приобретает совершенно иное значение (Abadir P.M. et al., 2012; Ellis B. et al., 2012). Действительно, по данным литературы, повышение экспрессии в тканях почки гена АПФ-1 является маркером неблагоприятного течения диабетической нефропатии (Thomas M.C., 2016). В дополнение к сказанному, можно привести сообщение группы исследователей, выявивших в условиях диабетической нефропатии усиление внутриклеточной продукции ангиотензиногена в проксимальных нефроцитах, обусловленное ацетилированием (H3K9) и триметилированием (H3K4me3) белка гистона-3 (Marumo T. et al., 2015). По мнению авторов, выявленный эффект может в равной степени свидетельствовать, как о повышении функциональной нагрузки на данный сегмент нефрона, так и о включении патофизиологических механизмов, индуцирующих повреждение данной популяции клеток канальцевого эпителия. Мнение о том, что повышение экспрессии ангиотензиногена в проксимальных нефроцитах может рассматриваться в качестве маркера прогрессирования почечной недостаточности, высказывают и другие авторы (O&#39;Leary R. et al., 2016; Bourgeois C.T. et al., 2017). Патофизиологические и эпигенетические механизмы этого феномена требуют более глубокого исследования. Однако, установлено, что на процессы эпигенетического контроля синтеза ангиотензиногена проксимальными нефроцитами могут оказывать влияние такие факторы, как интерферон-гамма (Satou R. et al., 2013), IL-6 (O&#39;Leary R. et al., 2016) и половые стероидные гормоны (Bourgeois C.T. et al., 2017). Наряду с этим, ангиотензин-II также обладает способностью модулировать состояние экспрессии белков в тканях почки, стимулируя повышение экспрессии АТ1 рецепторов и трансформирующего фактора роста-бета1, на фоне угнетения АПФ-2 (Macconi D. et al., 2014). Эпигенетические механизмы, инициируемые на стадии острой почечной недостаточности, могут рассматриваться в качестве фактора, создающего предпосылки прогрессирования почечной недостаточности, формируя неблагоприятный прогноз течения заболевания (Beckerman P. et al., 2014; Tang J., Zhuang S., 2015; Lee-Son K., Jetton J.G., 2016). В контексте обсуждаемой темы уместно напомнить, что фармакологические ингибиторы РАС (ингибиторы АПФ-1, антагонисты АТ1 рецепторов и ингибиторы ренина) довольно широко и успешно применяются, в том числе, при решении проблемы сдерживания прогрессирующей почечной недостаточности. Применение данной группы препаратов способствует ослаблению протеинурии, предотвращает поражение канальцевого эпителия, содействует ограничению воспаления и фиброза почки (Macconi D. et al., 2014). Поэтому, вполне логичным является вопрос о возможном участии блокаторов РАС в нормализации изменений, индуцированных эпигенетической перестройкой хроматина. Установлено, что в условиях острой почечной недостаточности токсического генеза, ренопротекторные свойства антагониста АТ1 рецепторов (лозартана) обусловлены сдерживанием, в том числе, эпигенетических механизмов, индуцирующих десквамацию подоцитов и усиление протеинурии (Hayashi K. et al., 2015). В частности, авторами выявлено, что лозартан влияет на состояние метилирования промотора гена белка нефрина. По некоторым данным, в условиях экспериментальной модели диабетической нефропатии, лозартан может оказывать умеренный благоприятный эффект на состояние эпигенетических механизмов в тканях почки крыс (Reddy M.A. et al., 2013). В дальнейшем, в условиях ранее примененной экспериментальной модели, авторы показали, что лозартан эффективно блокирует эпигенетические механизмы (через регуляцию процессов ацетилирования H3K9/14Ac) экспрессии генов, ответственных за стимуляцию синтеза ингибитора активатора плазминогена-1 (PAI-1) и моноцитарного хемоаттрактанта протеина-1 (MCP-1), являющихся важными медиаторами повреждения тканей почек (Reddy M.A. et al., 2014). На основании полученных данных авторы цитируемой публикации делают вывод о том, что наиболее эффективная фармакологическая терапия почечной недостаточности должна базироваться на комбинированном применении ингибиторов РАС и специфических модуляторов эпигенетических механизмов. Аналогичную точку зрения высказываются и другие авторы, предполагая, что к наиболее благоприятным терапевтическим результатам может привести сочетанное назначение нефрологическим пациентам ингибитора АПФ-1 и ингибитора деацетилазы гистонов (HDACI) (Zhong Y. et al., 2013). Признавая эффективность лозартана в ограничении метилирования гистонов Harshman L.A. и Zepeda-Orozco D. (2016) видят перспективность клинического использования в нефрологической практике препаратов, относящихся к группе ингибиторов HDACI. Наряду с этим, высказывается мнение о роли микро-РНК в эпигенетических механизмах активации локальной РАС почек при хронической почечной недостаточности (Witasp A. et al., 2017). В литературе высказывается мнение о том, что изучение эпигенетических механизмов функционирования внутриклеточной РАС является фундаментальным направлением современной медицинской науки, призванное решать наиболее актуальные практические задачи в области нефрологии и заболеваний сердечно-сосудистой системы (De Mello W.C., 2017). Таким образом, проведенный анализ данных литературы показал, что эпигенетические аспекты перестройки внутрипочечной (внутриорганной) РАС принципиально важны для понимания патофизиологических механизмов нарушения деятельности почек, сопряженных с усилением внутриклеточной продукции ангиотензина-II. Во-первых, эпигенетическая модификация хроматинового комплекса приводит к появлению новых атипичных очагов интенсивной продукции ангиотензина-II в канальцевом эпителии проксимального и дистального отдела нефрона. Во-вторых, самодостаточная (содержащая все основные компоненты) внутриклеточная РАС канальцевого эпителия переключается на аутокринный и паракринный механизмы, с одной стороны, ослабляет свою роль в физиологической регуляции гомеостатических функций почек. С другой стороны, активация внутриклеточной РАС все более нацелена на патофизиологические механизмы усиления повреждения ткани через нарушения энергетического обмена клетки (De Mello W.C., 2017). Кроме того, активируемые эпигенетическими механизмами гены белков-компонентов РАС, через повышение продукции ангиотензина-II, запускают новый виток каскадного усиления ковалентной модификации хроматина, где в качестве индуктора эпигенетических преобразований, напрямую или опосредовано выступает сам ангиотензин-II. Об этом убедительно свидетельствует эффективность применения блокаторов РАС в отношении эпигенетической трансформации хроматина клеток почки. В-третьих, в доступной нам литературе имеются единичные косвенные данные, позволяющие судить о том, насколько эффективно проникают внутрь клеток (в том числе в эпителий канальца) фармакологические ингибиторы РАС (Foster D.R. et al., 2009). При том, что существует очевидная потенциальная возможность с помощью ингибиторов РАС оказывать влияние на внутриклеточные эффекты ангиотензина-II, нацеленные на регуляцию экспрессии генов (da Silva Novaes A. et al., 2018). При этом мы можем только предполагать характер возможного терапевтического действия селективных ингибиторов на внутриклеточную РАС. В-четвертых, данное направление исследований способствует разработке принципиально новых фармакологических препаратов, способствующих более эффективному решению практических задач не только в нефрологии, но и в борьбе с заболеваниями сердечно-сосудистой системы и в области онкологии. <strong>3.2. МИНЕРАЛОКОРТИКОИДЫ.</strong> &nbsp; Анализ фармакологических способов контроля метаболизма минералокортикоидов вовлечен в довольно широкий круг задач, далеко выходящий за пределы изучения патогенеза почечной недостаточности (Zhang D. et al., 2009; Welch A.K. et al., 2016; Bavishi C. et al., 2016; Kawarazaki W., Fujita T., 2016; Azzam Z.S. et al., 2017). Однако, роль альдостерона в патогенезе заболеваний почек, по-прежнему занимает одно из центральных мест (Currie G. et al., 2016). Строго говоря, альдостерон синтезируется вне почки. Тем не менее, мы посчитали возможным рассмотрение эпигенетических эффектов, связанных с его метаболизмом в контексте анализируемого вопроса, поскольку его физиологические, патофизиологические и фармакологические аспекты тесно связаны с функционированием локальной РАС коры надпочечников и внутрипочечной РАС (Feraille E., Dizin E., 2016; Kawarazaki W., Fujita T., 2016; Nehme A., Zibara K., 2017). Возможно, такое объединение может иметь и более обоснованный аргументы, однако, данный вопрос требует дополнительного изучения (De Mello W.C., 2017). Тем не менее, уже известные факты, широко применяемые в практической медицине (Bavishi C. et al., 2016; Currie G. et al., 2016), дают нам право дополнить выше изложенные аргументы сведениями о роли эпигенетических механизмов в патофизиологии альдостерона и РААС. Позволим себе еще одно краткое замечание. В процессе филогенеза появление у амниот минералокортикоидов произошло относительно недавно &ndash; в связи с выходом позвоночных животных на сушу. В то время, как у низших позвоночных (анамний) функцию минералокортикоидов выполнял кортизол (Dolomatov S.I. et al., 2012). Вероятно, поэтому мы наблюдаем интерференцию эффектов альдостерона и глюкокортикоидов на процессы реабсорбции натрия в дистальном отделе нефрона человека (Feraille E., Dizin E., 2016; Nehme A., Zibara K., 2017). В данном случае упоминание о минералокортикоидной функции глюкокортикоидов следует рассматривать, как попытку более полно оценить обсуждаемые процессы. Возможно, рассмотрение регуляторных эффектов альдостерона, необходимо начать с того, что наиболее важными стимулами интенсивности его секреции в коре надпочечников являются: повышение содержания ионов калия во внеклеточной (внутрисосудистой) жидкости и ангиотензина-II, образующийся в локальной (внутриорганной) РАС надпочечников и почек (Feraille E., Dizin E., 2016; Kawarazaki W., Fujita T., 2016; Nehme A., Zibara K., 2017). Поскольку стимулирующее действие ангиотензина-II на уровень секреции альдостерона реализуется через АТ1-популяцию рецепторов, уместно напомнить, что ранее была установлена роль эпигенетических механизмов в управлении экспрессией АТ1 рецепторов, в том числе и в корковом веществе надпочечников (Bogdarina I. et al., 2007; Liang M. et al., 2013). Кроме того, показано, что механизмы фетального программирования, обусловленные даже непродолжительным повышением кортизола в крови матери могут усиливать экспрессию их рецепторов у плода (Liang M. et al., 2013; Tain Y.L., Hsu C.N., 2017). По мнению авторов цитируемых публикаций, такой механизм может способствовать неадекватной стимуляции реабсорбции натрия в зрелом возрасте, приводя к системным нарушениям параметров гемодинамики. Кроме того, авторы отмечают, что активация реабсорбции натрия в дистальном отделе нефрона может осуществляться и за счет триметилирования of H3K36, сопровождающегося подавлением экспрессии гена 11&beta;-гидроксистероид дегидрогеназы-2, отвечающей за метаболический клиренс глюкокортикоидов. Необходимо подчеркнуть, что патофизиологические механизмы альдостерона в почках непосредственно сопряжены со стимуляцией фиброгенеза в тканях органа, повреждением подоцитов и нарастанием протеинурии (Kawarazaki W., Fujita T., 2016). В современной литературе мы наблюдаем повышение интереса к эпигенетическим механизмам перестройки работы почки, связанных с изменением экспрессии транспортных систем натрия, калия и хлора в различных сегментах нефрона (Tain Y.L., Hsu C.N., 2017). Одно из центральных мест этого направления исследований прочно занимает эпителиальный натриевый канал (ENaC) дистального отдела нефрона (Duarte J.D. et al., 2012; Kone B.C., 2013; Yu Z. et al., 2013). В цитируемых источниках сообщается, что альдостерон стимулирует транскрипцию гена белка альфа-субъединицы EnaC (&alpha;ENaC) через активацию фермента глюкокортикоид-индуцируемую киназу-1, подавляющую активность Dot1a (метилтрансферазу белков-гистонов H3K79), транскрипционного фактора Af9 и гистоновой деацетилазы Sirt1, изменяя активность комплекса Dot1/Af9. Кроме того, в литературе имеются данные о том, что индуцированная альдостероном модификация хроматина может способствовать усилению экспрессии гена эндотелина-1 в соединительных трубочках внутренней медуллы (Welch A.K. et al., 2016). Поскольку рецепторам минералокортикоидов отводится важная роль в реализации эпигенетических эффектов альдостерона, могут представлять интерес данные о том, какова роль данной популяции рецепторов в регуляции экспрессии генов, чувствительных к влиянию альдостерона (Ueda K. et al., 2014). Привлекают внимание сообщения о том, что эпигенетические изменения в системе РААС могут принципиально нарушать механизмы стимуляции секреции альдостерона в корковом веществе надпочечников, ослабляя регуляторную роль внутриорганной РАС почек и надпочечников, выводя на первые позиции совершенно иные факторы (например, лептин), непосредственно не связанные с функциональным состоянием почек и не привязанные к параметрам водно-солевого обмена (Kawarazaki W., Fujita T., 2016). Таким образом, проведенный анализ данных литературы показал, что эпигенетические механизмы перестройки метаболизма альдостерона являются важным фактором в патогенезе ренальных дисфункций и патологических нарушений системной гемодинамики. Установлено, что эпигенетические механизмы затрагивают: систему регуляции метаболизма неполовых стероидов; контролирующих экспрессию транспортных белков дистального отдела нефрона; секрецию физиологически активных пептидов в канальцевом отделе нефрона. Кроме того, есть основания предполагать, что процессы регулирования секреции альдостерона также могут подвергаться эпигенетическим изменениям, приводя к неадекватной стимуляции продукции гормона. Возможно, совокупность выявленных закономерностей позволяет некоторым авторам утверждать, что вызванная эпигенетической перестройкой хроматина неограниченная активация РААС и взаимное усиление патофизиологических эффектов ангиотензина-II и альдостерона является одним из базовых патогенетических механизмов хронических заболеваний почек и органов сердечно-сосудистой системы (De Mello W.C., 2017). <strong>3.3. ТРАНСФОРМИРУЮЩИЙ ФАКТОР РОСТА-бета1 </strong> &nbsp; Согласно данным литературы, трансформирующий фактор роста-бета1 (ТФР-бета1) принадлежит к суперсемейству цитокинов, в состав которых, помимо ТФР-бета, входит большое количество белков, например, ВМР, в норме имеющих важное значение для цитодифференцировки тканей и процессов заживления ран (Shi M. et al., 2011). В стимуляции внутриренального синтеза ТФР-бета1важную роль играет ангиотензин-II через АТ1 популяцию рецепторов (Reddy M.A. et al., 2014). Между тем, авторы цитируемого источника отмечают, что антагонисты АТ1 рецепторов и блокаторы АПФ-1 оказывают умеренное благоприятное воздействие на процессы фиброза органа при хронической почечной недостаточности, поскольку существуют РАС-независимые пути индукции ТФР-бета1. Известно, что ТФР-бета1 и ТФР-бета3 является ключевым фактором стимуляции фиброгенеза ткани почки в условиях хронической почечной недостаточности (Wing M.R. et al., 2013). Обнаружено, что патологические нарушения почек в условиях экспериментальных моделей острой почечной недостаточности сопровождаются достаточно быстрым приростом продукции ТФР-бета1 в тканях почки, в том числе, благодаря активации эпигенетических механизмов (Zager R.A. et al., 2011), нарушая нормальное течение репаративных процессов в почке (Bonventre J.V., Yang L., 2011). В экспериментальных условиях острой почечной недостаточности in vivo и в моделировании острого токсического воздействия на культивируемые проксимальные нефроциты было установлено, что стимуляция метилирования Н3 (H3K4mе3) предшествует резкому повышению уровня мРНК ТФР-бета1 в ткани (Zager R.A., Johnson A.C.M., 2010). Результаты экспериментальных исследований подтверждают, что эпигенетическая активация гена ТФР-бета1 происходит в условиях острой почечной недостаточности, способствуя хронизации заболеваний почек (Sun G. et al., 2014). Поскольку ТФР-бета1 может участвовать в метастазировании злокачественных опухолей, является одним из основных индукторов фиброза почек, печени, легких, кожи, проблеме клинического применения анти-ТФР-бета терапии, основанной, в том числе, на эпигенетических механизмах, уделяется значительное внимание, как наиболее перспективному направлению в лечении целого ряда опасных заболеваний (Zeisberg M., Zeisberg E.M., 2015). В частности, анализируется эффективность различных способов подавления патогенетических ТФР-бета1-заисимых механизмов через селективное ингибирование популяции II-типа рецепторов цитокина (Doi S. et al., 2011), применение антисывороток ТФР-бета1 протеина (Zeisberg M., Zeisberg E.M., 2015), использование селективных блокаторов активности деацетилаз гистоновых белков (HDAC) (Guo W. et al., 2009). Хотя, по мнению некоторых авторов, в качестве основной мишени специфических блокаторов деацетилаз гистонов следует рассматривать фермент HDAC класса I, которая, возможно, критически важна для стимуляции ТФР-бета1-зависимого фиброза почек (Liu N. et al., 2013). Также, некоторыми авторами высказывается мнение о целесообразности фармакологической коррекции баланса активности феерментов ацетилтрансфераз гистонов (HATs) и ферментов деацетилаз гистонов (HDACs) (Yuan H. et al., 2013). Необходимо отметить, что в литературе представлены обзоры, содержащие достаточно глубокий и всесторонний анализ возможных системных терапевтических эффектов ингибиторов энзиматической активности HDACs, нацеленных на предотвращение фиброза внутренних органов, включая почки, а также других модуляторов эпигенетических изменений в ренальной паренхиме (Van Beneden K. et al., 2013; Tang J., Zhuang S., 2015). Приводятся аргументы в пользу терапевтической эффективности ингибиторов метилирования в развитии ТФР-бета1-зависимого фиброгенеза почки (Bechtel W. et al., 2010). При этом, в качестве наиболее актуальной мишени перспективных препаратов предлагается фермент метилтрансфераза 7/9 (SET7/9), осуществляющая монометилирование остатка лизина 4 белка-гистона H3 (H3K4me1) (Sasaki K. et al., 2016). На том основании, что некоторые виды микроРНК (в частности, miR-29b) обладают способностью подавлять некоторые просклерозирующие эффекты ТФР-бета1, предполагается, данное направление также может быть в перспективе применено для сдерживания прогрессирующей почечной недостаточности (Wing M.R. et al., 2013). Установлено, что некоторые микроРНК (микро РНК-21 и микро ТНК-192), могут рассматриваться в качестве индукторов ТФР-бета1-зависимого тубулоинтерстициального фиброза и гломерулосклероза (Liu R. et al., 2015). Стимулированное ТФР-бета1 повышение транскрипции микро РНК<em>-192</em> подтверждено в опытах in vitro в культуре клеток (человека и мыши) мезангиума, подоцитов, эндотелиоцитов и канальцевого эпителия (Kato M. et al., 2013). Авторам также удалось установить, что стимуляция ТФР-бета1 транскрипции микро РНК<em>-192</em> зависит от нескольких участков ацетилирования гистона Н3 (H3K9, H3K14 и H3K27). Кроме того, авторами данной публикации высказывается мысль о том, что микро РНК-192 принадлежит особая роль в каскадном усилении просклерозирующих эффектов ТФР-бета1 через активацию транскрипции микро РНК-200b и микро РНК-200c, повышающих экспрессию генов коллагена-1альфа2 (<em>Col1a2</em><em>), коллагена-4альфа1(</em><em>Col4a1</em>) и самого ТФР-бета1 (<em>TGF-</em>&beta;<em>1</em>). С другой стороны, известно, что ТФР-бета1 через Smad3-протеин, стимулирует образование микро РНК-21, активирующей, в свою очередь, экспрессию генов collagen I и fibronectin, а также способствующей повышению уровня &alpha;-SMA в почке (Wing M.R. et al., 2013). Показано, что ТФР-бета1 через активацию фермента метилирования гистонов H3K4-метилтрансферазы SET7/9, повышает экспрессию генов, запускающих, процессы фиброгенеза в почке. Напротив, подавление SET7/9 ингибирует экспрессию индуцируемых ТФР-бета1 генов фиброза (Reddy M.A, Natarajan R., 2015; Dressler G.R., Patel S.R., 2015; Hilliard S.A., El-Dahr S.S., 2016). Возможно, медиаторами эффекта ТФР-бета1 в отношении активности SET7/9 являются продукты реакции, катализируемой ферментом 12/15-липоксигеназы (Yuan H. et al., 2016). Наряду с этим, сообщается о том, что ТФР-бета1-зависимая активация фиброгенеза осуществляется через систему внутриклеточной передачи сигнала Smad-протеинами (Reddy M.A, Natarajan R., 2015). Авторы указывают, что, например, Smad2-протеин причастен к стимуляции ацетилирования молекулы гистона Н3 (H3K9/14Ac). Наряду с ранее названными эпигенетическими изменениями, отмечается, что метилирование гистона Н3 (H3K9me2 и H3K9me3) является важным механизмом в регуляции экспрессии генов коллагена-1альфа1 (Col1&alpha;1) и ингибитора активатора плазминогена (PAI-1) (Reddy M.A. et al., 2013; Sun G. et al., 2014). Одним из базовых патогенетических механизмов тубулоинтерстициальных повреждений канальцевого отдела нефрона является эпителиально-мезенхимальная трансформация, маркером интенсивности которого служит экспрессия &alpha;-актина (&alpha;SMA). В связи с этим представляет интерес сообщение о том, что в условиях экспериментальной модели односторонней обструкции мочеточника у мышей TGF-&beta;1 не оказывал существенного влияния на состояние H3K9Ac в проксимальных нефроцитах и миофибробластах. Наряду с этим, цитокин приводил к перераспределению метки H3K9Me3 в хроматине ядра фибробластов, что коррелировало с увеличением экспрессии &alpha;-SMA (Hewitson T.D. et al., 2017). Таким образом, обзор литературы показал, что эпигенетические эффекты TGF-&beta;1 оказывают весьма значительное влияние на процессы фиброгенеза в тканях почек, затрагивая, фактически, все известные механизмы импринтинга: метилирование и ацетилирование гистоновых белков, а также перестройку экспрессии некоторых специфических микро РНК. Следует отметить, что эпигенетические механизмы, инициируемые TGF-&beta;1 в ренальной паренхиме, не только непосредственно участвуют в реализации просклерозирующего эффекта цитокина, но и способствуют резкому усилению TGF-&beta;1-зависимых патогенетических механизмов ремоделирования ренальной паренхимы. При этом, ингибирование TGF-&beta;1-зависимой модификации хроматина способствует сдерживанию патологических изменений деятельности почек. Что, с одной стороны, доказывает важную патогенетическую роль TGF-&beta;1 в хронизации и прогрессировании почечной недостаточности. С другой стороны, это открывает новые перспективы использования селективных модуляторов эпигенетических процессов в практической медицине, что подтверждается сведениями о готовности их применения в доклинических испытаниях (Van Beneden K. et al., 2013). <strong>3.4. МОЛЕКУЛА ОКСИДА АЗОТА (</strong><strong>NO</strong><strong>)</strong> &nbsp; По данным литературы, эпигенетические механизмы выполняют очень важную функцию в регуляции аргинин-зависимого пути синтеза NO в системе изоформ NO-синтаз: эндотелиальной (nNOS - NOS-1), индуцибельной (iNOS - NOS-2), и нейрональной (eNOS - NOS-3). Некоторые авторы выделяют еще одну изоформу &ndash; митохондриальную mtNOS. Имеются данные о том, что гипоксия, один из наиболее мощных активаторов эпигенетической модификации хроматина, способствует изменению экспрессии генов различных изоформ фермента NOS (Shirodkar A.V., Marsden P.A., 2011). Согласно данным цитируемого обзора, ишемия может сопровождаться репрессией гена eNOS в эндотелиоцитах, на фоне активации транскрипции всех трех изоформ NOS в неоинтиме, включая транскрипцию гена eNOS в мышечных волокнах стенки кровеносных сосудов. Авторы отмечают, что добавление к культивируемым клеткам гладкой мускулатуры сосудистой стенки ингибитора метилтрансферазы ДНК (5-azacytidine), а также как ингибитора HDAC (Trichostatin A), приводило к стимуляции транскрипцию гена eNOS в этих клетках, также, способствуя увеличению мРНК eNOS. В исследованиях in vitro на культуре проангиогенных клеток (early EPCs) и мезангиобластов было установлено, что добавление в среду только 3-deazaneplanocin A (DZNep), ингибитора триметилирования H3K27, не оказывало существенного влияния на экспрессию гена eNOS, тогда, как сочетанное воздействие на клетки DZNep и ингибитора гистоновой дезацетилазы Trichostatin A (TSA) увеличивает экспрессию eNOS (Ohtani K. et al., 2011). Результаты клинических наблюдений, подтверждая роль метилирования и ацетилирования гистонов в регуляции экспресси гена eNOS, также акцентируют внимание на процессах метилирования ДНК (Kheirandish-Gozal L. et al., 2013). Возможно, анализ процесса метилирования промотора гена eNOS представляет интерес в составлении прогноза рисков патологических нарушений некоторых показателей минерального обмена человека (Harvey N.C. et al., 2012). Эпигенетические механизмы контроля экспрессия eNOS в эндотелии кровеносных сосудов почки критически важны в процессе органогенеза, а также адаптации почки к гипоксии и изменениям параметров внутрипочечной гемодинамики (Jamal A. et al., 2012). По данным источника, эндотелиоциты могут не проявлять чувствительность к действию цитокинов, стимулирующих экспрессию iNOS, в том случае, если промотор этого гена обильно метилирован, В норме в тканях почки преимущественно представлены nNOS (NOS-1), в основном в области macula densa, а также eNOS (NOS-3) в эндотелиоцитах и в канальцевом эпителии. Известно, что NO участвует в регуляции ренальной гемодинамики, канальцевого транспорта натрия, регуляции величины скорости клубочковой фильтрации. Является важным фактором контроля тубуло-гломерулярной обратной связи, регулятором агрегатного состояния крови и процессов воспаления. Однако, динамика изменения внутрипочечной продукции NO не всегда совпадает с уровнем экспрессии генов NO-синтаз. Так, как интенсивность внутрипочечного синтеза NO, по мере прогрессирования почечной недостаточности, может снижаться в результате поражения сосудистого русла, фиброза коркового слоя почек, изменения метаболизма субстрата (L-Arginine), повышения концентрации эндогенного блокатора NO-синтаз (асимметричного диметиларгинина - ADMA) и доступности кофакторов NOS-синтазных энзиматических комплексов. Установлено, что прогрессирование почечной недостаточности сопровождается снижением внутрипочечной продукции NO, что коррелирует с интенсивностью фиброгенеза в почке (Schmidt Dellamea B. et al., 2014). Вместе с тем, авторы отмечают роль некоторых биологически активных веществ (инсулина, фактора некроза опухоли-альфа, ангиотензина-II) в регуляции экспрессии генов NO-синтаз. Возможно, стимулируемая инсулином избыточная экспрессия гена eNOS (NOS-3) является одним из важнейших патогенетических механизмов прогрессирования диабетической нефропатии, поскольку в условиях экспериментальной модели, введение животным vorinostat (неселективного ингибитора гистон-деацетилаз класса I и класса II понижало экспрессию данного гена, что способствовало ограничению протеинурии о накопления белков внеклеточного матрикса мезангиальными клетками (Advani A. et al., 2011). Сообщается, что, во-первых, в условиях экспериментальной патологии почек избыточная внутрипочечная продукция оксида азота является важным патогенетическим фактором развития гломерулопаии. Во-вторых, Trichostatin A (TSA) - ингибитор гистон-деацетилаз может способствовать нормализации избыточной продукции NO, как клетками мезангиума, так и индуцибельной iNOS, активируемой некоторыми провоспалительными цитокинами (например, IL-1&beta;) (Van Beneden K. et al., 2013). Возможно, ингибиторы деацетилаз гистонов следует рассматривать в качестве перспективной группы фармакологических препаратов, позволяющих сдерживать целый ряд NO-зависимых патогенетических механизмов прогрессирования почечной недостаточности: воспалительный и просклерозирующий компоненты тубуло-интерстициальных повреждений, блокировать активацию фибробластов почки и апоптоз канальцевого эпителия почки (Jamal A. et al., 2012). Кроме того, ингибиторы деацетилаз гистонов, снижая в почке экспрессию генов iNOS и eNOS, способствуют восстановлению функции почек на фоне ограничения образования &alpha;-SMA, коллагена I, фибронектина, ТФР бета1, а также ограничивают апоптоз в условиях диабетической нефропати (Khan S., Jena G., 2014). Установлено, что гипоксия является одним из наиболее мощных факторов, регулирующих экспрессию гена <em>NOS3</em> эндотелиальной NO-синтазы эндотелиоцитов через снижение и ацетилирования гистоновых белков, и метилирования остатков лизина 4 в гистоне H3 (Fish J.E. et al., 2010). Высказывается мнение о том, что, спровоцированное гипоксией усиление экспрессии индуцибельной iNOS, также может оказывать нефропротекторный эффект при реперфузионных повреждениях органа (Bonventre J.V., Yang L., 2012). Тем не менее, продолжительная стимуляция экспрессии iNOS при токсическом поражении почки рассматривается в качестве неблагоприятного фактора, усугубляющего течение заболевания (Sattarinezhad E. et al., 2017). Необходимо признать, что проблема эпигенетической перестройки внутрипочечной системы оксида азота достаточно многогранна, в частности, в литературе представлены работы, посвященные анализу изменений баланса некоторых гуморальных регуляторов деятельности почки (NO, ангиотензина-II, производных арахидоновой кислоты) в условиях фетального программирования (Tain Y.-L., Joles J.A., 2016). Обсуждаемые вопросы постоянно находятся в поле зрения современной науки, о чем свидетельствуют обзорные публикации, содержащие сведения о фундаментальных эпигенетических механизмах регуляции системы оксида азота (Vasudevan D. et al., 2016; Socco S. et al., 2017). Однако, нельзя исключать возможности наличия органоспецифических, в том числе в ренальной паренхиме, механизмов контроля экспрессии различных изоформ NOS, в частности, iNOS и eNOS (Cerkezkayabekir A. et al., 2017). Суммируя изложенные факты, можно сделать вывод о том, что эпигенетическая трансформация системы оксида азота является важным компонентом патогенетических механизмов нарушения деятельности почек. Имеющиеся в литературе факты указывают, что инициирование данной перестройки, например, гипоксией тканей или под воздействием гормонов и цитокинов, может осуществляться на самых ранних этапах заболевания почек. Кроме того, ренальная система NOS подвергается радикальной модификации по мере прогрессирования почечной недостаточности, что проявляется в уменьшении экспрессии nNOS в корковом веществе почек, неуклонном снижении экспрессии eNOS в эндотелиоцитах и появлении атипичной локализации eNOS в мышечном слое сосудистой стенки, стимуляции экспрессии iNOS. С одной стороны, известно, что NOS почек (главным образом nNOS) принимают участие в регуляции активности внутриорганной РАС, а молекула NO &ndash; один из основных антагонистов ренотропных эффектов ангиотензина-II на сосудистом и канальцевом уровне (Chappell M.C., 2012; Thoonen R. et al., 2013). Следовательно, ослабление внутриорганных регуляторных влияний конститутивных NO-синтаз может являться одной из причин неограниченной активации внутрипочечной РАС и ТФР-бета в условиях прогрессирования почечной недостаточности (Macconi D. et al., 2014). Более того, по мнению некоторых авторов именно активацию митохондриальной NOS допустимо рассматривать в ряду основных патогенетических механизмов эпигенетической активации внутриклеточной РАС (De Mello W.C., 2017). С другой стороны, неадекватная активация экспрессии NOS (eNOS и iNOS) на определенных этапах течения заболевания, в силу специфики физико-химических свойств конечного продукта &ndash; молекулы оксида азота и особенностей функционирования NO-синтазных комплексов, может служить источником активных форм кислорода и азота, внося, таким образом, существенный вклад в усиление патологических процессов (Advani A. et al., 2011; Sattarinezhad E. et al., 2017; Tain Y.-L. et al., 2017). Помимо этого, обсуждение эпигенетических перестроек аргинин-зависимого пути образования NO не исчерпывает всей темы метаболизма оксида азота в почках в норме и при патологии. Известно, что существует механизм ресинтеза молекулы NO, использующий в качестве субстрата химически стабильные продукты окисления NO (нитриты, нитраты и др.) и контролируемый такими белками, как гемоглобин или цитохром Р450. В современных обзорах мы встречаем упоминание аргинин-независимого синтеза NO в связи с эпигенетической модуляций системы оксида азота (Vasudevan D. et al., 2016; Socco S. et al., 2017). Однако, данные механизмы имеют определенную специфику, характерную для обменных и транспортных процессов, протекающих в тканях почек. <strong>3.5. ПАТОФИЗИОЛОГИЧЕСКОЕ ЗНАЧЕНИЕ ЭПИГЕНЕТИЧЕСКОЙ ТРАНСФОРМАЦИИ СИСТЕМЫ ВНУТРИОРГАННОЙ ГУМОРАЛЬНОЙ РЕГУЛЯЦИИ ДЕЯТЕЛЬНОСТИ ПОЧЕК</strong> &nbsp; Результаты проведенного обзора позволяют сделать вывод о том, что эпигенетические механизмы вносят очень важный вклад в перестройку гуморальных систем регуляции деятельности почек в условиях почечной недостаточности, во многом способствуя прогрессирующему сокращению популяции действующих нефронов, непосредственно создавая предпосылки неблагоприятного течения заболевания. При этом, можно выделить несколько общих тенденций, характерных для эпигенетической трансформации внутриренального синтеза и метаболизма физиологически активных веществ. Во-первых, формирование атипичных очагов их продукции, что наиболее явно присутствует в процессах перестройки систем РАС и оксида азота. Во-вторых, гуморальные факторы, осуществляющие в неповрежденной почке координацию физиологических систем контроля гомеостатической деятельности почек, по мере усиления некоторых эпигенетических изменений, все более утрачивают функции регуляции гомеостаза и переключаются на патофизиологический путь индукции ренальных дисфункций и стимуляции прогрессирования почечной недостаточности. В-третьих, эпигенетические изменения, затрагивающие гены белков, выполняющих ключевые функции в синтезе и метаболизме гуморальных факторов регуляции функций почек, могут выполнять роль пускового механизма становления и прогрессирования почечной недостаточности. В дальнейшем, неограниченный синтез этих молекул белковой и небелковой природы приводит к триггерному усилению процесса, в том числе, опять же с привлечением эпигенетической перестройки хроматина. Следовательно, с одной стороны, гены белков, управляющих продукцией гуморальных факторов регуляции функций почек, являются объектом импринтинга. С другой стороны, стимулированная импринтингом модуляция синтеза гуморальных факторов, на последующем витке спирали, содействует дальнейшему углублению эпигенетической модификации хроматина и усилению роста их образования. Наиболее отчетливо указанная закономерность прослеживается в неограниченной активации РААС и системы ТФР-бета почек. В-четвертых, анализируя спровоцированную импринтингом трансформацию баланса ренотропных регуляторных эффектов гуморальных факторов, можно сделать вывод о том, что в этих условиях наблюдается безмерное нарастание вазотонического, просклерозирующего и провоспалительного потенциала в результате неограниченной активации РААС и системы ТФР-бета. На этом фоне происходит неуклонное сокращение регуляторных возможностей оппозиционного вектора контроля, представленного, в частности, системой оксида азота, в первую очередь, конститутивными изоформами eNOS и nNOS. В-пятых, раскрытие эпигенетических процессов в становлении и прогрессировании нефропатий различного генеза не только способствует созданию более прочной теоретической основы патогенеза почечной недостаточности, но и открывает перспективы к разработке принципиально новых фармакологических способов коррекции функции почек. К сожалению, формат рукописи не позволяет уделить данной теме того внимания, которое она безусловно заслуживает. Между тем, важный практический интерес представляют результаты исследования роли эпигенетических механизмов в модуляции систем аргинин-вазопрессина (Murgatroyd C., 2014; Lesse A. et al., 2017), порообразующих белков аквапоринов (Park E.-J., Kwon T.-H., 2015; MacManes M.D., 2017) и атриального натрийуретического пептида (Sergeeva I.A. et al., 2014; 2016). Равно, как и ренотропные эпигенетические эффекты инсулина (Kumar S. et al., 2016; Shiels P.G. et al., 2017), факторов, индуцируемых гипоксией (HIFs семейство протеинов) (Perez-Perri J.I. et al., 2011; Liu J. et al., 2017), продуктов метаболизма арахидоновой кислоты (Yuan H. et al., 2016) и тироксина (Liu X. et al., 2014; Re A. et al., 2016) могут иметь самое непосредственное отношение к обсуждаемым вопросам. По нашему мнению, данная тема может представлять интерес для понимания особенностей патофизиологических механизмов нарушения функции почек. Поскольку, эпигенетическая модификация хроматина играет принципиально важную роль в нарушении баланса внутрипочечного метаболизма гуморальных факторов регуляции функции почек. Средства фармакологической коррекции, разработанные в соответствии с пониманием механизмов импринтинга в значительной степени, могут способствовать в сдерживании хронизации и прогрессирования почечной недостаточности. Напротив, отказ от более современной стратегии сдерживания прогрессирующих нарушений ренальной паренхимы, может иметь последствия в форме изменений процессов синтеза гуморальных факторов под влиянием эпигенетических механизмов, оказыващих дальнейшее влияние на ковалентную модификацию хроматина, а также усиливающих патофизиологические механизмы повреждения ренальной паренхимы. <strong>СПИСОК ЛИТЕРАТУРЫ К ГЛАВЕ </strong>&laquo;<strong>ФАКТОРЫ ВНУТРИОРГАННОЙ ГУМОРАЛЬНОЙ РЕГУЛЯЦИИ ДЕЯТЕЛЬНОСТИ ПОЧЕК. ИХ МЕСТО И РОЛЬ В ЭПИГЕНЕТИЧЕСКИХ МЕХАНИЗМАХ НАРУШЕНИЯ ФУНКЦИОНАЛЬНОГО СОСТОЯНИЯ РЕНАЛЬНОЙ ПАРЕНХИМЫ&raquo;</strong> &nbsp; 1.Bush E.W., McKinsey T.A. Protein acetylation in the cardiorenal axis: the promise of histone deacetylase inhibitors. Circ Res. 2010;106(2):272-284 doi: 10.1161/CIRCRESAHA.109.209338 2.Prieto M.C., Gonzalez A.A., Navar L.G. Evolving concepts on regulation and function of renin in distal nephron. Pflugers Arch. 2013;465(1):121-132 doi: 10.1007/s00424-012-1151-6 3.Gonzalez A.A., Prieto M.C. Roles of collecting duct renin and (pro)renin receptor in hypertension: mini review. Ther Adv Cardiovasc Dis. 2015;9(4):191-200 doi: 10.1177/1753944715574817 4.Sequeira Lopez M.L., Gomez R.A. Novel mechanisms for the control of renin synthesis and release. Curr Hypertens Rep. 2010;12(1):26-32 doi: 10.1007/s11906-009-0080-z 5.Kurtz A. Control of renin synthesis and secretion. Am J Hypertens. 2012;25(8):839-847 doi: 10.1038/ajh.2011.246 6.Gomez R.A. Fate of Renin Cells During Development and Disease. Hypertension. 2017;69(3):387-395 doi: 10.1161/HYPERTENSIONAHA.116.08316 &nbsp; 7.Gomez R.A., Sequeira-Lopez M.L.S. Renin cells in homeostasis, regeneration and immune defence mechanisms. Nat Rev Nephrol. 2018;14(4):231-245 doi: 10.1038/nrneph.2017.186 &nbsp; 8.Reddy M.A, Natarajan R. Recent Developments in Epigenetics of Acute and Chronic Kidney Diseases Kidney Int. 2015 88(2): 250&ndash;261 doi: 10.1038/ki.2015.148 &nbsp; 9.Uwaezuoke S.N., Okafor H.U., Muoneke V.N. et al. Chronic kidney disease in children and the role of epigenetics: Future therapeutic trajectories. Biomed Rep. 2016; 5(6): 660&ndash;664 doi: 10.3892/br.2016.781 &nbsp; 10.Zununi Vahed S., Samadi N., Mostafidi E. et al. Genetics and Epigenetics of Chronic Allograft Dysfunction in Kidney Transplants. Iran J Kidney Dis. 2016;10(1):1-9 &nbsp; 11.Lee-Son K., Jetton J.G. AKI and Genetics: Evolving Concepts in the Genetics of Acute Kidney Injury: Implications for Pediatric AKI. J Pediatr Genet. 2016; 5(1): 61&ndash;68 doi: 10.1055/s-0035-1557112 &nbsp; 12.Woroniecki R., Gaikwad A., Susztak K. Fetal environment, epigenetics, and pediatric renal disease. Pediatr Nephrol. 2011; 26(5): 705&ndash;711 doi: 10.1007/s00467-010-1714-8 &nbsp; 13.K&ouml;ttgen A., Pattaro C., B&ouml;ger C.A. et al. Multiple New Loci Associated with Kidney Function and Chronic Kidney Disease: The CKDGen consortium. Nat Genet. 2010; 42(5): 376&ndash;384 doi: 10.1038/ng.568 &nbsp; 14.Ma R.C.W. Genetics of cardiovascular and renal complications in diabetes. J Diabetes Investig. 2016; 7(2): 139&ndash;154 doi: 10.1111/jdi.12391 &nbsp; 15.Thomas M.C. Epigenetic Mechanisms in Diabetic Kidney Disease. Curr Diab Rep.2016;16:31 doi 10.1007/s11892-016-0723-9 &nbsp; 16.Witasp A., Van Craenenbroeck A.H., Shiels P.G. et al. Current epigenetic aspects the clinical kidney researcher should embrace. Clinical Science. 2017; 131:1649&ndash;1667 doi:10.1042/CS20160596 &nbsp; 17.Shirodkar A.V., Marsden P.A. Epigenetics in cardiovascular disease. Curr Opin Cardiol. 2011; 26(3): 209&ndash;215 doi: 10.1097/HCO.0b013e328345986e &nbsp; 18.Shi M., Zhu J., Wang R. et al. Latent TGF-&beta; structure and activation. Nature. 2011; 474(7351): 343&ndash;349 doi: 10.1038/nature10152 &nbsp; 19.Kobori H., Katsurada A., Miyata K. et al. Determination of plasma and urinary angiotensinogen levels in rodents by newly developed ELISA. Am J Physiol Renal Physiol. 2008; 294(5): F1257&ndash;F1263 doi: 10.1152/ajprenal.00588.2007 &nbsp; 20.Marumo T., Hishikawa K., Yoshikawa M., Fujita T. Epigenetic Regulation of BMP7 in the Regenerative Response to Ischemia. J Am Soc Nephrol. 2008; 19(7): 1311&ndash;1320 doi: 10.1681/ASN.2007091040 &nbsp; 21.Hayashi K., Sasamura H., Nakamura M. et al. Renin-angiotensin blockade resets podocyte epigenome through Kruppel-like Factor 4 and attenuates proteinuria. Kidney Int. 2015;88(4):745-753 doi: 10.1038/ki.2015.178 &nbsp; 22.Reddy M.A., Sumanth P., Lanting L. et al. Losartan reverses permissive epigenetic changes in renal glomeruli of diabetic db/db mice. Kidney Int. 2014; 85(2): 362&ndash;373 doi: 10.1038/ki.2013.387 &nbsp; 23.Kobori H., Kamiyama M., Harrison-Bernard L.M., Navar L.G. Cardinal Role of the Intrarenal Renin-Angiotensin System in the Pathogenesis of Diabetic Nephropathy. J Investig Med. 2013; 61(2): 256&ndash;264 doi:10.231/JIM.0b013e31827c28bb &nbsp; 24.Beckerman P., Ko Y.-A., Susztak K. Epigenetics: a new way to look at kidney diseases. Nephrol Dial Transplant. 2014; 29(10): 1821&ndash;1827 doi: 10.1093/ndt/gfu026 &nbsp; 25.van der Wijst M.G.P., Venkiteswaran M., Chen H. et al. Local chromatin microenvironment determines DNMT activity: from DNA DNMT activity: from DNA methyltransferase to DNA demethylase or DNA dehydroxymethylase. Epigenetics. 2015; 10(8): 671&ndash;676 doi:10.1080/15592294.2015.1062204 &nbsp; 26.Saletore Y.,Chen-Kiang S., Mason C.E. Novel RNA regulatory mechanisms revealed in the epitranscriptome. RNA Biol. 2013; 10(3): 342&ndash;346 doi: 10.4161/rna.23812 &nbsp; 27.Voon H.P.J., Wong L.H. New players in heterochromatin silencing: histone variant H3.3 and the ATRX/DAXX chaperone. Nucleic Acids Res. 2016; 44(4): 1496&ndash;1501 doi: 10.1093/nar/gkw012 &nbsp; 28.Jamal A., Man H.S.J., Marsden P.A. Gene Regulation in the Vascular Endothelium: Why Epigenetics Is Important for the Kidney. Semin Nephrol. 2012; 32(2): 176&ndash;184 doi: 10.1016/j.semnephrol.2012.02.009 &nbsp; 29.Zama A.M., Uzumcu M. Epigenetic effects of endocrine-disrupting chemicals on female reproduction: An ovarian perspective. Front Neuroendocrinol. 2010; 31(4): 420&ndash;439 doi:10.1016/j.yfrne.2010.06.003 &nbsp; 30.Lister R., Pelizzola M., Dowen R.H. et al. Human DNA methylomes at base resolution show widespread epigenomic differences. Nature. 2009; 462: 315-322 doi: 10.1038/nature08514 &nbsp; 31.Efimova O.A., Pendina A.A., Tikhonov A.V. et al. DNA methylation - a major mechanism of human genome reprogramming and regulation. Medical Genetics. 2012; 4(118): 10-18 &nbsp; 32.Bechtel W., McGoohan S., Zeisberg E.M. et al. Methylation determines fibroblast activation and fibrogenesis in the kidney. Nat Med. 2010; 16(5): 544&ndash;550 doi: 10.1038/nm.2135 &nbsp; 33.Ponnaluri V.K.C., Ehrlich K.C., Zhang G., Lacey M., Johnston D., Pradhan S., Ehrlich M. Association of 5-hydroxymethylation and 5-methylation of DNA cytosine with tissue-specific gene expression. Epigenetics. 2016; 12(2): 123-138 doi: 10.1080/15592294.2016.1265713 &nbsp; 34.Quarta C., Shneider R., Tschӧp M.H. Epigenetic ON/OFF Switches for Obesity. Cell. 2016; 164(3): 341-342 doi: 10.1016/j.cell.2016.01.006 &nbsp; 35.Dwivedi R.S., Herman J.G., McCaffrey T. et al. Beyond genetics: epigenetic code in chronic kidney disease. Kidney Int. 2011; 79(1): 23-32 doi: 10.1038/ki.2010.335 &nbsp; 36.Ziller M.J., Gu H., M&uuml;ller F., Donaghey J. et al. Charting a dynamic DNA methylation landscape of the human genome. Nature. 2013; 500(7463): 477-481. doi: 10.1038/nature12433 &nbsp; 37.Zhang D., Yu Z., Cruz P. et al. Epigenetics and the Control of Epithelial Sodium Channel Expression in Collecting Duct. Kidney Int. 2009; 75(3): 260&ndash;267 doi: 10.1038/ki.2008.475 &nbsp; 38.Auclair G., Weber M. Mechanisms of DNA methylation and demethylation in mammals. Biochimie. 2012; 94(11): 2202-2211 doi: 10.1016/j.biochi.2012.05.016 &nbsp; 39.Araki Y., Mimura T. The Histone Modification Code in the Pathogenesis of Autoimmune Diseases. Mediators Inflamm. 2017;2017:2608605 doi: 10.1155/2017/2608605 &nbsp; 40.Ganai S.A., Ramadoss M., Mahadevan V. Histone Deacetylase (HDAC) Inhibitors - emerging roles in neuronal memory, learning, synaptic plasticity and neural regeneration. Curr Neuropharmacol. 2016; 14(1):55-71 &nbsp; 41.Gong F., Chiu L.Y., Miller K.M. Acetylation Reader Proteins: Linking Acetylation Signaling to Genome Maintenance and Cancer. PLoS Genet. 2016; 12(9):e1006272 doi: 10.1371/journal.pgen.1006272 &nbsp; 42.Nathan D., Ingvarsdottir K., Sterner D. E. et al. Histone sumoylation is a negative regulator in Saccharomyces cerevisiae and shows dynamic interplay with positive-acting histone modifications. Genes and Development. 2006; 20(8):966&ndash;976. doi: 10.1101/gad.1404206 &nbsp; 43.Rossetto D., Avvakumov N., C&ocirc;t&eacute; J. Histone phosphorylation: a chromatin modification involved in diverse nuclear events. Epigenetics. 2012; 7(10):1098&ndash;1108 doi: 10.4161/epi.21975 &nbsp; 44.Chen K.W., Chen L. Epigenetic Regulation of BDNF Gene during Development and Diseases. Int J Mol Sci. 2017; 18(3): 571 doi: 10.3390/ijms18030571 &nbsp; 45.Wang Z., Zang C., Rosenfeld J. A. et al. Combinatorial patterns of histone acetylations and methylations in the human genome. Nature Genetics. 2008; 40(7):897&ndash;903 doi: 10.1038/ng.154 &nbsp; 46.Nabzdyk C.S., Pradhan-Nabzdyk L., LoGerfo F.W. RNAi therapy to the wall of arteries and veins: anatomical, physiologic, and pharmacological considerations. J Transl Med. 2017; 15:164 doi: 10.1186/s12967-017-1270-0 &nbsp; 47.Cui J., Qin L., Zhang J., Abrahimi P. et al. Ex vivo pretreatment of human vessels with siRNA nanoparticles provides protein silencing in endothelial cells. Nat Commun. 2017; 8:191 doi: 10.1038/s41467-017-00297-x &nbsp; 48.Matsusaka T., Niimura F., Shimizu A. et al. Liver Angiotensinogen Is the Primary Source of Renal Angiotensin II. J Am Soc Nephrol. 2012; 23(7): 1181&ndash;1189 doi: 10.1681/ASN.2011121159 &nbsp; 49.Harshman L.A., Zepeda-Orozco D. Genetic Considerations in Pediatric Chronic Kidney Disease. J Pediatr Genet. 2016; 5(1): 43&ndash;50 doi: 10.1055/s-0035-1557111 &nbsp; 50.Tain Y.-L., Huang L.-T., Hsu C.-N. Developmental Programming of Adult Disease: Reprogramming by Melatonin? Int J Mol Sci. 2017; 18(2): 426. doi: 10.3390/ijms18020426 &nbsp; 51.Tain Y.L., Hsu C.N. Developmental Origins of Chronic Kidney Disease: Should We Focus on Early Life? Int J Mol Sci. 2017; 18(2): 381 doi: 10.3390/ijms18020381 &nbsp; 52.Bogdarina I., Welham S., King P.J. et al. Epigenetic modification of the renin-angiotensin system in the fetal programming of hypertension. Circ Res. 2007; 100(4): 520&ndash;526 doi: 10.1161/01.RES.0000258855.60637.58 &nbsp; 53.Wu L., Shi A., Zhu D. et al. High sucrose intake during gestation increases angiotensin II type 1 receptor-mediated vascular contractility associated with epigenetic alterations in aged offspring rats. Peptides. 2016;86:133-144 doi: 10.1016/j.peptides.2016.11.002 &nbsp; 54.De Mello W.C. Chemical Communication between Heart Cells is Disrupted by Intracellular Renin and Angiotensin II: Implications for Heart Development and Disease. Front Endocrinol (Lausanne). 2015; 6: 72 doi: 10.3389/fendo.2015.00072 &nbsp; 55.Liang M., Cowley A.W., Mattson D.L. et al. Epigenomics of Hypertension. Semin Nephrol. 2013; 33(4): 392&ndash;399 doi: 10.1016/j.semnephrol.2013.05.011 &nbsp; 56.Abadir P.M., Walston J.D., Carey R.M. Subcellular characteristics of functional intracellular renin&ndash;angiotensin systems. Peptides. 2012; 38(2): 437&ndash;445 doi: 10.1016/j.peptides.2012.09.016 &nbsp; 57.Ellis B., Li X.C., Miguel-Qin E. et al. Review: Evidence for a functional intracellular angiotensin system in the proximal tubule of the kidney. Am J Physiol Regul Integr Comp Physiol. 2012; 302(5): R494&ndash;R509 doi: 10.1152/ajpregu.00487.2011 &nbsp; 58.Thomas M.C. Epigenetic Mechanisms in Diabetic Kidney Disease. Curr Diab Rep. 2016;16:31 doi: 10.1007/s11892-016-0723-9 &nbsp; 59.Marumo T., Yagi S., Kawarazaki W. et al. Diabetes Induces Aberrant DNA Methylation in the Proximal Tubules of the Kidney. J Am Soc Nephrol. 2015; 26(10): 2388&ndash;2397 doi: 10.1681/ASN.2014070665 &nbsp; 60.Satou R., Miyata K., Gonzalez-Villalobos R.A. et al. Interferon-&gamma; biphasically regulates angiotensinogen expression <em>via</em> a JAK-STAT pathway and suppressor of cytokine signaling 1 (SOCS1) in renal proximal tubular cells. FASEB J. 2012; 26(5): 1821&ndash;1830 doi: 10.1096/fj.11-195198 &nbsp; 61.O&#39;Leary R., Penrose H., Miyata K., Satou R. Macrophage-derived IL-6 contributes to ANG II-mediated angiotensinogen stimulation in renal proximal tubular cells. Am J Physiol Renal Physiol. 2016; 310(10): F1000&ndash;F1007 doi: 10.1152/ajprenal.00482.2015 &nbsp; 62.Bourgeois C.T., Satou R., Prieto M.C. HDAC9 is an epigenetic repressor of kidney angiotensinogen establishing a sex difference. Biol Sex Differ. 2017; 8: 18. doi: 10.1186/s13293-017-0140-z &nbsp; 63.Macconi D., Remuzzi G., Benigni A. Key fibrogenic mediators: old players. Renin&ndash;angiotensin system. Kidney Int Suppl. 2014; 4(1): 58&ndash;64 doi: 10.1038/kisup.2014.11 &nbsp; 64.Tang J., Zhuang S. Epigenetics in acute kidney injury. Curr Opin Nephrol Hypertens. 2015; 24(4): 351&ndash;358 doi: 10.1097/MNH.0000000000000140 &nbsp; 65.Rodr&iacute;guez-Romo R., Berman N., G&oacute;mez A., Bobadilla N.A. Epigenetic regulation in the acute kidney injury (AKI) to chronic kidney disease transition (CKD). Nephrology (Carlton). 2015; 20:736&ndash;743 doi: 10.1111/nep.12521 &nbsp; 66.Reddy M.A., Park J.T., Natarajan R. Epigenetic Modifications in the Pathogenesis of Diabetic Nephropathy. Semin Nephrol. 2013; 33(4): 341&ndash;353 doi: 10.1016/j.semnephrol.2013.05.006 &nbsp; 67.Zhong Y., Chen E.Y., Liu R. et al. Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase. J Am Soc Nephrol. 2013; 24(5): 801&ndash;811 doi: 10.1681/ASN.2012060590 &nbsp; 68.De Mello W.C. Local Renin Angiotensin Aldosterone Systems and Cardiovascular Diseases. Med Clin North Am. 2017;101(1):117-127 doi: 10.1016/j.mcna.2016.08.017 &nbsp; 69.Foster D.R., Yee S., Bleske B.E. et al. Lack of interaction between the peptidomimetic substrates captopril and cephradine. J Clin Pharmacol. 2009;49(3):360-367 doi: 10.1177/0091270008329554 &nbsp; 70.da Silva Novaes A., Ribeiro R.S., Pereira L.G., Borges F.T., Boim M.A. Intracrine action of angiotensin II in mesangial cells: subcellular distribution of angiotensin II receptor subtypes AT1 and AT2. Mol Cell Biochem. 2018;448(1-2):265-274 doi: 10.1007/s11010-018-3331-y &nbsp; 71.Welch A.K., Jeanette Lynch I., Gumz M.L. et al. Aldosterone alters the chromatin structure of the murine endothelin-1 gene. Life Sci. 2016;159:121-126 doi: 10.1016/j.lfs.2016.01.019 &nbsp; 72.Bavishi C., Bangalore S., Messerli F.H. Renin Angiotensin Aldosterone System Inhibitors in Hypertension: Is There Evidence for Benefit Independent of Blood Pressure Reduction? Prog Cardiovasc Dis. 2016;59(3):253-261 doi: 10.1016/j.pcad.2016.10.002 &nbsp; 73.Kawarazaki W., Fujita T.The Role of Aldosterone in Obesity-Related Hypertension. Am J Hypertens. 2016; 29(4): 415&ndash;423 doi: 10.1093/ajh/hpw003 &nbsp; 74.Azzam Z.S., Kinaneh S., Bahouth F. et al. Involvement of Cytokines in the Pathogenesis of Salt and Water Imbalance in Congestive Heart Failure. Front Immunol. 2017; 8: 716 doi: 10.3389/fimmu.2017.00716 &nbsp; 75.Currie G., Taylor A.H., Fujita T. et al. Effect of mineralocorticoid receptor antagonists on proteinuria and progression of chronic kidney disease: a systematic review and meta-analysis. BMC Nephrol. 2016; 17(1): 127 doi: 10.1186/s12882-016-0337-0 &nbsp; 76.Feraille E., Dizin E. Coordinated Control of ENaC and Na+,K+-ATPase in Renal Collecting Duct. J Am Soc Nephrol. 2016;27(9):2554-2563 doi: 10.1681/ASN.2016020124 &nbsp; 77.Nehme A., Zibara K. Efficiency and specificity of RAAS inhibitors in cardiovascular diseases: how to achieve better end-organ protection? Hypertension Research. 2017; (6):1&ndash;7 doi:10.1038/hr.2017.65 &nbsp; 78.Dolomatov S.I., Zukow W.A., Novikov N.Y. The regulation of osmotic and ionic balance in fish reproduction and in the early stages of ontogeny. Russian Journal of Marine Biology. 2012; 38(5): 365&ndash;374 doi:org/10.1134/S1063074012050057 &nbsp; 79.Duarte J.D., Zineh I., Burkley B. et al. Effects of genetic variation in H3K79 methylation regulatory genes on clinical blood pressure and blood pressure response to hydrochlorothiazide. J Transl Med. 2012; 10: 56 doi: 10.1186/1479-5876-10-56 &nbsp; 80.Kone B.C. Epigenetics and the Control of the Collecting Duct Epithelial Sodium Channel. Semin Nephrol. 2013; 33(4): 383&ndash;391 doi: 10.1016/j.semnephrol.2013.05.010 &nbsp; 81.Yu Z., Kong Q., Kone B.C. Aldosterone reprograms promoter methylation to regulate <em>&alpha;</em><em>ENaC</em> transcription in the collecting duct. Am J Physiol Renal Physiol. 2013; 305(7): F1006&ndash;F1013 doi: 10.1152/ajprenal.00407.2013 &nbsp; 82.Welch A.K., Jeanette Lynch I., Gumz M.L. et al. Aldosterone alters the chromatin structure of the murine endothelin-1 gene. Life Sci. 2016;159:121-126 doi: 10.1016/j.lfs.2016.01.019 &nbsp; 83.Ueda K., Fujiki K., Shirahige K. et al. Genome-wide analysis of murine renal distal convoluted tubular cells for the target genes of mineralocorticoid receptor. Biochem Biophys Res Commun. 2014; 445(1): 132&ndash;137 doi: 10.1016/j.bbrc.2014.01.125 &nbsp; 84.Liu R., Lee K., He J.C. Genetics and Epigenetics of Diabetic Nephropathy. Kidney Dis (Basel). 2015; 1(1): 42&ndash;51 doi: 10.1159/000381796 &nbsp; 85.Kato M., Dang V., Wang M. et al. TGF-&beta; Induces Acetylation of Chromatin and of Ets-1 to Alleviate Repression of miR-192 in Diabetic Nephropathy. Sci Signal. 2013; 6(278): ra43 doi: 10.1126/scisignal.2003389 &nbsp; 86.Hilliard S.A., El-Dahr S.S. Epigenetics of Renal Development and Disease. Yale J Biol Med. 2016; 89(4): 565&ndash;573 &nbsp; 87.Dressler G.R., Patel S.R. Epigenetics in Kidney Development and Renal Disease. Transl Res. 2015; 165(1): 166&ndash;176 doi: 10.1016/j.trsl.2014.04.007 &nbsp; 88.Sun G., Cui W., Guo Q., Miao L. Histone Lysine Methylation in Diabetic Nephropathy. J Diabetes Res. 2014; 2014: 654148 doi: 10.1155/2014/654148 &nbsp; 89.Wing M.R., Ramezani A., Gill H.S. et al. Epigenetics of Progression of Chronic Kidney Disease: Fact or Fantasy? Semin Nephrol. 2013; 33(4): 10.1016/j.semnephrol.2013.05.008 doi: 10.1016/j.semnephrol.2013.05.008 &nbsp; 90.Zager R.A., Johnson A.C.M., Becker K. Acute unilateral ischemic renal injury induces progressive renal inflammation, lipid accumulation, histone modification, and &ldquo;end-stage&rdquo; kidney disease. Am J Physiol Renal Physiol. 2011; 301(6): F1334&ndash;F1345 doi: 10.1152/ajprenal.00431.2011 &nbsp; 91.Bonventre J.V., Yang L. Cellular pathophysiology of ischemic acute kidney injury. J Clin Invest. 2011; 121(11): 4210&ndash;4221 doi: 10.1172/JCI45161 &nbsp; 92.Zager R.A., Johnson A.C.M. Progressive histone alterations and proinflammatory gene activation: consequences of heme protein/iron-mediated proximal tubule injury. Am J Physiol Renal Physiol. 2010; 298(3): F827&ndash;F837 doi: 10.1152/ajprenal.00683.2009 &nbsp; 93.Zeisberg M., Zeisberg E.M. Precision renal medicine: a roadmap towards targeted kidney fibrosis therapies. Fibrogenesis Tissue Repair. 2015; 8: 16 doi: 10.1186/s13069-015-0033-x &nbsp; 94.Doi S., Zou Y., Togao O. et al. Klotho Inhibits Transforming Growth Factor-&beta;1 (TGF-&beta;1) Signaling and Suppresses Renal Fibrosis and Cancer Metastasis in Mice. J Biol Chem. 2011; 286(10): 8655&ndash;8665 doi: 10.1074/jbc.M110.174037 &nbsp; 95.Guo W., Shan B., Klingsberg R.C. et al. Abrogation of TGF-&beta;1-induced fibroblast-myofibroblast differentiation by histone deacetylase inhibition. Am J Physiol Lung Cell Mol Physiol. 2009; 297(5): L864&ndash;L870 doi: 10.1152/ajplung.00128.2009 &nbsp; 96.Liu N., He S., Ma L. et al. Blocking the Class I Histone Deacetylase Ameliorates Renal Fibrosis and Inhibits Renal Fibroblast Activation via Modulating TGF-Beta and EGFR Signaling. PLoS One. 2013; 8(1): e54001 doi: 10.1371/journal.pone.0054001 &nbsp; 97.Yuan H., Reddy M.A., Sun G. et al. Involvement of p300/CBP and epigenetic histone acetylation in TGF-&beta;1-mediated gene transcription in mesangial cells. Am J Physiol Renal Physiol. 2013; 304(5): F601&ndash;F613 doi: 10.1152/ajprenal.00523.2012 &nbsp; 98.Van Beneden K., Mannaerts I., Pauwels M. et al. HDAC inhibitors in experimental liver and kidney fibrosis. Fibrogenesis Tissue Repair. 2013; 6: 1 doi: 10.1186/1755-1536-6-1 &nbsp; 99.Tang J., Zhuang S. Epigenetics in acute kidney injury. Curr Opin Nephrol Hypertens. 2015; 24(4): 351&ndash;358 doi: 10.1097/MNH.0000000000000140 &nbsp; 100.Sasaki K., Doi S., Nakashima A. et al. Inhibition of SET Domain&ndash;Containing Lysine Methyltransferase 7/9 Ameliorates Renal Fibrosis. J Am Soc Nephrol. 2016; 27(1): 203&ndash;215 doi: 10.1681/ASN.2014090850 &nbsp; 101.Yuan H., Reddy M.A., Deshpande S. et al. Epigenetic Histone Modifications Involved in Profibrotic Gene Regulation by 12/15-Lipoxygenase and Its Oxidized Lipid Products in Diabetic Nephropathy. Antioxid Redox Signal. 2016; 24(7): 361&ndash;375 doi: 10.1089/ars.2015.6372 &nbsp; 102.Hewitson T.D., Holt S.D., Tan S.J. et al. Epigenetic Modifications to H3K9 in Renal Tubulointerstitial Cells after Unilateral Ureteric Obstruction and TGF-&beta;1 Stimulation. Front Pharmacol. 2017; 8: 307 doi: 10.3389/fphar.2017.00307 &nbsp; 103.Ohtani K., Vlachojannis G.J., Koyanagi M. et al. Epigenetic Regulation of Endothelial Lineage Committed Genes in Pro-Angiogenic Hematopoietic and Endothelial Progenitor Cells. Novelty and Significance. Circulation Research. 2011;109:1219-1229 doi.org/10.1161/CIRCRESAHA.111.247304 &nbsp; 104.Kheirandish-Gozal L., Khalyfa A., Gozal D. et al. Endothelial Dysfunction in Children With Obstructive Sleep Apnea Is Associated With Epigenetic Changes in the <em>eNOS</em> Gene. Chest. 2013; 143(4): 971&ndash;977 doi: 10.1378/chest.12-2026 &nbsp; 105.Harvey N.C., Lillycrop K.A., Garratt E. et al. Evaluation of methylation status of the eNOS promoter at birth in relation to childhood bone mineral content. Calcif Tissue Int. 2012; 90(2): 120&ndash;127 doi: 10.1007/s00223-011-9554-5 &nbsp; 106.Schmidt Dellamea B., Bauermann Leit&atilde;o C., Friedman R., Canani L.H. Nitric oxide system and diabetic nephropathy. Diabetol Metab Syndr. 2014; 6: 17. doi: 10.1186/1758-5996-6-17 &nbsp; 107.Advani A., Huang Q., Thai K. et al. Long-Term Administration of the Histone Deacetylase Inhibitor Vorinostat Attenuates Renal Injury in Experimental Diabetes through an Endothelial Nitric Oxide Synthase-Dependent Mechanism. Am J Pathol. 2011; 178(5): 2205&ndash;2214 doi: 10.1016/j.ajpath.2011.01.044 &nbsp; 108.Khan S., Jena G. Sodium butyrate, a HDAC inhibitor ameliorates eNOS, iNOS and TGF-&beta;1-induced fibrogenesis, apoptosis and DNA damage in the kidney of juvenile diabetic rats. Food Chem Toxicol. 2014;73:127-139 doi: 10.1016/j.fct.2014.08.010 &nbsp; 109.Fish J.E., Yan M.S., Matouk C.C. et al. Hypoxic Repression of Endothelial Nitric-oxide Synthase Transcription Is Coupled with Eviction of Promoter Histones. J Biol Chem. 2010; 285(2): 810&ndash;826 doi: 10.1074/jbc.M109.067868 &nbsp; 110.Bonventre J.V., Yang L. Cellular pathophysiology of ischemic acute kidney injury. J Clin Invest. 2011; 121(11): 4210&ndash;4221 doi: 10.1172/JCI45161 &nbsp; 111.Sattarinezhad E., Panjehshahin M.R., Torabinezhad S. et al. Protective Effect of Edaravone Against Cyclosporine-Induced Chronic Nephropathy Through Antioxidant and Nitric Oxide Modulating Pathways in Rats. Iran J Med Sci. 2017; 42(2): 170&ndash;178 &nbsp; 112.Tain Y.-L., Joles J.A. Reprogramming: A Preventive Strategy in Hypertension Focusing on the Kidney. Int J Mol Sci. 2016; 17(1): 23 doi: 10.3390/ijms17010023 &nbsp; 113.Vasudevan D., Bovee R.C., Thomas D.D. Nitric oxide, the new architect of epigenetic landscapes. Nitric Oxide. 2016;59:54-62 doi: 10.1016/j.niox.2016.08.002 &nbsp; 114.Socco S., Bovee R.C., Palczewski M.B. et al. Epigenetics: The third pillar of nitric oxide signaling. Pharmacol Res. 2017;121:52-58 doi: 10.1016/j.phrs.2017.04.011 &nbsp; 115.Cerkezkayabekir A., Sanal F., Bakar E. et al. Naringin protects viscera from ischemia/reperfusion injury by regulating the nitric oxide level in a rat model. Biotech Histochem. 2017;92(4):252-263 doi: 10.1080/10520295.2017.1305499 &nbsp; 116.Chappell M.C. The Non-Classical Renin-Angiotensin System and Renal Function. Compr Physiol. 2012; 2(4): 2733&ndash;2752 doi: 10.1002/cphy.c120002 &nbsp; 117.Thoonen R., Sips P.Y., Bloch K.D. et al. Pathophysiology of Hypertension in the Absence of Nitric Oxide/Cyclic GMP Signaling. Curr Hypertens Rep. 2013; 15(1): 47&ndash;58 doi: 10.1007/s11906-012-0320-5 &nbsp; 118.Murgatroyd C. Epigenetic programming of neuroendocrine systems during early life. Exp Physiol. 2014;99(1):62-65 doi: 10.1113/expphysiol.2013.076141 &nbsp; 119.Lesse A., Rether K., Gr&ouml;ger N. et al. Chronic Postnatal Stress Induces Depressive-like Behavior in Male Mice and Programs second-Hit Stress-Induced Gene Expression Patterns of OxtR and AvpR1a in Adulthood. Mol Neurobiol. 2017;54(6):4813-4819 doi: 10.1007/s12035-016-0043-8 &nbsp; 120.Park E.-J., Kwon T.-H. A Minireview on Vasopressin-regulated Aquaporin-2 in Kidney Collecting Duct Cells. Electrolyte Blood Press. 2015; 13(1): 1&ndash;6 doi: 10.5049/EBP.2015.13.1.1 &nbsp; 121.MacManes M.D. Severe acute dehydration in a desert rodent elicits a transcriptional response that effectively prevents kidney injury. Am J Physiol Renal Physiol. 2017;313(2):F262-F272 doi: 10.1152/ajprenal.00067.2017 &nbsp; 122.Sergeeva I.A., Hooijkaas I.B., Van Der Made I. et al. A transgenic mouse model for the simultaneous monitoring of ANF and BNP gene activity during heart development and disease. Cardiovasc Res. 2014;101(1):78-86 doi: 10.1093/cvr/cvt228 &nbsp; 123.Sergeeva I.A., Hooijkaas I.B., Ruijter J.M. et al. Identification of a regulatory domain controlling the Nppa-Nppb gene cluster during heart development and stress. Development. 2016;143(12):2135-2146 doi: 10.1242/dev.132019 &nbsp; 124.Kumar S., Pamulapati H., Tikoo K. Fatty acid induced metabolic memory involves alterations in renal histone H3K36me2 and H3K27me3. Mol Cell Endocrinol. 2016;422:233-242 doi: 10.1016/j.mce.2015.12.019 &nbsp; 125.Perez-Perri J.I., Acevedo J.M., Wappner P. Epigenetics: New Questions on the Response to Hypoxia. Int J Mol Sci. 2011; 12(7): 4705&ndash;4721 doi: 10.3390/ijms12074705 &nbsp; 126.Liu J., Wei Q., Guo C. et al. Hypoxia, HIF, and Associated Signaling Networks in Chronic Kidney Disease. Int J Mol Sci. 2017; 18(5): 950 doi: 10.3390/ijms18050950 &nbsp; 127.Shiels P.G., McGuinness D., Eriksson M. et al. The role of epigenetics in renal ageing. Nat Rev Nephrol. 2017;13(8):471-482 doi: 10.1038/nrneph.2017.78 &nbsp; 128.Liu X., Zheng N., Shi Y.N. et al. Thyroid hormone induced angiogenesis through the integrin &alpha;v&beta;3/protein kinase D/histone deacetylase 5 signaling pathway. J Mol Endocrinol. 2014;52(3):245-254 doi: 10.1530/JME-13-0252 &nbsp; 129.Re A., Nanni S., Aiello A. et al. Anacardic acid and thyroid hormone enhance cardiomyocytes production from undifferentiated mouse ES cells along functionally distinct pathways. Endocrine. 2016;53(3):681-688 doi: 10.1007/s12020-015-0751-2 &nbsp; <strong>ГЛАВА 4. БЕЛКИ РЕНИН-АНГИОТЕНЗИНОВОЙ СИСТЕМЫ ПРИ ОНКОЛОГИЧЕСКИХ ЗАБОЛЕВАНИЯХ </strong> &nbsp; По нашему мнению, обсуждение роли патофизиологических механизмов контроля экспрессии генов белков, принимающих участие в регуляции деятельности почек, предполагает использование в виде иллюстрации какой-либо определенной модели патологии. В качестве такой модели нами были выбраны процессы малигнизации и метастазирования опухолей. С одной стороны, одним из важных маркеров малигнизации клеток, есть изменения в процессах биосинтеза белков, в норме не характерных для данной популяции клеток. С другой стороны, онкологические заболевания, выбранные в качестве примера, на первый взгляд, не имеют прямого отношения к системам контроля водно-солевого гомеостаза. Тем не менее, они, во-первых, демонстрируют некоторые специфические, нельзя сказать, что второстепенные, свойства протеинов, объединяемых общим термином &laquo;компоненты РАС&raquo;. Во-вторых, описываемые закономерности изменения экспрессии белков &mdash; &laquo;компонентов РАС&raquo; при онкологических заболеваниях дают повод оценить широкий спектр функций данной группы протеинов. По данным литературы, компоненты ренин-ангиотензиновой системы (РАС) могут принимать участие в процессах малигнизации тканей, стимулировать рост и метастазирование опухолей (Regulska K. et al., 2013; Gomez R.A., Sequeira-Lopez M.L.S., 2016; Pinter M., Jain R.K., 2017; Pinter M. et al., 2017). Более ранние исследования продемонстрировали диагностическую ценность анализа экспрессии компонентов РАС в онкологии (Rоmer F. K., 1981). Результаты современных исследований подтверждают тезис о диагностической ценности анализа экспрессии компонентов РАС, подчеркивая также их значение в составлении прогноза течения заболевания и выборе способа лечения злокачественных опухолей (Regulska K. et al., 2013; Tawinwung S. et al., 2015; Gomez R.A., Sequeira-Lopez M.L.S., 2016). Наряду с этим, следует указать, что пептиды-компоненты РАС рассматривают в качестве ключевых патогенетических механизмов роста и метастазирования злокачественных опухолей, включая стимуляцию локальной продукции ангиотензина-II (А<strong>-</strong>II), повышение экспрессии рецепторов к А-II, изменение баланса экспрессии ангиотензин-I-превращающих ферментов (АСЕ-1 и АСЕ-2) и уровень образования продуктов их реакции (А-II и А-1-7 соответственно) (Regulska K. et al., 2013; Sobczuk P. et al., 2017; Sun H. et al., 2017). Объектом внимания некоторых исследований является изучение степени риска индукции канцерогенеза ингибиторами РАС (Connolly S. et al., 2011; Azoulay L. et al., 2012; Yang Y. et al., 2015; Sobczuk P. et al., 2017). Вместе с тем, патогенетические механизмы, индуцирующие увеличение экспрессии белков-компонентов РАС в малигнизированных клетках, их роль в процессах роста и метастазирования остаются мало изученными. <strong>4.1. ДИАГНОСТИЧЕСКАЯ ЦЕННОСТЬ АНАЛИЗА ЭКСПРЕССИИ БЕЛКОВ-КОМПОНЕНТОВ РАС В ОНКОЛОГИИ</strong> &nbsp; <strong>4.1.1. Рецепторы к А-</strong><strong>II</strong> &nbsp; А-II оказывает свое влияние через АТ1 и АТ2 популяции рецепторов. Установлено, что в клетках астроцитомы человека частота выявления АТ1 рецепторов у пациентов с высокой степенью злокачественности опухоли (степень III и IV) возрастает до 67% против 10% в группе с низким уровнем злокачественности, что положительно коррелирует с интенсивностью пролиферации клеток и плотностью неоангиогенеза (Arrieta O. et al., 2008). В исследованиях на лабораторных животных, привитых культурой клеток колоректального рака (CRC), было установлено, что А-II через АТ1 и АТ2 рецепторы стимулирует миграцию малигнизированных клеток и их метастазирование в печень (Nguyen L. et al., 2016). Сообщается, что при некоторых онкологических заболеваниях легких раковые клетки, демонстрирующие высокие уровни экспрессии АТ1-рецепторов, обладают резистентностью к воздействию цитостатиков (Cheng Q. et al., 2016). Анализ клинических наблюдений позволяет сделать вывод о том, что повышение экспрессии АТ1 рецепторов малигнизированными клетками свидетельствует о неблагоприятном прогнозе течения заболевания, обусловленном стимуляцией неоангиогенеза, роста и метастазирования опухоли (Keizman D. et al., 2011; Sun H. et al., 2017). Подчеркивается, что активация плейотропных АТ1-зависимых проонкогенных эффектов А-II может затрагивать в том числе лимфоциты и связанные с опухолью макрофаги, что приводит к снижению противоракового иммунитета, изменению продукции интерлейкинов и провоспалительных цитокинов (Coulson R. et al., 2017; Pinter M., Jain R.K., 2017). Значительный прирост АТ1 белка в трансформированных клетках происходит за счет активации гена <em>AGTR</em><em>1</em> (Coulson R. et al., 2017). Возможно, стимуляция неоангиогенеза, реализуемая через АТ1 рецепторы, является одним из универсальных патогенетических механизмов прогрессирования опухолей различного генеза (Osumi H. et al., 2015; Pinter M., Jain R.K., 2017). Приводятся данные о синэргических эффектах систем рецепторов АТ1/А-II и АТ2/А-II в стимуляции неоангиогенеза (Ager E.I. et al., 2011), а также усилении миграции клеток, воспаления формирование внеклеточного матрикса через AT1 и AT2 рецепторы к А-II (Aydiner A. et al., 2015). Показано, что изменения экспрессии АТ1 и АТ2 рецепторов допустимо рассматривать в качестве маркеров малигнизации слизистой желудка, индуцированной патогенными микроорганизмами, например <em>Helicobacter</em><em> </em><em>pylori</em> (Sugimoto M. et al., 2012), а также при прогрессировании плоскоклеточного рака языка (Itinteang T. et al., 2016), прогрессировании колоректального рака и оценке степени риска его метастазирования (Kuniyasu H., 2012; Shimizu Y. et al., 2017), диагностике онкологических заболеваний легких (Gallagher P.E. et al., 2011) и молочной железы (Vinson G.P. et al., 2012). Уровень экспрессии рецепторов А-II рассматривается в качестве прогностического критерия течения плоскоклеточного рака пищевода (Li S.-H. et al., 2016) и светлоклеточного рака почки (Dolley-Hitze T. et al., 2010). Возможно, динамика изменения экспрессии <em>АТ1 и АТ2 </em>может рассматриваться в качестве интегрального индикатора чувствительности малигнизированной ткани к воздействию гуморальных индукторов канцерогенеза (Rhodes D.R. et al., 2009; Vinson G.P. et al., 2012; Sugimoto M. et al., 2012; Regulska K. et al., 2013; Pinter M., Jain R.K., 2017). В ряде обзорных публикаций достаточно подробно изложена оценка результатов исследования особенностей экспрессии АТ1 и АТ2 рецепторов А-II при различных онкологических заболеваниях, их диагностическая и прогностическая ценность. Представлены аргументы с точки зрения их роли в патогенезе заболеваний, прогрессировании и диссеминации опухолей, а также перспективность клинического применения селективных антагонистов рецепторов А-II в целях повышения эффективности химиотерапии, иммунотерапии и ингибиторов неоангиогенеза в онкологии (Vinson G.P. et al., 2012; Regulska K. et al., 2013; Wegman-Ostrosky T. et al., 2015; Sobczuk P. et al., 2017; Pinter M., Jain R.K., 2017). &nbsp; <strong>4.1.2. Ангиотензин-</strong><strong>I</strong><strong>-превращающий фермент (АСЕ-1).</strong><strong> </strong> &nbsp; Ангиотензин-I-превращающий фермент (<strong>АСЕ-1</strong>), карбоксипедиптидаза, один из ключевых факторов, осуществляющих превращение ангиотензина-I (А-1) в физиологически активный ангиотензин-II (А-II). Вместе с тем, при патологии, включая онкологические заболевания, роль АСЕ-1 в образовании А-II может изменяться за счет усиления вклада АСЕ-независимого пути конверсии А-1 в А-II в присутствии альфа-химазы и других пептидаз, формируя резистентность опухолевых клеток к современным методам противораковой терапии (Xie G. et al., 2017; Sobczuk P. et al., 2017). Широко известен и тот факт, что АСЕ-1, обладая относительно низкой субстратной специфичностью, может участвовать не только в образовании А-II, но и в метаболизме кининов, а также других физиологически активных молекул, потенциально актуальных для процессов канцерогенеза, роста и диссеминации опухолей (Regulska K. et al., 2013; Sobczuk P. et al., 2017). Привлекают внимание сведения о том, что АСЕ-1, помимо пептидазной активности, может непосредственно участвовать во внутриклеточной передаче сигнала А-II, фактически являясь рецептором октапептида (de Alvarenga E.C. et al., 2016). По мнению авторов цитируемой публикации, механизм АСЕ-зависимой рецепции А-II может выполнять важную роль в управлении миграции и пролиферации раковых клеток. Следовательно, динамика изменения топологии и уровней экспрессии АСЕ при онкологических заболеваниях может служить маркером локализации проонкогенных эффектов А-II и других гуморальных факторов, метаболизм которых связан с функциями компонентов РАС. Например, при онкологических заболеваниях почек наблюдается закономерное изменение активности и топологии экспрессии белков АСЕ (Errarte P. et al., 2017; Sobczuk P. et al., 2017). В норме эпителий корковых сегментов канальцевого отдела нефрона, в частности, эпителий проксимального отдела, демонстрирует высокие показатели экспрессии АСЕ, который отсутствует в клетках светлоклеточного рака почки (CCRCC) и выявляется только в кровеносных сосудах опухоли (Errarte P. et al., 2017). Авторами показано, что уровень экспрессии белка в опухоли и величина его энзиматической активности в плазме крови могут служить маркером CCRCC агрессивности опухоли и является индикатором выживаемости пациентов с CCRCC. С другой стороны, перспектива применения широко известных ингибиторов АСЕ в целях подавления неоангиогенеза в злокачественных новообразованиях рассматривается в качестве одного из основных аргументов к применению препаратов данной группы в онкологии (Shen J. et al., 2016). Показано, что способствующее ускользанию от противоракового иммунитета микроокужение опухолевых клеток мышей, может формироваться макрофагами и связанными с опухолью фибробластами (Nakamura K. et al., 2018). По мнению авторов, резко повышенный в макрофагах уровень экспрессии АСЕ указывает на повышение интенсивности локальной продукции физиологически активных веществ, вызывающих иммуносупрессию: оксид азота, трансфомирующий фактор роста-бета1 и PGE2. В норме экспрессия АСЕ критически важна для формирования специфического микроокружения в процессах цитодифференцировки на стадии эмбрионального развития органа или в некоторых интенсивно пролиферирующих тканях взрослого человека. Однако, чрезмерно высокий уровень экспрессии не только ассоциируется с нарушениями гемопоэза, но и рассматривается, как эффект ACE в онкогематологии (Haznedaroglu I.C., Malkan U.Y., 2016). Существенное повышение экспрессии АСЕ рака гортани свидетельствует о неблагоприятном течении заболевания и высоком риске метастазирования опухоли (Han C., Ge W., 2016). Следовательно, изменение экспрессии АСЕ-1 наряду с изучением полиморфизма гена АСЕ широко используется в современной онкологии в качестве маркера тяжести течения заболевания и его прогноза (Regulska K. et al., 2013). Вместе с тем, уровень экспрессии АСЕ-1 клетками злокачественных опухолей не всегда коррелирует с интенсивностью локального продукции А-II, по причине усиления активности, например, химазы, регулирующей АСЕ-независимый путь образования А-II (Xie G. et al., 2017). Помимо этого, необходимо учитывать, что АСЕ непосредственно принимает участие в регуляции иммунных реакций организма (Haznedaroglu I.C., Malkan U.Y., 2016). &nbsp; <strong>4.1.3. Ангиотензин-</strong><strong>I</strong><strong>-превращающий фермент-2 (АСЕ-2) и ось ACE2/Ang-(1&ndash;7)/M</strong><strong>AS</strong><strong>1.</strong><strong> </strong> &nbsp; АСЕ-2, гомолог АСЕ-1, отвечает за метаболический клиренс А-II, используемого ферментом в качестве субстрата для синтеза ангиотензина-1-7 (А-1-7). В свою очередь, А-1-7, осуществляя регуляторное влияние через МAS1-рецепторы, оказывает оппозиционное действие вазотоническим, провоспалительным и просклерозирующим эффектам А-II (Clarke N.E., Turner A.J., 2012). Снижение уровня экспрессии АСЕ-2 клетками рака молочной железы рассматривается в качестве маркера тяжелой формы течения заболевания с высоким риском метастазирования (Yu С. et al., 2016). По мнению авторов, уровень экспрессии АСЕ-2 отражает степень влияния ACE2/Ang-(1&ndash;7)/MAS1 оси на ограничение трансформации кальций-зависимых путей внутриклеточной передачи сигнала, характерной для процесса малигнизации клеток. Показано, что уровень экспрессии АСЕ-2 отрицательно коррелирует с интенсивностью неоангиогенеза в некоторых опухолях легких и чувствительностью раковых клеток к цитостатикам. Активность оси ACE2/Ang-(1-7)/MAS1 может угнетать секрецию VEGFа и подавлять активности матричных металлопротеиназ MMP-2 и MMP-9, тем самым способствуя ограничению неоангиогенеза, повышению чувствительности опухоли к цитостатикам и снижению риска метестазирования (Feng Y. et al., 2011; Cheng Q. et al., 2016). В ряде публикаций указывается, что гипоксия является признаком солидных опухолей, подчеркивая, что условия гипоксии способствуют усилению проонкогенного влияния АСЕ-1/А-II на фоне снижения эффектов оси ACE-2/Ang-(1-7)/MAS1 (Fan L. et al., 2014). Авторами цитируемой публикации показано, что in vitro в культуре клеток карциномы легких Льюиса гипоксия способствует снижению экспрессии АСЕ-2 на фоне АСЕ-1/А-II-зависимой индукции VEGFа. Приводятся аргументы в пользу перспективности клинического использования А-1-7, как фактора противораковой терапии опухоли груди, клетки которой не экспрессируют рецепторы эстрогенов, рецепторы прогестерона и рецептора-2 эпидермального фактора роста (Luo Y. et al., 2015). Некоторые обзоры также содержат позитивную оценку перспектив ACE-2/Ang-(1-7)/MAS1 оси в противораковой фармакологии (Regulska K. et al., 2013). Наряду с этим, подчеркивается, что характер влияния ACE-2/Ang-(1-7)/MAS1 оси на раковые клетки и прогрессирование опухоли может зависеть от локализации опухоли (Wegman-Ostrosky T. et al., 2015; Haznedaroglu I.C., Malkan U.Y., 2016; Sobczuk P. et al., 2017). В частности, приводятся данные о том, что А-1-7 стимулирует метастазирование почечно-клеточного рака (RCC), индуцирует активацию генов провоспалительных факторов, в целом способствуя прогрессированию заболевания (Sobczuk P. et al., 2017). Принимая к сведению изложенные факты, авторы склоняются к мнению о том, что А-1-7 в отношении RCC обладает, скорее, пронкогенным действием. &nbsp; <strong>4.1.4. Ангиотензиноген.</strong> &nbsp; Ангиотензиноген (<strong>Agt</strong>) является универсальным предшественником А-II и А-1-7. В норме Agt, главным образом, синтезируется в печени. При онкологических заболеваниях, как правило, печень сохраняет роль основного источника Agt (Vinson G.P. et al., 2012). Однако, представляют интерес данные о диагностической ценности локальной продукции Agt, как маркера канцерогенеза. Также привлекают внимание особенности метаболизма Agt раковыми клетками. С одной стороны, локальная продукция Agt рассматривается в качестве одного из наиболее информативных маркеров активности опухолевого неоангиогенеза (Choi J.-H. et al., 2014). С другой стороны, согласно данным цитируемой публикации, доминирующим продуктом конверсии Agt в опухолевых тканях является А-II. При этом, комбинированное влияние HIF-1-альфа и А-II, на фоне более высокой продукции Agt, рассматривается в качестве базового патогенетического механизма стимуляции ростовых факторов (в частности, VEGFа), активирующих опухолевый неоангиогенез. Действительно, результаты клинических исследований показали, что, во-первых, повышенная экспрессия гена Agt у пациентов с глиобластомой, может расцениваться, как маркер резистентности опухоли к противораковой терапии, направленной на угнетение опухолевого неоангиогенеза (Urup T. et al., 2016). Во-вторых, более высокая экспрессия гена Agt опухолевой тканью сопровождается усилением локальной продукции А-II. Тем не менее, в литературе приводятся данные о том, что также Agt обладает способностью угнетать неоангиогенез (Wegman-Ostrosky T. et al., 2015). Обсуждая локальную продукцию Agt, необходимо уточнить, что, по мнению некоторых авторов, стимуляция локальной экспрессии компонентов РАС, включая Agt, рассматривается в качестве центрального индуктора внутриклеточного каскада регуляторных белков, определяющих процессы малигнизации клеток и метастазирования (Sugimoto M. et al., 2012). Более того, опубликованные результаты не исключают возможности активации и перестройки внутриклеточного метаболизма компонентов РАС в раковых клетках (Blanco L.. et al., 2014). Что не противоречит мнению об универсальной патогенетической роли активации внутриклеточной РАС, причастной также и к процессам модуляции экспрессии генов (Ellis B. et al., 2012; De Mello W.C., 2015). Вместе с тем, указывается на тканеспецифические особенности экспрессии Agt, как маркера риска онкологических заболеваний. Например, риск возникновения рака легких ассоциируется со снижением продукции Agt белка (Wang H. et., 2015). По мнению авторов, эпигенетические механизмы снижения экспрессии гена <em>Agt</em> и точечные мутации гена <em>Agt</em> могут рассматриваться в качестве факторов, усиливающих риск онкологических заболеваний легких. Возможно, динамика локальной продукции Agt протеина и его уровни в плазме крови могут по-разному формировать прогноз течения метастазов колоректального рака (Martin P. et al., 2014). Авторами установлено, что повышение уровня Agt протеина в сыворотке крови достоверно ассоциировалось с худшей общей выживаемостью, а эпителиальная экспрессия Agt достоверно ассоциировалась с улучшенной выживаемостью без прогрессирования заболевания. Еще один аспект диагностической ценности локальной продукции Agt протеина опухолевыми тканями может быть обусловлен закономерным изменением экспрессии гена <em>Agt</em> по мере течения заболевания (Vinson G.P. et al., 2012). &nbsp; <strong>4.1.5. (Про)Ренин.</strong> &nbsp; В последнее время молекула (про)ренина и ее рецепторы привлекает все большее внимание не только, в качестве регуляторного фермента РАС, но и как важный элемент механизмов контроля онтогенеза, заживления ран и патогенеза ряда заболеваний (Gomez R.A., Sequeira-Lopez M.L.S., 2016). В некоторых обзорах, посвященных анализу патогенетической роли РАС в онкологических заболеваниях, встречаются сведения о важном влиянии ренина на процессы малигнизации клеток и прогрессирования опухоли (Vinson G.P. et al., 2012; Sugimoto M. et al., 2012). В исследованиях in vitro установлено, что ренин может оказывать стимулирующее влияние на рост культуры клеток почечно-клеточного рака (Hu J. et al., 2015). Экспрессия ренина может рассматриваться, как маркер нормального созревания предшественников клеток крови или их малигнизации (Haznedaroglu I.C., Malkan U.Y., 2016). Авторы цитируемого обзора подчеркивают, что экспрессия ренина была обнаружена в клетках острого миелоидного лейкоза, в клетках хронического миелоидного лейкоза и острого лимфолейкоза. Высказывается мнение о том, что стволовые клетки костного мозга, которые экспрессируют ренин являться источником лимфобластного лейкоза (Belyea B.C. et al., 2014). По данным литературы, экспрессия гена ренина в процессе нормального и малигнизированного емопоэза может регулироваться эпигенетическими механизмами (Belyea B.C. t al., 2014; Haznedaroglu I.C., Malkan U.Y., 2016). В контексте обсуждаемой емы уместно напомнить, что сложно функционирующая, относительно мало зученная, система рецепторов к (про)ренину имеет отношение не только к АС, но и к регуляции экспрессии генов белков-индукторов процессов оспаления и фиброза тканей (Nguyen G., 2011). Дальнейшие исследования одтвердили РАС-независимые эффекты системы рецепторов к (про)ренину, родемонстрировав их роль в регуляции фундаментальных механизмов онтроля гомеостаза клетки (M&uuml;ller D.N. et al., 2012). Также было установлено, то уровни в плазме крови рецепторов к (про)ренину ((P)RR) в группе нкологических пациентов были резко повышены (Shibayama Y. et al., 2015). На сновании анализа динамики экспрессии (P)RR в клетках на различной стадии алигнизации авторами цитируемой публикации делается вывод о том, что P)RR могут быть тесно вовлечены в процессы онкогенез в поджелудочной елезе. Результаты изучения in vitro экспрессии PRR в культивируемых клетках лиомы человека позволяютс сделать вывод о том, что этот рецептор может ыть как прогностическим маркером, так и мишенью в лечении заболевания Kouchi M. et al., 2017). Приводятся данные о том, что изменение экспрессии P)RR в процессе гемопоэза может рассматриваться в качестве перспективного аркера диагностики в онкогематологии (Haznedaroglu I.C., Malkan U.Y., 2016). <strong>4.2. ЭПИГЕНЕТИЧЕСКИЕ МЕХАНИЗМЫ, КАК ВОЗМОЖНЫЕ РЕГУЛЯТОРЫ ЭКСПРЕССИИ ПРОТЕИНОВ-КОМПОНЕНТОВ РАС ПРИ ОНКОЛОГИЧЕСКИХ ЗАБОЛЕВАНИЯХ </strong> &nbsp; Представленная выше краткая информация о динамике экспрессии протеинов-компонентов РАС в опухолевых тканях свидетельствует о том, что, во-первых, этот показатель может существенно повышаться в тканях, для которых в норме не характерны высокие уровни экспрессии данной группы протеинов (Sugimoto M. et al., 2012; Shibayama Y. et al., 2015; Han C., Ge W., 2016; Itinteang T. et al., 2016; Yue Z. et al., 2016). И напротив, при некоторых онкологических заболеваниях клетки постепенно утрачивают присущую им в норме способность экспрессировать белки РАС (Errarte P. et al., 2017; Sobczuk P. et al., 2017). Во-вторых, отмечается закономерное изменение экспрессии и топологии белков РАС в опухолевых тканях в зависимости от стадии течения и степени тяжести заболевания (Vinson G.P. et al., 2012; Haznedaroglu I.C., Malkan U.Y., 2016; Kouchi M. et al., 2017). В ряде публикаций приводятся доказательства ведущей роли эпигенетических механизмов в изменении синтеза белков, способных стимулировать процессы малигнизации, воспаления, фиброза и метастазирования (TsaiY.-P., Wu K.-J., 2012; Tan W. et al., 2014; Harb-De la Rosa A.et al., 2015; Cheng Y. et al., 2016; Haznedaroglu I.C., Malkan U.Y., 2016; Semenza G.L., 2016). При этом, уделяется внимание эпигенетической перестройке экспрессии генов протеинов-компонентов РАС в процессах малигнизации и роста раковых клеток (TsaiY.-P., Wu K.-J., 2012; Han C.-D., Ge W.-S., 2016; Haznedaroglu I.C., Malkan U.Y., 2016; ie G. et al., 2017). Эпигенетическая перестройка экспрессии компонентов РАС тносительно новое и мало изученное направление в онкологии. В норме, л ние пигенетических механизмов на динамику экспрессии генов белков АС про еживается на ранних стадиях гисто- и органогенеза, а также в нтенсивно про ферирующих тканях (Belyea B.C. et al., 2014; Haznedaroglu .C., Malkan U.Y , 016). Сообщается, что одним из универсальных индукторов кспрессии ген в елков-компонентов РАС, по мере прогрессирования локачественных нов бразований, может являться <em>HIF</em><em>-1альфа </em>(TsaiY.-P., Wu .-J., 2012; Choi J.-H. et l., 2014; Xie G. et al., 2017). Установлено, что ряд акторов, соп тствующих ечению сахарного диабета, также может оказывть лияние на экс рессию генов елков РАС, усиливая риск онкологических аболеваний (Ya g X. et al., 2012; eddy M.A. et al., 2012; Reddy M.A., Natarajan., 2015; Weg an-Ostrosky T. et al., 015).<em> Возможно, </em><em>HIF</em><em>-1альфа епосредственно при имает участие в егуляции экспрессии нгиотензиногена (</em>Agt) (Choi J.- . et al., 2014). В свою чередь, локальная родукция Agt критически важна для усиления образования -II, тимулирующего опухолевый неоангиогенез и мет стазирование через Т1-рецепторы. Сообщается, что антагонист АТ1-рецепторов олмесартан ожет ерез активацию синтеза микроРНК-205 инг бировать экспрессию VEGF-а аковыми клетками (Yue Z. et al., 2016). В дан ом случае А-II рассматривается ачестве регулятора процессов тра скрипции. Действительно, спериментальные исследования показывают, что А-II может усиливать дукцию провоспалительных цитокинов (IFN&gamma;, TNF ) и матричных ме аллопротеиназ (MMP2, MMP9), стимулируя адгезию раковых клеток к эндотелиальным клеткам, а также активируя их трансэндотелиальную миграцию и миграцию опухолевых клеток через белки внеклеточного матрикса (Rodrigues-Ferreira S., et al. 2012). Наряду с этим, высказывается мнение об универсальности эпигенетической перестройки экспрессии компонентов РАС в патогенезе, в том числе, и онкологических заболеваний (Kemp J.R. et al., 2014; Reddy M.A., NatarajanR., 2015). С другой стороны, приводятся сведения об эпигенетических эффектах А-1-7, направленных на ограничение подвижности раковых клеток и их способности к метастазированию (de Oliveira da Silva B. et al., 2016). С этой точки зрения особое значение приобретают данные о способности АСЕ-1 участвовать в механизмах внутриклеточной передачи сигнала А-II (de Alvarenga E.C. et al., 2016). Не менее актуальной является информация о важности системы (про)ренин &mdash; рецепторы к (про)ренину в управлении экспрессии генов, независимо от состояния активности РАС (Nguyen G., 2011; M&uuml;ller D.N. et al., 2012). Результаты дальнейших исследований подтверждают тезис о том, что система (про)ренин &mdash; рецепторы к (про)ренину могут выполнять важную функцию в патогенезе и течении онкологических заболеваний (Shibayama Y. et al., 2015; Wang C. et al., 2016; Kaneko K. et al., 2017). <strong>4.3. ОНКОЛОГИЧЕСКИЕ АСПЕКТЫ ЭКСПРЕССИИ КОМПОНЕНТОВ РАС И ЛОКАЛЬНАЯ РЕНИН-АНГИОТЕНЗИНОВАЯ СИСТЕМА</strong> &nbsp; Само понятие &laquo;локальная РАС&raquo; формировалось, как представление об элементе внутриорганного гуморального комплекса контроля гомеостатических функций данного органа. На примере локальной РАС почек эту мысль можно проиллюстрировать следующим примером. В норме, адекватным стимулом активации внутриренальной РАС есть два различных механизма, обусловленных внутриорганными изменениями кровяного давления и интенсивности транспорта хлорида натрия в области macula densa. В результате активации системы происходит усиление секреции клетками юкста-гломерулярного аппарата регуляторного фермента РАС &mdash; ренина и повышение продукции А-II. Основные ренотропные физиологические эффекты А-II реализуются, в основном, в отношении параметров внутрипочечной гемодинамики, процессов фильтрации и канальцевого транспорта веществ (г.о. натрия) на уровне проксимального отдела нефрона. В том числе через инициацию эффектов, контролирующих транскрипцию транспортных и регуляторных белков в проксимальных нефроцитах (Li X.C. et al., 2012; Satou R., Gonzalez-Villalobos R.A., 2012). В физиологических условиях, индукция секреции ренина (Sparks M.A. et al., 2014) и А-II-зависимая стимуляция транскрипции транспортных белков канальцевого эпителия (Shao W. et al., 2013) адекватны текущему состоянию водно-солевого баланса организма. Например, вызванная гипонатриевой диетой физиологическая стимуляция РАС не сопряжена с повышением ренальных потерь Agt или с развитием повреждений ренальной паренхимы (Shao W. et al., 2013). Следовательно, конечным результатом деятельности сложного комплекса гуморальных регуляторов внутрипочечной системы контроля гомеостаза является поддержание стабильных параметров кровяного давления, ионного гомеостаза, кислотно-основного равновесия, постоянства объема внеклеточной жидкости организма (Satou R., Gonzalez-Villalobos R.A., 2012; Zhuo J.L. et al., 2013; Sparks M.A. et al., 2014; Ferr&atilde;o F.M. et al., 2014). При этом, топология основной массы ренин-секретирующих клеток почки в области ЮГА, скорее всего, имеет принципиально важное значение. Поскольку данная популяция клеток непосредственно получает информацию о параметрах гемодинамики и о состоянии транспорта ионов хлора и натрия в дистальных извитых сегментах нефрона. Напротив, появление эктопических очагов секреции, например, ренина за пределами ЮГА (в канальцевом эпителии, клетках мезангиума) лишает клетки-продуценты адекватной стимуляции. По нашему мнению, такие события, в совокупности с локализацией продукции всех белков-компонентов РАС в одной клетке может создавать предпосылки для неограниченной активации сформировавшихся эктопических очагов РАС, нацеленных на инициацию и каскадное усиление патологических изменений в ренальной паренхиме. С другой стороны, гипоксия, оксидативный стресс, высокий уровень глюкозы в крови и другие неблагоприятные факторы способны индуцировать эпигенетические механизмы активации фиброза и воспаления ренальной паренхимы, в том числе и изменений топологии компонентов РАС через механизмы контроля экспрессии генов (Macconi D.et al., 2014; Reddy M.A., NatarajanR. , 2015, Nangaku M. et al., 2017). Одним из важных результатов указанных событий есть усиление секреции ренина в паренхиме мозгового слоя почки (ZhuoJ.L., 2011), в гладкомышечных клетках артериол, мезангиальных клетках и в интерстиции через эпигенетические механизмы контроля экспрессии генов (Sparks M.A. et al., 2014; De Mello W.C., 2015). Ренин &mdash; регуляторный фермент РАС, детерминирующий интенсивность дальнейшей продукции А-II. Накопление активных форм кислорода (ROS) в почечной ткани способствует усилению экскреции Agt почками, усиливая цепь обратной связи между активацией ROS и дальнейшей активацией ROS синтеза Agt (Nguyen M.T.X. et al., 2015). Показано, что инфузия животным А-II существенно активирует биосинтез Agt в проксимальных нефроцитах, приводя к дальнейшему росту канальцевой продукции А-II и повышению его патогенетического влияния (Ramkumar N. et al., 2016). В целом, аккумуляция компонентов РАС в проксимальных нефроцитах, усиление внутриклеточной продукции А-II и его эффектов на процессы транскрипции, функции митохондрий, усиление продукции ROS &mdash; один из базовых патогенетических механизмов нарушений гомеостатических функций почек (Navar L.G. et al., 2011; Ellis B. et al., 2012; Li X.C., Zhuo J.L., 2016). В качестве диагностического критерия патологической трансформации внутрипочечной РАС рекомендуется использование ренальной экскреции ангиотензиногена (Kobori H.et al., 2002; Navar L.G. et al., 2011; Alge J.L. et al., 2013). Таким образом, патологическая трансформация внутрипочечной РАС осуществляется: 1.Под контролем эпигенетических механизмов, изменяющих процессы транскрипции, в том числе белков-компонентов РАС. 2.В результате формирования эктопических очагов биосинтеза ключевых белков-компонентов РАС. 3.В результате усиления внутриклеточной продукции А-II и усиления влияния октапептида на транскрипцию белков. 4.Ослаблением экспрессии АСЕ-2, снижением продукции А-1-7, эффекты которого носят оппозиционный характер по отношению к А-II. В результате, в отличии от физиологических условий, патологическое изменение топологии и уровня экспрессии компонентов РАС приводит: 1.К появлению эктопических очагов РАС, в т.ч. усилению внутриклеточной РАС канальцевого эпителия.2.К образованию эктопических очагов РАС (ренин, ангиотензиноген) способствующих ускользанию пусковых механизмов активации РАС от базовых егуляторных стимулов параметров водно-солевого баланса организма и гемодинамики. 3.К изменению вектора регуляторных эффектов эктопических очагов РАС, которые больше не направлены на поддержание гомеостаза. Сформировавшиеся эктопические очаги экспрессии компонентов РАС обеспечивает дальнейшую неограниченную индукцию фиброза, воспаления и гипертрофии клеток ренальной паренхимы. 4.К изменению внутриклеточных систем передачи сигнала (Satou R., Gonzalez-Villalobos R.A., 2012) и баланса регуляторного влияния А-II и А-1-7, в сторону усиления активности АСЕ-1 и альфа-химазы на фоне снижения экспрессии АСЕ-2 (Sparks M.A. et al., 2014).Отметим, что подобные изменения происходят и в результате перестройки экспрессии компонентов РАС в клетках злокачественных опухолей, индуцирующих малигнизацию клеток, фиброз и воспаление ткани, неоангиогенез, метастазирование и иммуносупрессию (Regulska K. et al., 2013; Pinter M., Jain R.K., 2017; Sobczuk P. et al., 2017). Также, как в патогенезе и прогрессировании почечной недостаточности, компоненты РАС раковых клеток не причастны к выполнению гомеостатических функций. Следовательно, по нашему мнению, локальной РАС не являются. С точки зрения интересов практической медицины речь идет о целесообразности использования блокаторов РАС в лечении онкологических заболеваний. По нашему мнению, в этом вопросе можно выделить несколько аспектов. С одной стороны, усиление экспрессии эктопических очагов РАС клетками злокачественной опухоли, на первый взгляд, дает основание ожидать результативности использования ингибиторов АСЕ и антагонистов рецепторов А-II в лечении онкологических заболеваний. В действительности, монотерапия блокаторами РАС онкологических заболеваний может демонстрировать достаточно умеренный терапевтический результат. Сообщается о путях усиления противораковых эффектов ингибиторов РАС в комплексе с мероприятиями иммунотерапии и химиотерапии (Pinter M., Jain R.K., 2017). Наряду с этим, указывается на потенциальные риски, связанные с использованием определенных блокаторов РАС в лечении конкретных онкологических заболеваний (Sobczuk P. et al., 2017), вплоть до полной нецелесообразности их применения (S&oslash;rensen G.V. et al., 2013; Chae Y.K. et al., 2014; Nakai Y. et. al., 2016). С другой стороны, на основе анализа природы экспрессии эктопических очагов РАС, предполагаются качественно иные способы их фармакологической коррекции, основанные на модулировании эпигенетических механизмов подавления активности эктопической РАС (Zhong Y. et al., 2013; Reddy M.A. et al., 2014). Высказывается мнение об универсальной роли эпигенетических механизмов в патогенезе формирования эктопической РАС при онкологических и неонкологических заболеваниях (Kemp J.R. et al., 2014; Tang J., Zhuang S., 2015; Reddy M.A., NatarajanR., 2015). Анализируются перспективные способы лечения онкологических заболеваний, полностью базирующиеся на управлении эпигенетическими механизмами при помощи синтетических microRNA (Tan W. et al., 2014; Felipe A.V. et al., 2014). Новые перспективы использования селективных модуляторов эпигенетических процессов в практической медицине, представляющих интерес и для онкологии, подтверждаются сведениями о готовности применения данной группы фармакологических препаратов (ингибиторы деацетилаз) в доклинических испытаниях (Van Beneden K. et al., 2013). Таким образом, проведенный обзор литературы показал, что изменение экспрессии компонентов РАС тесно связано с патогенезом малигнизации клеток, прогрессированием раковых опухолей, а также стимуляцией процессов метастазирования. Сведения о состоянии экспрессии белков компонентов РАС способствуют пониманию механизмов канцерогенеза и диссеминации клеток опухоли. Эти данные позволяют использовать качественные и количественные параметры экспрессии компонентов РАС в качестве маркеров тяжести течения онкологического заболевания. Тесная вовлеченность компонентов РАС вканцерогенез послужила основой для использования ингибиторов РАС (ингибиторов АСЕ-1 и антагонистов рецепторов А-II) в терапии онкологических заболеваний. Вместе с тем, анализ причин изменения экспрессии белков РАС в клетках опухоли позволил выявить, что весьма значимая функция в этих процессах принадлежит эпигенетическим механизмам регуляции экспрессии генов. Благодаря исследованиям состояния эпигенетических механизмов при онкологических заболеваниях были разработаны принципиально новые методы их коррекции, основанные на применении селективных регуляторов систем ковалентной модификации белков-гистонов (например, ингибитор деацетилаз) и технология синтеза микро РНК. Имеющиеся в литературе данные о фармакологических свойствах указанных препаратов позволяют предположить их перспективность в эффективном лечении онкологических заболеваний. СПИСОК ЛИТЕРАТУРЫ К ГЛАВЕ &laquo;<strong>БЕЛКИ РЕНИН-АНГИОТЕНЗИНОВОЙ СИСТЕМЫ ПРИ ОНКОЛОГИЧЕСКИХ ЗАБОЛЕВАНИЯХ&raquo;</strong> 1.Regulska K., Stanisz B., Regulski M. The renin-angiotensin system as a target of novel anticancer therapy. Curr Pharm Des. 2013;19(40):7103-7125 doi: 10.2174/13816128113199990508 &nbsp; 2.Gomez R.A., Sequeira-Lopez M.L.S. Novel Functions of Renin Precursors in Homeostasis and Disease. Physiology (Bethesda). 2016; 31(1): 25&ndash;33 doi: 10.1152/physiol.00039.2015 &nbsp; 3.Pinter M., Weinmann A., W&ouml;rns M.-A. et al. Use of inhibitors of the renin&ndash;angiotensin system is associated with longer survival in patients with hepatocellular carcinoma.United European Gastroenterol J. 2017; 5(7): 987&ndash;996 doi: 10.1177/2050640617695698 &nbsp; 4.Pinter M., Jain R.K. Targeting the renin-angiotensin system to improve cancer treatment: Implications for immunotherapy. Science Translational Medicine. 2017; 9(410):eaan5616 doi: 10.1126/scitranslmed.aan5616 &nbsp; 5.Rоmer F. K. Angiotensin-converting enzyme and its association with outcome in lung cancer. Br. J. Cancer 1981;43:135-142 &nbsp; 6.Tawinwung S., Ninsontia C., Chanvorachote P. Angiotensin II Increases Cancer Stem Cell-like Phenotype in Lung Cancer Cells. Anticancer Res. 2015;35(9):4789-4797 &nbsp; 7.Sobczuk P., Szczylik C., Porta C., Czarnecka A.M. Renin angiotensin system deregulation as renal cancer risk factor. Oncol Lett. 2017;14(5): 5059&ndash;5068 doi: 10.3892/ol.2017.6826 &nbsp; 8.Sun H., Li T., Zhuang R. et al. Do renin&ndash;angiotensin system inhibitors influence the recurrence, metastasis, and survival in cancer patients? Evidence from a meta-analysis including 55 studies. Medicine (Baltimore). 2017; 96(13): e6394 doi: 10.1097/MD.0000000000006394 &nbsp; 9.Connolly S., Yusuf S., Swedberg K. et al. Effects of telmisartan, irbesartan, valsartan, candesartan, and losartan on cancers in 15 trials enrolling 138,769 individuals. ARB Trialists Collaboration. J Hypertens. 2011;29(4):623-635 doi: 10.1097/HJH.0b013e328344a7de &nbsp; 10.Azoulay L., Assimes T.L., Yin H. et al. Long-Term Use of Angiotensin Receptor Blockers and the Risk of Cancer. PLoS One. 2012; 7(12): e50893 doi: 10.1371/journal.pone.0050893 &nbsp; 11.Yang Y., Zhang F., Skrip L. et al. Lack of an Association between Angiotensin Receptor Blocker Based Therapy and Increased Risk of Cancer: Evidence from Large Observational Studies. PLoS One. 2015; 10(3): e0119775 doi: 10.1371/journal.pone.0119775 &nbsp; 12.Aydiner A., Ciftci R., Sen F. Renin-Angiotensin System Blockers May Prolong Survival of Metastatic Non-Small Cell Lung Cancer Patients Receiving Erlotinib. Medicine (Baltimore). 2015; 94(22): e887 doi: 10.1097/MD.0000000000000887 &nbsp; 13.Arrieta O., Pineda-Olvera B., Guevara-Salazar P. et al. Expression of AT1 and AT2 angiotensin receptors in astrocytomas is associated with poor prognosis. Br J Cancer. 2008; 99(1): 160&ndash;166 doi: 10.1038/sj.bjc.6604431 &nbsp; 14.Nguyen L., Ager E.I., Neo J., Christophi C. Regulation of colorectal cancer cell epithelial to mesenchymal transition by the renin angiotensin system. J Gastroenterol Hepatol. 2016;31(10):1773-1782 doi: 10.1111/jgh.13307 &nbsp; 15.Cheng Q., Zhou L., Zhou J et al. ACE2 overexpression inhibits acquired platinum resistance-induced tumor angiogenesis in NSCLC. Oncol Rep. 2016;36(3):1403-1410 doi: 10.3892/or.2016.4967 &nbsp; 16.Keizman D., Huang P., Eisenberger M.A. et al. Angiotensin system inhibitors and outcome of sunitinib treatment in patients with metastatic renal cell carcinoma: A retrospective examination. Eur J Cancer. 2011; 47(13): 1955&ndash;1961 doi: 10.1016/j.ejca.2011.04.019 &nbsp; 17.Coulson R., Liew S.H., Connelly A.A. et al. The angiotensin receptor blocker, Losartan, inhibits mammary tumor development and progression to invasive carcinoma. Oncotarget. 2017; 8(12): 18640&ndash;18656 doi: 10.18632/oncotarget.15553 &nbsp; 18.Osumi H., Matsusaka S., Wakatsuki T. et al. Angiotensin II type-1 receptor blockers enhance the effects of bevacizumab-based chemotherapy in metastatic colorectal cancer patients. Mol Clin Oncol. 2015; 3(6): 1295&ndash;1300 doi: 10.3892/mco.2015.630 &nbsp; 19.Ager E.I., Wen S.W., Chan J. et al. Altered efficacy of AT1R-targeted treatment after spontaneous cancer cell-AT1R upregulation. BMC Cancer. 2011; 11: 274 doi: 10.1186/1471-2407-11-274 &nbsp; 20.Aydiner A., Ciftci R., Sen F. Renin-Angiotensin System Blockers May Prolong Survival of Metastatic Non-Small Cell Lung Cancer Patients Receiving Erlotinib. Medicine (Baltimore). 2015; 94(22): e887 doi: 10.1097/MD.0000000000000887 &nbsp; 21.Sugimoto M., Yamaoka Y., Shirai N., Furuta T. Role of renin-angiotensin system in gastric oncogenesis. J Gastroenterol Hepatol. 2012; 27(3): 442&ndash;451 doi: 10.1111/j.1440-1746.2011.06964.x &nbsp; 22.Itinteang T., Dunne J.C., Chibnall A.M. et al. Cancer stem cells in moderately differentiated oral tongue squamous cell carcinoma express components of the renin&ndash;angiotensin system. J Clin Pathol. 2016; 69(10): 942&ndash;945 doi: 10.1136/jclinpath-2016-203736 &nbsp; 23.Kuniyasu H. Multiple roles of angiotensin in colorectal cancer. World J Clin Oncol. 2012; 3(12): 150&ndash;154 doi: 10.5306/wjco.v3.i12.150 &nbsp; 24.Shimizu Y., Amano H., Ito Y. et al. Angiotensin II subtype 1a receptor signaling in resident hepatic macrophages induces liver metastasis formation. Cancer Sci. 2017;108: 1757&ndash;1768 doi: 10.1111/cas.13306 &nbsp; 25.Gallagher P.E., Cook K., Soto-Pantoja D. et al. Angiotensin Peptides and Lung Cancer. Curr Cancer Drug Targets. 2011; 11(4): 394&ndash;404 &nbsp; 26.Vinson G.P., Barker S., Puddefoot J.R. The renin&ndash;angiotensin system in the breast and breast cancer. Endocr Relat Cancer. 2012;19 (1): R1-R19 doi: 10.1530/ERC-11-0335 &nbsp; 27.Li S.-H., Lu H.-I., Chang A.Y.W. et al. Angiotensin II type I receptor (AT1R) is an independent prognosticator of esophageal squamous cell carcinoma and promotes cells proliferation via mTOR activation. Oncotarget. 2016; 7(41): 67150&ndash;67165 doi: 10.18632/oncotarget.11567 &nbsp; 28.Dolley-Hitze T., Jouan F., Martin B. et al. Angiotensin-2 receptors (AT1-R and AT2-R), new prognostic factors for renal clear-cell carcinoma? Br J Cancer. 2010; 103(11): 1698&ndash;1705 doi: 10.1038/sj.bjc.6605866 &nbsp; 29.Rhodes D.R., Ateeq B., Cao Q. et al. AGTR1 overexpression defines a subset of breast cancer and confers sensitivity to losartan, an AGTR1 antagonist. Proc Natl Acad Sci U S A. 2009; 106(25):10284&ndash;10289 doi: 10.1073/pnas.0900351106 &nbsp; 30.Wegman-Ostrosky T., Soto-Reyes E., Vidal-Mill&aacute;n S., S&aacute;nchez-Corona J. The renin-angiotensin system meets the hallmarks of cancer. J Renin Angiotensin Aldosterone Syst. 2015;16:227&ndash;233 doi: 10.1177/1470320313496858 &nbsp; 31.Errarte P., Beitia M., Perez I. et al. Expression and activity of angiotensin-regulating enzymes is associated with prognostic outcome in clear cell renal cell carcinoma patients. PLoS One. 2017; 12(8): e0181711 doi: 10.1371/journal.pone.0181711 &nbsp; 32.Xie G., Liu Y., Yao Q. et al. Hypoxia-induced angiotensin II by the lactate-chymase-dependent mechanism mediates radioresistance of hypoxic tumor cells. Sci Rep. 2017; 7: 42396 doi: 10.1038/srep42396 &nbsp; 33.de Alvarenga E.C., de Castro Fonseca M., Coelho Carvalho C. et al. Angiotensin Converting Enzyme Regulates Cell Proliferation and Migration. PLoS One. 2016; 11(12): e0165371 doi: 10.1371/journal.pone.0165371 &nbsp; 34.Shen J., Huang Y.-M., Wang M. et al. Renin&ndash;angiotensin system blockade for the risk of cancer and death. Journal of the Renin-Angiotensin-Aldosterone System. 2016;17(3):1&ndash;14 doi: 10.1177/1470320316656679 &nbsp; 35.Nakamura K., Yaguchi T., Ohmura G. et al. Involvement of local renin-angiotensin system in immunosuppression of tumor microenvironment. Cancer Science. 2018;109(1):54&ndash;64 doi:10.1111/cas.13423 &nbsp; 36.Haznedaroglu I.C., Malkan U.Y. Local bone marrow renin-angiotensin system in the genesis of leukemia and other malignancies. European Review for Medical and Pharmacological Sciences. 2016;20(19):4089-4111 &nbsp; 37.Han C., Ge W. Up-Regulation of Angiotensin-Converting Enzyme (ACE) Enhances Cell Proliferation and Predicts Poor Prognosis in Laryngeal Cancer. Med Sci Monit, 2016; 22: 4132-4138 doi:10.12659/MSM.896933 &nbsp; 38.Clarke N.E., Turner A.J. Angiotensin-ConvertingEnzyme2: The first Decade. International Journal of Hypertension.2012; 2012: 307315 Article ID307315 doi:10.1155/2012/307315 &nbsp; 39.Yu С., Tang W., Wang Y. et al., Downregulation of ACE2/Ang-(1&ndash;7)/Mas axis promotes breast cancer metastasis by enhancing store-operated calcium entry. Cancer Letters. 2016;376(2):268-277 doi: 10.1016/j.canlet.2016.04.006 &nbsp; 40.Cheng Q., Zhou L., Zhou J. et al. ACE2 overexpression inhibits acquired platinum resistance-induced tumor angiogenesis in NSCLC. Oncology Reports. 2016;36: 1403-1410 doi: 10.3892/or.2016.4967 &nbsp; 41.Feng Y., Ni L., Wan H. et al. Overexpression of ACE2 produces antitumor effects via inhibition of angiogenesis and tumor cell invasion in vivo and in vitro. Oncology Reports. 2011; 26: 1157-1164 doi: 10.3892/or.2011.1394 &nbsp; 42.Fan L., Feng Y., Wan H.Y. et al. Hypoxia induces dysregulation of local renin-angiotensin system in mouse Lewis lung carcinoma cells. Genetics and Molecular Research. 2014;13(4): 10562-10573 doi<strong>:</strong>10.4238/2014.December.12.19 &nbsp; 43.Luo Y., Tanabe E., Kitayoshi M. et al. Expression of MAS1 in breast cancer. Cancer Sci. 2015;106(9):1240&ndash;1248 doi: 10.1111/cas.12719 &nbsp; 44.Choi J.-H., Nguyen M.-P., Lee D. et al. Hypoxia-Induced Endothelial Progenitor Cell Function Is Blunted in Angiotensinogen Knockout Mice. Mol Cells. 2014; 37(6): 487&ndash;496 doi:10.14348/molcells.2014.0119 45.Urup T., Michaelsen S.R.,Olsen L.R. et al. Angiotensinogen and HLA class II predict bevacizumab response in recurrent glioblastoma patients. Mol Oncol. 2016; 10(8): 1160&ndash;1168 doi: 10.1016/j.molonc.2016.05.005 &nbsp; 46.Blanco L., Sanz B., Perez I. et al. Altered glutamyl-aminopeptidase activity and expression in renal neoplasms. BMC Cancer. 2014; 14:386 doi:10.1186/1471-2407-14-386 &nbsp; 47.Ellis B., Li X.C., Miguel-Qin E. et al. <strong>Review:</strong> Evidence for a functional intracellular angiotensin system in the proximal tubule of the kidney. Am J Physiol Regul Integr Comp Physiol. 2012; 302(5): R494&ndash;R509 doi:10.1152/ajpregu.00487.2011 &nbsp; 48.De Mello W.C. Chemical Communication between Heart Cells is Disrupted by Intracellular Renin and Angiotensin II: Implications for Heart Development and Disease. Front Endocrinol (Lausanne). 2015; 6: 72 doi: 10.3389/fendo.2015.00072 &nbsp; 49.Wang H., Zhang K., Qin H. et. Genetic Association Between Angiotensinogen Polymorphisms and Lung Cancer Risk. Medicine (Baltimore). 2015; 94(37): e1250 doi:10.1097/MD.0000000000001250 &nbsp; 50.Martin P., Noonan S., Mullen M.P. et al. Predicting response to vascular endothelial growth factor inhibitor and chemotherapy in metastatic colorectal cancer. BMC Cancer. 2014; 14: 887 Doi: 10.1186/1471-2407-14-887 &nbsp; 51.Gomez R.A., Sequeira-Lopez M.L.S. Novel Functions of Renin Precursors in Homeostasis and Disease. Physiology (Bethesda). 2016; 31(1): 25&ndash;33 doi: 10.1152/physiol.00039.2015 &nbsp; 52.Hu J., Zhang L.-C., Song X. et al. KRT6 interacting with notch1 contributes to progression of renal cell carcinoma, and aliskiren inhibits renal carcinoma cell lines proliferation in vitro. Int J Clin Exp Pathol. 2015; 8(8): 9182&ndash;9188 53.Nguyen G. Renin, (pro)renin and receptor: an update. Clinical Science. (2011) 120, 169&ndash;178 doi:10.1042/CS20100432 54.M&uuml;ller D.N., Binger K.J., Riediger F. Prorenin receptor regulates more than the renin-angiotensin system. Annals of Medicine. 2012; 44(Suppl 1): S43&ndash;S48 &nbsp; 55.Shibayama Y., Fujimori T., Nguyen G. et al. (Pro)renin receptor is crucial for Wnt/&beta;-catenin-dependent genesis of pancreatic ductal adenocarcinoma. Sci Rep. 2015; 5: 8854 doi: 10.1038/srep08854 56.Kouchi M., Shibayama Y., Ogawa D. et al. (Pro)renin receptor is crucial for glioma development via the Wnt/b-catenin signaling pathway. J. Neurosurg. 2017; 127:819&ndash;828 57.Belyea B.C., Xu F., Pentz E.S. et al. Identification of renin progenitors in the mouse bone marrow that give rise to B-cell leukaemia. Nat Commun. 2014; 5: 3273 doi:10.1038/ncomms4273 58.Yue Z., Yun-shan Z., Feng-xia X. miR-205 mediates the inhibition of cervical cancer cell proliferation using olmesartan. Journal of the Renin-AngiotensinAldosterone System. 2016; 17(3): 1&ndash;8 doi: 10.1177/1470320316663327 &nbsp; 59.Itinteang T., Dunne J.C., Chibnall A.M. et al. Cancer stem cells in moderately differentiated oral tongue squamous cell carcinoma express components of the renin&ndash;angiotensin system. J Clin Pathol. 2016; 69(10): 942&ndash;945 doi: 10.1136/jclinpath-2016-203736 &nbsp; 60.TsaiY.-P., Wu K.-J. Hypoxia-regulated target genes implicated in tumor metastasis. J Biomed Sci. 2012; 19(1): 102. doi: 10.1186/1423-0127-19-102 &nbsp; 61.Tan W., Li Y., Lim S.-G., Tan T.M.C. <em>miR-106b-25/miR-17-92</em> clusters: Polycistrons with oncogenic roles in hepatocellular carcinoma. World J Gastroenterol. 2014; 20(20): 5962&ndash;5972 doi:10.3748/wjg.v20.i20.5962 &nbsp; 62.Cheng Y., Guo Y., Zhang Y. et al. MicroRNA-106b is involved in transforming growth factor &beta;1&ndash;induced cell migration by targeting disabled homolog 2 in cervical carcinoma. J Exp Clin Cancer Res. 2016; 35: 11 doi: 10.1186/s13046-016-0290-6 &nbsp; 63.Harb-De la Rosa A., Acker M., Swain S., Manoharan M. The role of epigenetics in kidney malignancies. Cent European J Urol. 2015; 68(2): 157&ndash;164 doi:10.5173/ceju.2015.453 &nbsp; 64.Semenza G.L. The Hypoxic Tumor Microenvironment: A Driving Force for Breast Cancer Progression. Biochim Biophys Acta. 2016; 1863(3): 382&ndash;391 doi:10.1016/j.bbamcr.2015.05.036 &nbsp; 65.Han C.-D., Ge W.-S. Up-Regulation of Angiotensin-Converting Enzyme (<em>ACE</em>) Enhances Cell Proliferation and Predicts Poor Prognosis in Laryngeal Cancer. Med Sci Monit. 2016; 22: 4132&ndash;4138 doi: 10.12659/MSM.896933 &nbsp; 66.Choi J.-H., Nguyen M.-P., Lee D. et al. Hypoxia-Induced Endothelial Progenitor Cell Function Is Blunted in Angiotensinogen Knockout Mice. Mol Cells. 2014; 37(6): 487&ndash;496 doi: 10.14348/molcells.2014.0119 &nbsp; 67.Yang X., So W.Y., Ma R.C. et al. Diabetes and cancer: the mechanistic implications of epidemiological analyses from the Hong Kong Diabetes Registry. Diabetes Metab Res Rev. 2012;28(5):379-387 doi: 10.1002/dmrr.2287 &nbsp; 68.Reddy M.A., Park J.T., NatarajanR. Epigenetic modifications and diabetic nephropathy. Kidney Res Clin Pract. 2012; 31(3): 139&ndash;150 doi:10.1016/j.krcp.2012.07.004 &nbsp; 69.Reddy M.A., NatarajanR. Recent Developments in Epigenetics of Acute and Chronic Kidney Diseases. Kidney Int. 2015; 88(2): 250&ndash;261 doi:10.1038/ki.2015.148 &nbsp; 70.Rodrigues-Ferreira S., Abdelkarim M., Dillenburg-Pilla P. et al. Angiotensin II Facilitates Breast Cancer Cell Migration and Metastasis. PLoS One. 2012; 7(4): e35667 doi: 10.1371/journal.pone.0035667 &nbsp; 71.Kemp J.R., Unal H., Desnoyer R. et al. Angiotensin II-regulated microRNA 483-3p directly targets multiple components of the Renin-Angiotensin System. J Mol Cell Cardiol. 2014; 75: 25&ndash;39 doi: 10.1016/j.yjmcc.2014.06.008 &nbsp; 72.de Oliveira da Silva B., Furtado Lima K., Gon&ccedil;alves L. et al. MicroRNA Profiling of the Effect of the Heptapeptide Angiotensin-(1-7) in A549 Lung Tumor Cells Reveals a Role for miRNA149-3p in Cellular Migration Processes. PLoSOne. 2016; 11(9): e0162094 doi: 10.1371/journal.pone.0162094 &nbsp; 73.Wang C., Guo D., Wang Q. et al. Aliskiren targets multiple systems to alleviate cancer cachexia. Oncol Rep. 2016;36(5):3014-3022 doi: 10.3892/or.2016.5118 74.Kaneko K., Ohba K., Hirose T. et al. Expression of (Pro)renin Receptor During Rapamycin-Induced Erythropoiesis in K562 Erythroleukemia Cells and Its Possible Dual Actions on Erythropoiesis. Tohoku J. Exp. Med. 2017; 241:35-43 doi: 10.1620/tjem.241.35 &nbsp; 75.Li X.C., Hopfer U., Zhuo J.L. Novel signaling mechanisms of intracellular angiotensin II-induced NHE3 expression and activation in mouse proximal tubule cells. Am J Physiol Renal Physiol. 2012; 303(12): F1617&ndash;F1628 doi: 10.1152/ajprenal.00219.2012 76.Satou R., Gonzalez-Villalobos R.A.The role of the JAK-STAT pathway in blood pressure and intrarenal renin-angiotensin system regulation. JAKSTAT. 2012; 1(4): 250&ndash;256 doi: 10.4161/jkst.22729 &nbsp; Shao W., Seth D.M., Prieto M.C. et al. Activation of the renin-angiotensin system by a low-salt diet does not augment intratubular angiotensinogen and angiotensin II in rats. Am J Physiol Renal Physiol. 2013; 304(5): F505&ndash;F514 doi: 10.1152/ajprenal.00587.2012 Sparks M.A., Crowley S.D., Gurley S.B. et al. Classical Renin-Angiotensin System in Kidney Physiology. Compr Physiol. 2014; 4(3): 1201&ndash;1228 doi: 10.1002/cphy.c130040 Ferr&atilde;o F.M., Lara L.S., Lowe J. Renin-angiotensin system in the kidney: What is new? World J Nephrol. 2014; 3(3): 64&ndash;76 doi: 10.5527/wjn.v3.i3.64 Zhuo J.L., Ferrao F.M., Zheng Y., Li X.C. New Frontiers in the Intrarenal Renin-Angiotensin System: A Critical Review of Classical and New Paradigms. Front Endocrinol (Lausanne). 2013; 4: 166 doi: 10.3389/fendo.2013.00166 &nbsp; Macconi D., Remuzzi G., Benigni A. Key fibrogenic mediators: old players. Renin&ndash;angiotensin system. Kidney Int Supp l. 2014; 4(1): 58&ndash;64 doi: 10.1038/kisup.2014.11 &nbsp; Nangaku M., Hirakawa Y., Mimura I. et al. Epigenetic Changes in the Acute Kidney Injury-to-Chronic Kidney Disease Transition. Nephron. 2017;137:256&ndash;259 doi.org/10.1159/000476078 &nbsp; ZhuoJ.L. Augmented intratubular renin and prorenin expression in the medullary collecting ducts of the kidney as a novel mechanism of angiotensin II-induced hypertension. Am J Physiol Renal Physiol. 2011; 301(6): F1193&ndash;F1194 doi: 10.1152/ajprenal.00555.2011 &nbsp; Nguyen M.T.X., Han J., Ralph D.L. et al. Short-term nonpressor angiotensin II infusion stimulates sodium transporters in proximal tubule and distal nephron. Physiol Rep. 2015; 3(9): e12496 doi: 10.14814/phy2.12496 Ramkumar N.,Stuart D.,Calquin M. et al. Possible role for nephron‐derived angiotensinogen in angiotensin‐II dependent hypertension. Physiol Rep. 2016; 4(1): e12675 doi: 10.14814/phy2.12675 Navar L.G., Kobori H., Prieto M.C., Gonzalez-Villalobos R.A. Intratubular renin-angiotensin system in hypertension. Hypertension. 2011; 57(3): 355&ndash;362 doi: 10.1161/HYPERTENSIONAHA.110.163519 &nbsp; Ellis B., Li X.C., Miguel-Qin E. et al. <strong>Review:</strong> Evidence for a functional intracellular angiotensin system in the proximal tubule of the kidney. Am J Physiol Regul Integr Comp Physiol.2012;302(5):R494&ndash;R509 doi:10.1152/ajpregu.00487.2011 &nbsp; Li X.C., Zhuo J.L. Recent Updates on the Proximal Tubule Renin-Angiotensin System in Angiotensin II-Dependent Hypertension. Curr Hypertens Rep. 2016; 18(8): 63 doi:10.1007/s11906-016-0668-z &nbsp; Kobori H., Harrison-Bernard L.M., Navar L.G. Urinary excretion of angiotensinogen reflects intrarenal angiotensinogen production. Kidney Int. 2002; 61(2): 579&ndash;585 doi:10.1046/j.1523-1755.2002.00155.x &nbsp; Alge J.L., Karakala N., Neely B.A. et al. Urinary Angiotensinogen and Risk of Severe AKI. Clin J Am Soc Nephrol. 2013; 8(2): 184&ndash;193 doi:10.2215/CJN.06280612 &nbsp; S&oslash;rensen G.V., Ganz P.A., Cole S.W. et al. Use of &beta;-Blockers, Angiotensin-Converting Enzyme Inhibitors, Angiotensin II Receptor Blockers, and Risk of Breast Cancer Recurrence: A Danish Nationwide Prospective Cohort Study. J.Clin Oncol. 2013;31(18):2265&ndash;2272 doi:10.1200/JCO.2012.43.9190 &nbsp; Chae Y.K.,, Dimou A., Pierce S. et al. The effect of calcium channel blockers on the outcome of acute myeloid leukemia. Leuk. Lymphoma. 2014;55(12): 2822&ndash;2829 doi:10.3109/10428194.2014.901513 &nbsp; Nakai Y., Isayama H., Sasaki T. et al. No Survival Benefit from the Inhibition of Renin&ndash;Angiotensin System in Biliary Tract Cancer. Anticancer research. 2016; 36: 4965-4970 doi:10.21873/anticanres.11065 Zhong Y., Chen E.Y., Liu R. et al. Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase. J Am Soc Nephrol. 2013; 24(5):801&ndash;811 doi:10.1681/ASN.2012060590 &nbsp; Reddy M.A., Sumanth P., Lanting L. et al. Losartan reverses permissive epigenetic changes in renal glomeruli of diabetic db/db mice. Kidney Int. 2014; 85(2): 362&ndash;373 doi:10.1038/ki.2013.387 &nbsp; Felipe A.V., de Oliveira J., Chang P.Y. et al. RNA Interference: a Promising Therapy for Gastric Cancer. Asian Pac J Cancer Prev. 2014; 15(14):5509-5515 doi.org/10.7314/APJCP.2014.15.14.5509 &nbsp; Tang J., Zhuang S. Epigenetics in acute kidney injury. Curr Opin Nephrol Hypertens. 2015;24(4):351&ndash;358 doi:10.1097/MNH.0000000000000140 &nbsp; Van Beneden K., Mannaerts I., Pauwels M. et al. HDAC inhibitors in experimental liver and kidney fibrosis. Fibrogenesis Tissue Repair. 2013; 6: 1 doi:10.1186/1755-1536-6-1 &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; <strong>Dolomatov S.I., Zukow W. </strong><strong>Эпигенетика почек</strong><strong> = Kidneys epigenetics</strong><strong>. </strong><strong>RSW. Radom,</strong><strong> 144 </strong><strong>p. ISBN </strong><strong>9780359774524</strong><strong>.</strong><strong> DOI </strong><strong>http://dx.doi.org/10.5281/zenodo.3270699</strong><strong> PBN Poland </strong><strong>https://pbn.nauka.gov.pl/sedno-webapp/works/917606</strong> &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &copy; The Author(s) 2019. This monograph is published with Open Access. Open Access This monograph is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited. &nbsp; &nbsp; Attribution &mdash; You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work). Noncommercial &mdash; You may not use this work for commercial purposes. Share Alike &mdash; If you alter, transform, or build upon this work, you may distribute the resulting work only under the same or similar license to this one. &nbsp; Zawartość jest objęta licencją Creative Commons Uznanie autorstwa-Użycie niekomercyjne-Na tych samych warunkach 4.0 &nbsp; <strong>ISBN 9780359774524</strong> &nbsp; <strong>DOI </strong><strong>http://dx.doi.org/10.5281/zenodo.</strong><strong>3270699</strong> &nbsp; <strong>PBN Poland </strong><strong>https://pbn.nauka.gov.pl/sedno-webapp/works/917606</strong> &nbsp; Radomska Szkoła Wyższa w Radomiu, Polska ul. 1905 roku 26/28 26-600 Radom Tel: 048 383 66 05 mail: med@rsw.edu.pl &nbsp; <strong>144</strong><strong> p. Number of characters: </strong><strong>250</strong><strong> 000 (with abstracts). Number of images:</strong><strong> 4 </strong><strong>x 1000 characters (lump sum) =</strong><strong> 4 </strong><strong>000 characters.</strong> <strong>Total: Number of characters: 2</strong><strong>54</strong><strong> 000 (with abstracts, summaries and graphics) = 6,</strong><strong>35</strong><strong> sheet publications.</strong> &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; <strong>ISBN 9780359774524</strong> &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; <strong>ISBN 9780359774524</strong> &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;

Authors: Dafni Moschidou &amp; Pascale V Guillot ### Abstract Pluripotent stem cells have potential applications in regenerative medicine, disease modelling and drug screening. Induced pluripotent stem (iPS) cells have first been generated from fibroblasts using retroviral insertion of OCT4A, SOX2, c-MYC and KLF4. Since then, a number of methods have been developed to avoid the random integration of ectopic factors in the genome and the low efficiency of the process. Those include alternative integrating, non-integrating, excisable and DNA-free systems, but they all present challenges that prevail their use as a clinical and molecular tool. Here we present a transgene-free detailed protocol to generate human pluripotent cells from c-KIT+ amniotic fluid fetal stem cells. The parental populations express OCT4A and can be reverted to functional pluripotency through manipulations of culture conditions and Valproic acid (VPA) supplementation. The resulting pluripotent cells could potentially be used safely without ethical and legal restriction in the clinic for prenatal and postnatal autologous use. ### Introduction Pluripotent stem cells have several applications in cell therapy and tissue engineering to treat tissue injuries and organ pathologies, as well as drug screening and investigation of disease mechanisms (1). Embryonic stem cells (ESC), which are derived form the inner cell mass, have the capacity to differentiate into lineages of the three germ layers, i.e. mesoderm, endoderm and ectoderm, and contribute to adult tissues including the germline. Other early embryonic tissues have also been used to derive pluripotent stem cells, including epiblast stem cells (EpiSC), embryonal carcinoma cells (ECC) and primordial germ cells (PGC). The expression of OCT4A, a marker of undifferentiated pluripotent cells which regulates the Rex1 promoter, is essential to prevent the early embryo from differentiating; for example, OCT4A-deficient mouse embryos lose pluripotency and differentiate into trophectoderm. Unfortunately, these cell types are difficult to expand ex vivo, poorly contribute to adult tissues and, similarly to ESC, are only available during the early stages of development. Consequently, their use is ethically challenged because their derivation is associated with destruction of the early embryo. Somatic stem cells, which can be isolated from most tissues throughout pre-and post-natal life, do not express OTC4A (2) or other markers associated with pluripotency; consequently, they show considerable reduced plasticity, only differentiating into a restricted number of cell types, usually within their lineage. The absence of pluripotency in somatic stem cells restricts their applications in regenerative medicine to treat injuries or diseases from the tissues of which they are derived. Strategies to revert somatic stem cells to pluripotency have been investigated since 1952, when Briggs and Kings developed somatic cell nuclear transfer (SCNT). They successfully created cloned animals by replacing the nucleus of enucleated oocytes with the nucleus of late stage embryos. Although cloned organisms present phenotypic abnormalities and cloning is technically challenging (3), these findings supported the concept that the genome retains a capacity to revert to earlier states of plasticity and that the epigenetic modifications, which are responsible for cellular differentiation are reversible. Since 2006, induced pluripotent stem (iPS) cells have been generated from fibroblasts obtained from dermal biopsies by using retroviruses to ectopically express key transcription factors critical for the modulation of cell fate and maintenance of the pluripotent identity, i.e. the four reprogramming factors OCT4A, SOX2, c-MYC and KLF4 (4). Recent data suggest that endogenous expression of the reprogramming genes may favour the reprogramming process of somatic stem cells with minimal or no ectopic factors, underpinning OCT4A expression as being sufficient to induce pluripotency. For example murine neural stem cells, which endogenously express SOX2 and c-MYC, were successfully induced to pluripotency through ectopic viral expression of OCT4A and KLF4 only (5), and recently by OCT4A alone in both mouse and human neural stem cells (6, 7). In line with these findings, germline cells, which endogenously express OCT4A, have been shown to acquire pluripotency without addition of exogenous transcription factors, but instead via a chemical approach, for example Fgf2 and Leukaemia inhibitory factor (LIF) (8,9). Other evidences suggest that modification of the culture conditions alone may induce pluripotency without genetic manipulations in OCT4A-expressing cells (9). For example, Zhou et al. (10) reverted epiblast stem cells from a later developmental pluripotent state to ES-like pluripotency using small molecules supplementation. We recently demonstrated that Valproic acid confers functional pluripotency to human amniotic fluid stem cells in a transgene-free approach (11). We found that human c-KIT+ first and mid-trimester amniotic fluid cells (AFSC) endogenously express OCT4A, although levels of expression are notably inferior to those found in ES cells (11). Accordingly, AFSC do not fulfil the stringent criteria of pluripotency despite being broadly multipotent. We hypothesized that manipulation of culture conditions and the use of epigenetic modulators could revert OCT4A+ cells to functional pluripotency. We showed that culture of AFSC on Matrigel in a medium designed to sustain pluripotency supplemented with the histone deacetylase (HDAC) inhibitor Valproic acid led the cells to grow as compact colonies of small cells. These cells up-regulated OCT4A to a level similar to ES cells, and expressed alkaline phosphatase (ALP), SOX2, c-MYC, KLF4, NANOG, SSEA3, SSEA4, TRA-1-60, TRA-1-81, and REX1, which is expressed upon OCT4A up-regulation in cells with low or null levels of OCT4A. In addition, the reprogrammed cells expressed FBX015, a protein expressed in undifferentiated ES cells which is expressed during co-expression of OCT4A, SOX2, c-MYC and KLF4. The cells formed embryoid bodies in vitro and highly differentiated teratomas in vivo following injection into immunodeficient mice, showed reactivation of the epigenetically silenced X chromosomes in female lines and expressed hTERT. In addition, cells gained the ability to differentiate beyond the standard mesodermal lineages bone, fat and cartilage and formed definitive endoderm, mature functional oligodendrocytes, neurons and hepatocytes (11). **Advantages of the method** Our method is legally and ethically acceptable as AFSC are derived from the amniotic fluid. It is also safe and suitable for clinical applications as the AFSC are reprogrammed to pluripotency without ectopic factors, even inactivated, but simply by manipulation of the culture conditions only. In addition, our method is fast and easy, as pluripotent cells can be generated within 8-9 weeks. Reprogrammed cells can be expanded to clinically relevant numbers and stored for either prenatal, neonatal or postnatal autologous use. They can also be used in allogeneic settings, since a bank of 150 donor cell lines would provide a beneficial match for up to 37.9% of the population (12). We have used VPA, a small-molecule HDAC inhibitor, which is US Food and Drug Administration–approved for the treatment of epilepsy (13). Previously, VPA has been shown to enable reprogramming of primary human fibroblasts with just two transcription factors, OCT4A and SOX2 (14). VPA, which up-regulates OCT4A expression through factors targeting a proximal hormone response element, was enough to enhance OCT4A expression in AFSC, generating reprogrammed cells that were genetically stable over time. **Comparison with other methods** iPS cells generated using retroviral insertion of the four Yamanaka factors are usually only partially reprogrammed as the retroviral vectors are silenced towards the end of the process. In addition, the risks of multiple random integration of the transgenes into the host genome, the low efficiency of the process, the stability of the pluripotent phenotype, the risk of residual activity or reactivation of the viral transgenes, as well as the potential risk of virally-induced tumorigenicity further restrain the application of virally-induced iPS cells. This pitfall is even greater when using lentiviral vectors, as these are less efficient in being silenced and could prevent the cells from differentiating later on (1). Consequently, a number of delivery methods have been developed to generate integration-free iPS cells, including adenovirus (15), Sendai virus (16), episomal DNA plasmid (15, 17), and minicircle DNA vectors (18), although the absence of genomic integration should be experimentally verified in all cases. In addition, the procedures using integrating vectors that are subsequently excised from the genome are also associated with very low efficiency (19). For example, piggyBac transposons (20) can be removed after integration in the genome, although the screening of excised lines is time consuming. Finally, DNA-free pluripotent cell lines have been generated by direct delivery of either synthetic RNA (21) or protein (6). However, non-integration methods are mostly inefficient or technically challenging, and although progress has been made to increase the efficiency of episomal plasmid vectors using p53 suppression (19), this may also lead to genomic instability. **Experimental design** In this manuscript, we describe a method for generating functional pluripotent fetal stem cells without ethical and legal restrictions. In principle, these cells could be used in the clinic for regeneration therapy, and have applications in disease modelling and drug screening. The parental populations (human first and second trimester amniotic fluid stem cells) can be isolated during standard prenatal diagnostic, either multiple pregnancy reduction during the first trimester, or amniocentesis during mid-trimester, and do not require termination of pregnancy. These cells express OCT4A, which is absent in human first trimester fetal mesenchymal stem cells isolated from fetal blood, liver or bone marrow, as previously described by us. We first describe the technique to isolate c-KIT+ AFSC from the amniotic fluid. To establish the parental population, the amniotic fluid is first centrifuged and the cells replated in isolation medium, where they are allowed to expand in sufficient numbers before being c-KIT+ selected based on their cell surface expression of the epitope. The cells show a fibroblastic morphology, with a spindle-shaped cytoplasm, and grow as a monolayer of single cells, as shown in Figure 1A. The second step consists of adapting the cells to low growth factor culture conditions designed to sustain the maintenance and expansion of pluripotent cells in the absence of feeder cells. The cells are expanded on Matrigel in expansion medium (Nutristem medium, Stemgent) and passaged mechanically with collagenase. In these conditions, the cells show higher kinetics and grow as round and compact colonies of small SSEA3+ cells which grow on top of flat colonies of SSEA3- cells that functions as feeders, as seen in Figure 1B. After two weeks in expansion medium, the cells are switched to reprogramming medium composed of expansion medium supplemented with Valproic acid (0.1-1 mM) for a minimum of 5 days, during which time the cells stop dividing but up-regulate expression of pluripotency markers OCT4A, NANOG, SOX2, c-MYC, KLF4, express REX1, FBX015, SSEA3, SSEA4, TRA-1-60, TRA-1-81 and hTERT, and stain positive for alkaline phosphatase. The cells are subsequently returned to expansion medium and stabilized for a minimum of two weeks. They are able to form embryoid bodies in vitro and teratomas in vivo when transplanted into immunodeficient mice. When cultured in permissive medium in vitro, the cells express functional markers of neuron differentiation (NR1), produce urea (hepatic differentiation), and express markers of definitive endoderm, confirming their ability to differentiate into lineages of the three germ layers. The pluripotency state of the cells is also confirmed by the reactivation of the X chromosome in female lines. Finally whole genome transcription array should show a high homology with ES cells to confirm expression of ECM associated genes and other genes associated with pluripotency. The reprogrammed lines should show high kinetics and little senescence over time and should be genetically and epigenetically stable after long term expansion (11). We anticipate that the protocol described here for human amniotic fluid stem cells could be adapted to a wider range of human stem cells that express OCT4A in the parental population, although levels of expression are not required to be identical to ES cells. Such cell types include, but is not restricted to, human first trimester fetal chorion stem cells. Data from our laboratory indicate that these cells require an adaptation period to expansion medium of two weeks before Valproic acid can be added to the culture medium. ### Reagents **Cell lines** 1. Donors for amniotic fluid !CAUTION Subjects must have given informed consent approved by the Research Ethics Committee of their facilities. All experiments involving humans must be in compliance with national and institutional ethics regulations guidelines. **Culture medium** 1. Dulbecco’s modified Eagle’s medium high glucose (DMEM, Sigma, cat. no. D5671) - Knockout Dulbecco’s modified Eagle’s medium (KO-DMEM, Invitrogen, cat. no. 10829018) - Stemedia Nutristem XF/FF (Stemgent, cat. no. 01-0005) - Penicillin/Streptomycin (Invitrogen, cat. no. 15070-063) - L-glutamine (Invitrogen, cat. no. 25030-024) - Fetal Bovine Serum (FBS) heat inactivated (Biosera) - Non-essential amino acids (Invitrogen, cat. no. 11140-035) - β-mercaptoethanol !CAUTION β-mercaptoethanol is a toxic material. Avoid inhalation, ingestion and skin contact (Invitrogen, cat. no. 31350-010) **Enzymes** 1. Collagenase Type IV (Invitrogen, cat. no. 17104-019) - 0.25% Trypsin-EDTA (1X), Phenol Red (Invitrogen, cat. no. 25200-056) **Chemicals and general reagents** 1. Matrigel (BD Biosciences, cat. no. 354230) - Valproic acid sodium salt (VPA, 1mM) Sigma, cat. no. P4543) - Dulbecco’s phosphate buffered saline (DPBS, Sigma, cat. no. D8537) - RNeasy minikit (Qiagen, cat. no. 74104) - β-mercaptoethanol !CAUTION β-mercaptoethanol is a toxic material. Avoid inhalation, ingestion and skin contact (Sigma, cat. no. M6250) - RNAase-free DNAase set (Qiagen, cat. no. 79254) - Reverse transcription system (Promega, cat. no. A3500) - SYBR green PCR mastermix (Applied Biosystems, cat. no. 4364346) - Custom oligonucleotides (Thermo) - Dimethyl sulfoxide (DMSO) !CAUTION DMSO is a toxic material. Avoid inhalation, ingestion and skin contact (Sigma, cat. no. D2650) - Bovine Serum Albumin (BSA) (Sigma, cat. no. A3059) - Paraformaldehyde (PFA) !CAUTION PFA is a toxic material. Avoid inhalation, ingestion and skin contact (Sigma, cat. no. P6148) - Triton X-100 (Sigma, cat. no. T8787) - Glycine (Sigma, cat. no. G7126) - Casein (Vector Labs, cat. no. SP-5020) - 45% Fish gelatin (British Biocell, cat. no. gel10) - Vectashield mounting medium with DAPI (Vector Labs, cat. no. H-1200) - Methylene blue solution (Sigma, cat. no. 03978) - AutoMACS running buffer (Miltenyi Biotec, cat. no. 130-091-221) - CD117 microbead kit human (Miltenyi Biotec, cat. no. 130-091-332) - Urea/Ammonia determination kit (R-Biopharm AG, Darmstadt, Germany) - Monothioglycerol (Sigma, cat. no. 88639) - Hepatocyte growth factor (Peprotech, cat. no. 100-39) - Oncostatin M (Peprotech, cat. no. 300-10T) - Dexamethasone (Sigma, cat. no. D2915) - Fibroblast Growth Factor 4 (Peprotech, cat. no. 100-31) - ITS (Insulin, Transferrin, selenium) (Sigma, cat. no. I1884) - DMEM:F12 medium (Sigma, cat. no. D6421) - Glucose (Sigma, cat. no. G7528) - Sodium bicarbonate (Sigma, cat. no. S8761) - HEPES buffer (Sigma, cat. no. H0887) - Insulin (Sigma, cat. no. I1882) - Transferrin (Sigma, cat. no. T1147) - Progesterone (Sigma, cat. no. P0130) - Putrescine (Sigma, cat. no. P7505) - Selenium chloride (Sigma, cat. no. S5261) - Epidermal Growth Factor (Peprotech, cat. no. AF-100-15) - basic Fibroblast Growth Factor (Peprotech, cat. no. 100-18B) - Leukemia Inhibitory Factor (Sigma, cat. no. L5283) - Baicalin (Sigma, cat. no. 572667) - N1 supplement (Sigma, cat. no. N6530) - Biotin (Sigma, cat. no. B4501) - Platelet Derived Growth Factor (Peprotech, cat. no. 100-13A) - Gelatin (Sigma, cat. no. G1393) - Urea/Ammonia determination kit (R-Biopharm AG, cat. no. 10542946-035) ### Equipment 1. Petri dishes (6-well, Fisher Scientific, cat. no. TKB-100-105K) - Falcon conical tubes (15ml and 50ml, VWR, cat. no. 525-0150 and 525-0156 respectively) - Parafilm (VWR, Cat. no. 291-1214) - Incubator maintained at 37°C, 90% humidity and 5% CO2 - Safety cabinet suitable for cell culture - Water bath maintained at 37°C - Centrifuge suitable for 15ml and 50ml tubes - Microcentrifuge suitable for 1.7 ml tubes - 1.7ml microcentrifuge tubes (Fisher, cat. no. FB56089) - 0.2 ml PCR tubes (VWR, cat. no. 7320-0548) - PCR machine - Step one ABI PRISM Sequence Detection System (Applied Biosystems) - MicroAmp fast 96-well reaction plate 0.1 ml (Applied Biosystems, cat. no. 4346907) - MicroAmp 96-well optical adhesive film (Applied Biosystems, cat. no. 4311971) - Square petri dishes 100 mm (VWR, cat. no. 391-2018) - Cell scraper 18 cm (VWR, cat. no. 734-0385) - Cryogenic vials 2 ml (VWR, cat. no. 479-3222) - 0.2 μm syringe filter (Appleton woods, cat. no. FC121) - Syringes for 20ml and 50ml (VWR, cat. no. 613-3922 and 613-3925 respectively) - Plastic disposable pipettes for 5ml and 10ml (VWR, cat. no. 734-1737 and 734-1738 respectively) - Filter units, PES membrane, 250ml, 0.22μM filter pore size (Fisher Scientific, cat. no. FDR-120-050L) - Pipettes for 20μl, 200μl and 1000μl (Gilson) - Filtered pipette tips for 20μl, 200μl and 1000μl (Starlab, cat. no. S1120-1810, S1120-8810 and S1126-7810 respectively) - Inverted light microscope with phase contrast (x10, x20, x40 objectives) - Pipette filter CellMate II (Fisher scientific, cat. no. PMX-170-030C) - MACS columns (Miltenyi Biotec, cat. no. 130-042-201) - miniMACS separator (Miltenyi Biotec) - MACS multistand (Miltenyi Biotec) - FACS tubes round bottom (VWR, cat. no. 734-0436) - Cell counter or haemocytometer - Thermanox plastic coverslips for 24-well dish (Fisher Scientific, cat. no. TKT-210-330P) ### Procedure **REAGENT SETUP** **Matrigel-coated culture plates** Refer to manufacturer’s instructions for reagent handling and thawing. **!CAUTION** It is important to keep Matrigel and all equipment used to prepare and aliquot stocks chilled. Thaw Matrigel on ice overnight. When thawed, dilute Matrigel 1:2 using ice-cold KO-DMEM and immediately aliquot into 15 ml chilled centrifuge tubes (1 ml/tube). Aliquots can be stored at -80°C until use. To prepare Matrigel-coated plates, thaw 1 ml stock aliquot overnight at 4°C and dilute 1:15 using ice cold KO-DMEM. Using chilled pipette tips, aliquot 1 ml/well for a 6-well plate. Swirl to coat plate surface evenly. Plates can be used after incubation at 37°C for 1 hour, or at 4°C overnight, and can be kept at 4°C for up to 2 weeks wrapped in Parafilm. Plates kept at 4°C should be transferred to 37°C for at least 30 minutes before use. To use Matrigel-coated plates for cell culture, aspirate the Matrigel solution, replace with 3ml of pre-warmed Nutristem media and place back into incubator to equilibrate. Passage cells onto the prepared plates after a minimum of 10 minutes. **Collagenase Type IV solution** Final concentration is 200U/ml. Dissolve 20,000 U of collagenase Type IV in 100 ml KO-DMEM. Add all components to a 250 ml filter unit and filter. Aliquot into 15 ml sterile tubes and store at -20°C until use. Thawed solution can be stored at 4°C for up to 1 week. **Isolation medium** The isolation medium consists of DMEM supplemented with 2 mM L-Glutamine, 100 U/ml Penicillin/Streptomycin and 10% FBS. Solutions of L-Glutamine and Penicillin/Streptomycin are aliquoted in 5 ml tubes and stored at -20°C until use. FBS is filtered (optional) and aliquoted in 50 ml falcon tubes and stored at -20°C until use. To make 500 ml isolation medium, take one DMEM bottle and remove 60 ml of liquid. Thaw one aliquot of L-Glutamine, Penicillin/Streptomycin and FBS in a 37°C waterbath. Add solutions to the DMEM bottle. **!CAUTION** gently swirl the bottle to mix avoiding the liquid touching the ridges of the bottle. The isolation medium should be kept at 4°C for up to 2 weeks and a small aliquot should be pre-warmed in a 37°C waterbath before use. **Expansion medium** The expansion medium consist of Nutristem supplemented with 100 U/ml Penicillin/Streptomycin. To prepare one 500 ml bottle of expansion medium, remove 5 ml of solution from a 500 ml Nutristem bottle and replace with 5ml of thawed Penicillin/Streptomycin. **!CAUTION** gently swirl the bottle to mix avoiding the liquid touching the ridges of the bottle. The expansion medium should be aliquoted into 50 ml aliquots in falcon tubes and stored at -20°C until use. When needed, thaw one aliquot in a 37°C waterbath and at keep at 4°C for up to 1 week. Prior to use for cell culture, a small aliquot should be pre-warmed in a 37°C waterbath before use. **Reprogramming medium** Reprogramming medium consists of expansion medium supplemented with 1 mM VPA. Make 50 mM VPA stock by diluting 100 mg of powder VPA into 12 ml expansion medium and sterilize by filtering using a 0.2 μm syringe filter. Take 1 ml from this solution and add it to 50 ml expansion medium to make up a final VPA concentration of 1mM. CRITICAL STEP The 50 mM VPA stock and the reprogramming medium should be made fresh before use. **Freezing medium** The freezing medium consists of 60 % (vol/vol) DMEM, 30 % FBS and 10 % DMSO. To make 10 ml of freezing medium, add 6 ml of DMEM, 3 ml of FBS and 1 ml of DMSO. CRITICAL STEP Add the DMSO last and keep the freezing medium at 4°C until use. **Solution for Flow cytometry and cell separation** The solution for flow cytometry and cell separation consists of 1% BSA in DPBS. First, make a stock solution of 10 % BSA by dissolving 5 g of BSA into 50 ml of DPBS and sterile filter using a 0.2 μm syringe filter. **!CAUTION** BSA does not readily dissolve in DPBS. To fully dissolve, put a little bit of DPBS in a 50 ml falcon tube and add the BSA powder carefully. Then, affix the tube horizontally on a shaking plate, shaking slowly. When dissolved, complete the volume up to 50 ml with DPBS and sterile filter using a 0.2 μm syringe filter. To make the 1 % BSA solution, add 5 ml of the filtered solution into 45 ml of DPBS. CRITICAL STEP 1% BSA in DPBS should be stored at -20°C and thawed before use. The solution can be kept at 4°C for 24 h. **PROCEDURE** **Isolation of AFSC from human amniotic fluid - TIMING ∼10 min** 1.Collect human amniotic fluid after amniocentesis (usually 1-2 ml) in a sterile syringe. 2.Transfer to 15 ml centrifuge tube and centrifuge at 300g for 5 minutes. 3.Resuspend the resulting pellet in 1 ml of pre-warmed isolation medium and transfer to one well of a 6-well plate, add 2 more ml of pre-warmed medium, working in aseptic conditions. **!CAUTION** any study involving use of human tissue must conform to national and institutional ethics regulations. **Expansion of isolated AFSC cells - TIMING ∼ 2 weeks** 4.Check cells daily for attachment without changing the medium for the first week. 5.When the first colonies are forming (∼ 10-15 cells each), replace the medium. Aspirate the medium from the well carefully without touching the bottom of the well. Wash the well carefully with 2 ml of pre-warmed DPBS. Replace with 3 ml of pre-warmed isolation medium. **!CAUTION** place the pipette end on the side of the well and release the solution very slowly to avoid disturbance of the colonies. 6.Allow the colonies to grow until 70% confluence has been reached, changing the medium every Monday, Wednesday and Friday. 7.When the culture has reached 70% confluence, passage the cells. 8.Remove the medium and wash with DPBS as mentioned above. 9.Add 1 ml of Trypsin solution, swirl the plate gently to cover plate surface evenly and place back in the incubator for 2-3 minutes, until cells detach. 10.Add 1 ml of isolation medium to neutralize the trypsin, and collect in a 15 ml tube. 11.Centrifuge at 300g for 5 minutes. 12.Carefully remove the supernatant and resuspend the pellet slowly in 200 μl of isolation medium to obtain a single cell suspension 13.Add a further 800μl of isolation medium, resuspending slowly 14.Add a further 2 ml of isolation medium and resuspend carefully, avoiding the formation of air bubbles 15.Transfer 1 ml of cell suspension into each of 3 wells of a 6 well plate 16.Add 2ml of pre-warmed isolation medium to each well containing cells 17.Place the plate in the incubator **Selection of c-KIT+ cells. - TIMING 1h** When the cells have been expanded to ∼10×10e6 cells, proceed with selection of c-KIT+ cells 18.Repeat steps 8-11 19.Carefully remove the supernatant and resuspend the pellet slowly in 200 μl of solution for cell separation to obtain a single cell suspension 20.Add a further 800 μl of solution for cell separation, resuspending slowly 21.Count the cells using a haemocytometer or cell counter, using methylene blue to determine cell viability 22.Wash the cells by adding 4 ml to the cell suspension and resuspending gently 23.Centrifuge at 300g for 5 minutes 24.Discard the supernatant and resuspend the pellet as before 25.Repeat wash 2 more times, centrifuging after each wash 26.Resuspend the cell pellet in 300 μl of AutoMACS running buffer, in a FACS round bottom tube 27.Add 100 μl of CD117 microbeads 28.Mix well and incubate at 4°C for 15 minutes 29.Wash cells by adding 4 ml of running buffer, resuspend well 30.Centrifuge at 300g for 10 minutes 31.Remove supernatant completely and resuspend in 500 μl of running buffer 32.Place an MS column in the magnetic field of the MACS separator 33.Prime column by rinsing with 500 μl of running buffer 34.Apply cell suspension to the column, and collect the flow through that contains the unlabelled cells in a 15 ml falcon tube 35.Wash column 3 times with 500 μl of running buffer, collecting the flow through in the same 15 ml tube 36.After the washes, remove the separation column and place it in a 15ml falcon tube 37.Add 1 ml of isolation medium onto the column and immediately flush out the CD117+ magnetically labelled cells by firmly pushing the plunger into the column. ? TROUBLESHOOTING - PAUSE POINT If needed, cells can be frozen and kept in liquid nitrogen long-term 38.Plate the cells in 6-well plates at a cell density of 2×10e5 cells/well, topping up with isolation medium to 3 ml per well 39.Place the plate in the incubator **Adaptation of cells to medium sustaining pluripotency - TIMING ∼ 2 weeks** To transfer the cells from isolation medium to expansion medium: 40.First prepare Matrigel-coated plates and place the plates in the incubator with 2 ml per well of pre-warmed 1:1 isolation medium:expansion medium to equilibrate for a minimum of 10 minutes. 41.When the cells reach 70% confluence in isolation medium, detach the cells with trypsin as describe in steps 8-11. 42.Resuspend the cells in 1 ml of a solution made of pre-warmed 1:1 isolation medium:expansion medium. 43.Count the cells and resuspend at a cell density of 2×10e5 cells/ml 44.Add 1 ml of single cell suspension per well. ? TROUBLESHOOTING 45.The next day, check for cell viability (should be 100%) and replace the media with 3 ml of pre-warmed expansion medium per well 46.The pre-warmed expansion medium is then replaced daily 47.When the cells reach 70 % confluence, passage the cells 48.Prepare Matrigel plates and place the plates in the incubator with 2 ml per well of pre-warmed expansion medium to equilibrate for a minimum of 10 minutes. 49.Pre-warm the collagenase in a 37°C waterbath for 15 minutes 50.Aspirate carefully the medium from the wells 51.Add carefully 1 ml of collagenase on the side of the well without touching the cells 52.Place the plate back in the incubator for 7 minutes **!CAUTION** after 5 minutes of incubation, check the cells under light microscope. The cells must not detach completely but the sides of the cytoplasm should slightly detach while the nucleus remain attached. This might take 5 to 7 minutes depending on cell type. 53.Carefully aspirate the collagenase from the side of the well without touching the cells 54.Wash the well twice by gently pipetting 2 ml of room temperature DPBS on the side of the well, paying attention not to detach the cells 55.Add 1 ml of pre-warmed expansion medium per well 56.Gently scrape cells with a 1 ml pipette tip until cells are uniformly dispersed into small clumps (50 to 500 cells) **!CAUTION** do not triturate the cells to a single cell suspension 57.Add 2 ml of expansion medium 58.Add 1 ml of cell suspension into one well of a 6 well plate (1:3 split ratio) 59.Place the plate back into the incubator. The cells should now start growing as compact spherical colonies of small cells, which are difficult to disaggregate and with time increase in size on top of large fibroblastic cells arranged as flat colonies. - PAUSE POINT If needed, cells can be frozen and kept in liquid nitrogen long-term **Derivation of pluripotent cells - TIMING ∼ 5-14 days** 60.Prepare the reprogramming medium and pre-warm in a 37°C waterbath for 15 minutes 61.Remove the expansion medium from the cells and replace with 3 ml of pre-warmed reprogramming medium per well 62.Change the medium daily, for 5 days in total. **!CAUTION** At this stage, the cells will stop growing ? TROUBLESHOOTING 63.After 5 days, extract RNA from one well and synthesize cDNA. Using qRT-PCR, verify that the levels of expression of OCT4A, SOX2, c-MYC, KLF4 and FBX015 are upregulated **Stabilization of pluripotent lines - TIMING ∼ 3 weeks** To stabilize the cells after reprogramming: 64.Remove reprogramming medium and rinse cells carefully with 2 ml DPBS 65.Replace the medium with 3 ml of pre-warmed expansion medium per well 66.When the cells reach 70% confluence, you can either passage the cells by following steps 48-59 or freeze the cells. **Characterisation of pluripotent lines** 67.The pluripotency status of stabilised reprogrammed cells can be characterised using flow cytometry for cell surface markers (option A), flow cytometry for nuclear markers (option B), EB formation (option C), immunofluorescence (option D), quantitative real-time PCR (option E), teratoma formation (option F), or in vitro differentiation assays (option G). **REAGENT SETUP** **EB differentiation medium**: 80% (vol/vol) KO-DMEM supplemented with 1 mM L-glutamine, 0.1 mM b-mercaptoethanol, 1% non-essential amino acids stock and 20% FBS. **Immunofluorescence blocking solution**: DPBS supplemented with 1 % (vol/vol) BSA, 0.2 % (vol/vol) fish skin gelatin and 0.1 % (vol/vol) casein (pH 7.6). **Hepatic differentiation medium**: High glucose DMEM supplemented with 15% (vol/vol) FBS, 1 % (vol/vol) Penicillin/Streptomycin, 2 mM L-Glutamine, 300 μM Monothioglycerol, 20 ng/ml Hepatocyte Growth Factor, 10 ng/ml Oncostatin M, 10-7 Dexamethasone, 100 ng/ml Fibroblast Growth Factor 4 and 1X ITS (Insulin, Transferrin, selenium). **Ectoderm differentiation medium**: DMEM/F12 (1:1) supplemented with 1 % (vol/vol) Penicillin/Streptomycin, 2 mM L-Glutamine, 0.6 % (vol/vol) glucose, 3 mM sodium bicarbonate, 5 mM HEPES buffer, 25 mg/ml insulin, 100mg/ml transferrin, 20nM progesterone, 60 mM putrescine, 30 nM selenium chloride, 20 ng/ml Epidermal Growth Factor, 10 ng/ml basic Fibroblast Growth Factor and 10 ng/ml Leukemia Inhibitory Factor. **Neuronal differentiation medium**: High glucose DMEM supplemented with 0.5 % (vol/vol) FBS, 1 % (vol/vol) Penicillin/Streptomycin, 2 mM L-Glutamine and 0.1% (vol/vol) Baicalin. - CRITICAL STEP Neuronal medium must be made fresh and used immediately, as Baicalin becomes toxic for the cells when left at high concentration. **Oligodendrocyte differentiation medium**: high glucose DMEM supplemented with 1% (vol/vol) Penicillin/Streptomycin, 2mM L-Glutamine, 1X N1 supplement, 1μg/ml biotin, 5ng/ml basic Fibroblast Growth Factor, 1ng/ml Platelet Derived Growth Factor and 30% B104 conditioned medium. (A) Flow cytometry for cell surface markers: CD105, CD24, CD29, CD90, SSEA3, SSEA4, TRA-1-60, TRA-1-81 - TIMING 3 hours - (i) Detach the cells as described in steps 49-56. - (ii) Collect the cells in a 15 ml falcon tube and centrifuge at 300g for 5 minutes. - (iii) Resuspend the cells in 1 ml of flow cytometry buffer and count using a haemocytometer. - (iv) Wash the cells 3 times by resuspending in 4 ml of flow cytometry buffer and centrifuging at 300g for 5 minutes after each wash. - (v) For cell surface staining, stain cells with antibodies for 1 h at 4°C. - (vi) When using unconjugated primary antibodies, wash cells twice in 4 ml of flow cytometry buffer, centrifuging at 300g for 5 minutes after each wash. - (vii) Add secondary fluorochrome-conjugated antibody and incubate for 30 min at 4°C. - (viii) Wash the cells 3 times by resuspending in 4 ml of flow cytometry buffer and centrifuging at 300g for 5 minutes after each wash. (B) Flow cytometry for nuclear markers: OCT4A, SOX2, C-MYC, NANOG - TIMING 3 hours - (i) Detach the cells as described in steps 49-56. - (ii) Collect the cells in a 15 ml falcon tube and centrifuge at 300g for 5 minutes. - (iii) Resuspend the cells in 1 ml of flow cytometry buffer and count using a haemocytometer. - (iv) Wash the cells 3 times by resuspending in 4 ml of flow cytometry buffer and centrifuging at 300g for 5 minutes after each wash. - (v) Fix cells in 2 ml of 0.01% PFA for 10 minutes at room temperature - (vi) Wash twice with 4 ml of DPBS, centrifuging at 300g for 5 minutes after each wash - (vii) Resuspend the cells in DPBS with 1% (vol/vol) Triton and centrifuge at 300g for 5 minutes - (viii) Stain cells with antibodies for 1 h at 4°C. - (ix) When using unconjugated primary antibodies, wash cells twice in 4 ml of flow cytometry buffer, centrifuging at 300g for 5 minutes after each wash. - (x) Add secondary fluorochrome-conjugated antibody and incubate for 30 min at 4°C. - (xi) Wash the cells 3 times by resuspending in 4 ml of flow cytometry buffer and centrifuging at 300g for 5 minutes after each wash. (C) EB formation - TIMING ∼ 25 days - (i) Detach the cells from 5-6 confluent wells of a six-well plate as described in steps 49-55. - (ii) Scrape the cells using an 18 cm cell scraper, taking care to detach the cells in small clumps. CRITICAL STEP Do not overdo it to avoid breaking up clumps of cells too much into single cells. Check under the microscope after scraping to ensure all cells have detached from surface of the well. - (iii) Plate the cells in a 100mm square low-attachment petri dish in 15 ml of EB differentiation medium, using a 5 ml plastic disposable pipette to transfer the cell solution. - (iv) To change medium twice per week transfer cells to a 50 ml falcon tube and centrifuge at 300g for 5 minutes. - (v) Carefully remove supernatant without disturbing the cell pellet, and resuspend pellet in 5 ml of EB differentiation medium using a 5 ml plastic disposable pipette - (vi) Transfer cell solution to a new low-attachment petri dish, and add 10 ml of EB differentiation medium. - (vii) Allow the cells to develop into 15 day old EBs. - (viii) Transfer EBs suspensions to gelatin-coated plates for another 7-10 days before fixation in 4% PFA and immunostaining for markers representative of the three embryonic germ layers, i.e. NESTIN and PAX6 (ectoderm), BMP4 (primitive endoderm), CK3, CK19 (endoderm), GATA6 (mesoderm), or SYCP1 (testis), with concomitant down-regulation of OCT4A. **!CAUTION** PFA is a toxic material. Avoid inhalation, ingestion and skin contact. (D) Immunofluorescence - TIMING 3 days - (i) Fix cells on coverslips in 1 ml of 4% PFA in 125 mM HEPES (pH 7.6) per well for 10 minutes at 4°C. **!CAUTION** PFA is a toxic material. Avoid inhalation, ingestion and skin contact. - (ii) Remove 4% PFA and replace by 1 ml of 8% PFA in the same buffer for 50 minutes at 4°C. - (iii) Remove 8% PFA and wash cells twice with 2 ml DPBS per well. - (iv) Transfer coverslips into a 24-well plate (1 coverslip per well). - (v) Permeabilize cells in 1 ml of 0.5% Triton in DPBS for 30 min at room temperature. - (vi) Remove Triton solution and wash cells 6 times with DPBS. - (vii) Incubate cells with 1 ml 20mM glycine in DPBS for 30 minutes at room temperature. - (viii) Remove glycine solution and wash cells 3 times with DPBS. - (ix) Incubate cells with 1 ml of immunofluorescence blocking solution for 1 hour at room temperature. - (x) Incubate cells with primary antibodies diluted in immunofluorescence blocking solution for 2 hours at room temperature. - (xi) Wash cells every 20 minutes with 1 ml of immunofluorescence blocking solution for a total of 5 times. - (xii) Incubate the cells with secondary antibodies diluted in immunofluorescence blocking solution for 2 hours at room temperature. - (xiii) Wash the cells in 1 ml of immunofluorescence blocking solution overnight at 4°C. - (xiv) Wash the cells 3 times with 1 ml DPBS - (xv) Mount the coverslips using 1 drop of VectaShield containing DAPI (E) Quantitative real time PCR - TIMING ∼ 8 hours - (i) Detach the cells as described in steps 49-56. - (ii) Collect the cells in a 15 ml falcon tube and centrifuge at 300g for 5 minutes. - (iii) Remove the supernatant and extract RNA from the pellet using the RNeasy minikit according to manufacturer’s instructions. - (iv) Synthesise cDNA using the Reverse transcription system kit, according to manufacturer’s instructions. - (v) Prepare one mastermix per gene of interest containing SYBR green PCR mastermix, custom oligonucleotide pairs and water, and aliquot into each well of a MicroAmp fast 96-well reaction plate, running each gene in triplicate for each sample. - (vi) Add cDNA (10-20 ng) to each well, mixing the cDNA into the mastermix. (F) Teratoma formation assay - TIMING ∼ 13 weeks - (i) Detach 2×10e6 cells as described in steps 49-56. - (ii) Collect the cells in a 15 ml falcon tube and centrifuge at 300g for 5 minutes. - (iii) Remove the supernatant and resuspend the cells in 30% (vol/vol) Matrigel on ice. - (iv) Inject the cells subcutaneously into the dorsal flank of 8-12 week old common γ chain -/-, RAG2-/-,C5-/- immunodeficient mice without preconditioning. - (v) Observe mice for the growth of solid tumours up to 12 weeks or up to 10mm3 tumour volume. - (vi) Dissect the formed teratomas, and proceed with histopathological and immunohistochemical analysis to confirm the presence of cell and tissue derivatives from all three embryonic germ layers. (G) *In vitro* differentiation protocols **Hepatic differentiation - TIMING ∼ 25 days** - (i) Detach 2×10e6 cells as described in steps 49-56. - (ii) Collect the cells in a 15 ml falcon tube and centrifuge at 300g for 5 minutes. - (iii) Seed cells at a concentration of 5000 cells/cm2 on tissue culture plastic plates and coverslips coated with Matrigel in 3 ml isolation medium per well. - (iv) 3 days later, remove the isolation medium and wash each well carefully with 2 ml DPBS. - (v) Add 3 ml of pre-warmed hepatic differentiation medium per well. - (vi) Replace the medium every 3 days for 21 days in total. Collect the supernatant after each change and store at -80°C for analysis of urea secretion. - (vii) After 21 days, fix the cells with 4% (vol/vol) PFA and proceed with immunofluorescence analysis for the expression of Alpha Fetoprotein (AFP) and ALBUMIN. **!CAUTION** PFA is a toxic material. Avoid inhalation, ingestion and skin contact. - (viii) Measure urea in the supernatant using the Urea/Ammonia determination kit according to the manufacturer’s instructions. **Ectoderm differentiation - TIMING ∼ 25 days** - (i) Detach 2×10e6 cells as described in steps 49-56. - (ii) Collect the cells in a 15 ml falcon tube and centrifuge at 300g for 5 minutes. - (iii) Seed cells at a concentration of 3000 cells/cm2 on tissue culture plastic plates and coverslips coated with Matrigel in 3 ml of pre-warmed ectoderm differentiation medium. - (iv) Replace the medium every 3 days for 21 days in total. - (v) After 21 days, fix the cells with 4% (vol/vol) PFA and proceed with immunofluorescence analysis for the expression of NESTIN and VIMENTIN. **!CAUTION** PFA is a toxic material. Avoid inhalation, ingestion and skin contact. **Neuronal differentiation - TIMING 9 days** - (i) Detach 2×10e6 cells as described in steps 49-56. - (ii) Collect the cells in a 15 ml falcon tube and centrifuge at 300g for 5 minutes. - (iii) Seed cells at a concentration of 5000 cells/cm2 on tissue culture plastic plates and coverslips coated with Matrigel in 3 ml of isolation medium for 1 day. - (iv) Remove the isolation medium from the wells and wash with 2 ml of DPBS. - (v) Replace with 3 ml of pre-warmed, freshly made neuronal differentiation medium per well. - (vi) Add one co-culture membrane insert per well, and plate C17.2 mouse neural progenitor cells at a concentration of 10,000 cells/ cm2 into the insert. - (vii) Allow the cells to differentiate for 5 days without changing the medium. - (viii) After 5 days, fix the cells with 4 % (vol/vol) PFA and proceed with immunofluorescence analysis for the expression of the neuronal markers β-TUBULIN and MAP2 and for the NMDA receptor NR1. **!CAUTION** PFA is a toxic material. Avoid inhalation, ingestion and skin contact. **Oligodendrocyte differentiation - TIMING 9 days** - (i) Detach 2×10e6 cells as described in steps 49-56. - (ii) Collect the cells in a 15 ml falcon tube and centrifuge at 300g for 5 minutes. - (iii) Seed cells at a concentration of 5000 cells/cm2 on tissue culture plastic plates and coverslips coated with Matrigel in 3 ml of oligodendrocyte differentiation medium for 1 day. - (iv) The following day add one co-culture membrane insert per well, and plate CG4 rat oligodendrocyte progenitor cells at a concentration of 10,000 cells/ cm2 into the insert. - (v) Replace the medium every 2 days with 3 ml of pre-warmed oligodendrocyte differentiation medium per well, for 5 days in total. - (vi) After 5 days, fix the cells with 4% (vol/vol) PFA and proceed with immunofluorescence analysis for the expression of the oligodendrocyte markers O2 and NG2. **!CAUTION** PFA is a toxic material. Avoid inhalation, ingestion and skin contact. ### Timing - Steps 1-3, isolation of AFSC from human amniotic fluid: 10 minutes - Steps 4-17, expansion of AFSC: ∼ 2 weeks - Steps 18-39, isolation of c-KIT+ cells: 1 h - Steps 40-59, adaptation of cells to medium sustaining pluripotency: ∼ 2 weeks - Steps 60-63, derivation of pluripotent cells: ∼ 5-14 days - Steps 64-66, stabilization of pluripotent lines: ∼ 3 weeks - Step 67 A-G, characterisation of pluripotent lines: maximum 13 weeks ### Troubleshooting Troubleshooting advice can be found in [Table 1.doc](http://www.nature.com/protocolexchange/system/uploads/2191/original/TABLE_1.doc?1340882089). ### Anticipated Results **Parental population** - **Expansion**: AFSC should be plastic adherence and not form colonies but grow as a single layer of single cells. - **Morphology and cell size**: the cells should present a fibroblastic morphology with a spindle-shaped cytoplasm. Cell size should be assessed on light microscopy images of trypsinised cells in an haemocytometer using Image J. - **Immunophenotype**: the culture should not contain hematopoietic cells, as seen by the absence of staining for CD14, CD34, and CD45, and show low/null levels of HLAI and HLAII. In addition, they should express the mesenchymal markers CD73, CD44, CD105, CD29, fibronectin, laminin and CD90. Positive control should be human adult bone marrow MSC and negative controls should be human ES cells. - **Stem cell identity**: Expression of OCT4A variant 1, REX1 and hTERT should be performed by RT-PCR and show expression of OCT4A but not REX1 or hTERT. Levels of expression of other pluripotency markers, i.e. NANOG, SOX2, c-MYC, KLF4, should be performed using quantitative real time RT-PCR. Positive control should be human ES cells and negative controls human adult bone marrow MSC and results should show either absence of expression of levels considerably lower than those found in ES cells. At the protein level, heterogeneity of the population should be analysed by flow cytometry (OCT4, NANOG, SOX2, c-MYC, SSEA3, SSEA4, TRA-1-60, TRA-1-81 and CD24) and confocal immunostaining (OCT4, NANOG, SOX2, c-MYC, KLF4, SSEA3, SSEA4, TRA-1-60, TRA-1-81 and CD24). Positive controls should be human ES cells and negative controls should be istotype controls and human adult bone marrow MSC. Results should show that the cell population my contain a subset of cells positive for OCT4, but should be mostly negative for the other markers, with the exception of SSEA4. Measure of alkaline phosphatase staining should be negative. - **Whole genome transcriptome identity**: to complement the analysis of stem cell identity, the whole genome transcriptome should be investigated using the Affimetrix platform to complement the analysis of the stem cell identity in the parental population. - **Kinetics**: the kinetics of the population should be assessed to determine doubling time and senescence using growth rate analysis and cumulative population doubling over 60 days. These values will be the reference from which the increase in kinetics will be estimated in reprogrammed cells. - **Differentiation potential**: the plasticity of the cells should be investigated using the embryoid body assay and by testing the capacity of the cells to form teratomas after transplantation into immunodeficient mice. The cells should not be able to form either embryoid bodies in vitro or teratomas in vivo and not express markers of the three germ lineages. **Reprogrammed cells** - **Expansion**: The cells should now form colonies the cell morphology should change. - **Morphology and cell size**: the morphology of the cells should change, with cells becoming cuboidal and smaller in size compared to the parental population. - **Immunophenotype**: expression of the mesenchymal markers CD73, CD44, and CD105 should be down-regulated. - **Stem cell identity**: Cells should now express OCT4A variant 1, REX1 and hTERT. Levels of expression of other pluripotency markers, i.e. NANOG, SOX2, c-MYC, KLF4, should be up-regulated with levels in the range of those found in ES cells. At the protein level, the population should be positive for OCT4, NANOG, SOX2, c-MYC, KLF4, SSEA3, SSEA4, TRA-1-60, TRA-1-81 and CD24 and show homogeneity of expression for these markers. Measure of alkaline phosphatase staining should be positive. - **Whole genome transcriptome identity**: whole genome transcriptome analysis should show &gt;80% identity with ES cells, with the pool of genes common for the two cell types including genes involved in the maintenance of pluripotency. - **Kinetics**: the kinetics of the population should be significantly increased and the cells expanded long term without showing signs of senescence. - **X inactivation status**: the reactivation of X inactivation should be investigated and show downregulation of the Xist gene. - **Differentiation potential**: the cells should now form embryoid bodies and teratomas containing cells expressing markers of the three germ layers. The capacity of the cells to differentiate into functional endodermal, mesodermal and ectodermal lineages should be confirmed. Examples include definitive endoderm, hepatocytes, neurons and oligodendrocytes. ### References 1. Mukherjee, S. &amp; Thrasher, A. iPSCs: Unstable Origins? . *Mol Ther* 19, 1188-90 (2011). - Ryan, J. M., Pettit, A. R., Guillot, P. V., Chan, J. K. &amp; Fisk, N. M. Unravelling the Pluripotency Paradox in Fetal and Placental Mesenchymal Stem Cells: Oct-4 Expression and the Case of the Emperor’s New Clothes. *Stem Cell Rev*. Epub (2011). - Stadtfield, M. &amp; Hochedlinger, K. Induced pluripotency: history, mechanisms, and applications. *Genes and Development* 24, 2239-63 (2010). - Takahashi, K. &amp; Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. *Cell* 126, 663-76 (2006). - Di Stefano, B., Prigione, A. &amp; Broccoli, V. Efficient Genetic Reprogramming of Unmodified Somatic Neural Progenitors Uncovers the Essential Requirement of Oct4 and Klf4. *Stem Cell Dev* 18, 707-15 (2009). - Kim, D. e. a. Generation of human induced pluripotent stem cells by direct delivery of reprogramming proteins. *Cell Stem Cell*, 472-6 (2009). - Kim, J. B. e. a. Oct4-induced pluripotency in adult neural stem cells. *Cell* 136, 411-9 (2009). - Matsui, Y., Zsebo, K. &amp; Hogan, B. L. Derivation of pluripotential embryonic stem cells from murine primordial germ cells in culture. Cell 70, 841-7 (1992). - Sterneckert, J., Hoing, S. &amp; Scholer, H. R. Oct4 and more: the reprogramming expressway. *Stem Cells* Epub ahead of print (2011). - Zhou, H. e. a. Conversion of Mouse Epiblast Stem Cells to an Earlier Pluripotency State by Small Molecules. *The Journal of Biological Chemistry* 285, 29676-80 (2010). - Moschidou, D. et al. Valproic acid confers functional pluripotency to human amniotic fluid stem cells in a transgene-free approach. *Molecular Therapy* Epub (2012). - Taylor, C. T. e. a. Banking on human embryonic stem cells: estimating the number of donor cell lines needed for HLA matching. *Lancet* 366, 2019-25 (2005). - Leeman, B. A. &amp; Cole, A. J. Advancements in the treatment of epilepsy. *Ann Rev Med* 503-23 (2008). - Huangfu, D. et al. Induction of pluripotent stem cells from primary human fibroblasts with only Oct4 and Sox2. *Nat Biotechnol* 26, 1269-75 (2008). - Li, C. et al. Pluripotency can be rapidly and efficiently induced in human amniotic fluid-derived cells. *Hum Mol Genet* 18, 4340-9 (2009). - Fusaki, N., Ban, H., Nishiyama, A., Saeki, K. &amp; Hasegawa, M. Efficient induction of transgene-free human pluripotent stem cells using a vector based on Sendai virus, an RNA virus that does not integrate into the host genome. *Proc Jpn Acad Ser B Phys Biol Sci*. 85, 348-62 (2009). - Hu, K. e. a. Efficient generation of transgene-free induced pluripotent stem cells from normal and neoplastic bone marrow and cord blood mononuclear cells. *Blood*, e109-19 (2011). - Narsinh, K. H., Robbins, R. C., Kay, M. A., Longaker, M. T. &amp; Wu, J. C. Generation of adult human induced pluripotent stem cells using nonviral minicircle DNA vectors. *Nat Protoc* 6, 78-88 (2011). - Okita, K. e. a. A more efficient method to generate integration-free human iPS cells. *Nat Methods* 409-12 (2011). - Kaji, K. e. a. Virus-free induction of pluripotency and subsequent excision of reprogramming factors. *Nature*, 771-75 (2009). - Warren, L. e. a. Highly efficient reprogramming to pluripotency and directed differentiation of human cells with synthetic modified mRNA. *Cell Stem Cell*, 618-30 (2010). ### Figures **Table 1: Troubleshooting table** [Download Table 1](http://www.nature.com/protocolexchange/system/uploads/2191/original/TABLE_1.doc?1340882089) **Figure 1: Cell morphology of reprogrammed cells**.  *Figure 1| light microscopy images of human amniotic fluid stem cells cultured in isolation medium (A) and in reprogramming medium (B). Magnification x200*. ### Associated Publications **Valproic Acid Confers Functional Pluripotency to Human Amniotic Fluid Stem Cells in a Transgene-free Approach**. Dafni Moschidou, Sayandip Mukherjee, Michael P Blundell, Katharina Drews, Gemma N Jones, Hassan Abdulrazzak, Beata Nowakowska, Anju Phoolchund, Kenneth Lay, T Selvee Ramasamy, Mara Cananzi, Daniel Nettersheim, Mark Sullivan, Jennifer Frost, Gudrun Moore, Joris R Vermeesch, Nicholas M Fisk, Adrian J Thrasher, Anthony Atala, James Adjaye, Hubert Schorle, Paolo De Coppi, and Pascale V Guillot. *Molecular Therapy* 03/07/2012 [doi:10.1038/mt.2012.117 ](http://dx.doi.org/10.1038/mt.2012.117) ### Author information **Dafni Moschidou &amp; Pascale V Guillot**, Guillot PV Lab Correspondence to: Pascale V Guillot (dafni.moschidou04@imperial.ac.uk) *Source: [Protocol Exchange](http://www.nature.com/protocolexchange/protocols/2426) (2012) doi:10.1038/protex.2012.032. Originally published online 6 July 2012*.