To see the other types of publications on this topic, follow the link: Searching primes.

Journal articles on the topic 'Searching primes'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic 'Searching primes.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Müller, Tom. "Searching for Large Elite Primes." Experimental Mathematics 15, no. 2 (January 2006): 183–86. http://dx.doi.org/10.1080/10586458.2006.10128955.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Byatt, D., M. L. Dalrymple, and R. M. Turner. "Searching for primes in the digits of π." Computers & Mathematics with Applications 48, no. 3-4 (August 2004): 497–504. http://dx.doi.org/10.1016/j.camwa.2003.12.007.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Chermidov, Sergey Ivanovich. "PRIME NUMBER LAW. DEPENDENCE OF PRIME NUMBERS ON THEIR ORDINAL NUMBERS AND GOLDBACH – EULER BINARY PROBLEM USING COMPUTER." Vestnik of Astrakhan State Technical University. Series: Management, computer science and informatics 2020, no. 4 (October 31, 2020): 80–100. http://dx.doi.org/10.24143/2072-9502-2020-4-80-100.

Full text
Abstract:
The article considers the methods of defining and finding the distribution of composite numbers CN, prime numbers PN, twins of prime numbers Tw and twins of composite numbers TwCN that do not have divisors 2 and 3 in the set of natural numbers - ℕ based on a set of numbers like Θ = {6∙κ ± 1, κ ∈ ℕ}, which is a semigroup in relation to multiplication. There has been proposed a method of obtaining primes by using their ordinal numbers in the set of primes and vice versa, as well as a new algorithm for searching and distributing primes based on a closedness of the elements of the set Θ. It has been shown that a composite number can be presented in the form of products (6x ± 1) (6y ± 1), where x, y ℕ - are positive integer solutions of one of the 4 Diophantine equations: . It has been proved that if there is a parameter λ of prime twins, then none of Diophantine equations P (x, y, λ) = 0 has positive integer solutions. There has been found the new distribution law of prime numbers π(x) in the segment [1 ÷ N]. Any even number is comparable to one of the numbers i.e. . According to the above remainders m, even numbers are divided into 3 types, each type having its own way of representing sums of 2 elements of the set Θ. For any even number in a segment [1 ÷ ν], where ν = (ζ−m) / 6, , there is a parameter of an even number; it is proved that there is always a pair of numbers that are elements of the united sets of parameters of prime twins and parameters of transition numbers , i.e. numbers of the form with the same λ, if the form is a prime number, then the form is a composite number, and vice versa.
APA, Harvard, Vancouver, ISO, and other styles
4

Wu, Rachel, Gaia Scerif, Richard N. Aslin, Tim J. Smith, Rebecca Nako, and Martin Eimer. "Searching for Something Familiar or Novel: Top–Down Attentional Selection of Specific Items or Object Categories." Journal of Cognitive Neuroscience 25, no. 5 (May 2013): 719–29. http://dx.doi.org/10.1162/jocn_a_00352.

Full text
Abstract:
Visual search is often guided by top–down attentional templates that specify target-defining features. But search can also occur at the level of object categories. We measured the N2pc component, a marker of attentional target selection, in two visual search experiments where targets were defined either categorically (e.g., any letter) or at the item level (e.g., the letter C) by a prime stimulus. In both experiments, an N2pc was elicited during category search, in both familiar and novel contexts (Experiment 1) and with symbolic primes (Experiment 2), indicating that, even when targets are only defined at the category level, they are selected at early sensory-perceptual stages. However, the N2pc emerged earlier and was larger during item-based search compared with category-based search, demonstrating the superiority of attentional guidance by item-specific templates. We discuss the implications of these findings for attentional control and category learning.
APA, Harvard, Vancouver, ISO, and other styles
5

du Sautoy, Marcus, and Jonathan P. Keating. "The Music of the Primes: Searching to Solve the Greatest Mystery in Mathematics The Music of the Primes: Searching to Solve the Greatest Mystery in Mathematics Marcus du Sautoy HarperCollins, New York, 2003. $24.95 (352pp.). ISBN 0-06-621070-4." Physics Today 57, no. 6 (June 2004): 63. http://dx.doi.org/10.1063/1.1784279.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Nesbø, Camilla L., Rajkumari Kumaraswamy, Marlena Dlutek, W. Ford Doolittle, and Julia Foght. "Searching for Mesophilic Thermotogales Bacteria: “Mesotogas” in the Wild." Applied and Environmental Microbiology 76, no. 14 (May 21, 2010): 4896–900. http://dx.doi.org/10.1128/aem.02846-09.

Full text
Abstract:
ABSTRACT All cultivated Thermotogales are thermophiles or hyperthermophiles. However, optimized 16S rRNA primers successfully amplified Thermotogales sequences from temperate hydrocarbon-impacted sites, mesothermic oil reservoirs, and enrichment cultures incubated at <46°C. We conclude that distinct Thermotogales lineages commonly inhabit low-temperature environments but may be underreported, likely due to “universal” 16S rRNA gene primer bias.
APA, Harvard, Vancouver, ISO, and other styles
7

Schrimsher, Robert H., and Michael G. Kendrach. "A Primer: Basic PubMed Searching for Pharmacists." Hospital Pharmacy 41, no. 9 (September 2006): 855–67. http://dx.doi.org/10.1310/hpj4109-855.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Janssen, Maarten C. W., and T. Tony Ke. "Searching for Service." American Economic Journal: Microeconomics 12, no. 1 (February 1, 2020): 188–219. http://dx.doi.org/10.1257/mic.20180315.

Full text
Abstract:
Since Telser (1960), there is a well-established argument that a competitive market will not provide service due to freeriding. We show that with search frictions, the market may well provide service if the cost of doing so is not too large. Any market equilibrium with service provision has two or more firms providing service, implying overprovision of service as the social optimum mandates at most one service provider. Firms that provide service and those that do not can coexist, where consumers direct their search to service providers first to obtain service, and to nonservice providers later to enjoy lower prices. (JEL D11, D21, D83, L42, L81)
APA, Harvard, Vancouver, ISO, and other styles
9

MCCANNON, BRYAN C. "CONSUMER MISTAKES IN BERTRAND GAMES." International Game Theory Review 11, no. 01 (March 2009): 41–51. http://dx.doi.org/10.1142/s0219198909002133.

Full text
Abstract:
The identical agent, identical good Bertrand game is associated with prices at marginal cost — the Bertrand Paradox. If consumers make occasional mistakes I show that the standard Bertrand game gives rise to positive profits and prices above marginal cost. Some firms charge low prices to capture the bulk of the sales while others charge high prices selling to mistaken consumers. Furthermore, with free entry the Diamond Paradox arises; a full measure of the firms choose the monopoly price. As a result, the Diamond Paradox arises in an environment with zero search costs by replacing searching costs with searching errors.
APA, Harvard, Vancouver, ISO, and other styles
10

BINKLEY, JAMES. "Prices Paid in Grocery Markets: Searching Across Stores and Brands." Journal of Consumer Affairs 47, no. 3 (October 4, 2013): 465–84. http://dx.doi.org/10.1111/joca.12016.

Full text
APA, Harvard, Vancouver, ISO, and other styles
11

Zubrow, Marcia Singal. "Researching U.S. Federal Law: a Primer." Legal Information Management 20, no. 3 (September 2020): 158–75. http://dx.doi.org/10.1017/s1472669620000389.

Full text
Abstract:
AbstractThis article is designed for law librarians based outside the United States. The paper, written by Marcia Zubrow, provides basic information about the United States legal system and its sources. This background foundation to the article is important in understanding how to effectively use the two major U.S. databases, Lexis and Westlaw. The author describes the contents of the two databases within the context of the background information. Search techniques, including advance searching strategies, are described.
APA, Harvard, Vancouver, ISO, and other styles
12

Barnhart, David K. "Prizes and Pitfalls of Computerized Searching for New Words for Dictionaries." Dictionaries: Journal of the Dictionary Society of North America 7, no. 1 (1985): 253–60. http://dx.doi.org/10.1353/dic.1985.0030.

Full text
APA, Harvard, Vancouver, ISO, and other styles
13

Guo, Jiarong, James R. Cole, Qingpeng Zhang, C. Titus Brown, and James M. Tiedje. "Microbial Community Analysis with Ribosomal Gene Fragments from Shotgun Metagenomes." Applied and Environmental Microbiology 82, no. 1 (October 16, 2015): 157–66. http://dx.doi.org/10.1128/aem.02772-15.

Full text
Abstract:
ABSTRACTShotgun metagenomic sequencing does not depend on gene-targeted primers or PCR amplification; thus, it is not affected by primer bias or chimeras. However, searching rRNA genes from large shotgun Illumina data sets is computationally expensive, and no approach exists for unsupervised community analysis of small-subunit (SSU) rRNA gene fragments retrieved from shotgun data. We present a pipeline, SSUsearch, to achieve the faster identification of short-subunit rRNA gene fragments and enabled unsupervised community analysis with shotgun data. It also includes classification and copy number correction, and the output can be used by traditional amplicon analysis platforms. Shotgun metagenome data using this pipeline yielded higher diversity estimates than amplicon data but retained the grouping of samples in ordination analyses. We applied this pipeline to soil samples with paired shotgun and amplicon data and confirmed bias againstVerrucomicrobiain a commonly used V6-V8 primer set, as well as discovering likely bias againstActinobacteriaand forVerrucomicrobiain a commonly used V4 primer set. This pipeline can utilize all variable regions in SSU rRNA and also can be applied to large-subunit (LSU) rRNA genes for confirmation of community structure. The pipeline can scale to handle large amounts of soil metagenomic data (5 Gb memory and 5 central processing unit hours to process 38 Gb [1 lane] of trimmed Illumina HiSeq2500 data) and is freely available athttps://github.com/dib-lab/SSUsearchunder a BSD license.
APA, Harvard, Vancouver, ISO, and other styles
14

Alsamman, Alsamman M., Shafik D. Ibrahim, and Aladdin Hamwieh. "KASPspoon: an in vitro and in silico PCR analysis tool for high-throughput SNP genotyping." Bioinformatics 35, no. 17 (January 8, 2019): 3187–90. http://dx.doi.org/10.1093/bioinformatics/btz004.

Full text
Abstract:
Abstract Motivation Fine mapping becomes a routine trial following quantitative trait loci (QTL) mapping studies to shrink the size of genomic segments underlying causal variants. The availability of whole genome sequences can facilitate the development of high marker density and predict gene content in genomic segments of interest. Correlations between genetic and physical positions of these loci require handling of different experimental genetic data types, and ultimately converting them into positioning markers using a routine and efficient tool. Results To convert classical QTL markers into KASP assay primers, KASPspoon simulates a PCR by running an approximate-match searching analysis on user-entered primer pairs against the provided sequences, and then comparing in vitro and in silico PCR results. KASPspoon reports amplimers close to or adjoining genes/SNPs/simple sequence repeats and those that are shared between in vitro and in silico PCR results to select the most appropriate amplimers for gene discovery. KASPspoon compares physical and genetic maps, and reports the primer set genome coverage for PCR-walking. KASPspoon could be used to design KASP assay primers to convert QTL acquired by classical molecular markers into high-throughput genotyping assays and to provide major SNP resource for the dissection of genotypic and phenotypic variation. In addition to human-readable output files, KASPspoon creates Circos configurations that illustrate different in silico and in vitro results. Availability and implementation Code available under GNU GPL at (http://www.ageri.sci.eg/index.php/facilities-services/ageri-softwares/kaspspoon). Supplementary information Supplementary data are available at Bioinformatics online.
APA, Harvard, Vancouver, ISO, and other styles
15

Zhang, Dalei, and Hong Zhong. "A Novel Method of Searching Primitive Roots Modulo Fermat Prime Numbers." International Journal of Security and Its Applications 10, no. 3 (March 31, 2016): 439–48. http://dx.doi.org/10.14257/ijsia.2016.10.3.38.

Full text
APA, Harvard, Vancouver, ISO, and other styles
16

Kanakdande, Amruta P., Chandrahasya N. Khobragade, and Rajaram S. Mane. "Utilization of pomegranate waste-peel as a novel substrate for biodiesel production by Bacillus cereus (MF908505)." Sustainable Energy & Fuels 4, no. 3 (2020): 1199–207. http://dx.doi.org/10.1039/c9se00584f.

Full text
APA, Harvard, Vancouver, ISO, and other styles
17

Guo, Chenxi, Xinhong Hao, and Ping Li. "An Improved Trilinear Model-Based Angle Estimation Method for Co-Prime Planar Arrays." Sensors 18, no. 12 (November 28, 2018): 4180. http://dx.doi.org/10.3390/s18124180.

Full text
Abstract:
Angle estimation methods in two-dimensional co-prime planar arrays have been discussed mainly based on peak searching and sparse recovery. Peak searching methods suffer from heavy computational complexity and sparse recovery methods face some problems in selecting the regularization parameters. In this paper, we propose an improved trilinear model-based method for angle estimation for co-prime planar arrays in the view of trilinear decomposition, namely parallel factor analysis. Due to the principle of trilinear decomposition, our method does not require peak searching and can conduct auto-pairing easily, which can reduce the computational loads and avoid parameter selection problems. Furthermore, we exploit the virtual array concept of the whole co-prime planar array through the cross-correlation matrix obtained from the received signal data and present a matrix reconstruction method using the Khatri–Rao product to tackle the matrix rank deficiency problem in the virtual array condition. The simulation results show that our proposed method can not only achieve high estimation accuracy with low complexity compared to other similar approaches, but also utilize limited sensor number to implement the angle estimation tasks.
APA, Harvard, Vancouver, ISO, and other styles
18

Sari, Rafika, and Pratiwi Apridamayanti. "Detection of Antibiotic-Resistant Gene from Isolates of Diabetic Ulcer Patients." International Journal of Engineering and Applied Science Research 1, no. 1 (July 30, 2020): 1. http://dx.doi.org/10.26418/ijeasr.v1i1.40988.

Full text
Abstract:
Antibiotic resistance can be caused by the presence of several genes encoding antibiotic resistance found in certain bacteria. S. aureus bacteria contained blaZ (97.4%), mecA (42.3%) and tetM genes (20.2%). Bacillus sp. contained blm (87.2%), tetL (44%) and tetB genes (2.9%). E. coli bacteria contained tem (80.9%)dan shv genes (14.28%). Clostridium spp. Bacteria contained cat gene (36%), as well as S. pyogens contained ermT (36.5%). Specific primers made in silico based on bioinformatics were then analyzed by PCR (Polymerase Chain Reaction) and electrophoresis. The purpose of this study was to detect the presence of blaZ, mecA, tetM, blM, tetL, tetB, tem, shv, cat, and ermT genes. The research began by searching for the nucleotide sequences for the ermT, cat, tetB, and blaZ genes through the Primer 3Plus program and analyzed using OligoAnalyzer 3.1. In vitro detection was carried out by extracting DNA and then amplification using PCR, and analyzed by agarose gel electrophoresis. The results of the analysis of the primer criteria for the ermT gene and the blaZ gene at the optimum Tm 55 C, cat gene and the tetB gene at the optimum Tm 60 C have met all the primer criteria. The results obtained are mecA gene (533 bp), tetM gene (366 bp), blm gene (1107 bp), tetL gene (267 bp), tetB gene (186 bp), tem gene (1073 bp), cat gene (164 bp), the ermT gene (202 bp) has been detected successfully, while blaZ and shv have not been detected successfully.
APA, Harvard, Vancouver, ISO, and other styles
19

Lopes Lourenço, Pedro Miguel, Tânia Almeida, Diogo Mendonça, Fernanda Simões, and Carlos Novo. "Searching for nitrile hydratase using the Consensus-Degenerate Hybrid Oligonucleotide Primers strategy." Journal of Basic Microbiology 44, no. 3 (June 2004): 203–14. http://dx.doi.org/10.1002/jobm.200310340.

Full text
APA, Harvard, Vancouver, ISO, and other styles
20

Özyurt, Selçuk. "Searching for a Bargain: Power of Strategic Commitment." American Economic Journal: Microeconomics 7, no. 1 (February 1, 2015): 320–53. http://dx.doi.org/10.1257/mic.20130027.

Full text
Abstract:
This paper shows that in a multilateral bargaining setting where the sellers compete á la Bertrand, a range of prices that includes the monopoly price and 0 are compatible with equilibrium, even in the limit where the reputational concerns and frictions vanish. In particular, the incentive of committing to a specific demand, the opportunity of building reputation about inflexibility, and the anxiety of preserving their reputation can tilt players' bargaining power in such a way that being deemed as a tough bargainer is bad for the competing players, and thus, price undercutting is not optimal for the sellers. (JEL C78, D43, D83)
APA, Harvard, Vancouver, ISO, and other styles
21

Dušková, M., A. Španová, V. Dráb, and B. Rittich. "Searching for Genes of Lactococcus lactis subsp. lactis Encoding the Bacteriocin Nisin using DNA/DNA Hybridisation." Czech Journal of Food Sciences 27, Special Issue 1 (June 24, 2009): S366—S368. http://dx.doi.org/10.17221/603-cjfs.

Full text
Abstract:
In this work, PCR primers P8 and P9 were used for amplification of a 320 bp long PCR product specific to the nisin gene. The PCR product was labelled with digoxigenine during amplification and used as a DNA probe for the screening of homologous DNA sequences in 7 <I>Lactococcus lactis</I> subsp.<I> lactis</I> strains from the Culture Collection of Dairy Microorganisms (CCDM). Dot blot hybridisation and hybridisation of colonies were used for DNA/DNA hybridisation. It was shown that 6 tested strains of <I>Lactococcus lactis </I>subsp. <I>lactis </I>have genes encoding nisin. One strain had probably a defective gene encoding nisin.
APA, Harvard, Vancouver, ISO, and other styles
22

Kmieciak, Wioletta, Eligia M. Szewczyk, and Marcin Ciszewski. "Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers." Current Microbiology 73, no. 1 (April 16, 2016): 148–52. http://dx.doi.org/10.1007/s00284-016-1038-4.

Full text
APA, Harvard, Vancouver, ISO, and other styles
23

Lin, Qianyu, Xiang Ji, Feng Wu, and Lan Ma. "Conserved Sequence Analysis of Influenza A Virus HA Segment and Its Application in Rapid Typing." Diagnostics 11, no. 8 (July 23, 2021): 1328. http://dx.doi.org/10.3390/diagnostics11081328.

Full text
Abstract:
The high mutation rate of the influenza A virus hemagglutinin segment poses great challenges to its long-term effective testing and subtyping. Our conserved sequence searching method achieves high-specificity conserved sequences on H1–H9 subtypes. In addition, PCR experiments show that primers based on conserved sequences can be used in influenza A virus HA subtyping. Conserved sequence-based primers are expected to be long-term, effective subtyping tools for influenza A virus HA.
APA, Harvard, Vancouver, ISO, and other styles
24

Pandey, Amit, Berhane Wolde-Gabriel, and Elias Jarso. "Prime Box Parallel Search Algorithm: Searching Dynamic Dictionary in O(lg m) Time." Journal of Computer and Communications 04, no. 04 (2016): 134–45. http://dx.doi.org/10.4236/jcc.2016.44012.

Full text
APA, Harvard, Vancouver, ISO, and other styles
25

Yoshimoto, Atsushi, and Isao Shoji. "Searching for an optimal rotation age for forest stand management under stochastic log prices." European Journal of Operational Research 105, no. 1 (February 1998): 100–112. http://dx.doi.org/10.1016/s0377-2217(97)00040-4.

Full text
APA, Harvard, Vancouver, ISO, and other styles
26

Van Scheers, Louise, and Mike Cant. "The correlation between cherry picking and the distance that consumers travel to do grocery shopping." South African Journal of Economic and Management Sciences 10, no. 2 (April 9, 2013): 214–22. http://dx.doi.org/10.4102/sajems.v10i2.582.

Full text
Abstract:
Retailers often use price promotions to discriminate between consumers who can shift purchases over time and those who cannot. Retailers consistently tend to charge lower prices than necessary, pricing defensively to prevent loyal customers from cherry picking, or shifting to competitors. Knowledge about cherry picking behaviour will enable retailers to obtain a higher share of disposable income from even price-sensitive shoppers, while at the same time charging higher prices. Recent studies indicate that effective cherry picking entails saving costs through price searching over time, price searching across stores, or both. This study examines the relationship between cherry picking and the distance that consumers travel to do grocery shopping. Interviews were conducted at ten different retail outlets over three days, and the results show that there is a highly significant correlation between cherry picking and the distance that consumers travel to do grocery shopping.These results should help retailers to benefit from cherry picking by taking a proactive approach to store switching and store location, two of the main influences on cherry picking behaviour.
APA, Harvard, Vancouver, ISO, and other styles
27

Yonet, Nilay, Yıldız Aydin, Goksel Evci, and Ahu Altinkut Uncuoglu. "Genomic Evaluation of Sunflower Broomrape (Orobanche Cumana) Germplasm by KASP Assay." Helia 41, no. 68 (July 26, 2018): 57–72. http://dx.doi.org/10.1515/helia-2017-0016.

Full text
Abstract:
AbstractOrobanche cumana Wallr. is a holoparasitic plant for only sunflower, hence it is called as sunflower broomrape. Yield loss created by O. cumana which is generally 50 % can reach to 100 %. In this study, it was planned to perform molecular characterization of O. cumana germplasm as nine locations of Thrace region obtained from Trakya Agricultural Research Institute by using Single Nucleotide Polymorphism (SNP) markers, widely used in plant breeding programs, in Competitive Allele Specific PCR (KASP) assay which is a fluorescent tagged allele specific PCR method based, economic, reliable and easily repeatable genotyping technology. Databases and literature were scanned to spot variations on O. cumana genome which is not known clearly. So far, four SSR (Simple Sequence Repeat) marker (Ocum-197, Ocum-006, Ocum-023 and Ocum-151) regions showing polymorphic pattern were used for searching possible SNPs. Primer pairs were designed for amplification of the regions possibly having SNPs and PCR amplifications with these primer pairs were performed and 1 candidate deletion was detected on the amplicon which was amplified by Ocum-197 SSR marker. Following, the deletion was converted to KASP primers and KASP assay was performed. The deletion marker, Del-197, has grouped the samples from nine locations in the resulting allelic discrimination plot and infestation was performed according to this grouping, As a conclusion, Del-197 is considered as a selective marker for the ability to rapidly assay allelic variation at DNA markers for O. cumana populations that have effects on infestation results were evaluated as races, F, G, H and I in Thrace region.
APA, Harvard, Vancouver, ISO, and other styles
28

Jenber, Dagnachew. "The Distribution of Prime Numbers and Finding the Factor of Composite Numbers without Searching." Advances in Pure Mathematics 05, no. 06 (2015): 338–52. http://dx.doi.org/10.4236/apm.2015.56033.

Full text
APA, Harvard, Vancouver, ISO, and other styles
29

Flacke, Thomas. "Searching for composite Higgs models at the LHC." International Journal of Modern Physics A 31, no. 19 (July 7, 2016): 1630026. http://dx.doi.org/10.1142/s0217751x1630026x.

Full text
Abstract:
Composite Higgs models have the potential to provide a solution to the hierarchy problem and a dynamical explanation for the generation of the Higgs potential. They can be tested at the LHC as the new sector which underlies electroweak symmetry breaking must become strong in the TeV regime, which implies additional bound states beyond the Higgs. In this paper, we first discuss prospects and search strategies for top partners (and other quark partners) in the strongly coupled sector, which we study in an effective field theory setup. In the second part of the proceedings, we go beyond the effective field theory approach. We discuss potential UV embeddings for composite Higgs models which contain a Higgs as well as top partners. We show that in all of these models, additional pseudo-Nambu–Goldstone bosons beyond the Higgs are present. In particular, all of the models contain a pseudoscalar which couples to the Standard Model gauge fields through Wess–Zumino–Witten terms, providing a prime candidate for a di-boson (including a di-photon) resonance. The models also contain colored pNGBs which can be searched for at the LHC.
APA, Harvard, Vancouver, ISO, and other styles
30

Du, Ya-Hong, Yin-Shan Yun, and Wen-Xiu Ma. "Rational solutions to two Sawada–Kotera-like equations." Modern Physics Letters B 33, no. 09 (March 30, 2019): 1950108. http://dx.doi.org/10.1142/s0217984919501082.

Full text
Abstract:
Two Sawada–Kotera-like equations are introduced by the generalized bilinear operators [Formula: see text] associated with two prime numbers [Formula: see text] and [Formula: see text], respectively. Rational solutions of the two presented Sawada–Kotera-like equations are generated by searching polynomial solutions of the corresponding two generalized bilinear equations.
APA, Harvard, Vancouver, ISO, and other styles
31

Jaeger, David A., and Karl Storchmann. "Wine Retail Price Dispersion in the United States: Searching for Expensive Wines?" American Economic Review 101, no. 3 (May 1, 2011): 136–41. http://dx.doi.org/10.1257/aer.101.3.136.

Full text
Abstract:
Similar to other markets in which deviations from Jevons' “law of one price” is the norm rather than the exception, the retail wine market in the United States is characterized by large price dispersions. Drawing on a large sample of retail prices from wine-searcher.com we find an average per-wine coefficient of variation of 23 percent. Some of this is due to differential market conditions, especially state regulations. Our evidence suggests that dispersion also depends positively on price levels, after controlling for consumer, market, and state heterogeneity.
APA, Harvard, Vancouver, ISO, and other styles
32

Janssen, Maarten C. W., and Marielle C. Non. "Going Where the Ad Leads You: On High Advertised Prices and Searching Where to Buy." Marketing Science 28, no. 1 (January 2009): 87–98. http://dx.doi.org/10.1287/mksc.1080.0377.

Full text
APA, Harvard, Vancouver, ISO, and other styles
33

Iredell, J., and J. Lipman. "Antibiotic Resistance in the Intensive Care Unit: A Primer in Bacteriology." Anaesthesia and Intensive Care 33, no. 2 (April 2005): 188–95. http://dx.doi.org/10.1177/0310057x0503300206.

Full text
Abstract:
The clinical use of potent, well-tolerated, broad-spectrum antibiotics has been paralleled by the development of resistance in bacteria, and the prevalence of highly resistant bacteria in some intensive care units is despairingly commonplace. The intensive care community faces the realistic prospect of untreatable nosocomial infections and should be searching for new approaches to diagnose and manage resistant bacteria. In this review, we discuss some of the relevant underlying biology, with a particular focus on genetic transfer vehicles and the relationship of selection pressure to their movements. It is an attempt to demystify the relevant language and concepts for the anaesthetist and intensivist, to explain some of the reasons for the emergence of resistance in bacteria, and to provide a contextual basis for discussion of management approaches such as selective decontamination and antibiotic cycling.
APA, Harvard, Vancouver, ISO, and other styles
34

Jaramillo, J., C. Borgemeister, and P. Baker. "Coffee berry borerHypothenemus hampei(Coleoptera: Curculionidae): searching for sustainable control strategies." Bulletin of Entomological Research 96, no. 3 (June 2006): 223–33. http://dx.doi.org/10.1079/ber2006434.

Full text
Abstract:
AbstractThe coffee berry borerHypothenemus hampei(Ferrari) is the most serious pest of the world's most valuable tropical export crop. Since the last review on this insect was published six years ago, many new studies have contributed to an improved insight into the biology and ecology of the beetle, and have indicated new avenues for integrated and biological control. The latest developments in research, both laboratory and field, on the pest, its natural enemies and their implications for integrated control ofH. hampeiare summarized, with a particular focus on the situation in The Americas. Lately, the global coffee industry has changed radically; it has suffered a long cycle of lowest-ever world market prices caused by overproduction and technological change. At the same time, the advent of sustainable certification schemes has had a major impact on the industry. The role of integrated pest management and biological control ofH. hampeiin an era of changes in the coffee industry is discussed.
APA, Harvard, Vancouver, ISO, and other styles
35

Harlim, Claudia, and Gregorius Genep Sukendro. "Proses Komunikasi Organisasi di dalam Biro Iklan di Ada Indonesia dan Ada Singapura." Koneksi 3, no. 2 (February 8, 2020): 501. http://dx.doi.org/10.24912/kn.v3i2.6491.

Full text
Abstract:
This research is studying the process of organization communication in an advertising agency at ADA Indonesia and ADA Singapore. This research is done using a qualitative descriptive approach with ethnography method. The data that has been used was prim and secondary data. Prim’s data was one that contains interviews with the resource of information. Hence secondary data was one that contains data that resource from books and other resources. The Theories that have been used were Organizational theory, Organizational Culture theory, Climate of Organization, and Organization Communication. To gather the data, interviews, observation, bibliography study and online searching technique was used. The outcome from this research shows that the communication process that was used now is right and comfortable to apply on company’s daily organizational life. It also shows that even though the company is organizational, it didn’t imply any seniority concept or cultures that could corrupt the communication flow that has been functioning up until now on the company. Penelitian ini membahas mengenai proses komunikasi organisasi di dalam biro iklan di ADA Indonesia dan ADA Singapura. Penelitian ini dilakukan dengan menggunakan pendekatan penelitian deskriptif kualitatif dengan metode penelitian etnografi. Data yang digunakan dalam penelitian ini terdiri dari data primer dan sekunder. Data primer berupa hasil wawancara penulis dengan para narasumber, sedangkan data sekunder berupa data yang diperoleh dari buku dan sumber lain. Teori yang digunakan terdiri dari organisasi, budaya organisasi, iklim organisasi, dan komunikasi organisasi. Teknik pengumpulan data yang digunakan yaitu wawancara, observasi, studi kepustakaan dan penelusuran data online. Hasil dari penelitian ini menunjukkan bahwa proses komunikasi yang berjalan sekarang dinilai tepat dan nyaman untuk dijalankan. Bahwa walaupun perusahaan bersifat organisasional tetapi tidak memiliki kesenioritasan maupun budaya yang dapat mengacaukan komunikasi di dalam organisasi perusahaan tersebut.
APA, Harvard, Vancouver, ISO, and other styles
36

Barr, William. "Searching for Franklin from Australia: William Parker Snow's initiative of 1853." Polar Record 33, no. 185 (April 1997): 145–50. http://dx.doi.org/10.1017/s0032247400014467.

Full text
Abstract:
AbstractIn 1853 William Parker Snow (who had earlier participated in an expedition to search for the missing Franklin expedition in what is now the Canadian Arctic) decided to sink the money he had made in Melbourne during the Australian gold rush into a private expedition to search for Franklin, starting from Melbourne. In the southern autumn of 1853, he bought a 16-ton cutter, The Thomas, and, despite the handicaps of exorbitant prices and shortage of labour, fitted the vessel out for an Arctic expedition during the continuing frenzy of the gold rush. After calling at Sydney, The Thomas started north but encountered a series of violent winter gales that damaged her severely and forced Snow to seek shelter in the mouth of the Clarence River in northeastern New South Wales. By the time the storm damage had been repaired, all but two of Snow's men had deserted. Still in hopes of trying again, Snow sailed his cutter back south to Sydney and there finally abandoned this, one of the more bizarre episodes of the Franklin search.
APA, Harvard, Vancouver, ISO, and other styles
37

Budiyani, Putri Asri, and Dailibas Dailibas. "PENGARUH DEBT TO EQUITY RATIO (DER) DAN EARNING PER SHARE (EPS) TERHADAP HARGA SAHAM (STUDI KASUS PADA PERUSAHAAN SUB SEKTOR PERTAMBANGAN BATUBARA YANG TERDAFTAR DI BURSA EFEK INDONESIA PERIODE TAHUN 2014 – 2019)." Juripol (Jurnal Institusi Politeknik Ganesha Medan) 3, no. 2 (October 18, 2020): 36–52. http://dx.doi.org/10.33395/juripol.v3i2.10758.

Full text
Abstract:
The development of the coal mining subsector companies have decreased, especially in stock prices. The companies performance is the main point for investors to invest in the middle of a less good level influenced by various factors, including due to debt and profit. Financial statements are a proof of the companies performance. Searching for these factors is done by analyzing financial ratios related to debt and profits. The purpose of this research is analyze whether DER and EPS have a partial and simultaneous effect on stock prices. The population are all coal mining subsector companies listed on the Indonesia Stock Exchange (BEI) in the period 2014-2019 with a sample of 10 companies. This research is quantitative with purposive sampling technique. The data used are financial statements published by the Indonesia Stock Exchange (BEI) and then processed using SPSS for Windows 25. The results of the research get that partially DER has no effect on stock prices while EPS has an effect on stock prices. Simultaneously the DER and EPS have effects together on stock prices. Based on the results of DER and EPS with regression models, the variables have a strong influence on stock prices with determination were 37%. The biggest influence was contributed is EPS by 31% and then DER by 6%.
APA, Harvard, Vancouver, ISO, and other styles
38

Tsai, Ming Tang, and Chien Hung Chen. "An Artificial Neural Network Approach for Short-Term Electric Prices Forecasting." Advanced Materials Research 267 (June 2011): 985–90. http://dx.doi.org/10.4028/www.scientific.net/amr.267.985.

Full text
Abstract:
In this paper, a forecasting system of electric price is proposed to predict the short-term electric prices for avoiding the risk due to the electricity price volatility. Based on the Back-propagation Neural Network(BPN) and Orthogonal Experimental Design(OED), a New Artificial Neural Network Approach(NANNA) is constructed in the searching process. The data cluster, including Locational Marginal Price(LMP), system load, temperature, line-flow, are first collected and embedded in the Excel Database. In order to get a better solution, the OED is used to automatically regulate the parameters during the NANNA training process. Linking the NANNA and Excel database, the NANNA retrieved the input data from Excel Database to perform and analyze the efficiency and accuracy of the predicting system until the forecasting system is convergent. Simulation results will provide the participants to obtain the maximal profits and raise its ability of market’s competition in a price volatility environment.
APA, Harvard, Vancouver, ISO, and other styles
39

Meyer, Philip, and Morgan David Arant. "Use of an Electronic Database to Evaluate Newspaper Editorial Quality." Journalism Quarterly 69, no. 2 (June 1992): 447–54. http://dx.doi.org/10.1177/107769909206900218.

Full text
Abstract:
Electronic database searching opens new avenues for newspaper research. One strategy for evaluating quality of newspapers is to compare newspapers for spelling, grammar and style errors. An electronic database search was utilized to evaluate the editing precision of 58 news organizations and their ratings were compared to their Pulitzer Prize records. A non-linear relationship was found. Winning a small number of Pulitzers correlates positively with editing precision, but the effect diminishes rapidly with additional Pulitzer Prizes.
APA, Harvard, Vancouver, ISO, and other styles
40

Loughran, Jim. "Conferring human rights awards and prizes: Feeding the PR machine or a launching pad for change?" Security and Human Rights 20, no. 2 (2009): 154–64. http://dx.doi.org/10.1163/187502309788254614.

Full text
Abstract:
AbstractAlmost every day there is media coverage of an international prize or award. The issues highlighted range from the advancement of science to excellence in artistic endeavour to human rights. This article looks at the proliferation of human rights prizes and asks searching questions about who really benefits from this huge investment of time and money. The article explores the delicate balance between the needs of international organisations to build their media profile and attract funders and the needs of the organisation or individual on the ground for whom the winning of an international award can be a ground breaking opportunity.
APA, Harvard, Vancouver, ISO, and other styles
41

Ward, Derek J., Lucy Doos, and Andrew Stevens. "Trends in the costs of drugs launched in the UK between 1981 and 2015: an analysis of the launch price of drugs in five disease areas." BMJ Open 9, no. 5 (May 2019): e027625. http://dx.doi.org/10.1136/bmjopen-2018-027625.

Full text
Abstract:
ObjectivesTo investigate the trend in the launch price of new drugs for five common health conditions.DesignCross-sectional study using data on new drugs launched in the UK between 1981 and 2015 for hypertension, asthma, rheumatoid arthritis, schizophrenia and colorectal cancer.Data and sourcesAll drugs marketed in the UK between 1981 and 2015 (inclusive), and licensed specifically for the treatment of one of the five chosen conditions were included in the study. Newly launched medicines and their launch prices were identified by hand-searching all editions of the British National Formulary in addition to searching the websites of relevant regulatory agencies (European Medicines Agency and Medicines and Healthcare products Regulatory Agency). The launch price in UK pounds for a 28-day supply of each medicine at a typical or usual maintenance dose was adjusted for the effects of general inflation using the gross domestic product deflator series.Results104 drugs were included in our study with a mean inflation-adjusted 28-day launch price of £288 (SD £678). The launch price of new drugs varied significantly across the five conditions, with drugs for hypertension having the lowest mean price (£27) and drugs for colorectal cancer having the highest mean price (£1590) (p<0.001). There were large increases in launch prices across the study period, but the magnitude and pattern was markedly different between therapeutic areas. Biological drugs represented 13.5% of all included drugs and had a significantly higher launch price than non- biological drugs (£1233 vs £141, p<0.001). 22.1% of included drugs were first-of-kind and had a significantly higher launch price than follow-on drugs (£768 vs £151) (p<0.0001).ConclusionDrugs prices continue to increase across different therapeutic areas. This has some association with novelty, but, it is not clear if this increase in price is associated with medical benefits.
APA, Harvard, Vancouver, ISO, and other styles
42

Střelec, Luboš. "Searching for long memory effects in time series of central Europe stock market indices." Acta Universitatis Agriculturae et Silviculturae Mendelianae Brunensis 56, no. 3 (2008): 187–200. http://dx.doi.org/10.11118/actaun200856030187.

Full text
Abstract:
This article deals with one of the important parts of applying chaos theory to financial and capital markets – namely searching for long memory effects in time series of financial instruments. Source data are daily closing prices of Central Europe stock market indices – Bratislava stock index (SAX), Budapest stock index (BUX), Prague stock index (PX) and Vienna stock index (ATX) – in the period from January 1998 to September 2007. For analysed data R/S analysis is used to calculate the Hurst exponent. On the basis of the Hurst exponent is characterized formation and behaviour of analysed financial time series. Computed Hurst exponent is also statistical compared with his expected value signalling independent process. It is also operated with 5-day returns (i.e. weekly returns) for the purposes of comparison and identification nonperiodic cycles.
APA, Harvard, Vancouver, ISO, and other styles
43

Hafiz, Al, and Debby Apri Grecwin. "Prosedur penatalaksanaan celah bibir inkomplit bilateral dan rinoplasti primer dengan modifikasi mulliken." Oto Rhino Laryngologica Indonesiana 49, no. 1 (June 27, 2019): 93. http://dx.doi.org/10.32637/orli.v49i1.280.

Full text
Abstract:
Latar belakang: Celah bibir dengan atau tanpa celah lelangit merupakan abnormalitas perkembangan kraniofasial yang paling sering terjadi. Kelainan ini bisa unilateral atau bilateral, dan mungkin disertai dengan anomali kongenital lain. Celah bibir bilateral berpotensi mengubah struktur dan bentuk wajah serta menyebabkan gangguan dalam perkembangan makan, bicara, gigi geligi, dan kosmetik. Celah bibir selalu disertai dengan deformitas hidung, termasuk pada kasus celah bibir inkomplit. Mulliken adalah pionir yang melakukan perbaikan celah bibir bilateral dan rinoplasti primer dalam satu tahap operasi. Tujuan: Mengetahui keberhasilan operasi celah bibir inkomplit bilateral dan rinoplasti primer dengan teknik modifikasi Mulliken. Laporan kasus: Dilaporkan satu kasus celah bibir inkomplit bilateral pada anak laki-laki usia 7 bulan yang ditatalaksana dengan teknik modifikasi Mulliken. Metode: Telaah literatur berbasis bukti mengenai perbaikan celah bibir inkomplit bilateral dan rinoplasti primer dengan teknik modifikasi Mulliken melalui database Cochrane library, Pubmed Medline, dan hand searching. Hasil: Pertumbuhan nasal tip projection, nasal width, columellar length, upper lip height, cutaneous lip height, dan vermilion-mucosal height mendekati nilai normal. Kesimpulan: Prosedur celah bibir inkomplit bilateral disertai rinoplasti primer dengan teknik modifikasi Mulliken memberikan hasil yang baik. Introduction: Cleft lip with or without cleft palate is the most common disorder of craniofacial development. This disorder could be occurred unilaterally or bilaterally, and sometimes were also accompanied by other type of congenital disorders. Bilateral cleft lip potentially could change the face structure and shape, causing interference in eating, speech, dental development, and aesthetics. Cleft lip always occurred with nasal deformity, even in incomplete cleft lip. Mulliken is a pioneer in performing a repair in bilateral cleft lip and primary rhinoplasty altogether at the same time. Purpose: To find out the result of surgery procedure in bilateral incomplete cleft lip and primary rhinoplasty using Mulliken modification technique. Case report: A bilateral incomplete cleft lip case in a 7 months old boy and managed by Mulliken modification technique. Method: Evidence based literature study of bilateral incomplete cleft lip and primary rhinoplasty with Mulliken modification technique through Cochrane library, Pubmed Medline, and hand searching. Result: The growth of nasal tip projection, nasal width, collumellar length, upper lip height, cutaneus lip height, and vermilion mucous height were close to normal size. Conclusion: Procedure of bilateral incomplete cleft lip and primary rhinoplasty repair using Mulliken modification technique delivered a good outcome.
APA, Harvard, Vancouver, ISO, and other styles
44

Polyakov, D. V., A. I. Popov, and A. N. Tolmacheva. "An approach for searching prime numbers among members of constructed in special way subse-quence of integers." CONTINUUM. MATHS. INFORMATICS. EDUCATION, no. 4 (2020): 94–110. http://dx.doi.org/10.24888/2500-1957-2020-4-94-110.

Full text
APA, Harvard, Vancouver, ISO, and other styles
45

Kavitha, J., P. Arockia Jansi Rani, P. Mohamed Fathimal, and Asha Paul. "An Efficient Shot Boundary Detection Using Data-cube Searching Technique." Recent Advances in Computer Science and Communications 13, no. 4 (October 19, 2020): 798–807. http://dx.doi.org/10.2174/2213275912666190830141628.

Full text
Abstract:
Background:: In the internet era, there is a prime need to access and manage the huge volume of multimedia data in an effective manner. Shot is a sequence of frames captured by a single camera in an uninterrupted space and time. Shot detection is suitable for various applications such that video browsing, video indexing, content based video retrieval and video summarization. Objective:: To detect the shot transitions in the video within a short duration. It compares the visual features of frames like correlation, histogram and texture features only in the candidate region frames instead of comparing the full frames in the video file. Methods: This paper analyses candidate frames by searching the values of frame features which matches with the abrupt detector followed by the correct cut transition frame with in the datacube recursively until it detects the correct transition frame. If they are matched with the gradual detector, then it will give the gradual transition ranges, otherwise the algorithm will compare the frames within the next datacube to detect shot transition. Results:: The total average detection rates of all transitions computed in the proposed Data-cube Search Based Shot Boundary Detection technique are 92.06 for precision, 96.92 for recall and 93.94 for f1 measure and the maximum accurate detection rate. Conclusion:: Proposed method for shot transitions uses correlation value for searching procedure with less computation time than the existing methods which compares every single frame and uses multi features such as color, edge, motion and texture features in wavelet domain.
APA, Harvard, Vancouver, ISO, and other styles
46

Tatarintsev, Maxim, Sergey Korchagin, Petr Nikitin, Rimma Gorokhova, Irina Bystrenina, and Denis Serdechnyy. "Analysis of the Forecast Price as a Factor of Sustainable Development of Agriculture." Agronomy 11, no. 6 (June 18, 2021): 1235. http://dx.doi.org/10.3390/agronomy11061235.

Full text
Abstract:
Analysis of the rise in prices for consumer goods is a state’s priority task. The state assumes the obligation to regulate pricing in all spheres of consumption. First of all, the prices for essential commodities to which agricultural products belong are analyzed. The article shows the changes in prices for consumer goods of agricultural products (sugar) during a pandemic. The analysis of forecasting prices for sugar and its impact on the development of its production is carried out. The construction of the forecast model was based on extrapolation. The structure of a forecast model for price changes was based on the analysis of the time series of the Autoregressive Integrated Moving Average (ARIMA) class. This model consists of an autoregressive model and a moving average model. A forecast of the volume of domestic sugar transportation by rail has been completed. The algorithms implemented this model for searching for initial approximations and optimal parameters for the predictive model. The Hirotsugu Akaike Information Criterion (AIC) was used to select the best model. The algorithms were implemented in the Python programming language. The quality check of the description was performed with a predictive model of actual data. An economic interpretation of the rise in sugar prices and proof of the forecast’s truth obtained from a financial point of view were carried out.
APA, Harvard, Vancouver, ISO, and other styles
47

Getahun, Verena, and William A. Keillor. "Counting the Costs of Acquisitions: Using Cost-Benefit Analysis in a Seminary and University Library." Theological Librarianship 2, no. 2 (November 17, 2009): 24–35. http://dx.doi.org/10.31046/tl.v2i2.108.

Full text
Abstract:
This essay considers how cost-benefit analysis may be used in a small to mid-sized library to identify cost-savings in the acquisitions of monographs. The essay highlights parallel studies conducted at Luther Seminary Library and Bethel University Library which compared prices, discounts, and time costs across a range of vendor types to identify whether searching for the best price per item is cost-effective, and how much this strategy could save yearly in acquisitions. Both libraries found that substantial potential savings were identified through this study.
APA, Harvard, Vancouver, ISO, and other styles
48

Tsai, W. S., S. L. Shih, L. M. Lee, L. M. Dolores, and L. Kenyon. "First Report of a Novel Begomovirus Associated with Yellow Vein Disease of Browne's Blechum (Blechum pyramidatum)." Plant Disease 98, no. 5 (May 2014): 701. http://dx.doi.org/10.1094/pdis-10-13-1025-pdn.

Full text
Abstract:
Browne's Blechum (Blechum pyramidatum) is a common weed found in fields and waste grounds in the Philippines. A disease was observed causing begomovirus-like yellow/chlorotic leaf veins and shortened internodes of Browne's Blechum plants on the island of Luzon, Philippines; disease incidence ranged from 10 to 50% in fields in 2012. Samples were collected from two plants with symptoms from each of Laguna and Quezon provinces and one plant without symptoms from Laguna Province. All four samples from plants with symptoms tested positive for begomovirus by PCR using primer pair PAL1v1978B/PAR1c715H (2), but the symptomless plant sample did not. However, no virus DNA-B component was detected in any of the samples using either general detection primer pair DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (1). Using abutting primers AFPH12W1-R2F (TCTGGATCCATTGTTGAACGAGT) and AFPH12W1-R2R (CCGGGATCCCACATTGTTAAACA), a complete DNA-A component sequence was obtained for a Laguna isolate (GenBank Accession No. KF446659) and for a Quezon isolate (KF446660). The Laguna and Quezon isolate sequences were 2,764 and 2,756 nucleotides, respectively, and shared 90.6% nucleotide sequence identity. Both had six open reading frames (ORFs)—two in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4)—and the geminivirus conserved sequence (TAATATTAC). Based on BLASTn searching of GenBank and sequence analysis using MEGALIGN (DNASTAR), both isolates should be considered as a new begomovirus (tentatively named Blechum yellow vein virus, BlYVV) since their DNA-A sequences share less than 89% nucleotide identity with any other begomovirus. Both DNA sequences had the highest nucleotide identity (84.8 to 87.6%) with Papaya leaf curl Guangdong virus isolates (AJ558122, AY650283, FJ495184, FJ869907, and JN703795). To our knowledge, this is the first report of a previously unidentified begomovirus associated with yellow vein disease of this species. References: (1) S. K. Green et al. Plant Dis. 85:1286, 2001. (2) W. S. Tsai et al. Plant Pathol. 60:787, 2011.
APA, Harvard, Vancouver, ISO, and other styles
49

Kim, Daiwon. "Spatial Panel Analyses on the Relationship between Internet Information Searching and Apartment Sale and Chonsei Prices in Seoul." Journal of Korea Real Estate Analysists Association 22, no. 1 (March 31, 2016): 5–23. http://dx.doi.org/10.19172/kreaa.22.1.1.

Full text
APA, Harvard, Vancouver, ISO, and other styles
50

Paola, Pierfrancesco De, Vincenzo Del Giudice, Francesco Tajani, Pierluigi Morano, and Felicia Di Liddo. "An evaluation method for searching the functional relationships between property prices and influencing factors in the detected data." International Journal of Business Intelligence and Data Mining 1, no. 1 (2022): 1. http://dx.doi.org/10.1504/ijbidm.2022.10035383.

Full text
APA, Harvard, Vancouver, ISO, and other styles
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography