Journal articles: 'Sercambi'

1

Marafioti, Martin. "Semantic Distance as Reaction to Pestilence in Medieval Italy: Evidence from the Story Collections of Boccaccio, Sacchetti, and Sercambi." Forum Italicum: A Journal of Italian Studies 39, no. 2 (September 2005): 326–49. http://dx.doi.org/10.1177/001458580503900202.

Full text

Abstract:

In his Decameron, Giovanni Boccaccio prescribes storytelling as a means of distraction from the anxieties and suffering associated with the mortifera pestilenza of 1348. Boccaccio pays careful attention to semantics in his work; he confines the discussion of pestilence to the frame tale and avoids evoking the plague thematically, symbolically, and linguistically in the one hundred novelle. This essay examines the power attributed to language in times of epidemic outbreak, in particular, the fear of pronouncing the name of an illness, as if somehow, words possessed the power to make one more susceptible to the malady or to infect. This linguistic aversion to pestilence is analyzed in the story collections of Giovanni Boccaccio, Franco Sacchetti, and Giovanni Sercambi.

APA, Harvard, Vancouver, ISO, and other styles

2

Redon, Odile. "Suffilello de Montalto, voleur, ou le strip-tease contraint de la comtesse d'Artois. (Nouvelle de Giovanni Sercambi)." Médiévales 14, no. 29 (1995): 83–86. http://dx.doi.org/10.3406/medi.1995.1338.

Full text

APA, Harvard, Vancouver, ISO, and other styles

3

Henderson, Mark J., Emily S. Wires, Kathleen A. Trychta, Christopher T. Richie, and Brandon K. Harvey. "SERCaMP: a carboxy-terminal protein modification that enables monitoring of ER calcium homeostasis." Molecular Biology of the Cell 25, no. 18 (September 15, 2014): 2828–39. http://dx.doi.org/10.1091/mbc.e14-06-1141.

Full text

Abstract:

Endoplasmic reticulum (ER) calcium homeostasis is disrupted in diverse pathologies, including neurodegeneration, cardiovascular diseases, and diabetes. Temporally defining calcium dysregulation during disease progression, however, has been challenging. Here we describe secreted ER calcium-monitoring proteins (SERCaMPs), which allow for longitudinal monitoring of ER calcium homeostasis. We identified a carboxy-terminal modification that is sufficient to confer release of a protein specifically in response to ER calcium depletion. A Gaussia luciferase (GLuc)–based SERCaMP provides a simple and sensitive method to monitor ER calcium homeostasis in vitro or in vivo by analyzing culture medium or blood. GLuc-SERCaMPs revealed ER calcium depletion in rat primary neurons exposed to various ER stressors. In vivo, ER calcium disruption in rat liver was monitored over several days by repeated sampling of blood. Our results suggest that SERCaMPs will have broad applications for the long-term monitoring of ER calcium homeostasis and the development of therapeutic approaches to counteract ER calcium dysregulation.

APA, Harvard, Vancouver, ISO, and other styles

4

ZÁDOR, Ernö, Luca MENDLER, Mark VER HEYEN, László DUX, and Frank WUYTACK. "Changes in mRNA levels of the sarcoplasmic/endoplasmic-reticulum Ca2+-ATPase isoforms in the rat soleus muscle regenerating from notexin-induced necrosis." Biochemical Journal 320, no. 1 (November 15, 1996): 107–13. http://dx.doi.org/10.1042/bj3200107.

Full text

Abstract:

The relative mRNA levels corresponding to the different sarcoplasmic/endoplasmic-reticulum Ca2+-ATPase isoforms (SERCA1a, SERCA1b, SERCA2a, SERCA2b and SERCA3) were measured by reverse transcriptase–PCR in rat soleus muscles regenerating after notexin-induced necrosis. The succession of appearance of the different types of SERCA mRNA species in regenerating muscle largely recapitulates those observed during normal ontogenesis. The mRNA levels of the muscle-specific isoforms SERCA1a and SERCA2a became very low on the first and third days after injection of the snake venom. It was only on the fifth day of regeneration that the mRNA of the neonatal variant of the fast-twitch skeletal SERCA1b isoform began to rise, well before the other SERCA transcripts. At 7 and 10 days, i.e. at a time when the new myofibres normally become re-innervated, the mRNA level of SERCA1a and SERCA2a increased markedly, but the fast-twitch skeletal SERCA1a isoform was still the most prominent. On day 21, in the advanced stage of regeneration, a switch in the relative expression levels of SERCA1a and SERCA2a mRNA was observed and the ratio of both isoforms became similar to that found in the normal soleus muscles. This was followed by a decline in the level of all SERCA mRNA species, so that on day 28 the levels of the sarcoplasmic/endoplasmatic-reticulum Ca2+-pump RNAs was again lower but their ratio remained similar to that of the untreated control soleus.

APA, Harvard, Vancouver, ISO, and other styles

5

Wu, Kwan-Dun, David Bungard, and Jonathan Lytton. "Regulation of SERCA Ca2+ pump expression by cytoplasmic [Ca2+] in vascular smooth muscle cells." American Journal of Physiology-Cell Physiology 280, no. 4 (April 1, 2001): C843—C851. http://dx.doi.org/10.1152/ajpcell.2001.280.4.c843.

Full text

Abstract:

Vascular smooth muscle cells (VSMC) express three isoforms of the sarcoplasmic or endoplasmic reticulum Ca2+-ATPase (SERCA) pump; SERCA2b predominates (91%), whereas SERCA2a (6%) and SERCA3 (3%) are present in much smaller amounts. Treatment with thapsigargin (Tg) or A-23187 increased the level of mRNA encoding SERCA2b four- to fivefold; SERCA3 increased about 10-fold, whereas SERCA2a was unchanged. Ca2+ chelation prevented the Tg-induced SERCA2b increase, whereas Ca2+ elevation itself increased SERCA2b expression. These responses were discordant with those of 78-kDa glucose-regulated protein/immunoglobulin-binding protein (grp78/BiP), an endoplasmic reticulum stress-response protein. SERCA2b mRNA elevation was much larger than could be accounted for by the observed increase in message stability. The induction of SERCA2b by Tg did not require protein synthesis, nor was it affected by inhibitors of calcineurin, protein kinase C, Ca2+/calmodulin-dependent protein kinase, or tyrosine protein kinases. Treatment with the nonselective protein kinase inhibitor H-7 prevented Tg-induced SERCA2b expression from occurring, whereas another nonselective inhibitor, staurosporine, was without effect. We conclude that changes in cytosolic Ca2+ control the expression of SERCA2b in VSMC via a mechanism involving a currently uncharacterized, H-7-sensitive but staurosporine-insensitive, protein kinase.

APA, Harvard, Vancouver, ISO, and other styles

6

Verboomen, H., F. Wuytack, L. Van den Bosch, L. Mertens, and R. Casteels. "The functional importance of the extreme C-terminal tail in the gene 2 organellar Ca2+-transport ATPase (SERCA2a/b)." Biochemical Journal 303, no. 3 (November 1, 1994): 979–84. http://dx.doi.org/10.1042/bj3030979.

Full text

Abstract:

Ca(2+)-uptake experiments in microsomal fractions from transfected COS-1 cells have revealed a functional difference between the non-muscle SERCA2b Ca2+ pump and its muscle-specific SERCA2a splice variant. Structurally, the two pumps differ only in their C-terminal tail. The last four amino acids of SERCA2a are replaced in SERCA2b by a 49-residue-long peptide chain containing a very hydrophobic stretch which could be an additional transmembrane segment. The functionally important subdomains in the SERCA2b tail were analysed by constructing three SERCA2b deletion mutants lacking 12, 31 or 49 amino acids. The mutants and the parental SERCA2 pumps were expressed in COS-1 cells and analysed for functional difference. SERCA2b had a twofold higher Ca2+ affinity, a twofold lower turnover rate and a 10-fold lower vanadate-sensitivity than SERCA2a and the mutants. Since each of the three truncated versions of SERCA2b acquire the characteristic properties of SERCA2a, it is concluded that the stretch of the last 12 residues of SERCA2b is of critical importance.

APA, Harvard, Vancouver, ISO, and other styles

7

Zhang, Yuxia, Michio Inoue, Akihisa Tsutsumi, Satoshi Watanabe, Tomohiro Nishizawa, Kazuhiro Nagata, Masahide Kikkawa, and Kenji Inaba. "Cryo-EM structures of SERCA2b reveal the mechanism of regulation by the luminal extension tail." Science Advances 6, no. 33 (August 2020): eabb0147. http://dx.doi.org/10.1126/sciadv.abb0147.

Full text

Abstract:

Sarco/endoplasmic reticulum Ca2+ ATPase (SERCA) pumps Ca2+ from the cytosol into the ER and maintains the cellular calcium homeostasis. Herein, we present cryo–electron microscopy (cryo-EM) structures of human SERCA2b in E1∙2Ca2+–adenylyl methylenediphosphonate (AMPPCP) and E2-BeF3− states at 2.9- and 2.8-Å resolutions, respectively. The structures revealed that the luminal extension tail (LE) characteristic of SERCA2b runs parallel to the lipid-water boundary near the luminal ends of transmembrane (TM) helices TM10 and TM7 and approaches the luminal loop flanked by TM7 and TM8. While the LE served to stabilize the cytosolic and TM domain arrangement of SERCA2b, deletion of the LE rendered the overall conformation resemble that of SERCA1a and SERCA2a and allowed multiple conformations. Thus, the LE appears to play a critical role in conformational regulation in SERCA2b, which likely explains the different kinetic properties of SERCA2b from those of other isoforms lacking the LE.

APA, Harvard, Vancouver, ISO, and other styles

8

Dremina, Elena S., Victor S. Sharov, and Christian Schöneich. "Heat-shock proteins attenuate SERCA inactivation by the anti-apoptotic protein Bcl-2: possible implications for the ER Ca2+-mediated apoptosis." Biochemical Journal 444, no. 1 (April 26, 2012): 127–39. http://dx.doi.org/10.1042/bj20111114.

Full text

Abstract:

We have demonstrated previously that Bcl-2 and Bcl-2Δ21, a C-terminally truncated Bcl-2 sequence, inactivate SERCA (sarcoplasmic/endoplasmic reticulum Ca2+-ATPase) 1 in isolated SR (sarcoplasmic reticulum), accompanied by a translocation from CRDs (caveolae-related domains) of the SR. In the present study, we obtained evidence for the interaction of Bcl-2 with SERCA2b in C2C12 myoblasts and HEK (human embryonic kidney)-293 cells. Bcl-2 and SERCA2b co-immunoprecipitated from lysate and microsomal fractions of Bcl-2-overexpressing cells. However, Bcl-2 overexpression resulted only in a slight translocation from the CRDs and no significant SERCA inactivation. In isolated HEK-293 cell microsomes, incubation with Bcl-2Δ21 afforded SERCA2b inactivation and some translocation. HSP (heat-shock protein) 70, HSP90, HSP27 and α-crystallin attenuated Bcl-2Δ21-dependent SERCA2b inactivation. An in vitro mechanistic study with the SERCA1 isoform shows that HSP70 (i) protects SERCA1 from the inactivation by Bcl-2Δ21, (ii) inhibits SERCA1 translocation from CRD fractions, and (iii) prevents the Bcl-2Δ21-dependent loss of FITC labelling. Our data demonstrate that the mechanism of SERCA inactivation by Bcl-2 established in vitro for the SERCA1 isoform can be extended to the main housekeeping SERCA2b isoform, and that functional interactions of SERCA2b and Bcl-2 in the cell may be modulated by HSP70 and other chaperones and stress-regulated proteins.

APA, Harvard, Vancouver, ISO, and other styles

9

Pacifico, F., L. Ulianich, S. De Micheli, S. Treglia, A. Leonardi, P. Vito, S. Formisano, E. Consiglio, and B. Di Jeso. "The expression of the sarco/endoplasmic reticulum Ca2+-ATPases in thyroid and its down-regulation following neoplastic transformation." Journal of Molecular Endocrinology 30, no. 3 (June 1, 2003): 399–409. http://dx.doi.org/10.1677/jme.0.0300399.

Full text

Abstract:

Maintaining a high Ca(2+) concentration in the lumen of the endoplasmic reticulum (ER), by the action of sarco/endoplasmic reticulum Ca(2+)-ATPases (SERCAs), is important in many cellular processes, such as Ca(2+)-mediated cytosolic signaling in response to extracellular stimuli, cell growth and proliferation, and synthesis, processing and folding of ER-translated proteins. In the thyroid gland, SERCAs have not been studied yet, and there is little information available on general problems such as the expression of SERCAs following neoplastic transformation. In this study we investigated the expression of SERCA2b and SERCA3 in rat thyroid tIssue and, in addition, in normal and transformed rat thyroid cell lines. RT-PCR and Northern blot assays showed that SERCA2b is the SERCA form preferentially expressed in the thyroid. In rat thyroid, SERCA2b mRNA was expressed at a higher level than that of other non-muscle tIssues such as liver or spleen, but at much lower level than in brain. On the other hand, SERCA3 mRNA was not detected in thyroid by Northern blot analysis, or barely detected by RT-PCR assays. We also studied the SERCA2b expression pattern in PC Cl3 thyroid cells transformed by several oncogenes that induce different degrees of malignancy and dedifferentiation. RT-PCR and Northern blot assays showed that SERCA2b mRNA expression dramatically decreased in highly tumorigenic thyroid cells, while expression of glyceraldehyde-3-phosphate dehydrogenase mRNA, a housekeeping gene used as internal control, exhibited no variations. The dramatic down-regulation of SERCA2b expression in fully transformed thyroid cells was also evident by Western blot analysis. Also, following neoplastic transformation of thyroid cells, the enzymatic activity of SERCA2b was reduced in a measure which correlated with the mRNA and protein levels. Therefore, rat thyrocytes expressed intermediate levels of SERCAs, mostly the SERCA2b isoform. This pattern of expression was basically reproduced in fully differentiated thyroid cells in culture and was sensitive to neoplastic transformation.

APA, Harvard, Vancouver, ISO, and other styles

10

Verboomen, H., F. Wuytack, H. De Smedt, B. Himpens, and R. Casteels. "Functional difference between SERCA2a and SERCA2b Ca2+ pumps and their modulation by phospholamban." Biochemical Journal 286, no. 2 (September 1, 1992): 591–95. http://dx.doi.org/10.1042/bj2860591.

Full text

Abstract:

COS 1 cells were transfected with full-length pig stomach sarcoplasmic/endoplasmic reticulum Ca2+ pump (SERCA)2a or SERCA2b cDNA. Ca2+ uptake by microsomes from transfected cells revealed that the Ca2+ affinity of the SERCA2b Ca2+ pump (K0.5 0.17 +/- 0.01 microM) was higher than that of the SERCA2a Ca2+ pump (K0.5 0.31 +/- 0.02 microM). Thapsigargin-sensitivity was found to be identical for the two isoforms. The Ca2+ affinity of both the SERCA2a and SERCA2b Ca2+ pumps was decreased by a factor of two when they were co-expressed with phospholamban.

APA, Harvard, Vancouver, ISO, and other styles

11

LACABARATZ-PORRET, Christine, Sophie LAUNAY, Elisabeth CORVAZIER, Raymonde BREDOUX, Béla PAPP, and Jocelyne ENOUF. "Biogenesis of endoplasmic reticulum proteins involved in Ca2+ signalling during megakaryocytic differentiation: an in vitro study." Biochemical Journal 350, no. 3 (September 8, 2000): 723–34. http://dx.doi.org/10.1042/bj3500723.

Full text

Abstract:

The endoplasmic reticulum (ER) plays a key role in Ca2+ signalling through Ca2+ release via inositol 1,4,5-trisphosphate receptors (InsP3-Rs) and Ca2+ uptake by sarco/endoplasmic reticulum Ca2+-ATPases (SERCAs). Here, we investigated the organization of platelet ER and its biogenesis during megakaryocytopoiesis. First, erythro/megakaryoblastic MEG 01, UT7, M-O7e and CHRF 288-11 cell lines, platelets and thrombopoietin-induced UT7-Mpl cells were selected for the study of SERCA2b and SERCA3 proteins by Western blotting using the antibodies IID8 and PL/IM430, respectively. As judged by platelet glycoprotein IIIa (GPIIIa) expression, an increase in SERCA3 proteins was observed while that of SERCA2b remained unchanged throughout maturation. Second, these studies were extended to the newly described alternatively spliced SERCA3a–c RNAs and InsP3-Rs using the in vitro model of PMA-induced differentiation of MEG 01 cells. Time-course and dose–response studies showed a maximal approx. 4-fold up-regulation of SERCA3 proteins using 10-8 M PMA for 3 days, which paralleled induction of GPIIIa expression. SERCA3 induction was found to occur at the level of mRNA. The modulation of the different SERCA3 species (i.e. 3a, 3b and 3c) was isoform-specific: while SERCA3a was slightly increased, an approx. 3-fold induction of SERCA3b, and a 4-fold induction of SERCA3c, was observed after 24h of PMA treatment. Isoform-specific Western blotting and/or reverse transcriptase PCR studies showed that InsP3-R types I, II and III are expressed in MEG 01 cells, as well as in platelets. Study of the expression of these InsP3-R types in PMA-induced MEG 01 cells revealed that: (i) InsP3-RI protein and mRNA showed no changes; (ii) InsP3-RII mRNA was up-regulated and peaked at hour 48 and (iii) InsP3-RIII mRNA and protein showed a transitory maximal 3- and 2.3-fold increase at hours 6 and 30, respectively. Upon PMA treatment of CHRF 288-11 cells, in which GPIIIa is not induced upon treatment, a similar pattern of regulation of InsP3-R types II and III was seen, but a distinct pattern of SERCA3 regulation was observed. These results suggest a profound reorganization of ER-protein patterns during megakaryocytopoiesis and underline the role of SERCA3 gene regulation in the control of Ca2+-dependent platelet functions.

APA, Harvard, Vancouver, ISO, and other styles

12

Grover, Ashok K., Chiu-Yin Kwan, and Sue E. Samson. "Effects of peroxynitrite on sarco/endoplasmic reticulum Ca2+ pump isoforms SERCA2b and SERCA3a." American Journal of Physiology-Cell Physiology 285, no. 6 (December 2003): C1537—C1543. http://dx.doi.org/10.1152/ajpcell.00299.2003.

Full text

Abstract:

Sarco(endo)plasmic reticulum Ca2+ (SERCA) pumps are important for cell signaling. Three different genes, SERCA1, 2, and 3, encode these pumps. Most tissues, including vascular smooth muscle, express a splice variant of SERCA2 (SERCA2b), whereas SERCA3a is widely distributed in tissues such as vascular endothelium, tracheal epithelium, mast cells, and lymphoid cells. SERCA2b protein is readily inactivated by peroxynitrite that may be formed during cardiac ischemia reperfusion or during immune response after infection. Here, we compared the peroxynitrite sensitivity of SERCA2b and SERCA3a by using microsomes prepared from HEK-293T cells overexpressing the pumps. We incubated the microsomes with different concentrations of peroxynitrite and determined Ca2+ uptake, Ca2+-Mg2+-ATPase, Ca2+-dependent formation of acylphosphate intermediate, and protein mobility in Western blots. Ca2+ uptake, Ca2+-Mg2+-ATPase, and Ca2+-dependent formation of acylphosphate intermediate were inactivated for both SERCA2b and SERCA3a, but the latter was more resistant to the inactivation. Western blots showed that SERCA2b and SERCA3a proteins oligomerized after treatment with peroxynitrite, but each with a slightly different pattern. Compared with monomers, the oligomers may be less efficient in forming the acylphosphate intermediate and in conducting the remainder of the steps in the reaction cycle. We conclude that the resistance of SERCA3a to peroxynitrite may aid the cells expressing them in functioning during exposure to oxidative stress.

APA, Harvard, Vancouver, ISO, and other styles

13

MISQUITTA, Christine M., Paromita GHOSH, James MWANJEWE, and Ashok K. GROVER. "Role of cis-acting elements in the control of SERCA2b Ca2+ pump mRNA decay by nuclear proteins." Biochemical Journal 388, no. 1 (May 10, 2005): 291–97. http://dx.doi.org/10.1042/bj20041568.

Full text

Abstract:

Alternative splicing at position 3495 b yields SERCA2 (sarco/endoplasmic reticulum Ca2+ pump 2) RNA species, namely SERCA2a and SERCA2b which differ in 3′-end regions. This results in SERCA2b RNA being less stable. In vitro decay experiments show that, in the presence of protein extracts from nuclei of LVMs (left ventricular myocytes), the rate of decay of both SERCA2b RNA and synthetic RNA from its 3′-region is greater than that of the corresponding SERCA2a RNA. To search for cis-acting instability elements in the 3′-region of SERCA2b, we examined the effects of LVM nuclear protein extracts on the in vitro decay of six short overlapping capped [m7G(5′)ppp(5′)Gm] and polyadenylated (A40) RNA fragments from the 3′-end region (3444–4472) of SERCA2b. The proximal fragment 2B1 (3444–3753) was the most unstable. 2B1 RNA without a cap or a polyadenylated tail was analysed further in electrophoretic mobility-shift assays, and was observed to bind to protein(s) in the nuclear extracts. Based on competition for binding to nuclear proteins between radiolabelled 2B1 RNA and short unlabelled RNA fragments, the cis-acting element involved in this binding was the sequence 2B1-4. 2B1-4 is a 35-base (3521–3555, CCAGUCCUGCUCGUUGUGGGCGUGCACCGAGGGGG) GC-rich region just past the splice site (3495). Nuclear extracts decreased the electrophoretic mobility of the radiolabelled 2B1-4 RNA which bound to two proteins (19 and 21 kDa) in cross-linking experiments. Excess 2B1-4 RNA decreased the decay of the 2B1 RNA by the nuclear protein extract. 2B1-del 4 RNA (2B1 with the 2B1-4 domain deleted) also decayed more slowly than the control 2B1 RNA. Thus SERCA2b contains a novel GC-rich cis-acting element involved in its decay by nuclear proteins.

APA, Harvard, Vancouver, ISO, and other styles

14

FRANKLIN, Isobel K., Robert A. WINZ, and Michael J. HUBBARD. "Endoplasmic reticulum Ca2+-ATPase pump is up-regulated in calcium-transporting dental enamel cells: a non-housekeeping role for SERCA2b." Biochemical Journal 358, no. 1 (August 8, 2001): 217–24. http://dx.doi.org/10.1042/bj3580217.

Full text

Abstract:

Dental enamel-forming cells face a major challenge to avoid the cytotoxic effects of excess calcium. We have characterized sarcoplasmic/endoplasmic reticulum calcium-ATPase pumps (SERCA) in rat enamel cells to address the proposal that non-mitochondrial calcium stores play a dominant role in transcellular calcium transport. A single major isoform, SERCA2b, was detected during the protein-secretory and calcium-transport stages of enamel formation using reverse-transcriptase PCR, cDNA cloning, Northern analysis and immunoblotting. Most importantly, SERCA2b exhibited a specific 3-fold up-regulation to high expression levels during calcium transport, as determined by quantitative immunoblotting and ATPase assays. Sensitivity of the calcium-dependent ATPase to thapsigargin and three other SERCA inhibitors was characterized. These findings indicate that enamel cells are well-equipped to sequester calcium in endoplasmic reticulum stores and so protect against calcium toxicity, associate SERCA with transcellular calcium transport for the first time, and establish SERCA2b as a molecular and pharmacological target for future investigations of calcium transcytosis. The observed physiological regulation in enamel cells contradicts the widespread perception that SERCA2b is restricted to general housekeeping duties.

APA, Harvard, Vancouver, ISO, and other styles

15

Chandrasekera, P. Charukeshi, Margaret E. Kargacin, Julie P. Deans, and Jonathan Lytton. "Determination of apparent calcium affinity for endogenously expressed human sarco(endo)plasmic reticulum calcium-ATPase isoform SERCA3." American Journal of Physiology-Cell Physiology 296, no. 5 (May 2009): C1105—C1114. http://dx.doi.org/10.1152/ajpcell.00650.2008.

Full text

Abstract:

The sarco(endo)plasmic reticulum Ca2+-ATPases (SERCAs) play a crucial role in regulating free cytosolic Ca2+ concentration in diverse cell types. It has been shown that recombinant SERCA3, when measured in heterologous systems, exhibits low apparent affinity for Ca2+; however, Ca2+ affinity of native SERCA3 in an endogenous setting has not been examined. Such a measurement is complicated, because SERCA3 is always coexpressed with the housekeeping isoform SERCA2b. We used a fluorescence-based assay for monitoring continuous Ca2+ uptake into microsomes to examine the properties of endogenous human SERCA3 and SERCA2b. The kinetic parameters were derived using a cooperative two-component uptake model for Ca2+ activation, and the values assigned to SERCA3 were confirmed using the highly specific human SERCA3 inhibitory antibody PL/IM430. First, using recombinant human SERCA3 and SERCA2b proteins transiently expressed in HEK-293 cells, we confirmed the previously observed low apparent Ca2+ affinity for SERCA3 compared with SERCA2b (1.10 ± 0.04 vs. 0.26 ± 0.01 μM), and using mixtures of recombinant protein isoforms, we validated the two-component uptake model. Then we determined apparent Ca2+ affinity for SERCA proteins present endogenously in cultured Jurkat T lymphocytes and freshly isolated human tonsil lymphocytes. The apparent Ca2+ affinity in these two preparations was 1.04 ± 0.07 and 1.1 ± 0.2 μM for SERCA3 and 0.27 ± 0.02 and 0.26 ± 0.01 μM for SERCA2b, respectively. Our data demonstrate, for the first time, that affinity for Ca2+ is inherently lower for SERCA3 expressed in situ than for other SERCA isoforms.

APA, Harvard, Vancouver, ISO, and other styles

16

Ogawa, Haruo, Yoshiki Kabashima, Rie Nakajima, and Chikashi Toyoshima. "Crystal Structures of SERCA2a and SERCA2b." Biophysical Journal 114, no. 3 (February 2018): 147a. http://dx.doi.org/10.1016/j.bpj.2017.11.826.

Full text

APA, Harvard, Vancouver, ISO, and other styles

17

Grover, A. K., S. E. Samson, and C. M. Misquitta. "Sarco(endo)plasmic reticulum Ca2+ pump isoform SERCA3 is more resistant than SERCA2b to peroxide." American Journal of Physiology-Cell Physiology 273, no. 2 (August 1, 1997): C420—C425. http://dx.doi.org/10.1152/ajpcell.1997.273.2.c420.

Full text

Abstract:

Sarco(endo)plasmic reticulum Ca2+ pumps are encoded by genes SERCA1, SERCA2, and SERCA3. Most tissues express SERCA2 Ca2+ pumps (splice SERCA2b) which are inactivated by reactive oxygen. In contrast, SERCA3 is expressed in tissues such as tracheal epithelium, mast cells, lymphoid cells, and aortic endothelium, which are frequently exposed to oxidative stress. Therefore, we compared SERCA3 and SERCA2b proteins for their sensitivity to oxidation. We isolated microsomes from HEK-293 cells overexpressing SERCA3 or SERCA2b. We incubated the microsomes with different concentrations of hydrogen peroxide and then determined Ca2+ pump activities in them in the following three assay systems: ATP-dependent oxalate-stimulated azide-insensitive 45Ca2+ uptake by the microsomal vesicles, Ca(2+)-Mg(2+)-ATPase, and Ca(2+)-dependent acylphosphate formation. Peroxide inhibited the pump activities in microsomes with half-maximal inhibitory concentration (IC50) values of 69 +/- 14, 66 +/- 13, and 84 +/- 15 microM for the 45Ca2+ uptake, Ca(2+)-Mg(2+)-ATPase, and the acylphosphate formation reactions, respectively. However, for microsomes from SERCA3-expressing cells, the corresponding values of IC50 for peroxide were 274 +/- 47, 857 +/- 110, and 746 +/- 40 microM. Thus, in each assay system, the resistance to inactivation by peroxide was significantly (P < 0.05) higher for the SERCA3 protein than for SERCA2b. The SERCA3 resistance to oxidants may aid the cells expressing it to function during exposure to oxidative stress.

APA, Harvard, Vancouver, ISO, and other styles

18

Green, Kim N., Angelo Demuro, Yama Akbari, Brian D. Hitt, Ian F. Smith, Ian Parker, and Frank M. LaFerla. "SERCA pump activity is physiologically regulated by presenilin and regulates amyloid β production." Journal of Cell Biology 181, no. 7 (June 30, 2008): 1107–16. http://dx.doi.org/10.1083/jcb.200706171.

Full text

Abstract:

In addition to disrupting the regulated intramembraneous proteolysis of key substrates, mutations in the presenilins also alter calcium homeostasis, but the mechanism linking presenilins and calcium regulation is unresolved. At rest, cytosolic Ca2+ is maintained at low levels by pumping Ca2+ into stores in the endoplasmic reticulum (ER) via the sarco ER Ca2+-ATPase (SERCA) pumps. We show that SERCA activity is diminished in fibroblasts lacking both PS1 and PS2 genes, despite elevated SERCA2b steady-state levels, and we show that presenilins and SERCA physically interact. Enhancing presenilin levels in Xenopus laevis oocytes accelerates clearance of cytosolic Ca2+, whereas higher levels of SERCA2b phenocopy PS1 overexpression, accelerating Ca2+ clearance and exaggerating inositol 1,4,5-trisphosphate–mediated Ca2+ liberation. The critical role that SERCA2b plays in the pathogenesis of Alzheimer's disease is underscored by our findings that modulating SERCA activity alters amyloid β production. Our results point to a physiological role for the presenilins in Ca2+ signaling via regulation of the SERCA pump.

APA, Harvard, Vancouver, ISO, and other styles

19

Kono, Tatsuyoshi, Geonyoung Ahn, Dan R. Moss, Liann Gann, Angel Zarain-Herzberg, Yurika Nishiki, Patrick T. Fueger, Takeshi Ogihara, and Carmella Evans-Molina. "PPAR-γ Activation Restores Pancreatic Islet SERCA2 Levels and Prevents β-Cell Dysfunction under Conditions of Hyperglycemic and Cytokine Stress." Molecular Endocrinology 26, no. 2 (February 1, 2012): 257–71. http://dx.doi.org/10.1210/me.2011-1181.

Full text

Abstract:

Abstract The maintenance of intracellular Ca2+ homeostasis in the pancreatic β-cell is closely regulated by activity of the sarco-endoplasmic reticulum Ca2+ ATPase (SERCA) pump. Our data demonstrate a loss of β-cell SERCA2b expression in several models of type 2 diabetes including islets from db/db mice and cadaveric diabetic human islets. Treatment of 832/13 rat INS-1-derived cells with 25 mm glucose and the proinflammatory cytokine IL-1β led to a similar loss of SERCA2b expression, which was prevented by treatment with the peroxisome proliferator-activated receptor (PPAR)-γ agonist, pioglitazone. Pioglitazone was able to also protect against hyperglycemia and cytokine-induced elevations in cytosolic Ca2+ levels, insulin-secretory defects, and cell death. To determine whether PPAR-γ was a direct transcriptional regulator of the SERCA2 gene, luciferase assays were performed and showed that a −259 bp region is sufficient to confer PPAR-γ transactivation; EMSA and chromatin immunoprecipitation experiments confirmed that PPAR-γ directly binds a PPAR response element in this proximal region. We next sought to characterize the mechanisms by which SERCA2b was down-regulated. INS-1 cells were exposed to high glucose and IL-1β in time course experiments. Within 2 h of exposure, activation of cyclin-dependent kinase 5 (CDK5) was observed and correlated with increased serine-273 phosphorylation of PPAR-γ and loss of SERCA2 protein expression, findings that were prevented by pioglitazone and roscovitine, a pharmacological inhibitor of CDK5. We conclude that pioglitazone modulates SERCA2b expression through direct transcriptional regulation of the gene and indirectly through prevention of CDK5-induced phosphorylation of PPAR-γ.

APA, Harvard, Vancouver, ISO, and other styles

20

Grover, A. K., A. Xu, S. E. Samson, and N. Narayanan. "Sarcoplasmic reticulum Ca2+ pump in pig coronary artery smooth muscle is regulated by a novel pathway." American Journal of Physiology-Cell Physiology 271, no. 1 (July 1, 1996): C181—C187. http://dx.doi.org/10.1152/ajpcell.1996.271.1.c181.

Full text

Abstract:

Coronary artery smooth muscle expresses an alternative splice (SERCA2b) of the sarcoplasmic reticulum (SR) Ca2+ pump gene SERCA2, which is also expressed in cardiac muscle (SERCA2a), but how the activity of this transporter is regulated in the coronary artery is not known. SERCA2a in the cardiac muscle can be regulated via phospholamban or, as recently reported, by a direct phosphorylation of this protein by calmodulin kinase (Xu, A., C. Hawkins, and N. Narayanan. J.Biol. Chem. 268:8394-8397, 1993). Because both SERCA2a and SERCA2b contain this calmodulin kinase phosphorylation site, we examined the effect of endogenous calmodulin kinase phosphorylation of the SR Ca2+ pump in the coronary artery. SR-enriched membranes were isolated from coronary artery smooth muscle and washed in ethylene glycol-bis-(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid to remove bound calmodulin. When these membranes were incubated with MgATP2- in the presence of Ca2+/calmodulin, a 115-kDa protein was phosphorylated. This phosphorylated 115-kDa protein was identified as SERCA2b in Western blots and by immunoprecipitation using a SERCA2-selective antibody. Preincubating the membranes in MgATP2- in the presence of Ca2+/calmodulin stimulated the subsequent Ca2+ uptake in the presence of oxalate plus MgATP2- and azide. The stimulation of Ca2+ uptake was inhibited by including the SR Ca2+ pump inhibitors thapsigargin and cyclopiazonic acid in the Ca2+ uptake medium or by including the calmodulin antagonist N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide or the calmodulin kinase II peptide fragment 290-309 in the phosphorylation solution. Thus an endogenous calmodulin-dependent kinase phosphorylated SERCA2b and activated it. Phospholamban could not be detected in these membranes in Western blots. Therefore, the regulation of the SR Ca2+ pump activity in coronary artery smooth muscle may involve a direct phosphorylation of the pump protein by an endogenous calmodulin-dependent kinase.

APA, Harvard, Vancouver, ISO, and other styles

21

Ushioda, Ryo, Akitoshi Miyamoto, Michio Inoue, Satoshi Watanabe, Masaki Okumura, Ken-ichi Maegawa, Kaiku Uegaki, et al. "Redox-assisted regulation of Ca2+ homeostasis in the endoplasmic reticulum by disulfide reductase ERdj5." Proceedings of the National Academy of Sciences 113, no. 41 (September 30, 2016): E6055—E6063. http://dx.doi.org/10.1073/pnas.1605818113.

Full text

Abstract:

Calcium ion (Ca2+) is an important second messenger that regulates numerous cellular functions. Intracellular Ca2+ concentration ([Ca2+]i) is strictly controlled by Ca2+ channels and pumps on the endoplasmic reticulum (ER) and plasma membranes. The ER calcium pump, sarco/endoplasmic reticulum calcium ATPase (SERCA), imports Ca2+ from the cytosol into the ER in an ATPase activity-dependent manner. The activity of SERCA2b, the ubiquitous isoform of SERCA, is negatively regulated by disulfide bond formation between two luminal cysteines. Here, we show that ERdj5, a mammalian ER disulfide reductase, which we reported to be involved in the ER-associated degradation of misfolded proteins, activates the pump function of SERCA2b by reducing its luminal disulfide bond. Notably, ERdj5 activated SERCA2b at a lower ER luminal [Ca2+] ([Ca2+]ER), whereas a higher [Ca2+]ER induced ERdj5 to form oligomers that were no longer able to interact with the pump, suggesting [Ca2+]ER-dependent regulation. Binding Ig protein, an ER-resident molecular chaperone, exerted a regulatory role in the oligomerization by binding to the J domain of ERdj5. These results identify ERdj5 as one of the master regulators of ER calcium homeostasis and thus shed light on the importance of cross talk among redox, Ca2+, and protein homeostasis in the ER.

APA, Harvard, Vancouver, ISO, and other styles

22

Eggermont, J. A., F. Wuytack, J. Verbist, and R. Casteels. "Expression of endoplasmic-reticulum Ca2+-pump isoforms and of phospholamban in pig smooth-muscle tissues." Biochemical Journal 271, no. 3 (November 1, 1990): 649–53. http://dx.doi.org/10.1042/bj2710649.

Full text

Abstract:

The expression of the gene 2 sarcoplasmic/endoplasmic-reticulum Ca2(+)-pump isoforms (SERCA2a and SERCA2b) and of phospholamban was studied in pig smooth muscle of the stomach, longitudinal ileum, pulmonary artery and aorta. mRNA levels were determined using an RNAase protection assay. The SERCA2 isoforms and phospholamban were tested on Western blots with a panel of antibodies, some of which were isoform-specific. The pig smooth-muscle tissues all contained comparable SERCA2 mRNA levels, but these levels were 10-20-fold lower than SERCA2 mRNA levels in cardiac muscle. Of the SERCA2 mRNAs in smooth muscle, 72-81% encoded the non-muscle isoform (SERCA2b), and Western blot analysis with isoform-specific antibodies confirmed that the SERCA2b isoform is the predominant endoplasmic-reticulum Ca2(+)-pump in smooth muscle. In contrast with SERCA2 mRNA levels, phospholamban mRNA levels varied by 12-fold between the different pig smooth-muscle tissues, with low and very low levels in the pig pulmonary artery and the pig aorta respectively. The differential expression of phospholamban was also confirmed on Western blots. The finding that the phospholamban content varied between the different smooth-muscle tissues whereas the SERCA2 expression remained rather constant indicates that, in pig smooth muscle, the expression of phospholamban is not coupled with that of SERCA2.

APA, Harvard, Vancouver, ISO, and other styles

23

John, Linu M., James D. Lechleiter, and Patricia Camacho. "Differential Modulation of SERCA2 Isoforms by Calreticulin." Journal of Cell Biology 142, no. 4 (August 24, 1998): 963–73. http://dx.doi.org/10.1083/jcb.142.4.963.

Full text

Abstract:

In Xenopus laevis oocytes, overexpression of calreticulin suppresses inositol 1,4,5-trisphosphate-induced Ca2+ oscillations in a manner consistent with inhibition of Ca2+ uptake into the endoplasmic reticulum. Here we report that the alternatively spliced isoforms of the sarcoendoplasmic reticulum Ca2+-ATPase (SERCA)2 gene display differential Ca2+ wave properties and sensitivity to modulation by calreticulin. We demonstrate by glucosidase inhibition and site-directed mutagenesis that a putative glycosylated residue (N1036) in SERCA2b is critical in determining both the selective targeting of calreticulin to SERCA2b and isoform functional differences. Calreticulin belongs to a novel class of lectin ER chaperones that modulate immature protein folding. In addition to this role, we suggest that these chaperones dynamically modulate the conformation of mature glycoproteins, thereby affecting their function.

APA, Harvard, Vancouver, ISO, and other styles

24

Misquitta, Christine M., James Mwanjewe, Lin Nie, and Ashok K. Grover. "Sarcoplasmic reticulum Ca2+ pump mRNA stability in cardiac and smooth muscle: role of the 3′-untranslated region." American Journal of Physiology-Cell Physiology 283, no. 2 (August 1, 2002): C560—C568. http://dx.doi.org/10.1152/ajpcell.00527.2001.

Full text

Abstract:

Stomach smooth muscle (SSM) and left ventricular muscle (LVM) express the sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA) pump gene SERCA2. Alternative splicing yields two major isoforms, SERCA2a in LVM and slow twitch muscle and SERCA2b in SSM and most other tissues. The splices have different 3′-untranslated regions (UTR) and also encode proteins that differ slightly in their COOH-terminal domains. SERCA2 transcription rates are similar in the two tissues, yet LVM has a much higher level of SERCA2 mRNA than SSM. To understand the control of SERCA2 RNA expression, we inhibited transcription and showed that the half-life of SERCA2 mRNA is significantly longer ( P < 0.05) in primary cultures of LVM cells than in SSM cells. Nuclear SERCA2 mRNA levels were also higher in LVM than in SSM. In vitro decay assays using synthetic RNA corresponding to the 3′-UTR of SERCA2a and -2b showed that nuclear extracts produced a faster decay of SERCA2 RNA than cytoplasmic extracts and that nuclear extracts produced a faster decay of SERCA2b than -2a. This was also true when the full-length native mRNA was used instead of the 3′-UTR RNA, and SERCA2b decay by cytoplasmic extracts was faster for LVM than for SSM. We propose that nuclear decay is an initial step in the control of SERCA2 RNA abundance and that this control is maintained or modulated in the cytoplasm. We discuss how these control mechanisms may be part of a control switch in cardiac development and pathophysiology.

APA, Harvard, Vancouver, ISO, and other styles

25

Ahn, Wooin, Min Goo Lee, Kyung Hwan Kim, and Shmuel Muallem. "Multiple Effects of SERCA2b Mutations Associated with Darier's Disease." Journal of Biological Chemistry 278, no. 23 (April 1, 2003): 20795–801. http://dx.doi.org/10.1074/jbc.m301638200.

Full text

APA, Harvard, Vancouver, ISO, and other styles

26

Rosado, Juan A., Jose A. Pariente, Gines M. Salido, and Pedro C. Redondo. "SERCA2b Activity Is Regulated by Cyclophilins in Human Platelets." Arteriosclerosis, Thrombosis, and Vascular Biology 30, no. 3 (March 2010): 419–25. http://dx.doi.org/10.1161/atvbaha.109.194530.

Full text

APA, Harvard, Vancouver, ISO, and other styles

27

Dally, Saoussen, Raymonde Bredoux, Elisabeth Corvazier, Jens P. Andersen, Johannes D. Clausen, Leonard Dode, Mohammed Fanchaouy, et al. "Ca2+-ATPases in non-failing and failing heart: evidence for a novel cardiac sarco/endoplasmic reticulum Ca2+-ATPase 2 isoform (SERCA2c)." Biochemical Journal 395, no. 2 (March 28, 2006): 249–58. http://dx.doi.org/10.1042/bj20051427.

Full text

Abstract:

We recently documented the expression of a novel human mRNA variant encoding a yet uncharacterized SERCA [SR (sarcoplasmic reticulum)/ER (endoplasmic reticulum) Ca2+-ATPase] protein, SERCA2c [Gélébart, Martin, Enouf and Papp (2003) Biochem. Biophys. Res. Commun. 303, 676–684]. In the present study, we have analysed the expression and functional characteristics of SERCA2c relative to SERCA2a and SERCA2b isoforms upon their stable heterologous expression in HEK-293 cells (human embryonic kidney 293 cells). All SERCA2 proteins induced an increased Ca2+ content in the ER of intact transfected cells. In microsomes prepared from transfected cells, SERCA2c showed a lower apparent affinity for cytosolic Ca2+ than SERCA2a and a catalytic turnover rate similar to SERCA2b. We further demonstrated the expression of the endogenous SERCA2c protein in protein lysates isolated from heart left ventricles using a newly generated SERCA2c-specific antibody. Relative to the known uniform distribution of SERCA2a and SERCA2b in cardiomyocytes of the left ventricle tissue, SERCA2c was only detected in a confined area of cardiomyocytes, in close proximity to the sarcolemma. This finding led us to explore the expression of the presently known cardiac Ca2+-ATPase isoforms in heart failure. Comparative expression of SERCAs and PMCAs (plasma-membrane Ca2+-ATPases) was performed in four nonfailing hearts and five failing hearts displaying mixed cardiomyopathy and idiopathic dilated cardiomyopathies. Relative to normal subjects, cardiomyopathic patients express more PMCAs than SERCA2 proteins. Interestingly, SERCA2c expression was significantly increased (166±26%) in one patient. Taken together, these results demonstrate the expression of the novel SERCA2c isoform in the heart and may point to a still unrecognized role of PMCAs in cardiomyopathies.

APA, Harvard, Vancouver, ISO, and other styles

28

Krols, Michiel, Geert Bultynck, and Sophie Janssens. "ER–Mitochondria contact sites: A new regulator of cellular calcium flux comes into play." Journal of Cell Biology 214, no. 4 (August 15, 2016): 367–70. http://dx.doi.org/10.1083/jcb.201607124.

Full text

Abstract:

Endoplasmic reticulum (ER)–mitochondria membrane contacts are hotspots for calcium signaling. In this issue, Raturi et al. (2016. J. Cell Biol. http://dx.doi.org/10.1083/jcb.201512077) show that the thioredoxin TMX1 inhibits the calcium pump SERCA2b at ER–mitochondria contact sites, thereby affecting ER–mitochondrial calcium transfer and mitochondrial bioenergetics.

APA, Harvard, Vancouver, ISO, and other styles

29

Stefanovic, Branko, Lela Stefanovic, Bernd Schnabl, Ramon Bataller, and David A. Brenner. "TRAM2 Protein Interacts with Endoplasmic Reticulum Ca2+ Pump Serca2b and Is Necessary for Collagen Type I Synthesis." Molecular and Cellular Biology 24, no. 4 (February 15, 2004): 1758–68. http://dx.doi.org/10.1128/mcb.24.4.1758-1768.2004.

Full text

Abstract:

ABSTRACT Cotranslational insertion of type I collagen chains into the lumen of the endoplasmic reticulum (ER) and their subsequent folding into a heterotrimeric helix is a complex process which requires coordinated action of the translation machinery, components of translocons, molecular chaperones, and modifying enzymes. Here we describe a role for the protein TRAM2 in collagen type I expression in hepatic stellate cells (HSCs) and fibroblasts. Activated HSCs are collagen-producing cells in the fibrotic liver. Quiescent HSCs produce trace amounts of type I collagen, while upon activation collagen synthesis increases 50- to 70-fold. Likewise, expression of TRAM2 dramatically increases in activated HSCs. TRAM2 shares 53% amino acid identity with the protein TRAM, which is a component of the translocon. However, TRAM2 has a C terminus with only a 15% identity. The C-terminal part of TRAM2 interacts with the Ca2+ pump of the ER, SERCA2b, as demonstrated in a Saccharomyces cerevisiae two-hybrid screen and by immunoprecipitations in human cells. TRAM2 also coprecipitates with anticollagen antibody, suggesting that these two proteins interact. Deletion of the C-terminal part of TRAM2 inhibits type I collagen synthesis during activation of HSCs. The pharmacological inhibitor of SERCA2b, thapsigargin, has a similar effect. Depletion of ER Ca2+ with thapsigargin results in inhibition of triple helical collagen folding and increased intracellular degradation. We propose that TRAM2, as a part of the translocon, is required for the biosynthesis of type I collagen by coupling the activity of SERCA2b with the activity of the translocon. This coupling may increase the local Ca2+ concentration at the site of collagen synthesis, and a high Ca2+ concentration may be necessary for the function of molecular chaperones involved in collagen folding.

APA, Harvard, Vancouver, ISO, and other styles

30

Vangheluwe, Peter, and Frank Wuytack. "Improving cardiac Ca2+ transport into the sarcoplasmic reticulum in heart failure: lessons from the ubiquitous SERCA2b Ca2+ pump." Biochemical Society Transactions 39, no. 3 (May 20, 2011): 781–87. http://dx.doi.org/10.1042/bst0390781.

Full text

Abstract:

As a major Ca2+ pump in the sarcoplasmic reticulum of the cardiomyocyte, SERCA2a (sarcoplasmic/endoplasmic reticulum Ca2+-ATPase 2a) controls the relaxation and contraction of the cardiomyocyte. It is meticulously regulated by adapting its expression levels and affinity for Ca2+ ions to the physiological demand of the heart. Dysregulation of the SERCA2a activity entails poor cardiomyocyte contractility, resulting in heart failure. Conversely, improving cardiac SERCA2a activity, e.g. by boosting its expression level or by increasing its affinity for Ca2+, is a promising strategy to rescue contractile dysfunction of the failing heart. The structures of the related SERCA1a Ca2+ pump and the Na+/K+-ATPase of the plasma membrane exposed the pumping mechanism and conserved domain architecture of these ion pumps. However, how the Ca2+ affinity of SERCA2a is regulated at the molecular level remained unclear. A structural and functional analysis of the closely related SERCA2b Ca2+ pump, i.e. the housekeeping Ca2+ pump found in the endoplasmic reticulum and the only SERCA isoform characterized by a high Ca2+ affinity, aimed to fill this gap. We demonstrated the existence of a novel and highly conserved site on the SERCA2 pump mediating Ca2+ affinity regulation by the unique C-terminus of SERCA2b (2b-tail). It differs from the earlier-described target site of the affinity regulator phospholamban. Targeting this novel site may provide a new approach to improve SERCA2a function in the failing heart. Strikingly, the intramembrane interaction site of the 2b-tail in SERCA2b shares sequence and structural homology with the binding site of the β-subunit on the α Na+/K+-ATPase. Thus P-type ATPases seem to have developed related mechanisms of regulation, and it is a future challenge for us to discover these general principles of P-type regulation.

APA, Harvard, Vancouver, ISO, and other styles

31

Magnier, C., R. Bredoux, T. Kovacs, R. Quarck, B. Papp, E. Corvazier, J. de Gunzburg, and J. Enouf. "Correlated expression of the 97 kDa sarcoendoplasmic reticulum Ca2+-ATPase and Rap1B in platelets and various cell lines." Biochemical Journal 297, no. 2 (January 15, 1994): 343–50. http://dx.doi.org/10.1042/bj2970343.

Full text

Abstract:

Evidence has accumulated that cyclic AMP (cAMP)-induced phosphorylation of a Ras-related protein (Rap1) regulates platelet Ca2+ transport. As this transport was recently found to be controlled by two isoforms of sarcoendoplasmic reticulum Ca(2+)-ATPase (SERCA), the 100 kDa SERCA2b and the newly identified 97 kDa SERCA, we attempted to establish which isoform is involved in this regulation. For this purpose, we studied the expression and regulation of both the SERCA and Rap1 isoforms in platelets, haemopoietic cells and various cancer cell lines. SERCA2b was shown to be equally expressed in all the cell lines tested, as determined by detection of its phosphoenzyme formation and by Western blotting using an isoform-specific antibody. In contrast, the expression of the 97 kDa SERCA, studied by the same methods, varied from total absence in the cancer cells to high levels in the megakaryocytic cell lines. With regard to the potential regulatory Rap1 proteins, Western blotting showed different expression of total Rap1 isoforms among the cell lineages, thus ruling out any possible relationship between Rap1 and SERCA2b. However, the expression of Rap1 proteins correlated with that of the 97 kDa SERCA isoform. More refined analysis of the rap1A and rap1B isoforms by reverse transcription PCR and by determining cAMP-induced phosphorylation of Rap1B, i.e. its functional mechanism, confirmed the correlation between Rap1B and the 97 kDa SERCA expression. This relationship was also established by the concerted up-regulation of these two proteins demonstrated in the pathological model of platelets from hypertensive rats. It is concluded that the expressions of 97 KDa SERCA and Rap1B are related, suggesting that regulation of the platelet Ca(2+)-ATPase system by cAMP-induced phosphorylation of Rap1B specifically involves the 97 kDa SERCA.

APA, Harvard, Vancouver, ISO, and other styles

32

Hewarathna, Asha, Elena Dremina, and Christian Schöneich. "Inhibition and conformational change of SERCA3b induced by Bcl-2." Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics 1865, no. 1 (January 2017): 121–31. http://dx.doi.org/10.1016/j.bbapap.2016.09.004.

Full text

APA, Harvard, Vancouver, ISO, and other styles

33

Caspersen, Casper, and Marek Treiman. "SERCA2b, ENDOPLASMIC RETICULUM CALCIUM PUMP, IS A STRESS-INDUCIBLE PROTEIN." Biochemical Society Transactions 28, no. 1 (February 1, 2000): A33. http://dx.doi.org/10.1042/bst028a033a.

Full text

APA, Harvard, Vancouver, ISO, and other styles

34

Chen, L., S. Xu, Y. Xu, W. Lu, L. Liu, D. Yue, J. Teng, and J. Chen. "Cab45S promotes cell proliferation through SERCA2b inhibition and Ca2+ signaling." Oncogene 35, no. 1 (March 16, 2015): 35–46. http://dx.doi.org/10.1038/onc.2015.56.

Full text

APA, Harvard, Vancouver, ISO, and other styles

35

Lièvremont, J. P., A. M. Hill, M. Hilly, and J. P. Mauger. "The inositol 1,4,5-trisphosphate receptor is localized on specialized sub-regions of the endoplasmic reticulum in rat liver." Biochemical Journal 300, no. 2 (June 1, 1994): 419–27. http://dx.doi.org/10.1042/bj3000419.

Full text

Abstract:

Inositol 1,4,5-trisphosphate (InsP3) is involved in the mobilization of Ca2+ from intracellular non-mitochondrial stores. In rat liver, it has been shown that the InsP3-binding site co-purifies with the plasma membrane. This suggests that in the liver the InsP3 receptor (InsP3R) associates with plasma membrane. We studied the subcellular distribution of the liver InsP3R by measuring the maximal binding capacity of [3H]InsP3 and using antibodies against the 14 C-terminal residues of the type 1 InsP3R. The antibodies recognized a large amount of an InsP3R protein of 260 kDa in a membrane fraction which is also enriched with [3H]InsP3-binding sites and with markers of the basal, the lateral and the bile-canalicular membrane and the plasma-membrane Ca2+ pump (PMCA). The fractions enriched in markers of the endoplasmic reticulum (ER) and the Ca2+ pump of the ER (SERCA2b) contained low levels of InsP3 receptors. The immunofluorescent labelling of cultured hepatocytes with anti-InsP3R antibodies indicated that the receptor is concentrated in the perinuclear area and in some regions near the plasma membrane. The fraction enriched with InsP3R is also contaminated with markers of the ER and with SERCA2b. It was exposed to alkaline medium (pH 10.5) to extract endogenous actin and membrane-associated proteins before being subfractionated by Percoll-gradient centrifugation. The alkaline treatment allowed partial separation of the markers of the ER from the markers of the plasma membrane. The InsP3R was recovered in the heavy subfraction, which was also enriched with markers for the ER and with the SERCA2b and contained low levels of markers of the plasma membrane. These data indicate that the InsP3R is neither localized on the plasma membrane itself nor homogeneously distributed on the ER membrane. This supports the view that part of the receptor is localized on a specialized sub-region of the ER which interacts with the plasma membrane.

APA, Harvard, Vancouver, ISO, and other styles

36

Morita, Mitsuhiro, and Yoshihisa Kudo. "Growth factors upregulate astrocyte [Ca2+]i oscillation by increasing SERCA2b expression." Glia 58, no. 16 (September 27, 2010): 1988–95. http://dx.doi.org/10.1002/glia.21067.

Full text

APA, Harvard, Vancouver, ISO, and other styles

37

Chen, Tao, Paromita Ghosh, Christine M. Misquitta, Archana Govindan, and Ashok K. Grover. "Characterization of SERCA2b Ca2+–Mg2+ ATPase mRNA decay by nuclear proteins." Cell Calcium 41, no. 6 (June 2007): 581–92. http://dx.doi.org/10.1016/j.ceca.2006.10.008.

Full text

APA, Harvard, Vancouver, ISO, and other styles

38

Mottillo, Emilio P., Vanesa D. Ramseyer, and James G. Granneman. "SERCA2b Cycles Its Way to UCP1-Independent Thermogenesis in Beige Fat." Cell Metabolism 27, no. 1 (January 2018): 7–9. http://dx.doi.org/10.1016/j.cmet.2017.12.015.

Full text

APA, Harvard, Vancouver, ISO, and other styles

39

Roderick, H. Llewelyn, James D. Lechleiter, and Patricia Camacho. "Cytosolic Phosphorylation of Calnexin Controls Intracellular Ca2+ Oscillations via an Interaction with Serca2b." Journal of Cell Biology 149, no. 6 (June 12, 2000): 1235–48. http://dx.doi.org/10.1083/jcb.149.6.1235.

Full text

Abstract:

Calreticulin (CRT) and calnexin (CLNX) are lectin chaperones that participate in protein folding in the endoplasmic reticulum (ER). CRT is a soluble ER lumenal protein, whereas CLNX is a transmembrane protein with a cytosolic domain that contains two consensus motifs for protein kinase (PK) C/proline- directed kinase (PDK) phosphorylation. Using confocal Ca2+ imaging in Xenopus oocytes, we report here that coexpression of CLNX with sarco endoplasmic reticulum calcium ATPase (SERCA) 2b results in inhibition of intracellular Ca2+ oscillations, suggesting a functional inhibition of the pump. By site-directed mutagenesis, we demonstrate that this interaction is regulated by a COOH-terminal serine residue (S562) in CLNX. Furthermore, inositol 1,4,5-trisphosphate– mediated Ca2+ release results in a dephosphorylation of this residue. We also demonstrate by coimmunoprecipitation that CLNX physically interacts with the COOH terminus of SERCA2b and that after dephosphorylation treatment, this interaction is significantly reduced. Together, our results suggest that CRT is uniquely regulated by ER lumenal conditions, whereas CLNX is, in addition, regulated by the phosphorylation status of its cytosolic domain. The S562 residue in CLNX acts as a molecular switch that regulates the interaction of the chaperone with SERCA2b, thereby affecting Ca2+ signaling and controlling Ca2+-sensitive chaperone functions in the ER.

APA, Harvard, Vancouver, ISO, and other styles

40

BUYSE, Gunnar, Dominique TROUET, Thomas VOETS, Ludwig MISSIAEN, Guy DROOGMANS, Bernd NILIUS, and Jan EGGERMONT. "Evidence for the intracellular location of chloride channel (ClC)-type proteins: co-localization of ClC-6a and ClC-6c with the sarco/endoplasmic-reticulum Ca2+ pump SERCA2b." Biochemical Journal 330, no. 2 (March 1, 1998): 1015–21. http://dx.doi.org/10.1042/bj3301015.

Full text

Abstract:

Chloride channel protein (ClC)-6a and ClC-6c, a kidney-specific splice variant with a truncated C-terminus, are proteins that belong structurally to the family of voltage-dependent chloride channels. Attempts to characterize functionally ClC-6a or ClC-6c in Xenopus oocytes have so far been negative. Similarly, expression of both ClC-6 isoforms in mammalian cells failed to provide functional information. One possible explanation of these negative results is that ClC-6 is an intracellular chloride channel rather than being located in the plasma membrane. We therefore studied the subcellular location of ClC-6 isoforms by transiently transfecting COS and CHO cells with epitope-tagged versions of ClC-6a and ClC-6c. Confocal imaging of transfected cells revealed for both ClC-6 isoforms an intracellular distribution pattern that clearly differed from the peripheral location of CD2, a plasma-membrane glycoprotein. Furthermore, dual-labelling experiments of COS cells co-transfected with ClC-6a or -6c and the sarco/endoplasmic-reticulum Ca2+ pump (SERCA2b) indicated that the ClC-6 isoforms co-localized with the SERCA2b Ca2+ pump. Thus ClC-6a and ClC-6c are intracellular membrane proteins, most likely residing in the endoplasmic reticulum. In view of their structural similarity to proven chloride channels, ClC-6 isoforms are molecular candidates for intracellular chloride channels.

APA, Harvard, Vancouver, ISO, and other styles

41

Chami, Mounia, Devrim Gozuacik, David Lagorce, Marisa Brini, Pierre Falson, Gérard Peaucellier, Paolo Pinton, et al. "Serca1 Truncated Proteins Unable to Pump Calcium Reduce the Endoplasmic Reticulum Calcium Concentration and Induce Apoptosis." Journal of Cell Biology 153, no. 6 (June 11, 2001): 1301–14. http://dx.doi.org/10.1083/jcb.153.6.1301.

Full text

Abstract:

By pumping calcium from the cytosol to the ER, sarco/endoplasmic reticulum calcium ATPases (SERCAs) play a major role in the control of calcium signaling. We describe two SERCA1 splice variants (S1Ts) characterized by exon 4 and/or exon 11 splicing, encoding COOH terminally truncated proteins, having only one of the seven calcium-binding residues, and thus unable to pump calcium. As shown by semiquantitative RT-PCR, S1T transcripts are differentially expressed in several adult and fetal human tissues, but not in skeletal muscle and heart. S1T proteins expression was detected by Western blot in nontransfected cell lines. In transiently transfected cells, S1T homodimers were revealed by Western blot using mildly denaturing conditions. S1T proteins were shown, by confocal scanning microscopy, to colocalize with endogenous SERCA2b into the ER membrane. Using ER-targeted aequorin (erAEQ), we have found that S1T proteins reduce ER calcium and reverse elevation of ER calcium loading induced by SERCA1 and SERCA2b. Our results also show that SERCA1 variants increase ER calcium leakage and are consistent with the hypothesis of a cation channel formed by S1T homodimers. Finally, when overexpressed in liver-derived cells, S1T proteins significantly induce apoptosis. These data reveal a further mechanism modulating Ca2+ accumulation into the ER of nonmuscle cells and highlight the relevance of S1T proteins to the control of apoptosis.

APA, Harvard, Vancouver, ISO, and other styles

42

Atkin, L. "Rosiglitazone-induced SERCA2b inhibition: implications for monocyte cytoskeletal remodelling and diabetic microangiopathy." Bioscience Horizons 1, no. 1 (March 1, 2008): 1–8. http://dx.doi.org/10.1093/biohorizons/hzn001.

Full text

APA, Harvard, Vancouver, ISO, and other styles

43

Louch, William E., Peter Vangheluwe, Virginie Bito, Luc Raeymaekers, Frank Wuytack, and Karin R. Sipido. "Phospholamban ablation in hearts expressing the high affinity SERCA2b isoform normalizes global Ca2+ homeostasis but not Ca2+-dependent hypertrophic signaling." American Journal of Physiology-Heart and Circulatory Physiology 302, no. 12 (June 15, 2012): H2574—H2582. http://dx.doi.org/10.1152/ajpheart.01166.2011.

Full text

Abstract:

Cardiomyocytes from failing hearts exhibit reduced levels of the sarcoplasmic reticulum (SR) Ca2+-ATPase (SERCA) and/or increased activity of the endogenous SERCA inhibitor phospholamban. The resulting reduction in the Ca2+ affinity of SERCA impairs SR Ca2+ cycling in this condition. We have previously investigated the physiological impact of increasing the Ca2+ affinity of SERCA by substituting SERCA2a with the higher affinity SERCA2b pump. When phospholamban was also ablated, these double knockouts (DKO) exhibited a dramatic reduction in total SERCA levels, severe hypertrophy, and diastolic dysfunction. We presently examined the role of cardiomyocyte Ca2+ homeostasis in both functional and structural remodeling in these hearts. Despite the low SERCA levels in DKO, we observed near-normal Ca2+ homeostasis with rapid Ca2+ reuptake even at high Ca2+ loads and stimulation frequencies. Well-preserved global Ca2+ homeostasis in DKO was paradoxically associated with marked activation of the Ca2+-dependent nuclear factor of activated T-cell-calcineurin pathway known to trigger hypertrophy. No activation of the MAP kinase signaling pathway was detected. These findings suggest that local changes in Ca2+ homeostasis may play an important signaling role in DKO, perhaps due to reduced microdomain Ca2+ buffering by SERCA2b. Furthermore, alterations in global Ca2+ homeostasis can also not explain impaired in vivo diastolic function in DKO. Taken together, our results suggest that normalizing global cardiomyocyte Ca2+ homeostasis does not necessarily protect against hypertrophy and heart failure development and that excessively increasing SERCA Ca2+ affinity may be detrimental.

APA, Harvard, Vancouver, ISO, and other styles

44

Tuusa, Jussi T., Tarja T. Leskelä, and Ulla E. Petäjä-Repo. "Human δ opioid receptor biogenesis is regulated via interactions with SERCA2b and calnexin." FEBS Journal 277, no. 13 (May 27, 2010): 2815–29. http://dx.doi.org/10.1111/j.1742-4658.2010.07699.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

45

Vandecaetsbeek, I., M. Trekels, M. De Maeyer, H. Ceulemans, E. Lescrinier, L. Raeymaekers, F. Wuytack, and P. Vangheluwe. "Structural basis for the high Ca2+ affinity of the ubiquitous SERCA2b Ca2+ pump." Proceedings of the National Academy of Sciences 106, no. 44 (October 21, 2009): 18533–38. http://dx.doi.org/10.1073/pnas.0906797106.

Full text

APA, Harvard, Vancouver, ISO, and other styles

46

Yamasaki-Mann, Michiko, and Ian Parker. "Enhanced ER Ca2+ store filling by overexpression of SERCA2b promotes IP3-evoked puffs." Cell Calcium 50, no. 1 (July 2011): 36–41. http://dx.doi.org/10.1016/j.ceca.2011.04.008.

Full text

APA, Harvard, Vancouver, ISO, and other styles

47

Zádor, Ernő, and Magdolna Kósa. "The neonatal sarcoplasmic/endoplasmic reticulum calcium ATPase (SERCA1b): a neglected pump in scope." Pflügers Archiv - European Journal of Physiology 467, no. 7 (December 18, 2014): 1395–401. http://dx.doi.org/10.1007/s00424-014-1671-3.

Full text

APA, Harvard, Vancouver, ISO, and other styles

48

KOVÁCS, Tünde, Ferenc FELFÖLDI, Béla PAPP, Katalin PÁSZTY, Raymonde BREDOUX, Ágnes ENYEDI, and Jocelyne ENOUF. "All three splice variants of the human sarco/endoplasmic reticulum Ca2+-ATPase 3 gene are translated to proteins: a study of their co-expression in platelets and lymphoid cells." Biochemical Journal 358, no. 3 (September 10, 2001): 559–68. http://dx.doi.org/10.1042/bj3580559.

Full text

Abstract:

The molecular cloning of two previously unknown human sarco/endoplasmic reticulum Ca2+-ATPase 3 (SERCA3) 3′-end transcripts, 3b and 3c, has been recently published. Data were lacking, however, for the presence of these SERCA3 variants in different tissue or cell types at the protein level. Here we report the co-expression of three human SERCA3 protein isoforms in platelets and T lymphoid Jurkat cells. Isoform-specific polyclonal anti-peptide antibodies have been generated that recognize specifically the SERCA3a, 3b or 3c splice variants at their C-termini, and this has been confirmed by peptide-competition experiments as well. None of these antibodies cross-reacted with the housekeeping SERCA2b isoform co-expressed endogenously with SERCA3 proteins in non-muscle cells. Although all three SERCA3 isoforms could be detected in platelets, the 3a form was the most abundantly expressed species. Its size matched the apparent size of SERCA3a over-expressed in HEK-293 cells. Immunoprecipitation of the SERCA3 variants from platelet membranes using a PL/IM 430-affinity matrix provided evidence that the putative pan-anti-SERCA3 antibody, PL/IM 430, recognizes all SERCA3 protein isoforms. The epitope for the PL/IM 430 antibody could be localized in a 40kDa N-terminal tryptic fragment common to all three SERCA3 variants. Comparative Western-blot analysis showed that the expression level of the SERCA3a, 3b and 3c isoforms was more than 10 times lower in Jurkat cells than in platelets, whereas expression of the ubiquitous SERCA2b was nearly identical. This work highlights new Ca2+-transporting proteins of haematopoietic cells and provides specific antibodies for their detection.

APA, Harvard, Vancouver, ISO, and other styles

49

LIÈVREMONT, Jean-Philippe, Anne-Marie HILL, Dien TRAN, Jean-François COQUIL, Nicole STELLY, and Jean-Pierre MAUGER. "Intracellular calcium stores and inositol 1,4,5-trisphosphate receptor in rat liver cells." Biochemical Journal 314, no. 1 (February 15, 1996): 189–97. http://dx.doi.org/10.1042/bj3140189.

Full text

Abstract:

The D-myo-inositol 1,4,5-trisphosphate [Ins(1,4,5)P3] receptor was localized by immunofluorescence experiments in situ in liver cryosections. Two anti-Ins(1,4,5)P3 receptor antibodies (against the 14 C-terminal residues of the type 1 receptor or against the entire cerebellar receptor) weakly decorated the whole cytoplasm, and a more intense labelling was observed at the periphery of the hepatocytes, particularly beneath the canalicular and the sinusoidal domains of the plasma membrane (PM). Antibodies against calreticulin, the Ca2+ pump (SERCA2b) or endoplasmic reticulum (ER) membranes homogeneously labelled the cytoplasm and the subplasmalemmal area. These data indicate that the ER can be divided into at least two specialized subregions: one is located throughout most of the cytoplasm and contains markers of the rough ER (RER), calreticulin, SERCA2b and a low density of Ins(1,4,5)P3 receptor, and the other is confined to the periphery of the cells and contains calreticulin, Ca2+ pump, RER markers and a high density of Ins(1,4,5)P3 receptor. A membrane fraction enriched in Ins(1,4,5)P3 receptor and in markers of the PM was immuno-adsorbed with the antibody against the C-terminal end of the Ins(1,4,5)P3 receptor and pelleted with Sepharose protein A. The immuno-isolated material was enriched in Ins(1,4,5)P3 receptor, but none of the markers of the ER or of the PM could be detected. This suggests that the Ins(1,4,5)P3 receptor is localized on discrete domains of the ER membrane beneath the canalicular and the sinusoidal membranes, where it was found at higher densities than the other markers.

APA, Harvard, Vancouver, ISO, and other styles

50

Iyer, Malini S., Rebecca L. Paszkiewicz, Richard N. Bergman, Joyce M. Richey, Orison O. Woolcott, Isaac Asare-Bediako, Qiang Wu, et al. "Activation of NPRs and UCP1-independent pathway following CB1R antagonist treatment is associated with adipose tissue beiging in fat-fed male dogs." American Journal of Physiology-Endocrinology and Metabolism 317, no. 3 (September 1, 2019): E535—E547. http://dx.doi.org/10.1152/ajpendo.00539.2018.

Full text

Abstract:

CB1 receptor (CB1R) antagonism improves the deleterious effects of a high-fat diet (HFD) by reducing body fat mass and adipocyte cell size. Previous studies demonstrated that the beneficial effects of the CB1R antagonist rimonabant (RIM) in white adipose tissue (WAT) are partially due to an increase of mitochondria numbers and upregulation thermogenesis markers, suggesting an induction of WAT beiging. However, the molecular mechanism by which CB1R antagonism induces weight loss and WAT beiging is unclear. In this study, we probed for genes associated with beiging and explored longitudinal molecular mechanisms by which the beiging process occurs. HFD dogs received either RIM (HFD+RIM) or placebo (PL) (HFD+PL) for 16 wk. Several genes involved in beiging were increased in HFD+RIM compared with pre-fat, HFD, and HFD+PL. We evaluated lipolysis and its regulators including natriuretic peptide (NP) and its receptors ( NPRs), β-1 and β-3 adrenergic receptor ( β1R, β3R) genes. These genes were increased in WAT depots, accompanied by an increase in lipolysis in HFD+RIM. In addition, RIM decreased markers of inflammation and increased adiponectin receptors in WAT. We observed a small but significant increase in UCP1; therefore, we evaluated the newly discovered UCP1-independent thermogenesis pathway. We confirmed that SERCA2b and RYR2, the two key genes involved in this pathway, were upregulated in the WAT. Our data suggest that the upregulation of NPRs, β-1R and β-3R, lipolysis, and SERCA2b and RYR2 may be one of the mechanisms by which RIM promotes beiging and overall the improvement of metabolic homeostasis induced by RIM.

APA, Harvard, Vancouver, ISO, and other styles

Journal articles on the topic 'Sercambi'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles