To see the other types of publications on this topic, follow the link: Serdab.
Journal articles on the topic 'Serdab'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Serdab.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Grover, A. K., S. E. Samson, and C. M. Misquitta. "Sarco(endo)plasmic reticulum Ca2+ pump isoform SERCA3 is more resistant than SERCA2b to peroxide." American Journal of Physiology-Cell Physiology 273, no. 2 (August 1, 1997): C420—C425. http://dx.doi.org/10.1152/ajpcell.1997.273.2.c420.
Full textAbstract:
Sarco(endo)plasmic reticulum Ca2+ pumps are encoded by genes SERCA1, SERCA2, and SERCA3. Most tissues express SERCA2 Ca2+ pumps (splice SERCA2b) which are inactivated by reactive oxygen. In contrast, SERCA3 is expressed in tissues such as tracheal epithelium, mast cells, lymphoid cells, and aortic endothelium, which are frequently exposed to oxidative stress. Therefore, we compared SERCA3 and SERCA2b proteins for their sensitivity to oxidation. We isolated microsomes from HEK-293 cells overexpressing SERCA3 or SERCA2b. We incubated the microsomes with different concentrations of hydrogen peroxide and then determined Ca2+ pump activities in them in the following three assay systems: ATP-dependent oxalate-stimulated azide-insensitive 45Ca2+ uptake by the microsomal vesicles, Ca(2+)-Mg(2+)-ATPase, and Ca(2+)-dependent acylphosphate formation. Peroxide inhibited the pump activities in microsomes with half-maximal inhibitory concentration (IC50) values of 69 +/- 14, 66 +/- 13, and 84 +/- 15 microM for the 45Ca2+ uptake, Ca(2+)-Mg(2+)-ATPase, and the acylphosphate formation reactions, respectively. However, for microsomes from SERCA3-expressing cells, the corresponding values of IC50 for peroxide were 274 +/- 47, 857 +/- 110, and 746 +/- 40 microM. Thus, in each assay system, the resistance to inactivation by peroxide was significantly (P < 0.05) higher for the SERCA3 protein than for SERCA2b. The SERCA3 resistance to oxidants may aid the cells expressing it to function during exposure to oxidative stress.
2
Simons, Frank. "Innovation in Serdab Decoration in the Late Sixth Dynasty." Journal of Egyptian Archaeology 102, no. 1 (January 2016): 196–203. http://dx.doi.org/10.1177/030751331610200115.
Full text
3
Baines, John, and Christina Riggs. "Archaism and Kingship: A Late Royal Statue and its Early Dynastic Model." Journal of Egyptian Archaeology 87, no. 1 (December 2001): 103–18. http://dx.doi.org/10.1177/030751330108700110.
Full textAbstract:
Publication of British Museum EA 941, a Late Period or early Ptolemaic royal statue in travertine whose model is the Early Dynastic statue of Djoser (Cairo JE 49158) from the serdab on the north side of his Step Pyramid, or another statue of the same type. We present the British Museum statue, compare it with the Djoser statue, and argue for the former's likely dating and Saqqara provenance. Both statues are significant for their iconography of divine kingship and mortuary transfiguration.
4
Chandrasekera, P. Charukeshi, Margaret E. Kargacin, Julie P. Deans, and Jonathan Lytton. "Determination of apparent calcium affinity for endogenously expressed human sarco(endo)plasmic reticulum calcium-ATPase isoform SERCA3." American Journal of Physiology-Cell Physiology 296, no. 5 (May 2009): C1105—C1114. http://dx.doi.org/10.1152/ajpcell.00650.2008.
Full textAbstract:
The sarco(endo)plasmic reticulum Ca2+-ATPases (SERCAs) play a crucial role in regulating free cytosolic Ca2+ concentration in diverse cell types. It has been shown that recombinant SERCA3, when measured in heterologous systems, exhibits low apparent affinity for Ca2+; however, Ca2+ affinity of native SERCA3 in an endogenous setting has not been examined. Such a measurement is complicated, because SERCA3 is always coexpressed with the housekeeping isoform SERCA2b. We used a fluorescence-based assay for monitoring continuous Ca2+ uptake into microsomes to examine the properties of endogenous human SERCA3 and SERCA2b. The kinetic parameters were derived using a cooperative two-component uptake model for Ca2+ activation, and the values assigned to SERCA3 were confirmed using the highly specific human SERCA3 inhibitory antibody PL/IM430. First, using recombinant human SERCA3 and SERCA2b proteins transiently expressed in HEK-293 cells, we confirmed the previously observed low apparent Ca2+ affinity for SERCA3 compared with SERCA2b (1.10 ± 0.04 vs. 0.26 ± 0.01 μM), and using mixtures of recombinant protein isoforms, we validated the two-component uptake model. Then we determined apparent Ca2+ affinity for SERCA proteins present endogenously in cultured Jurkat T lymphocytes and freshly isolated human tonsil lymphocytes. The apparent Ca2+ affinity in these two preparations was 1.04 ± 0.07 and 1.1 ± 0.2 μM for SERCA3 and 0.27 ± 0.02 and 0.26 ± 0.01 μM for SERCA2b, respectively. Our data demonstrate, for the first time, that affinity for Ca2+ is inherently lower for SERCA3 expressed in situ than for other SERCA isoforms.
5
Pacifico, F., L. Ulianich, S. De Micheli, S. Treglia, A. Leonardi, P. Vito, S. Formisano, E. Consiglio, and B. Di Jeso. "The expression of the sarco/endoplasmic reticulum Ca2+-ATPases in thyroid and its down-regulation following neoplastic transformation." Journal of Molecular Endocrinology 30, no. 3 (June 1, 2003): 399–409. http://dx.doi.org/10.1677/jme.0.0300399.
Full textAbstract:
Maintaining a high Ca(2+) concentration in the lumen of the endoplasmic reticulum (ER), by the action of sarco/endoplasmic reticulum Ca(2+)-ATPases (SERCAs), is important in many cellular processes, such as Ca(2+)-mediated cytosolic signaling in response to extracellular stimuli, cell growth and proliferation, and synthesis, processing and folding of ER-translated proteins. In the thyroid gland, SERCAs have not been studied yet, and there is little information available on general problems such as the expression of SERCAs following neoplastic transformation. In this study we investigated the expression of SERCA2b and SERCA3 in rat thyroid tIssue and, in addition, in normal and transformed rat thyroid cell lines. RT-PCR and Northern blot assays showed that SERCA2b is the SERCA form preferentially expressed in the thyroid. In rat thyroid, SERCA2b mRNA was expressed at a higher level than that of other non-muscle tIssues such as liver or spleen, but at much lower level than in brain. On the other hand, SERCA3 mRNA was not detected in thyroid by Northern blot analysis, or barely detected by RT-PCR assays. We also studied the SERCA2b expression pattern in PC Cl3 thyroid cells transformed by several oncogenes that induce different degrees of malignancy and dedifferentiation. RT-PCR and Northern blot assays showed that SERCA2b mRNA expression dramatically decreased in highly tumorigenic thyroid cells, while expression of glyceraldehyde-3-phosphate dehydrogenase mRNA, a housekeeping gene used as internal control, exhibited no variations. The dramatic down-regulation of SERCA2b expression in fully transformed thyroid cells was also evident by Western blot analysis. Also, following neoplastic transformation of thyroid cells, the enzymatic activity of SERCA2b was reduced in a measure which correlated with the mRNA and protein levels. Therefore, rat thyrocytes expressed intermediate levels of SERCAs, mostly the SERCA2b isoform. This pattern of expression was basically reproduced in fully differentiated thyroid cells in culture and was sensitive to neoplastic transformation.
6
LACABARATZ-PORRET, Christine, Sophie LAUNAY, Elisabeth CORVAZIER, Raymonde BREDOUX, Béla PAPP, and Jocelyne ENOUF. "Biogenesis of endoplasmic reticulum proteins involved in Ca2+ signalling during megakaryocytic differentiation: an in vitro study." Biochemical Journal 350, no. 3 (September 8, 2000): 723–34. http://dx.doi.org/10.1042/bj3500723.
Full textAbstract:
The endoplasmic reticulum (ER) plays a key role in Ca2+ signalling through Ca2+ release via inositol 1,4,5-trisphosphate receptors (InsP3-Rs) and Ca2+ uptake by sarco/endoplasmic reticulum Ca2+-ATPases (SERCAs). Here, we investigated the organization of platelet ER and its biogenesis during megakaryocytopoiesis. First, erythro/megakaryoblastic MEG 01, UT7, M-O7e and CHRF 288-11 cell lines, platelets and thrombopoietin-induced UT7-Mpl cells were selected for the study of SERCA2b and SERCA3 proteins by Western blotting using the antibodies IID8 and PL/IM430, respectively. As judged by platelet glycoprotein IIIa (GPIIIa) expression, an increase in SERCA3 proteins was observed while that of SERCA2b remained unchanged throughout maturation. Second, these studies were extended to the newly described alternatively spliced SERCA3a–c RNAs and InsP3-Rs using the in vitro model of PMA-induced differentiation of MEG 01 cells. Time-course and dose–response studies showed a maximal approx. 4-fold up-regulation of SERCA3 proteins using 10-8 M PMA for 3 days, which paralleled induction of GPIIIa expression. SERCA3 induction was found to occur at the level of mRNA. The modulation of the different SERCA3 species (i.e. 3a, 3b and 3c) was isoform-specific: while SERCA3a was slightly increased, an approx. 3-fold induction of SERCA3b, and a 4-fold induction of SERCA3c, was observed after 24h of PMA treatment. Isoform-specific Western blotting and/or reverse transcriptase PCR studies showed that InsP3-R types I, II and III are expressed in MEG 01 cells, as well as in platelets. Study of the expression of these InsP3-R types in PMA-induced MEG 01 cells revealed that: (i) InsP3-RI protein and mRNA showed no changes; (ii) InsP3-RII mRNA was up-regulated and peaked at hour 48 and (iii) InsP3-RIII mRNA and protein showed a transitory maximal 3- and 2.3-fold increase at hours 6 and 30, respectively. Upon PMA treatment of CHRF 288-11 cells, in which GPIIIa is not induced upon treatment, a similar pattern of regulation of InsP3-R types II and III was seen, but a distinct pattern of SERCA3 regulation was observed. These results suggest a profound reorganization of ER-protein patterns during megakaryocytopoiesis and underline the role of SERCA3 gene regulation in the control of Ca2+-dependent platelet functions.
7
Zarain-Herzberg, Angel, and Georgina Alvarez-Fernandez. "Sarco(endo)plasmic Reticulum Ca2+-ATPase-2 Gene: Structure and Transcriptional Regulation of the Human Gene." Scientific World JOURNAL 2 (2002): 1469–83. http://dx.doi.org/10.1100/tsw.2002.228.
Full textAbstract:
The sarco(endo)plasmic reticulum Ca2+-ATPases (SERCAs) belong to a family of active calcium transport enzymes encoded by the SERCA1, 2, and 3 genes. In this study, we describe the complete structure of the human SERCA2 gene and its 5’ -regulatory region. The hSERCA2 gene is located in chromosome 12 position q24.1 in Contig NT_009770.8, spans 70 kb, and is organized in 21 exons intervened by 20 introns. The last two exons of the pre-mRNA produce by alternatively splicing the cardiac/slow-twitch muscle-specific SERCA2a isoform and the ubiquitous SERCA2b isoform. The sequence of the proximal 225-bp regulatory region of the SERCA2 genes is 80% G+C-rich and is conserved among human, rabbit, rat, and mouse species. It contains a TATA-like-box, an E-box/USF sequence, a CAAT-box, four Sp1 binding sites, and a thyroid hormone responsive element (TRE). There are two other conserved regulatory regions located between positions -410 to -661 bp and from -919 to -1410 bp. Among the DNA cis-elements present in these two regulatory regions there are potential binding sites for: GATA-4, -5, -6, Nkx-2.5/Csx, OTF-1, USF, MEF-2, SRF, PPAR/RXR, AP-2, and TREs. Upstream from position -1.5 kb, there is no significant homology among the SERCA2 genes cloned. In addition, the human gene has several repeated sequences mainly of the Alu and L2 type located upstream from position -1.7 kb, spanning in a continuous fashion for more than 40 kb. In this study, we report the cloning of 2.4 kb of 5’-regulatory region and demonstrate that the proximal promoter region is sufficient for expression in cardiac myocytes, and the region from -225 to -1232 bp contains regulatory DNA elements which down-regulate the expression of the SERCA2 gene in neonatal cardiomyocytes.
8
Wu, K. D., W. S. Lee, J. Wey, D. Bungard, and J. Lytton. "Localization and quantification of endoplasmic reticulum Ca(2+)-ATPase isoform transcripts." American Journal of Physiology-Cell Physiology 269, no. 3 (September 1, 1995): C775—C784. http://dx.doi.org/10.1152/ajpcell.1995.269.3.c775.
Full textAbstract:
The Ca(2+)-adenosinetriphosphatase pump of the sarcoplasmic or endoplasmic reticulum (SERCA) plays a critical role in Ca2+ signaling and homeostasis in all cells and is encoded by a family of homologous and alternatively spliced genes. To understand more clearly the role the different isoforms play in cell physiology, we have undertaken a quantitative and qualitative assessment of the tissue distribution of transcripts encoding each SERCA isoform. SERCA1 expression is restricted to fast-twitch striated muscles, SERCA2a to cardiac and slow-twitch striated muscles, whereas SERCA2b is ubiquitously expressed. SERCA3 is expressed most abundantly in large and small intestine, thymus, and cerebellum and at lower levels in spleen, lymph node, and lung. In situ hybridization analyses revealed SERCA3 transcripts in cells of the intestinal crypt, the thymic cortex, and Purkinje cells in cerebellum. In addition, SERCA3 was expressed abundantly in isolated rat spleen lymphocytes, in various murine lymphoid cell lines, and in primary cultured microvascular endothelial cells. This analysis demonstrates that SERCA3 is expressed selectively in cells in which Ca2+ signaling plays a critical and sensitive role in regulating physiological processes.
9
Chami, Mounia, Devrim Gozuacik, David Lagorce, Marisa Brini, Pierre Falson, Gérard Peaucellier, Paolo Pinton, et al. "Serca1 Truncated Proteins Unable to Pump Calcium Reduce the Endoplasmic Reticulum Calcium Concentration and Induce Apoptosis." Journal of Cell Biology 153, no. 6 (June 11, 2001): 1301–14. http://dx.doi.org/10.1083/jcb.153.6.1301.
Full textAbstract:
By pumping calcium from the cytosol to the ER, sarco/endoplasmic reticulum calcium ATPases (SERCAs) play a major role in the control of calcium signaling. We describe two SERCA1 splice variants (S1Ts) characterized by exon 4 and/or exon 11 splicing, encoding COOH terminally truncated proteins, having only one of the seven calcium-binding residues, and thus unable to pump calcium. As shown by semiquantitative RT-PCR, S1T transcripts are differentially expressed in several adult and fetal human tissues, but not in skeletal muscle and heart. S1T proteins expression was detected by Western blot in nontransfected cell lines. In transiently transfected cells, S1T homodimers were revealed by Western blot using mildly denaturing conditions. S1T proteins were shown, by confocal scanning microscopy, to colocalize with endogenous SERCA2b into the ER membrane. Using ER-targeted aequorin (erAEQ), we have found that S1T proteins reduce ER calcium and reverse elevation of ER calcium loading induced by SERCA1 and SERCA2b. Our results also show that SERCA1 variants increase ER calcium leakage and are consistent with the hypothesis of a cation channel formed by S1T homodimers. Finally, when overexpressed in liver-derived cells, S1T proteins significantly induce apoptosis. These data reveal a further mechanism modulating Ca2+ accumulation into the ER of nonmuscle cells and highlight the relevance of S1T proteins to the control of apoptosis.
10
Reinhardt, Timothy A., and Ronald L. Horst. "Ca2+-ATPases and their expression in the mammary gland of pregnant and lactating rats." American Journal of Physiology-Cell Physiology 276, no. 4 (April 1, 1999): C796—C802. http://dx.doi.org/10.1152/ajpcell.1999.276.4.c796.
Full textAbstract:
The transcellular Ca2+fluxes required for milk production must be rigorously regulated to maintain the low cytosolic Ca2+concentrations critical to cell function. Ca2+-ATPases play a critical role in the maintenance of this cellular Ca2+ homeostasis. Using RT-PCR and sequencing, we identified six Ca2+pumps in lactating mammary tissue. Three plasma membrane Ca2+-ATPases (PMCAs) were found (PMCA1b, PMCA2b, and PMCA4b). Two sarco (endo)plasmic reticulum Ca2+-ATPases (SERCAs) were identified (SERCA2 and SERCA3), and the rat homologue to the yeast Golgi Ca2+-ATPase RS-10 was also found. The pattern of mRNA expression of each of these pumps was examined in rat mammary tissue from the 7th day of pregnancy to the 21st day of lactation. Northern blots revealed increased mRNA expression for all Ca2+ pumps by the 14th day of lactation, and transcripts continued to increase through the 18th day of lactation. PMCA1b, PMCA4b, SERCA2, and SERCA3 showed the lowest levels of expression. RS-10 transcripts were more abundant than SERCA2, SERCA3, PMCA1b, and PMCA4b. RS-10 was the only pump to increase in expression before parturition. PMCA2b was the most abundant transcript found in lactating mammary tissue. At peak lactation, expression of PMCA2b approached that of actin. The high expression, high affinity for Ca2+, and high activity at low calmodulin concentrations exhibited by PMCA2b suggest that it is uniquely suited for maintenance of Ca2+ homeostasis in the lactating mammary gland. The pattern of expression and abundance of RS-10 suggest that it is a candidate for the Golgi Ca2+-ATPase shown to be important in maintaining the Golgi Ca2+concentration required for casein synthesis and micelle formation.
11
Grover, Ashok K., Chiu-Yin Kwan, and Sue E. Samson. "Effects of peroxynitrite on sarco/endoplasmic reticulum Ca2+ pump isoforms SERCA2b and SERCA3a." American Journal of Physiology-Cell Physiology 285, no. 6 (December 2003): C1537—C1543. http://dx.doi.org/10.1152/ajpcell.00299.2003.
Full textAbstract:
Sarco(endo)plasmic reticulum Ca2+ (SERCA) pumps are important for cell signaling. Three different genes, SERCA1, 2, and 3, encode these pumps. Most tissues, including vascular smooth muscle, express a splice variant of SERCA2 (SERCA2b), whereas SERCA3a is widely distributed in tissues such as vascular endothelium, tracheal epithelium, mast cells, and lymphoid cells. SERCA2b protein is readily inactivated by peroxynitrite that may be formed during cardiac ischemia reperfusion or during immune response after infection. Here, we compared the peroxynitrite sensitivity of SERCA2b and SERCA3a by using microsomes prepared from HEK-293T cells overexpressing the pumps. We incubated the microsomes with different concentrations of peroxynitrite and determined Ca2+ uptake, Ca2+-Mg2+-ATPase, Ca2+-dependent formation of acylphosphate intermediate, and protein mobility in Western blots. Ca2+ uptake, Ca2+-Mg2+-ATPase, and Ca2+-dependent formation of acylphosphate intermediate were inactivated for both SERCA2b and SERCA3a, but the latter was more resistant to the inactivation. Western blots showed that SERCA2b and SERCA3a proteins oligomerized after treatment with peroxynitrite, but each with a slightly different pattern. Compared with monomers, the oligomers may be less efficient in forming the acylphosphate intermediate and in conducting the remainder of the steps in the reaction cycle. We conclude that the resistance of SERCA3a to peroxynitrite may aid the cells expressing them in functioning during exposure to oxidative stress.
12
VANGHELUWE, Peter, Marleen SCHUERMANS, Ernö ZÁDOR, Etienne WAELKENS, Luc RAEYMAEKERS, and Frank WUYTACK. "Sarcolipin and phospholamban mRNA and protein expression in cardiac and skeletal muscle of different species." Biochemical Journal 389, no. 1 (June 21, 2005): 151–59. http://dx.doi.org/10.1042/bj20050068.
Full textAbstract:
The widely held view that SLN (sarcolipin) would be the natural inhibitor of SERCA1 (sarcoplasmic/endoplasmic-reticulum Ca2+-ATPase 1), and PLB (phospholamban) its counterpart for SERCA2 inhibition is oversimplified and partially wrong. The expression of SLN and PLB mRNA and protein relative to SERCA1 or SERCA2 was assessed in ventricle, atrium, soleus and EDL (extensor digitorum longus) of mouse, rat, rabbit and pig. SLN protein levels were quantified by means of Western blotting using what appears to be the first successfully generated antibody directed against SLN. Our data confirm the co-expression of PLB and SERCA2a in cardiac muscle and the very low levels (in pig and rabbit) or the absence (in rat and mouse) of PLB protein in the slow skeletal muscle. In larger animals, the SLN mRNA and protein expression in the soleus and EDL correlates with SERCA1a expression, but, in rodents, SLN mRNA and protein show the highest abundance in the atria, which are devoid of SERCA1. In the rodent atria, SLN could therefore potentially interact with PLB and SERCA2a. No SLN was found in the ventricles of the different species studied, and there was no compensatory SLN up-regulation for the loss of PLB in PLB−/− mouse. In addition, we found that SLN expression was down-regulated at the mRNA and protein level in the atria of hypertrophic hearts of SERCA2b/b mice. These data suggest that superinhibition of SERCA by PLB-SLN complexes could occur in the atria of the smaller rodents, but not in those of larger animals.
13
Dally, Saoussen, Raymonde Bredoux, Elisabeth Corvazier, Jens P. Andersen, Johannes D. Clausen, Leonard Dode, Mohammed Fanchaouy, et al. "Ca2+-ATPases in non-failing and failing heart: evidence for a novel cardiac sarco/endoplasmic reticulum Ca2+-ATPase 2 isoform (SERCA2c)." Biochemical Journal 395, no. 2 (March 28, 2006): 249–58. http://dx.doi.org/10.1042/bj20051427.
Full textAbstract:
We recently documented the expression of a novel human mRNA variant encoding a yet uncharacterized SERCA [SR (sarcoplasmic reticulum)/ER (endoplasmic reticulum) Ca2+-ATPase] protein, SERCA2c [Gélébart, Martin, Enouf and Papp (2003) Biochem. Biophys. Res. Commun. 303, 676–684]. In the present study, we have analysed the expression and functional characteristics of SERCA2c relative to SERCA2a and SERCA2b isoforms upon their stable heterologous expression in HEK-293 cells (human embryonic kidney 293 cells). All SERCA2 proteins induced an increased Ca2+ content in the ER of intact transfected cells. In microsomes prepared from transfected cells, SERCA2c showed a lower apparent affinity for cytosolic Ca2+ than SERCA2a and a catalytic turnover rate similar to SERCA2b. We further demonstrated the expression of the endogenous SERCA2c protein in protein lysates isolated from heart left ventricles using a newly generated SERCA2c-specific antibody. Relative to the known uniform distribution of SERCA2a and SERCA2b in cardiomyocytes of the left ventricle tissue, SERCA2c was only detected in a confined area of cardiomyocytes, in close proximity to the sarcolemma. This finding led us to explore the expression of the presently known cardiac Ca2+-ATPase isoforms in heart failure. Comparative expression of SERCAs and PMCAs (plasma-membrane Ca2+-ATPases) was performed in four nonfailing hearts and five failing hearts displaying mixed cardiomyopathy and idiopathic dilated cardiomyopathies. Relative to normal subjects, cardiomyopathic patients express more PMCAs than SERCA2 proteins. Interestingly, SERCA2c expression was significantly increased (166±26%) in one patient. Taken together, these results demonstrate the expression of the novel SERCA2c isoform in the heart and may point to a still unrecognized role of PMCAs in cardiomyopathies.
14
Dremina, Elena S., Victor S. Sharov, and Christian Schöneich. "Heat-shock proteins attenuate SERCA inactivation by the anti-apoptotic protein Bcl-2: possible implications for the ER Ca2+-mediated apoptosis." Biochemical Journal 444, no. 1 (April 26, 2012): 127–39. http://dx.doi.org/10.1042/bj20111114.
Full textAbstract:
We have demonstrated previously that Bcl-2 and Bcl-2Δ21, a C-terminally truncated Bcl-2 sequence, inactivate SERCA (sarcoplasmic/endoplasmic reticulum Ca2+-ATPase) 1 in isolated SR (sarcoplasmic reticulum), accompanied by a translocation from CRDs (caveolae-related domains) of the SR. In the present study, we obtained evidence for the interaction of Bcl-2 with SERCA2b in C2C12 myoblasts and HEK (human embryonic kidney)-293 cells. Bcl-2 and SERCA2b co-immunoprecipitated from lysate and microsomal fractions of Bcl-2-overexpressing cells. However, Bcl-2 overexpression resulted only in a slight translocation from the CRDs and no significant SERCA inactivation. In isolated HEK-293 cell microsomes, incubation with Bcl-2Δ21 afforded SERCA2b inactivation and some translocation. HSP (heat-shock protein) 70, HSP90, HSP27 and α-crystallin attenuated Bcl-2Δ21-dependent SERCA2b inactivation. An in vitro mechanistic study with the SERCA1 isoform shows that HSP70 (i) protects SERCA1 from the inactivation by Bcl-2Δ21, (ii) inhibits SERCA1 translocation from CRD fractions, and (iii) prevents the Bcl-2Δ21-dependent loss of FITC labelling. Our data demonstrate that the mechanism of SERCA inactivation by Bcl-2 established in vitro for the SERCA1 isoform can be extended to the main housekeeping SERCA2b isoform, and that functional interactions of SERCA2b and Bcl-2 in the cell may be modulated by HSP70 and other chaperones and stress-regulated proteins.
15
Eggermont, J. A., F. Wuytack, J. Verbist, and R. Casteels. "Expression of endoplasmic-reticulum Ca2+-pump isoforms and of phospholamban in pig smooth-muscle tissues." Biochemical Journal 271, no. 3 (November 1, 1990): 649–53. http://dx.doi.org/10.1042/bj2710649.
Full textAbstract:
The expression of the gene 2 sarcoplasmic/endoplasmic-reticulum Ca2(+)-pump isoforms (SERCA2a and SERCA2b) and of phospholamban was studied in pig smooth muscle of the stomach, longitudinal ileum, pulmonary artery and aorta. mRNA levels were determined using an RNAase protection assay. The SERCA2 isoforms and phospholamban were tested on Western blots with a panel of antibodies, some of which were isoform-specific. The pig smooth-muscle tissues all contained comparable SERCA2 mRNA levels, but these levels were 10-20-fold lower than SERCA2 mRNA levels in cardiac muscle. Of the SERCA2 mRNAs in smooth muscle, 72-81% encoded the non-muscle isoform (SERCA2b), and Western blot analysis with isoform-specific antibodies confirmed that the SERCA2b isoform is the predominant endoplasmic-reticulum Ca2(+)-pump in smooth muscle. In contrast with SERCA2 mRNA levels, phospholamban mRNA levels varied by 12-fold between the different pig smooth-muscle tissues, with low and very low levels in the pig pulmonary artery and the pig aorta respectively. The differential expression of phospholamban was also confirmed on Western blots. The finding that the phospholamban content varied between the different smooth-muscle tissues whereas the SERCA2 expression remained rather constant indicates that, in pig smooth muscle, the expression of phospholamban is not coupled with that of SERCA2.
16
Misquitta, Christine M., James Mwanjewe, Lin Nie, and Ashok K. Grover. "Sarcoplasmic reticulum Ca2+ pump mRNA stability in cardiac and smooth muscle: role of the 3′-untranslated region." American Journal of Physiology-Cell Physiology 283, no. 2 (August 1, 2002): C560—C568. http://dx.doi.org/10.1152/ajpcell.00527.2001.
Full textAbstract:
Stomach smooth muscle (SSM) and left ventricular muscle (LVM) express the sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA) pump gene SERCA2. Alternative splicing yields two major isoforms, SERCA2a in LVM and slow twitch muscle and SERCA2b in SSM and most other tissues. The splices have different 3′-untranslated regions (UTR) and also encode proteins that differ slightly in their COOH-terminal domains. SERCA2 transcription rates are similar in the two tissues, yet LVM has a much higher level of SERCA2 mRNA than SSM. To understand the control of SERCA2 RNA expression, we inhibited transcription and showed that the half-life of SERCA2 mRNA is significantly longer ( P < 0.05) in primary cultures of LVM cells than in SSM cells. Nuclear SERCA2 mRNA levels were also higher in LVM than in SSM. In vitro decay assays using synthetic RNA corresponding to the 3′-UTR of SERCA2a and -2b showed that nuclear extracts produced a faster decay of SERCA2 RNA than cytoplasmic extracts and that nuclear extracts produced a faster decay of SERCA2b than -2a. This was also true when the full-length native mRNA was used instead of the 3′-UTR RNA, and SERCA2b decay by cytoplasmic extracts was faster for LVM than for SSM. We propose that nuclear decay is an initial step in the control of SERCA2 RNA abundance and that this control is maintained or modulated in the cytoplasm. We discuss how these control mechanisms may be part of a control switch in cardiac development and pathophysiology.
17
Wu, Kwan-Dun, David Bungard, and Jonathan Lytton. "Regulation of SERCA Ca2+ pump expression by cytoplasmic [Ca2+] in vascular smooth muscle cells." American Journal of Physiology-Cell Physiology 280, no. 4 (April 1, 2001): C843—C851. http://dx.doi.org/10.1152/ajpcell.2001.280.4.c843.
Full textAbstract:
Vascular smooth muscle cells (VSMC) express three isoforms of the sarcoplasmic or endoplasmic reticulum Ca2+-ATPase (SERCA) pump; SERCA2b predominates (91%), whereas SERCA2a (6%) and SERCA3 (3%) are present in much smaller amounts. Treatment with thapsigargin (Tg) or A-23187 increased the level of mRNA encoding SERCA2b four- to fivefold; SERCA3 increased about 10-fold, whereas SERCA2a was unchanged. Ca2+ chelation prevented the Tg-induced SERCA2b increase, whereas Ca2+ elevation itself increased SERCA2b expression. These responses were discordant with those of 78-kDa glucose-regulated protein/immunoglobulin-binding protein (grp78/BiP), an endoplasmic reticulum stress-response protein. SERCA2b mRNA elevation was much larger than could be accounted for by the observed increase in message stability. The induction of SERCA2b by Tg did not require protein synthesis, nor was it affected by inhibitors of calcineurin, protein kinase C, Ca2+/calmodulin-dependent protein kinase, or tyrosine protein kinases. Treatment with the nonselective protein kinase inhibitor H-7 prevented Tg-induced SERCA2b expression from occurring, whereas another nonselective inhibitor, staurosporine, was without effect. We conclude that changes in cytosolic Ca2+ control the expression of SERCA2b in VSMC via a mechanism involving a currently uncharacterized, H-7-sensitive but staurosporine-insensitive, protein kinase.
18
Peters, David G., Heather Mitchell-Felton, and Susan C. Kandarian. "Unloading induces transcriptional activation of the sarco(endo)plasmic reticulum Ca2+-ATPase 1 gene in muscle." American Journal of Physiology-Cell Physiology 276, no. 5 (May 1, 1999): C1218—C1225. http://dx.doi.org/10.1152/ajpcell.1999.276.5.c1218.
Full textAbstract:
Previous work showed that protein and mRNA levels of the “fast” isoform of the sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA1) are markedly increased in unloaded slow-twitch soleus muscles, suggesting pretranslational control of gene expression [L. M. Schulte, J. Navarro, and S. C. Kandarian. Am. J. Physiol. 264 ( Cell Physiol. 33): C1308–C1315, 1993]. However, because of the difficulty of measuring transcription rates from whole muscle, transcriptional activation of the SERCA1 gene with unloading has not been confirmed. Because SERCA1 pre-mRNA levels can reflect transcriptional activity, in the present study SERCA1 introns were sequenced to allow intron-directed RT-PCR measurement of SERCA1 pre-mRNA. These data were then compared with changes in SERCA1 mRNA expression in control and unloaded soleus muscles. After 2, 4, and 10 days of unloading, SERCA1 pre-mRNA and mRNA transcript levels increased significantly by two-, three-, and sevenfold, respectively ( P < 0.01). Parallel increases in SERCA1 pre-mRNA and mRNA suggest transcriptional activation of the endogenous SERCA1 gene by muscle unloading. SERCA2, the cardiac/slow-twitch skeletal muscle isoform, was not markedly increased by unloading, and RNase protection assays showed no change in alternative splicing of SERCA1 or SERCA2 primary transcripts. With use of in vivo plasmid injection, the activity of a reporter gene driven by 3.6 kb of the SERCA1 5′-flanking region increased fivefold in 7-day-unloaded soleus muscles. Comparison of the magnitude of transcriptional activation of endogenous and constructed SERCA1 genes by unloading confirms the fidelity of using intronic RT-PCR to examine muscle gene transcription rates and suggests that cis-acting elements sufficient for regulating unloading-induced transcriptional activation are contained in this promoter construct.
19
KOVÁCS, Tünde, Ferenc FELFÖLDI, Béla PAPP, Katalin PÁSZTY, Raymonde BREDOUX, Ágnes ENYEDI, and Jocelyne ENOUF. "All three splice variants of the human sarco/endoplasmic reticulum Ca2+-ATPase 3 gene are translated to proteins: a study of their co-expression in platelets and lymphoid cells." Biochemical Journal 358, no. 3 (September 10, 2001): 559–68. http://dx.doi.org/10.1042/bj3580559.
Full textAbstract:
The molecular cloning of two previously unknown human sarco/endoplasmic reticulum Ca2+-ATPase 3 (SERCA3) 3′-end transcripts, 3b and 3c, has been recently published. Data were lacking, however, for the presence of these SERCA3 variants in different tissue or cell types at the protein level. Here we report the co-expression of three human SERCA3 protein isoforms in platelets and T lymphoid Jurkat cells. Isoform-specific polyclonal anti-peptide antibodies have been generated that recognize specifically the SERCA3a, 3b or 3c splice variants at their C-termini, and this has been confirmed by peptide-competition experiments as well. None of these antibodies cross-reacted with the housekeeping SERCA2b isoform co-expressed endogenously with SERCA3 proteins in non-muscle cells. Although all three SERCA3 isoforms could be detected in platelets, the 3a form was the most abundantly expressed species. Its size matched the apparent size of SERCA3a over-expressed in HEK-293 cells. Immunoprecipitation of the SERCA3 variants from platelet membranes using a PL/IM 430-affinity matrix provided evidence that the putative pan-anti-SERCA3 antibody, PL/IM 430, recognizes all SERCA3 protein isoforms. The epitope for the PL/IM 430 antibody could be localized in a 40kDa N-terminal tryptic fragment common to all three SERCA3 variants. Comparative Western-blot analysis showed that the expression level of the SERCA3a, 3b and 3c isoforms was more than 10 times lower in Jurkat cells than in platelets, whereas expression of the ubiquitous SERCA2b was nearly identical. This work highlights new Ca2+-transporting proteins of haematopoietic cells and provides specific antibodies for their detection.
20
Zhang, Z., D. Chen, and M. G. Wheatly. "Cloning and characterization of sarco/endoplasmic reticulum Ca(2+)-ATPase (SERCA) from crayfish axial muscle. Sarco/Endoplasmic Reticulum Ca(2+)-ATPase." Journal of Experimental Biology 203, no. 22 (November 15, 2000): 3411–23. http://dx.doi.org/10.1242/jeb.203.22.3411.
Full textAbstract:
The discontinuous pattern of muscle growth during the moulting cycle of a freshwater crustacean (the crayfish Procambarus clarkii) was used as a model system to examine the regulation of the expression of Sarco/Endoplasmic Reticulum Ca(2+)-ATPase (SERCA). We describe the cloning, sequencing and characterization of a novel SERCA cDNA (3856 bp) obtained from crayfish axial abdominal muscle by reverse transcription/polymerase chain reaction (RT-PCR) followed by rapid amplification of cDNA ends (RACE). This complete sequence contains a 145 base pair (bp) noncoding region at the 5′ end, a 3006 bp open reading frame coding for 1002 amino acid residues with a molecular mass of 110 kDa and 705 bp of untranslated region at the 3′ end. This enzyme contains all the conserved domains found in ‘P’-type ATPases, and the hydropathy profile suggests a transmembrane organization typical of other SERCAs. It exhibits 80% amino acid identity with Drosophila melanogaster SERCA, 79% identity with Artemia franciscana SERCA, 72% identity with rabbit fast-twitch muscle neonatal isoform SERCA1b, 71% identity with slow-twitch muscle isoform SERCA2 and 67% identity with SERCA3. Sequence alignment revealed that regions anchoring the cytoplasmic domain in the membrane were highly conserved and that most differences were in the NH(2) terminus, the central loop region and the COOH terminus. Northern analysis of total RNA from crayfish tissues probed with the 460 bp fragment initially isolated showed four bands (7.6, 7.0, 5.8 and 4.5 kilobases) displaying tissue-specific expression. SERCA was most abundant in muscle (axial abdominal, cardiac and stomach), where it is involved in Ca(2+) resequestration during relaxation, and in eggs, where it may be implicated in early embryogenesis. The level of SERCA mRNA expression in axial abdominal muscle varied during the moulting cycle as determined by slot-blot analysis. SERCA expression was greatest during intermoult and decreased to approximately 50% of this level during pre- and postmoult. Patterns of gene expression for SERCA and other sarcomeric proteins during the crustacean moulting cycle may be regulated by ecdysteroids and/or mechanical stimulation.
21
ZÁDOR, Ernö, Luca MENDLER, Mark VER HEYEN, László DUX, and Frank WUYTACK. "Changes in mRNA levels of the sarcoplasmic/endoplasmic-reticulum Ca2+-ATPase isoforms in the rat soleus muscle regenerating from notexin-induced necrosis." Biochemical Journal 320, no. 1 (November 15, 1996): 107–13. http://dx.doi.org/10.1042/bj3200107.
Full textAbstract:
The relative mRNA levels corresponding to the different sarcoplasmic/endoplasmic-reticulum Ca2+-ATPase isoforms (SERCA1a, SERCA1b, SERCA2a, SERCA2b and SERCA3) were measured by reverse transcriptase–PCR in rat soleus muscles regenerating after notexin-induced necrosis. The succession of appearance of the different types of SERCA mRNA species in regenerating muscle largely recapitulates those observed during normal ontogenesis. The mRNA levels of the muscle-specific isoforms SERCA1a and SERCA2a became very low on the first and third days after injection of the snake venom. It was only on the fifth day of regeneration that the mRNA of the neonatal variant of the fast-twitch skeletal SERCA1b isoform began to rise, well before the other SERCA transcripts. At 7 and 10 days, i.e. at a time when the new myofibres normally become re-innervated, the mRNA level of SERCA1a and SERCA2a increased markedly, but the fast-twitch skeletal SERCA1a isoform was still the most prominent. On day 21, in the advanced stage of regeneration, a switch in the relative expression levels of SERCA1a and SERCA2a mRNA was observed and the ratio of both isoforms became similar to that found in the normal soleus muscles. This was followed by a decline in the level of all SERCA mRNA species, so that on day 28 the levels of the sarcoplasmic/endoplasmatic-reticulum Ca2+-pump RNAs was again lower but their ratio remained similar to that of the untreated control soleus.
22
Verboomen, Hilde, Luc Mertens, Jan Eggermont, Frank Wuytack, and Ludo Van Den Bosch. "Modulation of SERCA2 activity: Regulated splicing and interaction with phospholamban." Bioscience Reports 15, no. 5 (October 1, 1995): 307–15. http://dx.doi.org/10.1007/bf01788363.
Full textAbstract:
Ca2+-uptake into intracellular stores is mediated by the sarco/endoplasmic reticulum Ca2+ATPases (SERCAs). This review deals first with the gene structural and the characterization of the tissue-specific SERCA2 transcript processing. Secondly, the two different protein isoforms and their regulation are described. Finally, this review ends with a discussion on the possible physiological role of the SERCA2 isoform diversity.
23
MISQUITTA, Christine M., Angela SING, and Ashok K. GROVER. "Control of sarcoplasmic/endoplasmic-reticulum Ca2+ pump expression in cardiac and smooth muscle." Biochemical Journal 338, no. 1 (February 8, 1999): 167–73. http://dx.doi.org/10.1042/bj3380167.
Full textAbstract:
Cardiac muscle expresses sarcoplasmic/endoplasmic-reticulum Ca2+ pump isoform SERCA2a; stomach smooth muscle expresses SERCA2b. In 2-day-old rabbits, cardiac muscle contained levels of SERCA2 protein that were 100–200-fold those in the stomach smooth muscle. In nuclear run-on assays, the rate of SERCA2 gene transcription in heart nuclei was not significantly higher than in the stomach smooth-muscle nuclei. However, the SERCA2 mRNA levels (mean±S.E.M.) were (29±4)-fold higher in the heart. In both tissues the SERCA2 mRNA was associated with polyribosomes. In a sucrose-density-gradient sedimentation velocity experiment on polyribosomes, there was no difference in the sedimentation pattern of SERCA2 mRNA between the two tissues, suggesting that the translation efficiency of SERCA2 RNA in the two tissues is quite similar. Thus the main difference in the control of SERCA2 expression in the two tissues is post-transcriptional and pretranslational.
24
Verboomen, H., F. Wuytack, L. Van den Bosch, L. Mertens, and R. Casteels. "The functional importance of the extreme C-terminal tail in the gene 2 organellar Ca2+-transport ATPase (SERCA2a/b)." Biochemical Journal 303, no. 3 (November 1, 1994): 979–84. http://dx.doi.org/10.1042/bj3030979.
Full textAbstract:
Ca(2+)-uptake experiments in microsomal fractions from transfected COS-1 cells have revealed a functional difference between the non-muscle SERCA2b Ca2+ pump and its muscle-specific SERCA2a splice variant. Structurally, the two pumps differ only in their C-terminal tail. The last four amino acids of SERCA2a are replaced in SERCA2b by a 49-residue-long peptide chain containing a very hydrophobic stretch which could be an additional transmembrane segment. The functionally important subdomains in the SERCA2b tail were analysed by constructing three SERCA2b deletion mutants lacking 12, 31 or 49 amino acids. The mutants and the parental SERCA2 pumps were expressed in COS-1 cells and analysed for functional difference. SERCA2b had a twofold higher Ca2+ affinity, a twofold lower turnover rate and a 10-fold lower vanadate-sensitivity than SERCA2a and the mutants. Since each of the three truncated versions of SERCA2b acquire the characteristic properties of SERCA2a, it is concluded that the stretch of the last 12 residues of SERCA2b is of critical importance.
25
Kono, Tatsuyoshi, Geonyoung Ahn, Dan R. Moss, Liann Gann, Angel Zarain-Herzberg, Yurika Nishiki, Patrick T. Fueger, Takeshi Ogihara, and Carmella Evans-Molina. "PPAR-γ Activation Restores Pancreatic Islet SERCA2 Levels and Prevents β-Cell Dysfunction under Conditions of Hyperglycemic and Cytokine Stress." Molecular Endocrinology 26, no. 2 (February 1, 2012): 257–71. http://dx.doi.org/10.1210/me.2011-1181.
Full textAbstract:
Abstract The maintenance of intracellular Ca2+ homeostasis in the pancreatic β-cell is closely regulated by activity of the sarco-endoplasmic reticulum Ca2+ ATPase (SERCA) pump. Our data demonstrate a loss of β-cell SERCA2b expression in several models of type 2 diabetes including islets from db/db mice and cadaveric diabetic human islets. Treatment of 832/13 rat INS-1-derived cells with 25 mm glucose and the proinflammatory cytokine IL-1β led to a similar loss of SERCA2b expression, which was prevented by treatment with the peroxisome proliferator-activated receptor (PPAR)-γ agonist, pioglitazone. Pioglitazone was able to also protect against hyperglycemia and cytokine-induced elevations in cytosolic Ca2+ levels, insulin-secretory defects, and cell death. To determine whether PPAR-γ was a direct transcriptional regulator of the SERCA2 gene, luciferase assays were performed and showed that a −259 bp region is sufficient to confer PPAR-γ transactivation; EMSA and chromatin immunoprecipitation experiments confirmed that PPAR-γ directly binds a PPAR response element in this proximal region. We next sought to characterize the mechanisms by which SERCA2b was down-regulated. INS-1 cells were exposed to high glucose and IL-1β in time course experiments. Within 2 h of exposure, activation of cyclin-dependent kinase 5 (CDK5) was observed and correlated with increased serine-273 phosphorylation of PPAR-γ and loss of SERCA2 protein expression, findings that were prevented by pioglitazone and roscovitine, a pharmacological inhibitor of CDK5. We conclude that pioglitazone modulates SERCA2b expression through direct transcriptional regulation of the gene and indirectly through prevention of CDK5-induced phosphorylation of PPAR-γ.
26
Poch, Esteban, Stephen Leach, Susan Snape, Tasha Cacic, David H. MacLennan, and Jonathan Lytton. "Functional characterization of alternatively spliced human SERCA3 transcripts." American Journal of Physiology-Cell Physiology 275, no. 6 (December 1, 1998): C1449—C1458. http://dx.doi.org/10.1152/ajpcell.1998.275.6.c1449.
Full textAbstract:
The sarcoplasmic (or endoplasmic) reticulum Ca2+-ATPase (SERCA)-3 has been implicated in the possible dysregulation of Ca2+ homeostasis that accompanies the pathology of hypertension and diabetes. We report the molecular cloning of two alternatively spliced transcripts from the human SERCA3 gene, ATP2A3, that encode proteins that differ at their carboxy termini by 36 amino acids. SERCA3 transcripts were most abundantly expressed in lymphoid tissues, intestine, pancreas, and prostate. The two human SERCA3 proteins encoded by alternatively spliced transcripts were recognized by the monoclonal antibody PL/IM430 and demonstrated Ca2+ uptake and ATPase activity with an apparent Ca2+ affinity 0.5 pCa unit lower than that of other SERCA gene products. The subcellular distribution of SERCA3 protein was indistinguishable from that of SERCA2b, with expression in the nuclear envelope and in the endoplasmic reticulum throughout the cell. Two variant SERCA3 constructs, huS3-I and huS3-II, were isolated that encode proteins with three amino acid differences: Ala-673 (in huS3-I) substituted for Thr (in huS3-II), Ile-817 substituted for Met, and an insertion of Glu-994. huS3-I displayed a 10-fold lower capacity to transport Ca2+ than huS3-II.
27
Grover, A. K., A. Xu, S. E. Samson, and N. Narayanan. "Sarcoplasmic reticulum Ca2+ pump in pig coronary artery smooth muscle is regulated by a novel pathway." American Journal of Physiology-Cell Physiology 271, no. 1 (July 1, 1996): C181—C187. http://dx.doi.org/10.1152/ajpcell.1996.271.1.c181.
Full textAbstract:
Coronary artery smooth muscle expresses an alternative splice (SERCA2b) of the sarcoplasmic reticulum (SR) Ca2+ pump gene SERCA2, which is also expressed in cardiac muscle (SERCA2a), but how the activity of this transporter is regulated in the coronary artery is not known. SERCA2a in the cardiac muscle can be regulated via phospholamban or, as recently reported, by a direct phosphorylation of this protein by calmodulin kinase (Xu, A., C. Hawkins, and N. Narayanan. J.Biol. Chem. 268:8394-8397, 1993). Because both SERCA2a and SERCA2b contain this calmodulin kinase phosphorylation site, we examined the effect of endogenous calmodulin kinase phosphorylation of the SR Ca2+ pump in the coronary artery. SR-enriched membranes were isolated from coronary artery smooth muscle and washed in ethylene glycol-bis-(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid to remove bound calmodulin. When these membranes were incubated with MgATP2- in the presence of Ca2+/calmodulin, a 115-kDa protein was phosphorylated. This phosphorylated 115-kDa protein was identified as SERCA2b in Western blots and by immunoprecipitation using a SERCA2-selective antibody. Preincubating the membranes in MgATP2- in the presence of Ca2+/calmodulin stimulated the subsequent Ca2+ uptake in the presence of oxalate plus MgATP2- and azide. The stimulation of Ca2+ uptake was inhibited by including the SR Ca2+ pump inhibitors thapsigargin and cyclopiazonic acid in the Ca2+ uptake medium or by including the calmodulin antagonist N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide or the calmodulin kinase II peptide fragment 290-309 in the phosphorylation solution. Thus an endogenous calmodulin-dependent kinase phosphorylated SERCA2b and activated it. Phospholamban could not be detected in these membranes in Western blots. Therefore, the regulation of the SR Ca2+ pump activity in coronary artery smooth muscle may involve a direct phosphorylation of the pump protein by an endogenous calmodulin-dependent kinase.
28
Enouf, J., R. Bredoux, B. Papp, I. Djaffar, A. M. Lompré, N. Kieffer, O. Gayet, K. Clemetson, F. Wuytack, and J. P. Rosa. "Human platelets express the SERCA2-b isoform of Ca2+-transport ATPase." Biochemical Journal 286, no. 1 (August 15, 1992): 135–40. http://dx.doi.org/10.1042/bj2860135.
Full textAbstract:
Previous biochemical studies suggested that the human platelet Ca2+ATPase system may be cell-specific. To test this hypothesis, we first undertook the molecular cloning of Ca2+ATPase from human erythroleukaemia (HEL) cells, because this human cell line exhibits megakaryocytic features and expresses a Ca2+ATPase that cross-reacts with platelet Ca(2+)-ATPase. For this cloning, an HEL-cell cDNA library was screened with a rat cardiac Ca2+ATPase cDNA probe. The insert of the longest clone isolated was 3.9 kb and its sequence displayed a 100% identity with that of the non-muscle human Ca2+ATPase 2-b isoform, termed SERCA2-b (sarco-endoplasmic-reticulum Ca2+ATPase). The 3.9 kb cDNA covered a subtotal coding region and part of the 3′ non-coding end of the SERCA2-b mRNA. It cross-hybridized with the 4 kb transcript species of cardiac SERCA2-a and with non-muscle SERCA2-b mRNAs, but not with fast-skeletal-muscle SERCA1 mRNA. We next confirmed that SERCA2-b was a component of the platelet Ca2+ATPase system because (1) the platelet clones isolated from a platelet cDNA library exhibited a 100% homology with HEL-cell cDNA; (2) SERCA2-b mRNA was amplified by PCR on total platelet RNA and (3) platelet Ca2+ATPase cross-reacted with a polyclonal SERCA2-b-specific antiserum. Platelets therefore contain a Ca2+ATPase definitely identified as the SERCA2-b isoform of Ca2+ATPase, thus eliminating the possibility that they only contain a single specific Ca2+ATPase.
29
Tupling, A. Russell. "The decay phase of Ca2+ transients in skeletal muscle: regulation and physiologyThis paper is one of a selection of papers published in this Special Issue, entitled 14th International Biochemistry of Exercise Conference – Muscles as Molecular and Metabolic Machines, and has undergone the Journal’s usual peer review process." Applied Physiology, Nutrition, and Metabolism 34, no. 3 (June 2009): 373–76. http://dx.doi.org/10.1139/h09-033.
Full textAbstract:
Cytosolic Ca2+ transients associated with contraction and relaxation cycles in skeletal muscle are primarily dependent on the kinetics of Ca2+ release and Ca2+ uptake by the sarcoplasmic reticulum (SR). In humans, sarco(endo)plasmic reticulum Ca2+-ATPases (SERCAs) are solely responsible for the removal of Ca2+ from the cytosol following muscle contraction. There are several signalling systems involved in the acute regulation of SERCAs required to achieve a given Ca2+ transient during muscle contraction–relaxation cycles. Cyclic-AMP-dependent protein kinase and Ca2+/calmodulin-dependent protein kinase signalling activate SERCAs through the regulation of the endogenous SERCA-regulatory proteins, phospholamban and sarcolipin, both of which are highly expressed in human skeletal muscle. Recent studies on the regulation of SERCA2b in arterial smooth muscle and work from my laboratory on the interaction between SERCAs and the inducible 70-kDa heat shock protein suggests a novel role for redox signalling in regulating SERCA activity. In the absence of fatigue, activation of these signalling systems in response to repeated muscle activity serves to increase the rate of cytosolic free Ca2+ ([Ca2+]f) decay (i.e., SR Ca2+ uptake) and the speed of muscle relaxation.
30
Jović, Biljana Stanislav, Aleksandar Acim Čučaković, and Mihailo Nebojsa Grbić. "Circle in Space—Space in Circle: A Study of Ratio between Open Space and Built-Up Area in Historical Circular Objects." Sustainability 13, no. 9 (April 22, 2021): 4662. http://dx.doi.org/10.3390/su13094662.
Full textAbstract:
Many cities nowadays explore different circular designs as new sustainable city concepts in different urban aspects. The new trend, as part of the adaptation for climate change, is a strategy of increasing the number of urban open spaces, and circular plan design could be a sustainable approach to urban development. This paper provides a historical overview of various examples of circular objects containing built structures and open spaces from the Neolithic to the present. The Built-Up Area (BUA) and Open Space (OS) relationships are shown histogramically for 36 objects arranged chronologically. The morphospace analysis was performed to determine any possible regularity in the relationships of parts of circular objects. For the purpose of this research, three variables were chosen. First, all selected historical examples of circular objects were divided into two main categories: objects with a total diameter smaller than 300 m and objects with a total diameter bigger than 300 m. Additionally, the selected circular objects were divided by their type of open space to better understand their spatial position. The largest number of analyzed objects belongs to the Parks–Gardens category, followed by settlements, and then earth works, sacral objects and circular buildings, with the smallest number of circular objects being in the category of allotments and plazas. The second variable was Jam area and % of Jam. The buildings are of different sizes up to several hundred m2, and the areas range up to several hundred ha. The total area to OS ratio ranges from 0% (for Large Serdab) to 100% (for multiple objects). There is a similar situation with the diameter ratios (total and “jam”). Additionally, the final variable was the historical position of the selected circular objects. Circular objects belong to all historical periods from the Neolithic to the present. The aim of this research was to explore the relationship between OS and BUA in various circular objects with different diameters of open spaces and find out if there was any regularity in this relationship. The morphospace analysis of this research indicates that there is no clear regularity in the relationship between the built-up area and the open space, but the aspects and research results shown here contribute to sustainability since the circular design approach could play a key role in future circular design processes.
31
MISQUITTA, Christine M., Paromita GHOSH, James MWANJEWE, and Ashok K. GROVER. "Role of cis-acting elements in the control of SERCA2b Ca2+ pump mRNA decay by nuclear proteins." Biochemical Journal 388, no. 1 (May 10, 2005): 291–97. http://dx.doi.org/10.1042/bj20041568.
Full textAbstract:
Alternative splicing at position 3495 b yields SERCA2 (sarco/endoplasmic reticulum Ca2+ pump 2) RNA species, namely SERCA2a and SERCA2b which differ in 3′-end regions. This results in SERCA2b RNA being less stable. In vitro decay experiments show that, in the presence of protein extracts from nuclei of LVMs (left ventricular myocytes), the rate of decay of both SERCA2b RNA and synthetic RNA from its 3′-region is greater than that of the corresponding SERCA2a RNA. To search for cis-acting instability elements in the 3′-region of SERCA2b, we examined the effects of LVM nuclear protein extracts on the in vitro decay of six short overlapping capped [m7G(5′)ppp(5′)Gm] and polyadenylated (A40) RNA fragments from the 3′-end region (3444–4472) of SERCA2b. The proximal fragment 2B1 (3444–3753) was the most unstable. 2B1 RNA without a cap or a polyadenylated tail was analysed further in electrophoretic mobility-shift assays, and was observed to bind to protein(s) in the nuclear extracts. Based on competition for binding to nuclear proteins between radiolabelled 2B1 RNA and short unlabelled RNA fragments, the cis-acting element involved in this binding was the sequence 2B1-4. 2B1-4 is a 35-base (3521–3555, CCAGUCCUGCUCGUUGUGGGCGUGCACCGAGGGGG) GC-rich region just past the splice site (3495). Nuclear extracts decreased the electrophoretic mobility of the radiolabelled 2B1-4 RNA which bound to two proteins (19 and 21 kDa) in cross-linking experiments. Excess 2B1-4 RNA decreased the decay of the 2B1 RNA by the nuclear protein extract. 2B1-del 4 RNA (2B1 with the 2B1-4 domain deleted) also decayed more slowly than the control 2B1 RNA. Thus SERCA2b contains a novel GC-rich cis-acting element involved in its decay by nuclear proteins.
32
Zhao, Yimeng, Haruo Ogawa, Shin-Ichiro Yonekura, Hiroaki Mitsuhashi, Satomi Mitsuhashi, Ichizo Nishino, Chikashi Toyoshima, and Shoichi Ishiura. "Functional analysis of SERCA1b, a highly expressed SERCA1 variant in myotonic dystrophy type 1 muscle." Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 1852, no. 10 (October 2015): 2042–47. http://dx.doi.org/10.1016/j.bbadis.2015.07.006.
Full text
33
SALVADOR, JESUS M., MANUEL BERENGENA, and ANA M. MATA. "EVIDENCE THAT AN ANTI-SERCA1 MONOCLONAL ANTIBODY RECOGNIZES THE SERCA2b CALCIUM PUMP IN PIG BRAIN." Biochemical Society Transactions 25, no. 2 (May 1, 1997): 169S. http://dx.doi.org/10.1042/bst025169s.
Full text
34
Gallo, Maria, Ian MacLean, Neil Tyreman, Karen J. B. Martins, Daniel Syrotuik, Tessa Gordon, and Charles T. Putman. "Adaptive responses to creatine loading and exercise in fast-twitch rat skeletal muscle." American Journal of Physiology-Regulatory, Integrative and Comparative Physiology 294, no. 4 (April 2008): R1319—R1328. http://dx.doi.org/10.1152/ajpregu.00631.2007.
Full textAbstract:
We investigated the effects of chronic creatine loading and voluntary running (Run) on muscle fiber types, proteins that regulate intracellular Ca2+, and the metabolic profile in rat plantaris muscle to ascertain the bases for our previous observations that creatine loading results in a higher proportion of myosin heavy chain (MHC) IIb, without corresponding changes in contractile properties. Forty Sprague-Dawley rats were assigned to one of four groups: creatine-fed sedentary, creatine-fed run-trained, control-fed sedentary, and control-fed run-trained animals. Proportion and cross-sectional area increased 10% and 15% in type IIb fibers and the proportion of type IIa fibers decreased 11% in the creatine-fed run-trained compared with the control-fed run-trained group ( P < 0.03). No differences were observed in fast Ca2+-ATPase isoform SERCA1 content ( P > 0.49). Creatine feeding alone induced a 41% increase ( P < 0.03) in slow Ca2+-ATPase (SERCA2) content, which was further elevated by 33% with running ( P < 0.02). Run training alone reduced parvalbumin content by 50% ( P < 0.05). By comparison, parvalbumin content was dramatically decreased by 75% ( P < 0.01) by creatine feeding alone but was not further reduced by run training. These adaptive changes indicate that elevating the capacity for high-energy phosphate shuttling, through creatine loading, alleviates the need for intracellular Ca2+ buffering by parvalbumin and increases the efficiency of Ca2+ uptake by SERCAs. Citrate synthase and 3-hydroxyacyl-CoA dehydrogenase activities were elevated by run training ( P < 0.003) but not by run training + creatine feeding. This indicates that creatine loading during run training supports a faster muscle phenotype that is adequately supported by the existing glycolytic potential, without changes in the capacity for terminal substrate oxidation.
35
Nguyen, Taitan, Neal A. Rubinstein, Camasamudram Vijayasarathy, Lawrence C. Rome, Larry R. Kaiser, Joseph B. Shrager, and Sanford Levine. "Effect of chronic obstructive pulmonary disease on calcium pump ATPase expression in human diaphragm." Journal of Applied Physiology 98, no. 6 (June 2005): 2004–10. http://dx.doi.org/10.1152/japplphysiol.00767.2004.
Full textAbstract:
We have previously demonstrated that human diaphragm remodeling elicited by severe chronic obstructive pulmonary disease (COPD) is characterized by a fast-to-slow myosin heavy chain isoform transformation. To test the hypothesis that COPD-induced diaphragm remodeling also elicits a fast-to-slow isoform shift in the sarcoendoplasmic reticulum Ca2+ ATPase (SERCA), the other major ATPase in skeletal muscle, we obtained intraoperative biopsies of the costal diaphragm from 10 severe COPD patients and 10 control subjects. We then used isoform-specific monoclonal antibodies to characterize diaphragm fibers with respect to the expression of SERCA isoforms. Compared with control diaphragms, COPD diaphragms exhibited a 63% decrease in fibers expressing only fast SERCA (i.e., SERCA1; P < 0.001), a 190% increase in fibers containing both fast and slow SERCA isoforms ( P < 0.01), and a 19% increase ( P < 0.05) in fibers expressing only the slow SERCA isoform (i.e., SERCA2). Additionally, immunoblot experiments carried out on diaphragm homogenates indicated that COPD diaphragms expressed only one-third the SERCA1 content noted in control diaphragms; in contrast, COPD and control diaphragms did not differ with respect to SERCA2 content. The combination of these histological and immunoblot results is consistent with the hypothesis that diaphragm remodeling elicited by severe COPD is characterized by a fast-to-slow SERCA isoform transformation. Moreover, the combination of these SERCA data and our previously reported myosin heavy chain isoform data (Levine S, Nguyen T, Kaiser LR, Rubinstein NA, Maislin G, Gregory C, Rome LC, Dudley GA, Sieck GC, and Shrager JB. Am J Respir Crit Care Med 168: 706–713, 2003) suggests that diaphragm remodeling elicited by severe COPD should decrease ATP utilization by the diaphragm.
36
Carr, Bruce. "Serdar E. Bulun, M.D." Seminars in Reproductive Medicine 28, no. 01 (January 2010): 001. http://dx.doi.org/10.1055/s-0029-1242986.
Full text
37
Krivokapić, Miloš. "DIPLOMATIC FORM AND GRAPHIC SYSTEM IN THE LETTERS OF THE SERDARS AND GUVERNADURS RADONJIĆ (1714-1828)." Folia linguistica et litteraria XI, no. 33 (2020): 207–30. http://dx.doi.org/10.31902/fll.33.2020.11.
Full textAbstract:
The letters of the serdars and guvernadurs Radonjic family, created in eighteenth and during the first three decades of the nineteenth century, were written in non-calligraphic, fast-written Cyrillic mode, including the national language in Njegushi, which corresponds to archaic Montenegrin dialects. The great part of the Radonjic family letters is characterized by corresponding style, the evidence of features in artistic style and by the fact that they are not numerous. The letters are recognizable through the variety of subject and motive matters, which provided the usage of different language methods. The letters of serdar Vuk, but also the letters of guvernadurs Stanisha and Jovan, apart the elements of diplomatic style, contain certain features characteristic for the national literature, which is not the case in other letters. The existing vowel system of the letters doesn’t differ from the vocal system of most our dialects, neither from the vocal system of literary language. Consonant system of the letters contains all consonants and obstruents which literary language possesses nowadays. However, there aren’t particular graphic signs which would be adequate to denote specific consonants, and that fact designates the imperfection of the graphic system.
38
Krivokapić, Miloš. "DIPLOMATIC FORM AND GRAPHIC SYSTEM IN THE LETTERS OF THE SERDARS AND GUVERNADURS RADONJIĆ (1714-1828)." Folia linguistica et litteraria XI, no. 33 (2020): 207–30. http://dx.doi.org/10.31902/fll.33.2020.11.
Full textAbstract:
The letters of the serdars and guvernadurs Radonjic family, created in eighteenth and during the first three decades of the nineteenth century, were written in non-calligraphic, fast-written Cyrillic mode, including the national language in Njegushi, which corresponds to archaic Montenegrin dialects. The great part of the Radonjic family letters is characterized by corresponding style, the evidence of features in artistic style and by the fact that they are not numerous. The letters are recognizable through the variety of subject and motive matters, which provided the usage of different language methods. The letters of serdar Vuk, but also the letters of guvernadurs Stanisha and Jovan, apart the elements of diplomatic style, contain certain features characteristic for the national literature, which is not the case in other letters. The existing vowel system of the letters doesn’t differ from the vocal system of most our dialects, neither from the vocal system of literary language. Consonant system of the letters contains all consonants and obstruents which literary language possesses nowadays. However, there aren’t particular graphic signs which would be adequate to denote specific consonants, and that fact designates the imperfection of the graphic system.
39
Vangheluwe, Peter, and Frank Wuytack. "Improving cardiac Ca2+ transport into the sarcoplasmic reticulum in heart failure: lessons from the ubiquitous SERCA2b Ca2+ pump." Biochemical Society Transactions 39, no. 3 (May 20, 2011): 781–87. http://dx.doi.org/10.1042/bst0390781.
Full textAbstract:
As a major Ca2+ pump in the sarcoplasmic reticulum of the cardiomyocyte, SERCA2a (sarcoplasmic/endoplasmic reticulum Ca2+-ATPase 2a) controls the relaxation and contraction of the cardiomyocyte. It is meticulously regulated by adapting its expression levels and affinity for Ca2+ ions to the physiological demand of the heart. Dysregulation of the SERCA2a activity entails poor cardiomyocyte contractility, resulting in heart failure. Conversely, improving cardiac SERCA2a activity, e.g. by boosting its expression level or by increasing its affinity for Ca2+, is a promising strategy to rescue contractile dysfunction of the failing heart. The structures of the related SERCA1a Ca2+ pump and the Na+/K+-ATPase of the plasma membrane exposed the pumping mechanism and conserved domain architecture of these ion pumps. However, how the Ca2+ affinity of SERCA2a is regulated at the molecular level remained unclear. A structural and functional analysis of the closely related SERCA2b Ca2+ pump, i.e. the housekeeping Ca2+ pump found in the endoplasmic reticulum and the only SERCA isoform characterized by a high Ca2+ affinity, aimed to fill this gap. We demonstrated the existence of a novel and highly conserved site on the SERCA2 pump mediating Ca2+ affinity regulation by the unique C-terminus of SERCA2b (2b-tail). It differs from the earlier-described target site of the affinity regulator phospholamban. Targeting this novel site may provide a new approach to improve SERCA2a function in the failing heart. Strikingly, the intramembrane interaction site of the 2b-tail in SERCA2b shares sequence and structural homology with the binding site of the β-subunit on the α Na+/K+-ATPase. Thus P-type ATPases seem to have developed related mechanisms of regulation, and it is a future challenge for us to discover these general principles of P-type regulation.
40
Dally, Saoussen, Elisabeth Corvazier, Raymonde Bredoux, Régis Bobe, and Jocelyne Enouf. "Multiple and diverse coexpression, location, and regulation of additional SERCA2 and SERCA3 isoforms in nonfailing and failing human heart." Journal of Molecular and Cellular Cardiology 48, no. 4 (April 2010): 633–44. http://dx.doi.org/10.1016/j.yjmcc.2009.11.012.
Full text
41
Skryl, S. V., A. V. Mazin, T. V. Meshcheryakova, A. V. Kalach, M. V. Ponomarev, and O. A. Gulyaev. "Prevention of information leakage through channels of spurious electromagnetic radiation and interference: research models." Radio industry (Russia) 31, no. 2 (July 7, 2021): 22–34. http://dx.doi.org/10.21778/2413-9599-2021-31-2-22-34.
Full textAbstract:
Problem statement. The investigation the currently used methods for determining the sources of information leakage threats from the basic hardware and systems (BHaS) through the spurious electromagnetic radiation and interference (SERaB) channels on the object of informatization (OoI), gives grounds to assert that they have a number of disadvantages. The lack of а formal interpretation for process dynamics of the SERaB information collecting and implementing measures to prevent information leakage requires development of a systematic approach to improving the ways and means of protecting confidential information from leakage through SERaB channels.The purpose. Development of mathematical models and a systematic approach to improving methods and means of protecting confidential information from leaks through the SERaB channels from the BHaS on the OoI.Results. The article substantiates the need for a systematic approach to improving the methods and means of protecting confidential information from leakage through the SERaB channels from the BHaS on the OoI. The authors determined the ways of ensuring the adequacy of the methodological apparatus for the study of these technologies in order to justify measures to prevent leakage. They formulate requirements for techniques used to evaluate the characteristics of measures to prevent information leakage through the SERaB channels. There are describe the procedure of forming the mathematical models set structure for evaluating such characteristics. Also in the article are present the analytical models of the time characteristics of threats to intercept informative SERaB signals on the OoI and measures to prevent information leakage. Finally, the authors are justify the probabilistic format of the indicator of the effectiveness of such measures.Practical relevance. The developed mathematical models can be an effective tool for evaluating the characteristics of measures to prevent information leakage through the SERaB channels.
42
Tonnesen, Morten F., Lars G. Grunnet, Josefine Friberg, Alessandra K. Cardozo, Nils Billestrup, Décio L. Eizirik, Joachim Størling, and Thomas Mandrup-Poulsen. "Inhibition of Nuclear Factor-κB or Bax Prevents Endoplasmic Reticulum Stress- But Not Nitric Oxide-Mediated Apoptosis in INS-1E Cells." Endocrinology 150, no. 9 (June 25, 2009): 4094–103. http://dx.doi.org/10.1210/en.2009-0029.
Full textAbstract:
Abstract Accumulating evidence suggests that endoplasmic reticulum (ER) stress by mechanisms that include ER Ca2+ depletion via NO-dependent down-regulation of sarcoendoplasmic reticulum Ca2+ ATPase 2b (SERCA2b) contributes to β-cell death in type 1 diabetes. To clarify whether the molecular pathways elicited by NO and ER Ca2+ depletion differ, we here compare the direct effects of NO, in the form of the NO donor S-nitroso-N-acetyl-d,l-penicillamine (SNAP), with the effects of SERCA2 inhibitor thapsigargin (TG) on MAPK, nuclear factor κB (NFκB), Bcl-2 proteins, ER stress, and apoptosis. Exposure of INS-1E cells to TG or SNAP caused caspase-3 cleavage and apoptosis. Both TG and SNAP induced activation of the proapoptotic transcription factor CCAAT/enhancer-binding protein homologous protein (CHOP). However, other classical ER stress-induced markers such as up-regulation of ER chaperone Bip and alternative splicing of the transcription factor Xbp-1 were exclusively activated by TG. TG exposure caused NFκB activation, as assessed by IκB degradation and NFκB DNA binding. Inhibition of NFκB or the Bcl-2 family member Bax pathways protected β-cells against TG- but not SNAP-induced β-cell death. These data suggest that NO generation and direct SERCA2 inhibition cause two quantitative and qualitative different forms of ER stress. In contrast to NO, direct ER stress induced by SERCA inhibition causes activation of ER stress signaling pathways and elicit proapoptotic signaling via NFκB and Bax.
43
Korkmaz, Serdal. "Dr. Serdal Korkmaz Guest co-Editor." Transfusion and Apheresis Science 56, no. 6 (December 2017): 786. http://dx.doi.org/10.1016/j.transci.2017.11.006.
Full text
44
Hernandez-Ilizaliturri, F. J., H. Kaur, A. Bhinder, S. Olejniczak, J. Knight, and M. S. Czuczman. "Impaired Ca++ mobilization in rituximab-resistant cells (RRCL) is associated with changes in the structure of CD20 antigen, down-regulation of Bax/Bak pro-apoptotic proteins and up-regulation of the endoplasmic reticulum (ER) Ca++ pump protein SERCA-3." Journal of Clinical Oncology 24, no. 18_suppl (June 20, 2006): 2516. http://dx.doi.org/10.1200/jco.2006.24.18_suppl.2516.
Full textAbstract:
2516 Ca++ mobilization leading to apoptosis has been observed following rituximab biding to CD20 in lymphoma cells. Extending rituximab (R) exposure (e.g. as via R maintenance regimens) could potentially accelerate the emergence of resistance to rituximab. To define the molecular basis for rituximab resistance we developed several RRCL and demonstrated changes in CD20 expression/structure and membrane reorganization following rituximab therapy. Specifically, changes in the N-terminal and the C-terminal region of the internal domain of CD20 were observed in RRCL as determined by Western blotting using various antibodies recognizing epitopes located in the internal (GST77 and 1439) and external domain (B1) of CD20. In our current work we evaluated the effects that CD20 structure/expression changes have upon Ca++ mobilization. Extracellular and intracellular Ca++ mobilization was measured by flow cytometric analysis using FLUO-3 AM (acetoxymethyl ester). Optimization of the Ca++ indicator and calibration curves were performed for each cell line. Raji and RRCL were labeled under optimal conditions with FLUO-3 AM/Pluronic Acid F-127. Subsequently, cells were then re-suspended in HANKS media with or without Ca++ and exposed to rituximab or isotype (10μg/ml) ± human serum (25%). Surface CD20 expression was similar between Raji cells and RRCL. Expression of pro- or anti-apoptotic proteins and Ca++ regulatory proteins SERCA3, SERCA2 and Calreticulin was also determined by western blotting. In vitro exposure of Raji cells to rituximab + HS resulted in Ca++ mobilization even in Ca++ depleted media. Notably, Ca++ mobilization was impaired in RRCL when compared to Raji parental cells. In addition, down-regulation of Bax/Bak and up-regulation of SERCA3 was demonstrated in RRCL. Our data suggest that the acquirement of rituximab resistance is associated with changes in the intracellular domain of CD20 and in Ca++ regulator/pro-apoptotic proteins (SERCA3 and Bax/Bak) resulting in a decrease in the intracellular mobilization of Ca++. No significant financial relationships to disclose.
45
Hu, Ping, K. M. Zhang, Leon D. Wright, John A. Spratt, and F. N. Briggs. "Correlations between MyoD, myogenin, SERCA1, SERCA2 and phospholamban transcripts during transformation of type-II to type-I skeletal muscle fibers." Pfl�gers Archiv European Journal of Physiology 434, no. 2 (May 15, 1997): 209–11. http://dx.doi.org/10.1007/s004240050386.
Full text
46
Talmadge, R. J., M. J. Castro, D. F. Apple, and G. A. Dudley. "Phenotypic adaptations in human muscle fibers 6 and 24 wk after spinal cord injury." Journal of Applied Physiology 92, no. 1 (January 1, 2002): 147–54. http://dx.doi.org/10.1152/japplphysiol.000247.2001.
Full textAbstract:
10.1152/japplphysiol.000247.2001.—The effects of spinal cord injury (SCI) on the profile of sarco(endo) plasmic reticulum calcium-ATPase (SERCA) and myosin heavy chain (MHC) isoforms in individual vastus lateralis (VL) muscle fibers were determined. Biopsies from the VL were obtained from SCI subjects 6 and 24 wk postinjury ( n = 6). Biopsies from nondisabled (ND) subjects were obtained at two time points 18 wk apart ( n = 4). In ND subjects, the proportions of VL fibers containing MHC I, MHC IIa, and MHC IIx were 46 ± 3, 53 ± 3, and 1 ± 1%, respectively. Most MHC I fibers contained SERCA2. Most MHC IIa fibers contained SERCA1. All MHC IIx fibers contained SERCA1 exclusively. SCI resulted in significant increases in fibers with MHC IIx (14 ± 4% at 6 wk and 16 ± 2% at 24 wk). In addition, SCI resulted in high proportions of MHC I and MHC IIa fibers with both SERCA isoforms (29% at 6 wk and 54% at 24 wk for MHC I fibers and 16% at 6 wk and 38% at 24 wk for MHC IIa fibers). Thus high proportions of VL fibers were mismatched for SERCA and MHC isoforms after SCI (19 ± 3% at 6 wk and 36 ± 9% at 24 wk) compared with only ∼5% in ND subjects. These data suggest that, in the early time period following SCI, fast fiber isoforms of both SERCA and MHC are elevated disproportionately, resulting in fibers that are mismatched for SERCA and MHC isoforms. Thus the adaptations in SERCA and MHC isoforms appear to occur independently.
47
Tullis, A., and B. A. Block. "Expression of sarcoplasmic reticulum Ca(2+)-ATPase isoforms in marlin and swordfish muscle and heater cells." American Journal of Physiology-Regulatory, Integrative and Comparative Physiology 271, no. 1 (July 1, 1996): R262—R275. http://dx.doi.org/10.1152/ajpregu.1996.271.1.r262.
Full textAbstract:
The superior rectus muscles of marlin, swordfish, sailfish, and spearfish are modified for generating heat rather than force. This study focuses on the sarcoplasmic reticulum calcium-adenosinetriphosphatase (SR Ca(2+)-ATPase) to gain further insight into the muscle fiber type origin of the billfish “heater cell.” Direct sequencing and immunolocalization demonstrated that marlin and swordfish epaxial swimming muscles express two forms of the SR Ca(2+)-ATPase in a fiber type-specific manner; red slow-twitch skeletal and cardiac muscles express the same SERCA2 message, whereas white fast-twitch skeletal muscles express a SERCA1 message. Thus the expression pattern of the SR Ca2+ pump is similar in both billfish and tetrapod muscles. Molecular and immunological studies revealed that billfish heater tissue and superior rectus muscle express both fast and slow SR Ca2+ pump isoforms. Immunohistochemical results suggest that heater cells and most extraocular muscle fibers express the fast SR Ca2+ pump. Expression of the fast SR Ca(2+)-ATPase by heater cells has implications for heater cell origin and thermogenic control.
48
Grüner, George, and James Tyrrell. "An interview with board member Serdar Sariciftci." Translational Materials Research 2, no. 1 (March 10, 2015): 010202. http://dx.doi.org/10.1088/2053-1613/2/1/010202.
Full text
49
Jiang, M., A. Xu, D. L. Jones, and N. Narayanan. "Coordinate downregulation of CaM kinase II and phospholamban accompanies contractile phenotype transition in the hyperthyroid rabbit soleus." American Journal of Physiology-Cell Physiology 287, no. 3 (September 2004): C622—C632. http://dx.doi.org/10.1152/ajpcell.00352.2003.
Full textAbstract:
This study investigated the effects of l-thyroxine-induced hyperthyroidism on Ca2+/calmodulin (CaM)-dependent protein kinase (CaM kinase II)-mediated sarcoplasmic reticulum (SR) protein phosphorylation, SR Ca2+ pump (Ca2+-ATPase) activity, and contraction duration in slow-twitch soleus muscle of the rabbit. Phosphorylation of Ca2+-ATPase and phospholamban (PLN) by endogenous CaM kinase II was found to be significantly lower (30–50%) in soleus of the hyperthyroid compared with euthyroid rabbit. Western blotting analysis revealed higher levels of sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA) 1 (∼150%) Ca2+ pump isoform, unaltered levels of SERCA2 Ca2+ pump isoform, and lower levels of PLN (∼50%) and δ-, β-, and γ-CaM kinase II (40 ∼ 70%) in soleus of the hyperthyroid rabbit. SR vesicles from hyperthyroid rabbit soleus displayed approximately twofold higher ATP-energized Ca2+ uptake and Ca2+-stimulated ATPase activities compared with that from euthyroid control. The Vmax of Ca2+ uptake (in nmol Ca2+·mg SR protein−1·min−1: euthyroid, 818 ± 73; hyperthyroid, 1,649 ± 90) but not the apparent affinity of the Ca2+-ATPase for Ca2+ (euthyroid, 0.97 ± 0.02 μM, hyperthyroid, 1.09 ± 0.04 μM) differed significantly between the two groups. CaM kinase II-mediated stimulation of Ca2+ uptake by soleus muscle SR was ∼60% lower in the hyperthyroid compared with euthyroid. Isometric twitch force of soleus measured in situ was significantly greater (∼36%), and the time to peak force and relaxation time were significantly lower (∼30–40%), in the hyperthyroid. These results demonstrate that thyroid hormone-induced transition in contractile properties of the rabbit soleus is associated with coordinate downregulation of the expression and function of PLN and CaM kinase II and selective upregulation of the expression and function of SERCA1, but not SERCA2, isoform of the SR Ca2+ pump.
50
Widowati, Esti, Gusti Fauza, Rizky Nugrahaningtyas, and Dinta Selma Petriani. "APLIKASI MATCHA GREEN TEA DAN SARI JERUK LEMON DALAM PRODUKSI SERABI SOLO DI UKM LINCO’S SOLO [MATCHA GREEN TEA AND LEMON JUICE APPLICATION OF SERABI SOLO PRODUCTION IN SME LINCO’S SOLO]." Jurnal Sinergitas PKM & CSR 4, no. 2 (September 24, 2020): 131. http://dx.doi.org/10.19166/jspc.v4i2.2137.
Full textAbstract:
<p class="p0">Serabi Solo is a traditional food made from rice flour, coconut milk, sugar, salt, water and other ingridients. Serabi is round, flat and porous. Coconut milk was used to develop serabi's taste making it sweet and savory. However, rancidity can decrease quality of serabi during shelf life. Mold growth also affects food safety of this perishable food. Serabi Solo is developing as gift that has longer shelf life beside flavor and appearance variations. Concrete solutions to inhibit rancidity were matcha green tea because of poliphenol as an antioxidant. Matcha green tea addition and pasteurization improved Serabi Solo quality and inhibited rancidity. Based on previous research, matcha green tea 1% made Serabi shelf life longer (24,66 hours). Other solution was coconut milk pretreatment. According to previous research, lemon juice pH 3 was used in coconut milk with hurdle technique made Serabi Solo has shelf life longer (32 hours). Therefore, this activity was to introduce matcha green tea 1% and lemon juice pH 3 to extend shelf of Serabi Solo in SME Linco's Solo.</p><p class="p0"><strong>Bahasa Indonesia Abstrak</strong>: Kue serabi solo merupakan salah satu makanan tradisional yang terbuat dari tepung beras dan santan. Kue ini bulat, pipih dan berpori-pori. Penambahan santan saat memasak serabi membuat serabi terasa manis dan gurih. Namun, santan dalam serabi selain memberikan rasa gurih juga mudah mengalami kerusakan selama penyimpanan. Munculnya aroma dan rasa tengik yang tidak disukai menyebabkan penurunan kualitas dan daya simpan kue serabi. Selain itu, pertumbuhan kapang juga menjadi masalah keamanan pangan pada serabi. Padahal sebagai produk oleh-oleh, serabi diharapkan memiliki umur simpan lebih panjang selain variasi rasa dan tampilan yang menarik dan kekinian. Solusi aplikatif untuk menghambat ketengikan pada kue serabi solo adalah penggunaan matcha green tea karena mengandung polifenol sebagai antioksidan. Penambahan matcha green tea dan perlakuan pasteurisasi pada santan dapat memperbaiki mutu dan mampu menghambat proses ketengikan sehingga dapat memperpanjang umur simpan kue serabi. Hasil dari penelitian sebelumnya, pada uji ketengikan menunjukkan bahwa kue serabi dengan penambahan matcha green tea konsentrasi 1% memiliki umur simpan selama 24,66 jam. Selain penambahan, matcha green tea, upaya memperpanjang umur simpan serabi yaitu dengan mendesain pretreatment santan. Penelitian sebelumnya menggunakan jenis jeruk dan konsentrasi pH asam sitrat yang paling disukai konsumen dan pengaruh serta lama daya simpan serabi dengan pretreatment santan menggunakan teknik hurdle. Serabi yang paling disukai adalah serabi dengan formula pretreatment santan menggunakan air jeruk lemon dengan pH 3 yang memiliki umur simpan 32 jam. Oleh karena itu, pada kegiatan PkM ini mengaplikasikan matcha green tea 1% dan sari jeruk lemon dengan pH 3 untuk meningkatkan umur simpan serabi terhadap variabel ketengikan di UKM Lincos Solo. </p><div id="gtx-trans" style="position: absolute; left: 23px; top: 207.571px;"> </div>