Relevant bibliographies by topics / SOS operator

Contents

  1. Journal articles
  2. Dissertations / Theses
  3. Books
  4. Book chapters
  5. Conference papers
  6. Reports

Academic literature on the topic 'SOS operator'

Author: Grafiati
Published: 4 June 2021
Last updated: 1 February 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'SOS operator.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Journal articles on the topic "SOS operator"

1

da Rocha, Raquel Paes, Apuã César de Miranda Paquola, Marilis do Valle Marques, Carlos Frederico Martins Menck, and Rodrigo S. Galhardo. "Characterization of the SOS Regulon of Caulobacter crescentus." Journal of Bacteriology 190, no. 4 (December 14, 2007): 1209–18. http://dx.doi.org/10.1128/jb.01419-07.

Full text
Abstract:
ABSTRACT The SOS regulon is a paradigm of bacterial responses to DNA damage. A wide variety of bacterial species possess homologs of lexA and recA, the central players in the regulation of the SOS circuit. Nevertheless, the genes actually regulated by the SOS have been determined only experimentally in a few bacterial species. In this work, we describe 37 genes regulated in a LexA-dependent manner in the alphaproteobacterium Caulobacter crescentus. In agreement with previous results, we have found that the direct repeat GTTCN7GTTC is the SOS operator of C. crescentus, which was confirmed by site-directed mutagenesis studies of the imuA promoter. Several potential promoter regions containing the SOS operator were identified in the genome, and the expression of the corresponding genes was analyzed for both the wild type and the lexA strain, demonstrating that the vast majority of these genes are indeed SOS regulated. Interestingly, many of these genes encode proteins with unknown functions, revealing the potential of this approach for the discovery of novel genes involved in cellular responses to DNA damage in prokaryotes, and illustrating the diversity of SOS-regulated genes among different bacterial species.
APA, Harvard, Vancouver, ISO, and other styles
2

Szabolcsi, Róbert. "Beyond Training Minimums – A New Concept of the UAV Operator Training Program." International conference KNOWLEDGE-BASED ORGANIZATION 22, no. 3 (June 1, 2016): 560–66. http://dx.doi.org/10.1515/kbo-2016-0096.

Full text
Abstract:
Abstract The UAV pilot/operator training is a crucial part being evaluated during certification of the unmanned aircraft systems (UAS). There are many milestones behind, many new initiatives are launched. However, many initiatives originated to the type of the crew training and certification originated to that of the minimum levels derived by regulations. There are two main approaches when establish a training organization. First is, the so-called approach of minimums (AoM) delivered to the operators. Second is originated to that of the set of skills (SoS) necessary to hold by operators to safe operation of the UAV. The author will examine two standpoints evaluating their privileges and bottlenecks, or, if there is any, the threat. New idea will be formulated by the author to combine advantages of those two approaches providing a new set of criteria for training system beyond present minimums.
APA, Harvard, Vancouver, ISO, and other styles
3

Groban, E. S. "Binding of the Bacillus subtilis LexA protein to the SOS operator." Nucleic Acids Research 33, no. 19 (October 24, 2005): 6287–95. http://dx.doi.org/10.1093/nar/gki939.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

van der Veen, Stijn, Saskia van Schalkwijk, Douwe Molenaar, Willem M. de Vos, Tjakko Abee, and Marjon H. J. Wells-Bennik. "The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis." Microbiology 156, no. 2 (February 1, 2010): 374–84. http://dx.doi.org/10.1099/mic.0.035196-0.

Full text
Abstract:
The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a ΔrecA mutant strain after exposure to the DNA-damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; ΔrecA cultures showed considerably lower rifampicin- and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Stress-survival studies showed ΔrecA mutant cells to be less resistant to heat, H2O2 and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.
APA, Harvard, Vancouver, ISO, and other styles
5

Galvão, Carolina W., Fábio O. Pedrosa, Emanuel M. Souza, M. Geoffrey Yates, Leda S. Chubatsu, and Maria Berenice R. Steffens. "TherecXgene product is involved in the SOS response inHerbaspirillum seropedicae." Canadian Journal of Microbiology 49, no. 2 (February 1, 2003): 145–50. http://dx.doi.org/10.1139/w03-010.

Full text
Abstract:
The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable σ70-dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response.Key words: Herbaspirillum seropedicae, recA gene, recX gene, DNA repair, SOS mutagenesis.
APA, Harvard, Vancouver, ISO, and other styles
6

Jochmann, Nina, Anna-Katharina Kurze, Lisa F. Czaja, Karina Brinkrolf, Iris Brune, Andrea T. Hüser, Nicole Hansmeier, Alfred Pühler, Ilya Borovok, and Andreas Tauch. "Genetic makeup of the Corynebacterium glutamicum LexA regulon deduced from comparative transcriptomics and in vitro DNA band shift assays." Microbiology 155, no. 5 (May 1, 2009): 1459–77. http://dx.doi.org/10.1099/mic.0.025841-0.

Full text
Abstract:
The lexA gene of Corynebacterium glutamicum ATCC 13032 was deleted to create the mutant strain C. glutamicum NJ2114, which has an elongated cell morphology and an increased doubling time. To characterize the SOS regulon in C. glutamicum, the transcriptomes of NJ2114 and a DNA-damage-induced wild-type strain were compared with that of a wild-type control using DNA microarray hybridization. The expression data were combined with bioinformatic pattern searches for LexA binding sites, leading to the detection of 46 potential SOS boxes located upstream of differentially expressed transcription units. Binding of a hexahistidyl-tagged LexA protein to 40 double-stranded oligonucleotides containing the potential SOS boxes was demonstrated in vitro by DNA band shift assays. It turned out that LexA binds not only to SOS boxes in the promoter–operator region of upregulated genes, but also to SOS boxes detected upstream of downregulated genes. These results demonstrated that LexA controls directly the expression of at least 48 SOS genes organized in 36 transcription units. The deduced genes encode a variety of physiological functions, many of them involved in DNA repair and survival after DNA damage, but nearly half of them have hitherto unknown functions. Alignment of the LexA binding sites allowed the corynebacterial SOS box consensus sequence TcGAA(a/c)AnnTGTtCGA to be deduced. Furthermore, the common intergenic region of lexA and the differentially expressed divS-nrdR operon, encoding a cell division suppressor and a regulator of deoxyribonucleotide biosynthesis, was characterized in detail. Promoter mapping revealed differences in divS-nrdR expression during SOS response and normal growth conditions. One of the four LexA binding sites detected in the intergenic region is involved in regulating divS-nrdR transcription, whereas the other sites are apparently used for negative autoregulation of lexA expression.
APA, Harvard, Vancouver, ISO, and other styles
7

Valinevich, P. A., S. E. Derkachov, and A. P. Isaev. "SOS-Representation for the SL(2,ℂ)-Invariant R-Operator and Feynman Diagrams." Journal of Mathematical Sciences 238, no. 6 (April 1, 2019): 819–33. http://dx.doi.org/10.1007/s10958-019-04278-x.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Au, Nora, Elke Kuester-Schoeck, Veena Mandava, Laura E. Bothwell, Susan P. Canny, Karen Chachu, Sierra A. Colavito, et al. "Genetic Composition of the Bacillus subtilis SOS System." Journal of Bacteriology 187, no. 22 (November 15, 2005): 7655–66. http://dx.doi.org/10.1128/jb.187.22.7655-7666.2005.

Full text
Abstract:
ABSTRACT The SOS response in bacteria includes a global transcriptional response to DNA damage. DNA damage is sensed by the highly conserved recombination protein RecA, which facilitates inactivation of the transcriptional repressor LexA. Inactivation of LexA causes induction (derepression) of genes of the LexA regulon, many of which are involved in DNA repair and survival after DNA damage. To identify potential RecA-LexA-regulated genes in Bacillus subtilis, we searched the genome for putative LexA binding sites within 300 bp upstream of the start codons of all annotated open reading frames. We found 62 genes that could be regulated by putative LexA binding sites. Using mobility shift assays, we found that LexA binds specifically to DNA in the regulatory regions of 54 of these genes, which are organized in 34 putative operons. Using DNA microarray analyses, we found that 33 of the genes with LexA binding sites exhibit RecA-dependent induction by both mitomycin C and UV radiation. Among these 33 SOS genes, there are 22 distinct LexA binding sites preceding 18 putative operons. Alignment of the distinct LexA binding sites reveals an expanded consensus sequence for the B. subtilis operator: 5′-CGAACATATGTTCG-3′. Although the number of genes controlled by RecA and LexA in B. subtilis is similar to that of Escherichia coli, only eight B. subtilis RecA-dependent SOS genes have homologous counterparts in E. coli.
APA, Harvard, Vancouver, ISO, and other styles
9

Braicu, Elena Ioana, Toon van Gorp, Rolf Richter, Radoslav Chekerov, Dirk Timmerman, Mani Nassir, Jalid Sehouli, and Ignace Vergote. "Surgical outcome score (SOS), a new algorithm based on HE4 and CA125, to predict surgical outcome in primary epithelial ovarian cancer (EOC) patients (pts)." Journal of Clinical Oncology 31, no. 15_suppl (May 20, 2013): 5549. http://dx.doi.org/10.1200/jco.2013.31.15_suppl.5549.

Full text
Abstract:
5549 Background: There are no clinical or biomolecular algorithms to predict surgical outcome in EOC pts. Recently, we showed that the combination of HE4 and CA125 predict surgical outcome in advanced primary EOC (ASCO 2012). We validated the cut-off values in an independent cohort and developed a new algorithm to predict surgical outcome-SOS. Methods: Pts with primary EOC (n = 193) were selected for a retrospective study between 2003 and 2011. Preoperative serum HE4 and CA125 levels were measured. The predictive values of HE4 and CA125 were analyzed using the receiver operator characteristic (ROC) with the corresponding area under the curve (AUC). Separate logistic regression algorithms for pre- and postmenopausal women were utilized to categorize pts into low and high-risk for residual disease, using CA125 and HE4 within SOS algorithm. Furthermore we performed a multivariate analysis for prediction of progression free- (PFS) and overall survival (OS). Results: Maximal cytoreduction was achieved in 67.4% pts. Serum HE4 expression correlated with residual disease (p<0.001, RR: 2.74, 95%CI 1.65-4.54), reaching a 76.2% sensitivity (Se), 56.9% specificity (Sp) and 83.1% negative predictive value (NPV), with 235 pM cut-off value. CA125 correlated with residual disease in premenopausal pts (p=0.031, RR: 3.13, 95%CI 1.28-7.65). For a CA125 cut-off of 500 IU/l, the Se, Sp and NPV were 39.7%, 69.8%, and 70.3%, respectively. ROMA predicted surgical outcome (AUC = 0.70, p <0.001, 95% CI = 0.624-0.776, RR = 2.54), reaching a 76.2% Se, 53.5% Sp for 81% cut-off value. SOS algorithm performed better than HE4 or CA125 alone, and ROMA (AUC= 0.741, p < 0.001, 95% CI 0.670-0.812, RR = 4.98). The Se, Sp and NPV was 90.5%, 46.5% and 90.9%, respectively, for a SOS cut off value of 21.5%. FIGO stage and residual disease were the only prognostic factors for both PFS and OS. SOS was an independent prognostic for PFS (p = 0.009, HR = 1.014, 95% CI = 1.004-1.025), but not for OS. Conclusions: This independent validation study confirm the predictive value of CA124 and HE4 on surgical outcome. The combination of HE4 and CA125 within the SOS score improve the prediction of surgical outcome, and therefore of PFS.
APA, Harvard, Vancouver, ISO, and other styles
10

Riera, Joan, Antonio R. de Henestrosa Fernández, Xavier Garriga, Angels Tapia, and Jordi Barbé. "Interspecies regulation of the recA gene of gram-negative bacteria lacking an E. coli-like SOS operator." Molecular and General Genetics MGG 245, no. 4 (July 1994): 523–27. http://dx.doi.org/10.1007/bf00302266.

Full text
APA, Harvard, Vancouver, ISO, and other styles
More sources

Dissertations / Theses on the topic "SOS operator"

1

Lind, Rose-Marie, and Pär Lindblad. "Från prio ett larm enligt medicinskt index till bedömning av egenvård enligt RETTS : En kvantitativ granskning av ambulansjournaler." Thesis, Linnéuniversitetet, Institutionen för hälso- och vårdvetenskap (HV), 2017. http://urn.kb.se/resolve?urn=urn:nbn:se:lnu:diva-62508.

Full text
Abstract:
Bakgrund: Enligt statistiken har ambulansutryckningarna ökat men ambulanstätheten minskat. Det behövs därför en väl fungerande prioritering av patienterna som söker akut vård från larmcentralen. De som inte är i akut behov av ambulanstransport till sjukhus ska kunna omdirigeras till att söka annan vård som vårdcentral eller stanna hemma med egenvård.   Syfte: är att jämföra patienter med samma ESS kod i ambulansjournalerna som endera transporterades till sjukhus eller kvarstannande med egenvård vid prio ett larm. Metod: En retrospektiv fallkontroll studie med en kvantitativ ansats. En journalgranskning med 139 inkluderade ambulansjournaler från södra Sverige.   Resultat: Andelen prio ett uppdrag där patienten lämnades hemma med egenvård i föreliggande studie var 193 stycken, 7,2 procent. Utifrån resultatet fanns det inga skillnader i åldern mellan patienter som stannade kvar respektive transporterades med ambulans till akuten på respektive sjukhus. Det fanns heller inga signifikanta skillnader mellan könen utifrån tid på dygnet. Dock fanns det en signifikant skillnad då det gällde avstånd till sjukhus. För patienterna som bodde ≤ 8 km radie från ett sjukhus stannade 83st (59,7%) kvar i hemmet med egenvård. För patienter med ≥ 8 km ifrån ett sjukhus stannade 106 (76,3 %) kvar i hemmet med egenvård. Totalt för patienter som transporterades överensstämde larmcentralens index med ambulanssjuksköterskans ESS-kod vid 52%. För patienter som kunde kvarstanna i hemmet var överensstämmelsen 42% mellan larmcentralens index och ambulanssjuksköterskans ESS.   Slutsats: Studien kunde inte påvisa någon skillnad mellan kön och tidpunkt av de som transporterades mot de som kunde stanna hemma, dock fanns det en signifikant skillnad på antal patienter som transporterades och kunde stanna hemma beroende på avstånd mellan deras boende och sjukhus. Även fanns det en förbättringspotential mellan SOS index och ambulanssjuksköterskans ESS kod, att denna skulle stämma mer överens. För ambulanssjuksköterskan är det viktigt att behandla alla patienter lika oberoende på yttre faktorer, i denna studie framkom att avståndet hade en betydelse. Detta får vi som ambulanssjuksköterskor ta till oss och inte låta ha en avgörande betydelse för den vård vi beslutar oss för att ge patienten.
Background: According to statistics, ambulance emergency were increased but the density decreases, which requires a well-functioning prioritization of patients seeking emergency care from the central station. Those who are not in need of urgent ambulance transport to the hospital to be redirected to seek other care medical center or stay at home with self-care.   Purpose: is to compare patients with the same ESS Code of ambulance records that are either transported to a hospital or keeping people with self-care at priority alarm. Method: A retrospective case-control study with a quantitative approach. A medical record review of 139 included ambulance records from southern Sweden.   Results: The proportion of priority a mission in which the patient was at home with self-care in this study were 193 pieces, 7.2 per cent. Based on the results, there were no differences in age between patients who remained and was transported by ambulance to the emergency room and hospital. There were also no significant differences between the sexes based on time of day. However, there was a significant difference as regards the distance to the hospital. For patients who lived ≤ 8 km radius of a hospital stayed 83st (59.7%) remain in the home with self-care. For patients with ≥ 8 km from the hospital stayed 106 (76.3%) remain in the home with self-care. Total of patients transported consistent monitoring center index with the ambulance nurse ESS Code at 52%. For patients who were able to remain in the home was the consistency 42% between the central station's index and the ambulance nurse ESS. Conclusion: The study did not demonstrate a difference between gender and time of the transported toward those who could stay at home, however, there was a significant difference in the number of patients who were transported and could stay home, depending on the distance between their accommodation and hospitals. Although there was an improvement in potential between SOS Index and the ambulance nurse ESS code. For ambulance nurse, it is important to treat all patients equally regardless of external factors, in this study revealed that the distance had a meaning. This we get that ambulance nurses bring to us and not let be crucial for the care we decide to give.
APA, Harvard, Vancouver, ISO, and other styles
2

Dimech, Angelo. "SKYVE : Online SMS and Contacts Operator-Independent Archiver." Thesis, Uppsala University, Department of Information Technology, 2010. http://urn.kb.se/resolve?urn=urn:nbn:se:uu:diva-129473.

Full text
Abstract:

The mobile phone is a relatively new means of communication. Nevertheless due to its usability it has evolved to become one of the most used ways of communication over the last ten years.

A mobile phone is a medium that has the main scope of allowing its user to call and send short text messages (SMS) to other people from practically anywhere. Due to the inconvenience of having to carry a separate medium to store contacts information, mobile phones have always had the functionality to store contacts details. Being a portable device it is very easily lost or stolen, and when this happens people are generally frustrated due to having lost their contacts and SMS messages more than about the mobile phone itself.

One of the easiest ways of overcoming this frustration is by archiving the information on the mobile onto another medium. Currently the only way to archive information from your mobile phone is by using proprietary software and connecting the mobile phone to your PC. This type of archiving is mostly useful when one loses his mobile phone but has the disadvantage that it can only be accessed through the same PC. This project will deal with a solution to overcame the mentioned problem. The solution is intended to became a platform for other solution that can be added in the future for archiving SMS and contact details.

APA, Harvard, Vancouver, ISO, and other styles
3

Engel, Filip. "Návrh mediální kampaně služby Student SMS Grátis." Master's thesis, Vysoká škola ekonomická v Praze, 2008. http://www.nusl.cz/ntk/nusl-3337.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Rossbach, Björn Peter. "Langzeitergebnisse und Einflussfaktoren operativ versorgter Tibiakopffrakturen /." Köln, 2008. http://opac.nebis.ch/cgi-bin/showAbstract.pl?sys=000278346.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Nogueira, Moema Guiduce [UNESP]. "Pensando no depois: um estudo sob a perspectiva da gramaticalização." Universidade Estadual Paulista (UNESP), 2011. http://hdl.handle.net/11449/100119.

Full text
Abstract:
Made available in DSpace on 2014-06-11T19:30:28Z (GMT). No. of bitstreams: 0 Previous issue date: 2011-07-28Bitstream added on 2014-06-13T19:00:38Z : No. of bitstreams: 1 nogueira_mg_dr_sjrp.pdf: 746465 bytes, checksum: 7967c086da68d8eec094c9a3be6ee1eb (MD5)
Sob perspectiva diacrônica, este trabalho tem como propósito resgatar a trajetória de mudança de usos de depois na história do português, com base em seus aspectos sintáticos, semânticos e pragmáticos. Fundamentada em descrição sincrônica de usos de depois no português atual (MARTELOTTA, 1996), nossa hipótese é a de que o continuum espaço > (tempo) > texto, que permite organizar os usos sincrônicos, é resultante de um percurso histórico de mudança categorial, desde o latim, com a seguinte configuração: advérbio espacial > advérbio temporal > locução prepositiva/conjuntiva ou conjunção temporal > operador argumentativo de valor aditivo. Esse percurso instancia-se por meio de um processo de gramaticalização, que, na sua acepção mais clássica, envolve rebaixamento de estatuto categorial de um elemento linguístico (HOPPER & TRAUGOTT, 1993), possível de ser apreendido em contextos linguísticos específicos. Assim, a expectativa é a de que usos de depois apreendidos nas diferentes sincronias permitem recompor sua trajetória de gramaticalização. Constitui ainda objetivo deste trabalho, correlacionar os usos de depois às funções ideacional, interpessoal e textual da linguagem (HALLIDAY, 1976, 1978). Metodologicamente, a investigação empírica toma por base dados diacrônicos provenientes de textos que integram a “Amostra diacrônica do Português” (LONGHIN-THOMAZI, 2004), disponível em . Trata-se de um banco de textos informatizados, de gêneros textuais variados, representativos de oito séculos, a contar do século XIII. Os resultados alcançados revelam, ao longo da história do português, sete usos diferentes de depois: i) como Locativo, para localizar entidade em espaço posterior; ii) como Temporal Absoluto, para localizar precisamente o tempo posterior de um evento; iii) como Temporal Aproximativo, para localizar...
Under a diachronic perspective, this paperwork aims at emphasizing the change path in the use of the word after in the history of the Portuguese language, based on its syntactic, semantic and pragmatic aspects. Supported by a synchronous description of the uses of the word after in current Portuguese (MARTELOTTA, 1996), our hypothesis is that continnum space > (time) > text, which allows for the organization of the synchronous uses, and comes from a historical path of categorial change, beginning with Latin and represented by the following configuration: adverb of space > adverb of time > prepositional/conjunctive phrase or conjunction of time > additive value argumentative operator. This historical path happens by means of a grammaticalization process, which, in its most classic meaning, involves categorial status degradation of a linguistic element (HOPPER & TRAUGOTT, 1993), observable in specific linguistic contexts. Thus, there is an expectation that the uses of after apprehended from different synchronies allow for the recreation of its grammaticalization path. This paperwork also aims at correlating the uses of after to the ideational, interpersonal and textual language functions (HALLIDAY, 1976, 1978). Methodologically, the empirical investigation is supported by diachronic data originated from texts that comprise the “Diachronic Sample of the Portuguese Language” (LONGHIN-THOMAZI, 2004), available at . The sample is a database of computerized texts from various genres and which are representative of eight centuries, starting from the thirteenth century. The results show seven different uses of the word after throughout the history of the Portuguese language: i) as a Locative element, in order to locate entities in subsequent space; ii) as an Absolute Temporal element, in order to precisely locate the subsequent time of a given event; iii)... (Complete abstract click electronic access below)
APA, Harvard, Vancouver, ISO, and other styles
6

Ferraro, Alberto. "Optimal design and operation of HMs removal from soil by EDDS enhanced washing." Thesis, Paris Est, 2015. http://www.theses.fr/2015PESC1194/document.

Full text
Abstract:
Ce travail de recherche porte sur l'optimisation des procédés de lavage de sol permettant le traitement des sites contaminés par des métaux lourds. Cette étude se concentre sur le cycle complet de ce type de traitement, incluant la possibilité de réutilisation et un traitement adapté de la solution de lavage de sol utilisée. La conception et l'exploitation d'un procédé de lavage de sol sont étudiées dans le but d'optimiser leur coût et leur efficacité. Dans ce but, les paramètres et la configuration du réacteur utilisé pour ce procédé sont étudiés en détail à travers des tests à l'échelle du laboratoire, et les cinétiques sont simulées par une modélisation mathématique. Les échantillons de sol utilisés au cours de cette étude proviennent de terres agricoles présentant une forte contamination en cuivre. Parmi plusieurs agents chélateurs de la famille des aminopolycarboxylates, il a été choisi d'utiliser l'acide éthylènediamine-N, N'-disuccinique (EDDS) pour sa biodégradabilité - largement rapportée dans la littérature – et son efficacité importante d'extraction des métaux lourds, y compris du cuivre. Le travail bibliographique a permis d'identifier les deux paramètres cruciaux pour l'optimisation du procédé de lavage de sol : le rapport molaire EDDS : Cu et le rapport liquide-solide (L/S). Des tests réalisés dans un réacteur à agitation continue (RAC) en fonctionnement discontinu ont permis d'étudier l'influence de ces deux paramètres sur le rendement et la cinétique d'extraction du cuivre. L’augmentation du rapport molaire EDDS : Cu a permis une meilleure amélioration de l'efficacité du procédé, comparée à l'augmentation du rapport L/S. Par ailleurs, les tests réalisés en discontinu ont clairement mis en évidence une première étape cinétique rapide au début du traitement, suivie d'une seconde étape d'extraction plus lente jusqu'à la fin du traitement. Il a donc été formulé un modèle empirique basé sur deux termes cinétiques. Les paramètres du modèle ont été calibrés puis validés grâce à deux séries de données expérimentales différentes. Ce modèle permet d'abord d'évaluer la validité de l'hypothèse d'un procédé reposant sur deux étapes cinétiques différentes. Cela représente aussi un nouvel outil pour prévoir l'efficacité du procédé en fonction de l'évolution du ratio molaire EDDS : Cu et du temps de traitement. Les coûts d'exploitation du procédé ont été minimisés en étudiant différentes configurations de traitement. En particulier, deux configurations en réacteur piston ont été analysées et comparées à celle en RAC. Les réacteurs pistons ont été simulés en utilisant plusieurs réacteurs en série et en variant les temps de rétention et le fractionnement de l'injection de la solution de lavage de sol. Comparés à la configuration en RAC, les résultats obtenus en réacteur piston ont montré une amélioration du rendement et de la cinétique d'extraction du cuivre, ainsi qu'une réduction de la quantité de solution de lavage utilisée. Pour finir, un procédé électrochimique a été mis en place pour le traitement et la récupération de la solution d'EDDS utilisée. Des tests en réacteur discontinu ont permis d'optimiser les paramètres de ce procédé (densité de courant, pH et conductivité de la solution de lavage de sol). La solution récupérée a ensuite été utilisée pour d'autres étapes de lavage de sol. Les résultats obtenus ont prouvé l'efficacité du traitement électrochimique pour la récupération de la solution d'EDDS, et permettent d'envisager l'application de cette technique pour réduire le coût des procédés de lavage de sol utilisant l'EDDS
The object of the present research work is the optimization of soil-washing processes applied to heavy metal contaminated soils. The work focuses on the whole cycle of these treatments, including the possible recovery and the proper disposal of the used washing solution. Both the design and the exploitation of a soil washing treatment are investigated, in order to maximize their efficacy, in terms of cost and process efficiency. At this aim process parameters and reactor configurations are studied in details through lab-scale tests, and the observed kinetics are simulated through mathematical modeling. Soil samples used for the experimental activity were collected from an agricultural field located in Southern Italy, mainly contaminated by copper. Among several Aminopolycarboxylate (APC) chelating agents, Ethylenediamine-N,N'-disuccinic acid (EDDS) was selected, for its recognized biodegradability, widely reported in literature works, and its efficiency as extracting agent towards several heavy metals, including Cu. Literature review allowed determining the two most important process parameters to be investigated for washing optimization. The two parameters were identified as EDDS : Cu molar ratio and liquid to soil ratio (L/S). In order to investigate the effect of these parameters on process kinetics and Cu extraction yield, batch washing tests in continuous-stirred tank reactor configuration (CSTR) were carried out. EDDS : Cu molar ratio increase was found to be able to enhance process efficiency more than L/S increase. Batch tests clearly displayed a first fast kinetic step at the beginning of the treatment, followed by a second slower kinetic extraction step, which lasted until the end of the treatment. According to this observation, an empirical mathematical model based on two-kinetic terms was formulated. Model parameters were firstly calibrated and then validated using two different sets of experimental data. The derived mathematical model was useful to assess the validity of the two-kinetic steps process hypothesis, and to provide a tool for process efficiency prediction depending on EDDS : Cu molar ratio and treatment time length. Exploitation costs of the process were minimized studying different treatment configurations. In details two Plug-Flow configurations were analyzed and compared to the CSTR one. The two Plug-Flow configurations were simulated using several reactors in series, varying the detention time of the reactors, and fractionating the injection of the washing solution. Achieved results displayed improvements in terms of Cu extraction yield and process kinetic for the tested Plug-Flow conditions compared to the CSTR one, and showed that the use of a Plug-Flow reactor allows to reduce the amount of required washing solution. Finally, an electrochemical process was tested for the treatment and the recovery of the spent EDDS solution. Batch tests were carried out to optimize electrochemical process parameters (e.g. current density, washing solution pH and conductivity). The recovered solution was also used for a multi-washing test. Results proved the effectiveness of the electrochemical treatment for EDDS solution recovery and its potential application as technique for EDDS-enhanced soil washing costs reduction
APA, Harvard, Vancouver, ISO, and other styles
7

Jaoul, Mathieu. "Study of HBT operation beyond breakdown voltage : Definition of a Safe Operating Area in this operation regime including the aging laws." Thesis, Bordeaux, 2020. http://www.theses.fr/2020BORD0029.

Full text
Abstract:
Le développement de nouvelles filières BiCMOS permettra, grâce aux améliorations technologiques apportées aux TBH (Transistor Bipolaire à Hétérojonction) SiGe:C, d’atteindre des performance dynamiques au-delà de 0.5 THz. Un aspect important doit être investigué : il s’agit de l’aire de sécurité de fonctionnement (SOA : Safe operating area) au-delà du classique BVCEO. En effet, de par la complexité des futures architectures de TBH(comme la B55X de chez STMicroelectronics) et de par leur taille nanométrique, il est attendu une augmentation des effets physiques présents dans ces transistors. Par ailleurs,en raison de la dépendance croissante de la conception de circuits vis-à-vis des outils logiciels, on s’attend à devoir développer des efforts supplémentaires pour concevoir des modèles compacts davantage prédictifs. Ainsi, le sous-projet SOA est conçu pour décrire l’aire de sécurité de fonctionnement des TBH SiGe :C de taille nanométrique en vue de son intégration dans le modèle compact en tenant compte des aspects critiques.Dans le premier chapitre, une description précise des régimes de fonctionnement au delà de la tension de claquage BVCEO est développée. Le modèle compact HICUM est amélioré pour prendre en compte les mécanismes se produisant dans cette région afin de modéliser précisément le phénomène d’avalanche et l’effet de focalisation du courant au centre de l’émetteur. Une validation de ce nouveau modèle est réalisée au travers de simulations TCAD mais aussi par des caractérisations électriques de différents TBH de tailles variées et pour de multiples températures.Dans le second chapitre, le comportement des transistors bipolaires proche des limites de fonctionnement a été étudié. Une étude de l’effet de focalisation du courant et du phénomène de “snapback” est réalisée pour en définir précisement les limites de fonctionnementà forts courants et tensions et une zone de stabilité est définie.Dans de troisième chapitre, le vieillissement accéléré de TBH est réalisé pour des régimes de fonctionnement aux frontières de la zone de sécurité de fonctionnement. Un modèle de vieillissement est alors développé pour prendre en compte les mécanismes d’usure se produisant dans ces régimes de fonctionnement.En conclusion, ce travail a permis de modéliser de manière précise les TBH SiGe àforts courant et tensions tout en prenant en compte les mécanismes d’usure se produisant dans ces régimes de polarisation
The development of new BiCMOS technology will be possible, thanks to the SiGe:CHBTs technological improvements to reach dynamic performance beyond 0.5 THz. Animportant aspect to be investigated is the Safe Operating Area (SOA) beyond the traditionalBVCEO. In fact, due to the complexity of future architectures of HBTs (likethe B55X from STMicroelectronics) and their nanoscale size, an increase of the wear-outmechanisms occurring in these transistors is expected. In addition, because of the increasingdependence of circuit design on software tools, it is expected that additional effortswill be required to develop more predictive compact models. Thus, the SOA sub-projectis designed to describe the functional safety area of nanoscale SiGe:C HBTs allowing thecompact model to take into account critical aspects.After a short introduction, a precise description of the transistor operations beyondthe breakdown voltage is detailed in the second chapter. The compact model HICUM isimproved to account for the mechanisms occurring in this region to accurately model theavalanche regime and the pinch-in effect. This new model is validated on TCAD simulationsand through electrical measurements on different devices, architecture, geometriesand temperatures.In the third chapter, the investigation is deepen towards the device border’s operation.A study of the pinch-in effect and the snapback behavior is therefore realized to understandthe operation limitations at high currents and voltages and a stable operation regime isintroduced.In the fourth chapter, accelerated aging tests are carried out at the boundaries of thesafe operating area to submit the transistor to thermal and hot carriers stresses during itsoperation. An aging model is developed to account for the wear-out mechanism occurringin that regime.To conclude, this work allowed to increase the modeling of SiGe HBTs at high voltagesand currents accounting for the wear-out mechanisms occurring in that operation regime
APA, Harvard, Vancouver, ISO, and other styles
8

Dias, Fernanda de Oliveira. "Construção operatoria e quadros psicopatologicos : um estudo sob a otica piagetiana." [s.n.], 1996. http://repositorio.unicamp.br/jspui/handle/REPOSIP/252420.

Full text
Abstract:
Orientador: Fermino Fernandes Sisto
Dissertação (mestrado) - Universidade Estadual de Campinas, Faculdade de Educação
Made available in DSpace on 2018-07-21T17:21:33Z (GMT). No. of bitstreams: 1 Dias_FernandadeOliveira_M.pdf: 11682029 bytes, checksum: 50a3a26d2358429884143cb2747dfc2c (MD5) Previous issue date: 1996
Resumo: Partindo-se dos pressupostos da teoria piagetiana de que a construção operatória segue um "créodo", levanta-se a hipótese de que no caso de crianças e adolescentes em que este "caminho necessário" foi severamente perturbado (por causas endógenas ou exógenas), os diferentes quadros patológicos resultantes ocasionariam construções operatórias também diferenciadas entre si, pois associadas aos quadros particulares. Participaram da pesquisa alunos de uma escola da rede particular de ensino da cidade de São Paulo, assim caracterizados: escolaridade da pré-escola ao 1º grau, idade de 6 a 17 anos e apresentando dificuldades severas para a aprendizagem em função de transtornos diversos. Estes transton10S foram agrupados em quatro grandes grupos: transtornos orgânicos, retardo mental, transtornos emocionais de comportamento e transtornos do desenvolvimento psicológico. Investigou-se através da análise estatística dos dados, as inter-relações entre o desempenho nas provas operatórias ( conservação, classificação e seriação) e os grupos psicopatológicos em que foram classificados os sujeitos. Os resultados mostraram não haver diferenças significativas nesta inter-relação, ou seja, os transtornos patológicos apontados não produzem diferentes ritmos de construção nos vários domínios pesquisados pelas provas operatórias. Entretanto, embora a construção cognitiva siga seu trajeto em direção à operatividade, os vários transtornos apontados afetaram o desenvolvimento como um todo, ocasionando as dificuldades acentuadas desse grupo de sujeitos para a apropriação do conhecimento e conseqüentemente para a aprendizagem
Abstrasct: On the basis of the presuppositions of Piagetian theory from wich operatory construction follows a "creodo", was formed a hypothesis that in case of childrell and adolescents ill wich "necessary way" was hardly disturbed ( by endogenous or exogenous reasons), different pathologic states could be caused, wich could make happen operatory constructions also different among themselves, as associated to private states. Students of a private school of São Paulo took part of this research. They are pupils from pre-school and first grade and aged between 6 and ] 7 years old. They presented severes difficulties on the leaming in function of several disturbances. These disturbs were categorized into four groups: organic disturbances, mental deficiency, emotional and behavior disturbances and psychological development disturbances. Statistical analysis was used to investigate the interrelation among the performance in the operatory tasks (conservation, classification and seriation) and the psychopathological groups. The results showed no significant differences in this interrelation; the pathological disturbances do not produce different rhythms of consumption into the several notions researched by the operatory tasks. However, although the cognitive construction follows its cours in the direction of an operatory conduct, the several refered disturbances affected the development, as a whole, causing the severed difficulties of that group 1I1 relation to the knowledge construction and conseqllcntly to leaming
Mestrado
Psicologia Educacional
Mestre em Educação
APA, Harvard, Vancouver, ISO, and other styles
9

Hultberg, Niklas. "Operation Rolling Thunder." Thesis, Försvarshögskolan, 2013. http://urn.kb.se/resolve?urn=urn:nbn:se:fhs:diva-4096.

Full text
Abstract:
This paper provides an explanation of the concepts John A. Warden III describes regarding the use of air power and if this theory can be found, within the confines of an unconventional war. The U.S. ability to air power is overwhelming, however the right kind of warfare can force this great power to abandon their military and political objectives by exhausting its resources over time as it becomes increasingly costly, both economically, politically and morally, to wage war. The research deals with operation Rolling Thunder and John A. Warden IIIs theory in relation to this massive bombing campaign. Firstly, you will find an analysis of John. A. Warden III's works. Five concepts can be found: Airspace Control, center of gravity, air interdiction, the enemy as a system and parallel attack. Secondly, a content analysis of relevant literature in the context of a case study on Operation Rolling Thunder. Thirdly a comparative analysis between the two results with a subsequent discussion relating the main problem and an effort is made to determine the outcome of the investigation and if the purpose of this paper has been met. Within the implementation phases of Operation Rolling Thunder, it is possible to distinguish som of Wardens key concepts regarding air power utilization. Even though the four phases illustrate a continuous change in strategy, Wardens theory The Enemy as a system was never implemented.
Denna uppsats ger en förklaring av John A. Warden IIIs teori om nyttjande av luftmakt och de begrepp som utgör grunden för denna. Frågan om grundbegreppen går att återfinna inom ramarna för ett otraditionellt krig tas upp. USAs förmåga till luftmakt är stor, men med rätt sorts krigföring kan även denna makt tvingas överge sina militära och politiska mål genom utmattning över en längre tidsperiod eftersom det blir allt dyrare, både ekonomiskt, politiskt och moraliskt, att föra krig. Här avhandlas operationen Rolling Thunder och John A. Warden IIIs teoris anknytning till denna enorma bombkampanj. Inledningsvis återfinns en innehållsanalys av John. A. Warden IIIs litteratur, vilket utmynnar i fem begrepp: Luftrumskontroll, tyngdpunkter, flyganfall på djupet, fienden som ett system och parallell attack. Efter det följer en innehållsanalys av relevant litteratur inom ramen för en fallstudie om Rolling Thunder och slutligen påträffas en komparativ analys mellan de två resultaten och en efterföljande diskussion knyter an till problemformuleringen och försöker utröna resultatet av undersökningen och om syftet med uppsatsen uppfyllts. I genomförandefaserna av Operation Rolling Thunder är det möjligt att urskilja vissa av Wardens centrala begrepp och tankar om luftmaktens nyttjande, men hans teori som helhet går inte att återfinna i genomförandet av Rolling Thunder. Trots att de fyra faserna åskådliggör en upprepad förändring i strategi, användes aldrig Wardens teori om fienden som ett system.
APA, Harvard, Vancouver, ISO, and other styles
10

Nogueira, Moema Guiduce. "Pensando no depois : um estudo sob a perspectiva da gramaticalização /." São José do Rio Preto : [s.n.], 2011. http://hdl.handle.net/11449/100119.

Full text
Abstract:
Orientador: Sebastião Carlos Leite Gonçalves
Banca: Eduardo Penhavel de Souza
Banca: Vânia Cristina Casseb-Galvão
Banca: Erotilde Goreti Pezatti
Banca: Gisele de Cássia Sousa
Resumo: Sob perspectiva diacrônica, este trabalho tem como propósito resgatar a trajetória de mudança de usos de depois na história do português, com base em seus aspectos sintáticos, semânticos e pragmáticos. Fundamentada em descrição sincrônica de usos de depois no português atual (MARTELOTTA, 1996), nossa hipótese é a de que o continuum espaço > (tempo) > texto, que permite organizar os usos sincrônicos, é resultante de um percurso histórico de mudança categorial, desde o latim, com a seguinte configuração: advérbio espacial > advérbio temporal > locução prepositiva/conjuntiva ou conjunção temporal > operador argumentativo de valor aditivo. Esse percurso instancia-se por meio de um processo de gramaticalização, que, na sua acepção mais clássica, envolve rebaixamento de estatuto categorial de um elemento linguístico (HOPPER & TRAUGOTT, 1993), possível de ser apreendido em contextos linguísticos específicos. Assim, a expectativa é a de que usos de depois apreendidos nas diferentes sincronias permitem recompor sua trajetória de gramaticalização. Constitui ainda objetivo deste trabalho, correlacionar os usos de depois às funções ideacional, interpessoal e textual da linguagem (HALLIDAY, 1976, 1978). Metodologicamente, a investigação empírica toma por base dados diacrônicos provenientes de textos que integram a "Amostra diacrônica do Português" (LONGHIN-THOMAZI, 2004), disponível em . Trata-se de um banco de textos informatizados, de gêneros textuais variados, representativos de oito séculos, a contar do século XIII. Os resultados alcançados revelam, ao longo da história do português, sete usos diferentes de depois: i) como Locativo, para localizar entidade em espaço posterior; ii) como Temporal Absoluto, para localizar precisamente o tempo posterior de um evento; iii) como Temporal Aproximativo, para localizar... (Resumo completo, clicar acesso eletrônico abaixo)
Abstract: Under a diachronic perspective, this paperwork aims at emphasizing the change path in the use of the word after in the history of the Portuguese language, based on its syntactic, semantic and pragmatic aspects. Supported by a synchronous description of the uses of the word after in current Portuguese (MARTELOTTA, 1996), our hypothesis is that continnum space > (time) > text, which allows for the organization of the synchronous uses, and comes from a historical path of categorial change, beginning with Latin and represented by the following configuration: adverb of space > adverb of time > prepositional/conjunctive phrase or conjunction of time > additive value argumentative operator. This historical path happens by means of a grammaticalization process, which, in its most classic meaning, involves categorial status degradation of a linguistic element (HOPPER & TRAUGOTT, 1993), observable in specific linguistic contexts. Thus, there is an expectation that the uses of after apprehended from different synchronies allow for the recreation of its grammaticalization path. This paperwork also aims at correlating the uses of after to the ideational, interpersonal and textual language functions (HALLIDAY, 1976, 1978). Methodologically, the empirical investigation is supported by diachronic data originated from texts that comprise the "Diachronic Sample of the Portuguese Language" (LONGHIN-THOMAZI, 2004), available at . The sample is a database of computerized texts from various genres and which are representative of eight centuries, starting from the thirteenth century. The results show seven different uses of the word after throughout the history of the Portuguese language: i) as a Locative element, in order to locate entities in subsequent space; ii) as an Absolute Temporal element, in order to precisely locate the subsequent time of a given event; iii)... (Complete abstract click electronic access below)
Doutor
APA, Harvard, Vancouver, ISO, and other styles
More sources

Books on the topic "SOS operator"

1

Price, E. Hoffmann. Operation Isis. New York: Ballantine, 1987.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
2

Wardlaw, Lee. Operation rhinoceros. Summerland, CA: Red Hen Press, 1992.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
3

SAS foundations: From installation to operation. New York: Windcrest/McGraw-Hill, 1994.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
4

Nottale, Laurent. Des fleurs pour Schrödinger: La relativité d'échelle et ses applications. Paris: Ellipses, 2009.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
5

Undercover operator: Wartime experiences with SOE in France and the Far East. Oxford: ISIS Large Print, 2005.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
6

Hudson, Sydney. Undercover operator: Wartime experiences with SOE in France and the Far East. Barnsley, S. Yorkshire: L. Cooper, 2003.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
7

Operation Barras: The SAS rescue mission, Sierra Leone 2000. London: Weidenfeld & Nicolson, 2004.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
8

Tony, Jeapes, ed. SAS secret war: Operation Storm in the Middle East. London: Greenhill, 2005.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
9

SAS Operation Bulbasket: Behind the lines in occupied France, 1944. London: L. Cooper, 1996.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
10

Will, Fowler. Certain death in Sierra Leone: The SAS and Operation Barras, 2000. Oxford: Osprey, 2010.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
More sources

Book chapters on the topic "SOS operator"

1

Semenov, Andrey B., Stanislav K. Strizhakov, and Igor R. Suncheley. "SCS operation." In Structured Cable Systems, 499–536. Berlin, Heidelberg: Springer Berlin Heidelberg, 2002. http://dx.doi.org/10.1007/978-3-662-10124-7_13.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Bandh, Tobias, Haitao Tang, Henning Sanneck, and Christoph Schmelz. "SON Operation." In LTE Self-Organising Networks (SON), 322–56. Chichester, UK: John Wiley & Sons, Ltd, 2011. http://dx.doi.org/10.1002/9781119961789.ch9.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Aceto, Luca, Eugen-Ioan Goriac, and Anna Ingólfsdóttir. "SOS Rule Formats for Idempotent Terms and Idempotent Unary Operators." In Lecture Notes in Computer Science, 108–20. Berlin, Heidelberg: Springer Berlin Heidelberg, 2013. http://dx.doi.org/10.1007/978-3-642-35843-2_11.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Swetha, K., R. Manohari, and Shanthi Prince. "SOA Parameters Optimization for High Data Rate Operation." In Lecture Notes in Electrical Engineering, 247–53. Singapore: Springer Singapore, 2017. http://dx.doi.org/10.1007/978-981-10-7293-2_27.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Cohen, Allen Carson. "Tutorials on Using Design of Experiments with SAS, JMP Protocols." In Design, Operation, and Control of Insect-Rearing Systems, 185–222. Boca Raton: CRC Press, 2021. http://dx.doi.org/10.1201/b22499-9.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Swishchuk, Anatoly. "Analogue of Dynkin’s Formula (ADF) for Multiplicative Operator Functionals (MOF), RE and SES." In Random Evolutions and their Applications, 106–18. Dordrecht: Springer Netherlands, 2000. http://dx.doi.org/10.1007/978-94-015-9598-8_5.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Guericke, Otto. "The use and Operation of the Aforementioned Apparatus." In The New (So-Called) Magdeburg Experiments of Otto Von Guericke, 145–49. Dordrecht: Springer Netherlands, 1994. http://dx.doi.org/10.1007/978-94-011-2010-4_65.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Oshima, Marie, Toshio Kobayashi, Nobuyuki Taniguchi, and Makoto Tsubokura. "Development of a Filtering Operation for Dynamic SGS Model Using the Finite Element Method." In Direct and Large-Eddy Simulation II, 57–68. Dordrecht: Springer Netherlands, 1997. http://dx.doi.org/10.1007/978-94-011-5624-0_6.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Jiao, Hailong, and Volkan Kursun. "Tri-mode Operation for Noise Reduction and Data Preservation in Low-Leakage Multi-Threshold CMOS Circuits." In VLSI-SoC: Forward-Looking Trends in IC and Systems Design, 258–90. Berlin, Heidelberg: Springer Berlin Heidelberg, 2012. http://dx.doi.org/10.1007/978-3-642-28566-0_11.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

Al-Taiar, Hasanen. "Multidisciplinary Teamwork and the Insanity Defence: A Case of Infanticide in Iraq." In International Perspectives in Values-Based Mental Health Practice, 149–53. Cham: Springer International Publishing, 2020. http://dx.doi.org/10.1007/978-3-030-47852-0_17.

Full text
Abstract:
AbstractIn April 2018, the author had an opportunity to visit Al-Rashad Hospital (where the only forensic psychiatry unit in Iraq exists) and he had the chance to meet with the brave psychiatrists and mental health professionals who worked in the oldest psychiatric hospital in Iraq. The author was amazed by how these colleagues operate amidst all challenges, limited financial resources and funding difficulties.The author was impressed by the work of the forensic psychiatry committee which determines the criminal responsibility of a large number of cases from all over Iraq. He had the chance of attending the Ministry of Health’s specialist panel which determines criminal responsibility for mentally disordered detainees. He attended the assessment of a young lady who was remanded on suspicion of killing her 1 year old son (infanticide). The panel and after two interviews concluded that the suspect had autism and learning disability. The patient was deemed irresponsible for her criminal behaviour and she was eventually granted an equivalent of a hospital treatment order.
APA, Harvard, Vancouver, ISO, and other styles

Conference papers on the topic "SOS operator"

1

Martinie, S., J. Lacord, O. Rozeau, M. S. Parihar, Kyunghwa Lee, Maryline Bawedin, Sorin Cristoloveanu, Yuan Taur, and J.-C. Barbe. "Z2-FET SPICE model: DC and memory operation." In 2017 IEEE SOI-3D-Subthreshold Microelectronics Technology Unified Conference (S3S). IEEE, 2017. http://dx.doi.org/10.1109/s3s.2017.8309240.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Rossi, Davide. "Sub-pJ per operation scalable computing: The PULP experience." In 2016 IEEE SOI-3D-Subthreshold Microelectronics Technology Unified Conference (S3S). IEEE, 2016. http://dx.doi.org/10.1109/s3s.2016.7804389.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Atias, Lior, Adam Teman, and Alexander Fish. "A 13T radiation hardened SRAM bitcell for low-voltage operation." In 2013 IEEE SOI-3D-Subthreshold Microelectronics Technology Unified Conference (S3S) (Formerly known as SOI Conference). IEEE, 2013. http://dx.doi.org/10.1109/s3s.2013.6716579.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Ogasahara, Yasuhiro, Masakazu Hioki, Tadashi Nakagawa, Toshihiro Sekigawa, Toshiyuki Tsutsumi, and Hanpei Koike. "Near-0.1V ultra-low voltage operation of SOTB 1M logic gates." In 2014 IEEE SOI-3D-Subthreshold Microelectronics Technology Unified Conference (S3S). IEEE, 2014. http://dx.doi.org/10.1109/s3s.2014.7028217.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Santos, I., and E. MacDonald. "Delay Insensitive logic with increased fault tolerance and optimized for subthreshold operation." In 2013 IEEE SOI-3D-Subthreshold Microelectronics Technology Unified Conference (S3S) (Formerly known as SOI Conference). IEEE, 2013. http://dx.doi.org/10.1109/s3s.2013.6716554.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Jagasivamani, Meenatchi, Michael Bajura, and Michael Fritze. "Dual threshold voltage adder for robust sub-Vt operation in 65nm technology." In 2013 IEEE SOI-3D-Subthreshold Microelectronics Technology Unified Conference (S3S) (Formerly known as SOI Conference). IEEE, 2013. http://dx.doi.org/10.1109/s3s.2013.6716562.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Vaknin, Afik, Ortal Yona, and Adam Teman. "A Double-Feedback 8T SRAM bitcell for low-voltage low-leakage operation." In 2013 IEEE SOI-3D-Subthreshold Microelectronics Technology Unified Conference (S3S) (Formerly known as SOI Conference). IEEE, 2013. http://dx.doi.org/10.1109/s3s.2013.6716565.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Coetzee, M. D., and P. W. E. Blom. "Proposed Concept Design for the High Temperature Sulphuric Acid Decomposition Reactor Applicable to the Hybrid Sulphur (HyS) Process." In Fourth International Topical Meeting on High Temperature Reactor Technology. ASMEDC, 2008. http://dx.doi.org/10.1115/htr2008-58022.

Full text
Abstract:
The utilization of alternate sources of energy is becoming more important due to the constantly growing world-wide demand for energy. The production of hydrogen via the Hybrid Sulphur process is a possible alternative that may contribute to alleviating the pressure on energy resources. The current field of interest is to investigate the operation of the sulphuric acid decomposition reactor operating at pressure ranges between 8 and 9 MPa. The reduction of SO3 to SO2 is, however, favoured at low pressures while maintaining high operating temperatures. Considering this, the need to investigate the possibility of operating at lower operating pressures is important in striving for higher process efficiencies. The proposed decomposition reactor is a multi-stage reactor system operated adiabatically with inter-stage heating in order to simplify the reactor design and improve the over-all conversion and efficiency of the process. At a pressure of 8–9 MPa and temperature of 900°C, the maximum conversion of SO3 to SO2 that can be achieved is between 48% and 54%. The proposed multi-stage reactor system has 5 packed bed (catalyst) reactor stages with 4 intermediate heat exchangers, and by lowering the operating pressure to 3 kPa, a maximum conversion of 72% could be achieved. The viability of the HyS process mainly depends on the performance of the SO3 decomposition reactor.
APA, Harvard, Vancouver, ISO, and other styles
9

Trevisoli, Renan, Rodrigo T. Doria, Michelly de Souza, Marcelo A. Pavanello, Sylvain Barraud, and Maud Vinet. "Influence of the crystal orientation on the operation of junctionless nanowire transistors." In 2016 IEEE SOI-3D-Subthreshold Microelectronics Technology Unified Conference (S3S). IEEE, 2016. http://dx.doi.org/10.1109/s3s.2016.7804380.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

Navarro, C., F. Gamiz, N. Rodriguez, L. Donetti, C. Sampedro, Seong Il Kim, Yong Tae Kim, and S. Cristoloveanu. "Gate-induced vs. implanted body doping impact on Z2-FET DC operation." In 2017 IEEE SOI-3D-Subthreshold Microelectronics Technology Unified Conference (S3S). IEEE, 2017. http://dx.doi.org/10.1109/s3s.2017.8308748.

Full text
APA, Harvard, Vancouver, ISO, and other styles

Reports on the topic "SOS operator"

1

Nelson, Matthew A., Dmitry Keselman, and Joseph F. Longo. BioWatch SMS Operator Guide. Office of Scientific and Technical Information (OSTI), July 2013. http://dx.doi.org/10.2172/1093942.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Surface, Eric A. SOF Language Transformation Strategy Needs Assessment Project: SOF Operator Survey Report. Fort Belvoir, VA: Defense Technical Information Center, October 2004. http://dx.doi.org/10.21236/ada634233.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Surface, Eric A. SOP Language Transformation Strategy Needs Assessment Project: Army Operator Survey Report. Fort Belvoir, VA: Defense Technical Information Center, October 2004. http://dx.doi.org/10.21236/ada634236.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

DiJaili, S. P. Novel operation of semiconductor optical amplifier (SOA) for optoelectronic applications. Office of Scientific and Technical Information (OSTI), March 1996. http://dx.doi.org/10.2172/491215.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Hudson, Tracy D., and Michael S. Kranz. Operation of Silicon-on-Insulator (SOI) Micro-ElectroMechanical Systems (MEMS) Gyroscopic Sensor as a Two-Axis Accelerometer. Fort Belvoir, VA: Defense Technical Information Center, April 2012. http://dx.doi.org/10.21236/ada559286.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Herrera-Muñoz, Stella María. Elaboración de provisionales de autocurado para prótesis parcial fija o coronas individuales. Ediciones Universidad Cooperativa de Colombia, December 2020. http://dx.doi.org/10.16925/gcgp.29.

Full text
Abstract:
Con esta guía para la elaboración de provisionales de autocurado para prótesis parcial fija o coronas individuales se espera tener una ruta clara para las prácticas de preclínica de los alumnos en modelos tipo Odonto, los cuales simulan las arcadas dentales de pacientes edéntulos parciales. La provisional es un dispositivo temporal que brinda a la estructura protección para la pulpa, restaura la función, la estabilidad y da la estética requerida por el paciente, ya que sirve para proyectar el tratamiento definitivo. Para la elaboración de la provisional de autocurado se debe considerar la morfología dental, la selección del color del material restaurador, la preparación del diente pilar (evaluando en esta la definición de la línea terminal), la vía de inserción, el espacio interoclusal e interproximal, los cuales son componentes de los principios de tallado. El material de elección para elaborar provisionales es la resina acrílica, que está compuesta por monómero y polímero, material que cuenta con apropiadas características de estabilidad, y con un fácil y rápido manejo, lo cual ayuda al operador a obtener excelentes resultados. Las técnicas que se manejan para la realización de dicho procedimiento son: cáscara de huevo y en bloque; la diferencia entre estas dos es la utilización del encerado diagnóstico y la elaboración de una matriz en silicona. Con esta guía se busca que los estudiantes adquieran conocimientos, habilidades y destrezas para la atención de sus pacientes.
APA, Harvard, Vancouver, ISO, and other styles
7

DeAnna, Dixon, and Hodo Wayne. Finite element analysis of quoin block deterioration and load transfer mechanisms in miter gates : pintle and pintle connections. Engineer Research and Development Center (U.S.), June 2021. http://dx.doi.org/10.21079/11681/40842.

Full text
Abstract:
The U.S. Army Corps of Engineers (USACE) currently operates and maintains approximately 193 commercially active lock sites with 239 locks and dams spanning nearly 12,000 miles. These networks of water channels are used to transport 600 million tons of domestic cargo, generating $405 billion in revenue annually. Nearly 60% of these structures in operation are over 50 years old and have reached design life. A failure of the miter gates could result in a major negative impact on the economy and on the ability to maintain flood control. Administrators need recommendations to better prioritize maintenance and repair of the USACE miter gates. This work investigated the influence of miter gate’s quoin block degradation on load transfer to the pintle and/or pintle connections. Results of finite element analysis are reported for the quoin block degradation simulated levels of 0%, 25%, 50%, and 75%. The parametric study shows the overstressed regions are the pintle neck and bolt-hole regions. To improve pintle designs so they may better mitigate detrimental environmental based deterioration effects, this work recommends (1) increasing the thickness of the bolt-hole connection region and (2) adding ribbing reinforcement around the neck area of the pintle.
APA, Harvard, Vancouver, ISO, and other styles
8

Arango-Arango, Carlos A., and Yanneth Rocío Betancourt-García. COSTOS DEL COMERCIO EN EL PROCESAMIENTO DE LOS PAGOS EN COLOMBIA. Banco de la República de Colombia, November 2020. http://dx.doi.org/10.32468/be.1143.

Full text
Abstract:
En Colombia se han logrado importantes avances en el acceso a productos transaccionales ofrecidos por el sistema financiero, sin embargo, su uso aún es bajo, y las empresas y los consumidores continúan utilizando de manera intensiva el efectivo. Una de las razones por las cuales los colombianos prefieren el efectivo para realizar sus pagos cotidianos es la limitada aceptación de pagos electrónicos por parte de los comercios, lo que se explica en parte por la percepción que tienen éstos sobre los altos costos relativos de operar con pagos electrónicos versus operar con efectivo. Con el fin de tener una medición integral de los costos privados de los comercios en la aceptación y uso de diferentes instrumentos de pago, el Banco de la República realizó en 2018 una encuesta a comercios que aceptan tanto efectivo como tarjetas de pago. Este documento presenta los resultados de dicha encuesta. Las estimaciones muestran que el efectivo es significativamente menos costoso que las tarjetas débito y crédito a la hora de recibir pagos en los comercios. Dicha estructura de costos se replica para los pagos que realizan los comercios asociados con sus gastos de funcionamiento, para los cuales se encuentra que los costos de los pagos electrónicos llegan a ser más del doble que los de los pagos en efectivo. Así las cosas, para los comercios, operar con efectivo resulta más económico que operar con instrumentos de pago electrónicos.
APA, Harvard, Vancouver, ISO, and other styles
9

Moors, Amanda J., Rebecca S. Pugh, Jody R. Evans, Jennifer M. Ness, Debra L. Ellisor, and Melannie J. Bachman. Standard Operation Procedures (SOPs) for the Palla VM-KT Vibrating Cryomill: Production of Fresh Frozen Standard Reference and Control Materials (SRMs/CMs) at the NIST Reference Material Production Facilitytitle. National Institute of Standards and Technology, August 2016. http://dx.doi.org/10.6028/nist.sp.1196.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

Mohammadian, Abolfazl, Amir Bahador Parsa, Homa Taghipour, Amir Davatgari, and Motahare Mohammadi. Best Practice Operation of Reversible Express Lanes for the Kennedy Expressway. Illinois Center for Transportation, September 2021. http://dx.doi.org/10.36501/0197-9191/21-033.

Full text
Abstract:
Reversible lanes in Chicago’s Kennedy Expressway are an available infrastructure that can significantly improve traffic performance; however, a special focus on congestion management is required to improve their operation. This research project aims to evaluate and improve the operation of reversible lanes in the Kennedy Expressway. The Kennedy Expressway is a nearly 18-mile-long freeway in Chicago, Illinois, that connects in the southeast to northwest direction between the West Loop and O’Hare International Airport. There are two approximately 8-mile reversible lanes in the Kennedy Expressway’s median, where I-94 merges into I-90, and there are three entrance gates in each direction of this corridor. The purpose of the reversible lanes is to help the congested direction of the Kennedy Expressway increase its traffic flow and decrease the delay in the whole corridor. Currently, experts in a control location switch the direction of the reversible lanes two to three times per day by observing real-time traffic conditions captured by a traffic surveillance camera. In general, inbound gates are opened and outbound gates are closed around midnight because morning traffic is usually heavier toward the central city neighborhoods. In contrast, evening peak-hour traffic is usually heavier toward the outbound direction, so the direction of the reversible lanes is switched from inbound to outbound around noon. This study evaluates the Kennedy Expressway’s current reversing operation. Different indices are generated for the corridor to measure the reversible lanes’ performance, and a data-driven approach is selected to find the best time to start the operation. Subsequently, real-time and offline instruction for the operation of the reversible lanes is provided through employing deep learning and statistical techniques. In addition, an offline timetable is also provided through an optimization technique. Eventually, integration of the data-driven and optimization techniques results in the best practice operation of the reversible lanes.
APA, Harvard, Vancouver, ISO, and other styles
You might also be interested in the extended bibliographies on the topic 'SOS operator' for particular source types:
Journal articles Dissertations / Theses Books
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography