To see the other types of publications on this topic, follow the link: SOS operator.
Journal articles on the topic 'SOS operator'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'SOS operator.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
da Rocha, Raquel Paes, Apuã César de Miranda Paquola, Marilis do Valle Marques, Carlos Frederico Martins Menck, and Rodrigo S. Galhardo. "Characterization of the SOS Regulon of Caulobacter crescentus." Journal of Bacteriology 190, no. 4 (December 14, 2007): 1209–18. http://dx.doi.org/10.1128/jb.01419-07.
Full textAbstract:
ABSTRACT The SOS regulon is a paradigm of bacterial responses to DNA damage. A wide variety of bacterial species possess homologs of lexA and recA, the central players in the regulation of the SOS circuit. Nevertheless, the genes actually regulated by the SOS have been determined only experimentally in a few bacterial species. In this work, we describe 37 genes regulated in a LexA-dependent manner in the alphaproteobacterium Caulobacter crescentus. In agreement with previous results, we have found that the direct repeat GTTCN7GTTC is the SOS operator of C. crescentus, which was confirmed by site-directed mutagenesis studies of the imuA promoter. Several potential promoter regions containing the SOS operator were identified in the genome, and the expression of the corresponding genes was analyzed for both the wild type and the lexA strain, demonstrating that the vast majority of these genes are indeed SOS regulated. Interestingly, many of these genes encode proteins with unknown functions, revealing the potential of this approach for the discovery of novel genes involved in cellular responses to DNA damage in prokaryotes, and illustrating the diversity of SOS-regulated genes among different bacterial species.
2
Szabolcsi, Róbert. "Beyond Training Minimums – A New Concept of the UAV Operator Training Program." International conference KNOWLEDGE-BASED ORGANIZATION 22, no. 3 (June 1, 2016): 560–66. http://dx.doi.org/10.1515/kbo-2016-0096.
Full textAbstract:
Abstract The UAV pilot/operator training is a crucial part being evaluated during certification of the unmanned aircraft systems (UAS). There are many milestones behind, many new initiatives are launched. However, many initiatives originated to the type of the crew training and certification originated to that of the minimum levels derived by regulations. There are two main approaches when establish a training organization. First is, the so-called approach of minimums (AoM) delivered to the operators. Second is originated to that of the set of skills (SoS) necessary to hold by operators to safe operation of the UAV. The author will examine two standpoints evaluating their privileges and bottlenecks, or, if there is any, the threat. New idea will be formulated by the author to combine advantages of those two approaches providing a new set of criteria for training system beyond present minimums.
3
Groban, E. S. "Binding of the Bacillus subtilis LexA protein to the SOS operator." Nucleic Acids Research 33, no. 19 (October 24, 2005): 6287–95. http://dx.doi.org/10.1093/nar/gki939.
Full text
4
van der Veen, Stijn, Saskia van Schalkwijk, Douwe Molenaar, Willem M. de Vos, Tjakko Abee, and Marjon H. J. Wells-Bennik. "The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis." Microbiology 156, no. 2 (February 1, 2010): 374–84. http://dx.doi.org/10.1099/mic.0.035196-0.
Full textAbstract:
The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a ΔrecA mutant strain after exposure to the DNA-damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; ΔrecA cultures showed considerably lower rifampicin- and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Stress-survival studies showed ΔrecA mutant cells to be less resistant to heat, H2O2 and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.
5
Galvão, Carolina W., Fábio O. Pedrosa, Emanuel M. Souza, M. Geoffrey Yates, Leda S. Chubatsu, and Maria Berenice R. Steffens. "TherecXgene product is involved in the SOS response inHerbaspirillum seropedicae." Canadian Journal of Microbiology 49, no. 2 (February 1, 2003): 145–50. http://dx.doi.org/10.1139/w03-010.
Full textAbstract:
The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable σ70-dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response.Key words: Herbaspirillum seropedicae, recA gene, recX gene, DNA repair, SOS mutagenesis.
6
Jochmann, Nina, Anna-Katharina Kurze, Lisa F. Czaja, Karina Brinkrolf, Iris Brune, Andrea T. Hüser, Nicole Hansmeier, Alfred Pühler, Ilya Borovok, and Andreas Tauch. "Genetic makeup of the Corynebacterium glutamicum LexA regulon deduced from comparative transcriptomics and in vitro DNA band shift assays." Microbiology 155, no. 5 (May 1, 2009): 1459–77. http://dx.doi.org/10.1099/mic.0.025841-0.
Full textAbstract:
The lexA gene of Corynebacterium glutamicum ATCC 13032 was deleted to create the mutant strain C. glutamicum NJ2114, which has an elongated cell morphology and an increased doubling time. To characterize the SOS regulon in C. glutamicum, the transcriptomes of NJ2114 and a DNA-damage-induced wild-type strain were compared with that of a wild-type control using DNA microarray hybridization. The expression data were combined with bioinformatic pattern searches for LexA binding sites, leading to the detection of 46 potential SOS boxes located upstream of differentially expressed transcription units. Binding of a hexahistidyl-tagged LexA protein to 40 double-stranded oligonucleotides containing the potential SOS boxes was demonstrated in vitro by DNA band shift assays. It turned out that LexA binds not only to SOS boxes in the promoter–operator region of upregulated genes, but also to SOS boxes detected upstream of downregulated genes. These results demonstrated that LexA controls directly the expression of at least 48 SOS genes organized in 36 transcription units. The deduced genes encode a variety of physiological functions, many of them involved in DNA repair and survival after DNA damage, but nearly half of them have hitherto unknown functions. Alignment of the LexA binding sites allowed the corynebacterial SOS box consensus sequence TcGAA(a/c)AnnTGTtCGA to be deduced. Furthermore, the common intergenic region of lexA and the differentially expressed divS-nrdR operon, encoding a cell division suppressor and a regulator of deoxyribonucleotide biosynthesis, was characterized in detail. Promoter mapping revealed differences in divS-nrdR expression during SOS response and normal growth conditions. One of the four LexA binding sites detected in the intergenic region is involved in regulating divS-nrdR transcription, whereas the other sites are apparently used for negative autoregulation of lexA expression.
7
Valinevich, P. A., S. E. Derkachov, and A. P. Isaev. "SOS-Representation for the SL(2,ℂ)-Invariant R-Operator and Feynman Diagrams." Journal of Mathematical Sciences 238, no. 6 (April 1, 2019): 819–33. http://dx.doi.org/10.1007/s10958-019-04278-x.
Full text
8
Au, Nora, Elke Kuester-Schoeck, Veena Mandava, Laura E. Bothwell, Susan P. Canny, Karen Chachu, Sierra A. Colavito, et al. "Genetic Composition of the Bacillus subtilis SOS System." Journal of Bacteriology 187, no. 22 (November 15, 2005): 7655–66. http://dx.doi.org/10.1128/jb.187.22.7655-7666.2005.
Full textAbstract:
ABSTRACT The SOS response in bacteria includes a global transcriptional response to DNA damage. DNA damage is sensed by the highly conserved recombination protein RecA, which facilitates inactivation of the transcriptional repressor LexA. Inactivation of LexA causes induction (derepression) of genes of the LexA regulon, many of which are involved in DNA repair and survival after DNA damage. To identify potential RecA-LexA-regulated genes in Bacillus subtilis, we searched the genome for putative LexA binding sites within 300 bp upstream of the start codons of all annotated open reading frames. We found 62 genes that could be regulated by putative LexA binding sites. Using mobility shift assays, we found that LexA binds specifically to DNA in the regulatory regions of 54 of these genes, which are organized in 34 putative operons. Using DNA microarray analyses, we found that 33 of the genes with LexA binding sites exhibit RecA-dependent induction by both mitomycin C and UV radiation. Among these 33 SOS genes, there are 22 distinct LexA binding sites preceding 18 putative operons. Alignment of the distinct LexA binding sites reveals an expanded consensus sequence for the B. subtilis operator: 5′-CGAACATATGTTCG-3′. Although the number of genes controlled by RecA and LexA in B. subtilis is similar to that of Escherichia coli, only eight B. subtilis RecA-dependent SOS genes have homologous counterparts in E. coli.
9
Braicu, Elena Ioana, Toon van Gorp, Rolf Richter, Radoslav Chekerov, Dirk Timmerman, Mani Nassir, Jalid Sehouli, and Ignace Vergote. "Surgical outcome score (SOS), a new algorithm based on HE4 and CA125, to predict surgical outcome in primary epithelial ovarian cancer (EOC) patients (pts)." Journal of Clinical Oncology 31, no. 15_suppl (May 20, 2013): 5549. http://dx.doi.org/10.1200/jco.2013.31.15_suppl.5549.
Full textAbstract:
5549 Background: There are no clinical or biomolecular algorithms to predict surgical outcome in EOC pts. Recently, we showed that the combination of HE4 and CA125 predict surgical outcome in advanced primary EOC (ASCO 2012). We validated the cut-off values in an independent cohort and developed a new algorithm to predict surgical outcome-SOS. Methods: Pts with primary EOC (n = 193) were selected for a retrospective study between 2003 and 2011. Preoperative serum HE4 and CA125 levels were measured. The predictive values of HE4 and CA125 were analyzed using the receiver operator characteristic (ROC) with the corresponding area under the curve (AUC). Separate logistic regression algorithms for pre- and postmenopausal women were utilized to categorize pts into low and high-risk for residual disease, using CA125 and HE4 within SOS algorithm. Furthermore we performed a multivariate analysis for prediction of progression free- (PFS) and overall survival (OS). Results: Maximal cytoreduction was achieved in 67.4% pts. Serum HE4 expression correlated with residual disease (p<0.001, RR: 2.74, 95%CI 1.65-4.54), reaching a 76.2% sensitivity (Se), 56.9% specificity (Sp) and 83.1% negative predictive value (NPV), with 235 pM cut-off value. CA125 correlated with residual disease in premenopausal pts (p=0.031, RR: 3.13, 95%CI 1.28-7.65). For a CA125 cut-off of 500 IU/l, the Se, Sp and NPV were 39.7%, 69.8%, and 70.3%, respectively. ROMA predicted surgical outcome (AUC = 0.70, p <0.001, 95% CI = 0.624-0.776, RR = 2.54), reaching a 76.2% Se, 53.5% Sp for 81% cut-off value. SOS algorithm performed better than HE4 or CA125 alone, and ROMA (AUC= 0.741, p < 0.001, 95% CI 0.670-0.812, RR = 4.98). The Se, Sp and NPV was 90.5%, 46.5% and 90.9%, respectively, for a SOS cut off value of 21.5%. FIGO stage and residual disease were the only prognostic factors for both PFS and OS. SOS was an independent prognostic for PFS (p = 0.009, HR = 1.014, 95% CI = 1.004-1.025), but not for OS. Conclusions: This independent validation study confirm the predictive value of CA124 and HE4 on surgical outcome. The combination of HE4 and CA125 within the SOS score improve the prediction of surgical outcome, and therefore of PFS.
10
Riera, Joan, Antonio R. de Henestrosa Fernández, Xavier Garriga, Angels Tapia, and Jordi Barbé. "Interspecies regulation of the recA gene of gram-negative bacteria lacking an E. coli-like SOS operator." Molecular and General Genetics MGG 245, no. 4 (July 1994): 523–27. http://dx.doi.org/10.1007/bf00302266.
Full text
11
Kimsey, Harvey H., and Matthew K. Waldor. "Vibrio cholerae LexA Coordinates CTX Prophage Gene Expression." Journal of Bacteriology 191, no. 22 (August 7, 2009): 6788–95. http://dx.doi.org/10.1128/jb.00682-09.
Full textAbstract:
ABSTRACT The filamentous bacteriophage CTXΦ transmits the cholera toxin genes by infecting and lysogenizing its host, Vibrio cholerae. CTXΦ genes required for virion production initiate transcription from the strong P A promoter, which is dually repressed in lysogens by the phage-encoded repressor RstR and the host-encoded SOS repressor LexA. Here we identify the neighboring divergent rstR promoter, P R, and show that RstR both positively and negatively autoregulates its own expression from this promoter. LexA is absolutely required for RstR-mediated activation of P R transcription. RstR autoactivation occurs when RstR is bound to an operator site centered 60 bp upstream of the start of transcription, and the coactivator LexA is bound to a 16-bp SOS box centered at position −23.5, within the P R spacer region. Our results indicate that LexA, when bound to its single site in the CTXΦ prophage, both represses transcription from P A and coactivates transcription from the divergent P R. We propose that LexA coordinates P A and P R prophage transcription in a gene regulatory circuit. This circuit is predicted to display transient switch behavior upon induction of CTXΦ lysogens.
12
Winterling, Kevin W., David Chafin, Jeffery J. Hayes, Ji Sun, Arthur S. Levine, Ronald E. Yasbin, and Roger Woodgate. "The Bacillus subtilis DinR Binding Site: Redefinition of the Consensus Sequence." Journal of Bacteriology 180, no. 8 (April 15, 1998): 2201–11. http://dx.doi.org/10.1128/jb.180.8.2201-2211.1998.
Full textAbstract:
ABSTRACT Recently, the DinR protein was established as the cellular repressor of the SOS response in the bacterium Bacillus subtilis. It is believed that DinR functions as the repressor by binding to a consensus sequence located in the promoter region of each SOS gene. The binding site for DinR is believed to be synonymous with the formerly identified Cheo box, a region of 12 bp displaying dyad symmetry (GAAC-N4-GTTC). Electrophoretic mobility shift assays revealed that highly purified DinR does bind to such sites located upstream of the dinA, dinB,dinC, and dinR genes. Furthermore, detailed mutational analysis of the B. subtilis recA operator indicates that some nucleotides are more important than others for maintaining efficient DinR binding. For example, nucleotide substitutions immediately 5′ and 3′ of the Cheo box as well as those in the N4 region appear to affect DinR binding. This data, combined with computational analyses of potential binding sites in other gram-positive organisms, yields a new consensus (DinR box) of 5′-CGAACRNRYGTTYC-3′. DNA footprint analysis of the B. subtilis dinR and recA DinR boxes revealed that the DinR box is centrally located within a DNA region of 31 bp that is protected from hydroxyl radical cleavage in the presence of DinR. Furthermore, while DinR is predominantly monomeric in solution, it apparently binds to the DinR box in a dimeric state.
13
Dommen, Arthur J., and George W. Dalley. "The OSS in Laos: The 1945 Raven Mission and American Policy." Journal of Southeast Asian Studies 22, no. 2 (September 1991): 327–46. http://dx.doi.org/10.1017/s002246340000391x.
Full textAbstract:
In September 1945, the U.S. Office of Strategic Services (OSS) headquarters in Kunming dispatched a mission to Laos. The purpose and composition of the mission were described on the first page of the mission's report as follows:The Raven Mission was put on by OSS in cooperation with AGAS [Air Ground Aid Section], and parachuted near Vientiane, French Indo-China on 16 September 1945 for Prisoner of War relief work. This mission was activated following a request by G-5 SOS. The mission was composed of the following personnel: Major [Aaron] Bank, Mission Leader; Major [Charles] Holland, Executive Officer; Lt. [Alger] Ellis, Asst. Executive Officer; Lt. Phelan, AGAS Representative; Lt. [B. Hugh] Tovar, Reports Officer; Lt. Reese, Reports Officer; T/5 McKowan, Radio Operator; T/5 Blandin, Medic; Lao Trug [Luu], Interpreter.
14
WEISSMÜLLER, GILBERTO, AYHAN YURTSEVER, LILIAN T. COSTA, ANA B. F. PACHECO, PAULO M. BISCH, WOLFGANG M. HECKL, and ROBERT W. STARK. "TORSIONAL RESONANCE MODE ATOMIC FORCE MICROSCOPY OF A PROTEIN–DNA COMPLEX." Nano 03, no. 06 (December 2008): 443–48. http://dx.doi.org/10.1142/s1793292008001374.
Full textAbstract:
Precise mapping of protein-binding sites on DNA is an important application of atomic force microscope (AFM) imaging. For a reliable measurement of distances on curved DNA molecules, an image-processing algorithm is required, which extracts the DNA contour from topographic AFM data. To this end we implemented an image analysis method providing an efficient way to obtain the contour together with a physical map of single and multiple protein-binding sites. This method relies on a calculation of the height profile along the DNA fragment, allowing one to determine the DNA length and the relative position of the binding site occupied by a protein. As a first test, complexes of the LexA repressor protein from the Escherichia coli SOS system and DNA fragments containing a specific LexA binding site (recA operator) were imaged by the torsional resonance mode (TR mode) and analyzed using the specialized algorithm. A topographic height of less than 0.5 nm of the DNA molecules indicates repulsive imaging conditions.
15
Cromdal, Jakob, Håkan Landqvist, Daniel Persson-Thunqvist, and Karin Osvaldsson. "Finding out what’s happened: Two procedures for opening emergency calls." Discourse Studies 14, no. 4 (August 2012): 371–97. http://dx.doi.org/10.1177/1461445612439960.
Full textAbstract:
This article examines two corpora of telephone calls to the Swedish emergency services SOS-Alarm. The focus of analysis is on the procedural consequentiality of the routine opening by the operator. In the first corpus, the summons are answered by identification of the service via the emergency number. In the second corpus, the protocol has been altered, such that the opening entails the emergency number combined with a standard query concerning the nature of the incident. Through sequential and categorial analysis of the two collections, we highlight the distinct trajectories of action ensuing from the two opening protocols. The stand-alone emergency number opening typically results in callers asking for a specific service. In contrast, opening turns that end with a direct query about the incident tend to solicit brief descriptions of the trouble. We discuss the benefits of the latter procedure in terms of topical progression and institutional relevance, proposing that the work of emergency assistance agencies worldwide might consider implementing opening routines with a similar design.
16
McCabe, Barbara C., David R. Pawlowski, and Gerald B. Koudelka. "The Bacteriophage 434 Repressor Dimer Preferentially Undergoes Autoproteolysis by an Intramolecular Mechanism." Journal of Bacteriology 187, no. 16 (August 15, 2005): 5624–30. http://dx.doi.org/10.1128/jb.187.16.5624-5630.2005.
Full textAbstract:
ABSTRACT Inactivation of the lambdoid phage repressor protein is necessary to induce lytic growth of a lambdoid prophage. Activated RecA, the mediator of the host SOS response to DNA damage, causes inactivation of the repressor by stimulating the repressor's nascent autocleavage activity. The repressor of bacteriophage lambda and its homolog, LexA, preferentially undergo RecA-stimulated autocleavage as free monomers, which requires that each monomer mediates its own (intramolecular) cleavage. The cI repressor of bacteriophage 434 preferentially undergoes autocleavage as a dimer specifically bound to DNA, opening the possibility that one 434 repressor subunit may catalyze proteolysis of its partner subunit (intermolecular cleavage) in the DNA-bound dimer. Here, we first identified and mutagenized the residues at the cleavage and active sites of 434 repressor. We utilized the mutant repressors to show that the DNA-bound 434 repressor dimer overwhelmingly prefers to use an intramolecular mechanism of autocleavage. Our data suggest that the 434 repressor cannot be forced to use an intermolecular cleavage mechanism. Based on these data, we propose a model in which the cleavage-competent conformation of the repressor is stabilized by operator binding.
17
Poulin-Laprade, Dominic, and Vincent Burrus. "A λ Cro-Like Repressor Is Essential for the Induction of Conjugative Transfer of SXT/R391 Elements in Response to DNA Damage." Journal of Bacteriology 197, no. 24 (October 5, 2015): 3822–33. http://dx.doi.org/10.1128/jb.00638-15.
Full textAbstract:
ABSTRACTIntegrative and conjugative elements (ICEs) of the SXT/R391 family are the main contributors to acquired multidrug resistance in the seventh pandemic lineage ofVibrio cholerae, the etiological agent of the diarrheal disease cholera. Conjugative transfer of SXT/R391 ICEs is triggered by antibiotics and agents promoting DNA damage through RecA-dependent autoproteolysis of SetR, an ICE-encoded λ CI-like repressor. Here, we describe the role of CroS, a distant λ Cro homolog, as a key component contributing to the regulation of expression of the activator SetCD that orchestrates the expression of the conjugative transfer genes. We show that deletion ofcroSabolishes the SOS response-dependent induction of SXT despite the presence of a functionalsetRgene. Using quantitative reverse transcription-PCR andlacZreporter assays, we also show that CroS repressessetRandsetCDexpression by binding to operator sites shared with SetR. Furthermore, we provide evidence of an additional operator site bound by SetR and CroS. Finally, we show that SetCD expression generates a positive feedback loop due to SXT excision and replication in a fraction of the cell population. Together, these results refine our understanding of the genetic regulation governing the propagation of major vectors of multidrug resistance.IMPORTANCEHealthcare systems worldwide are challenged by an alarming drug resistance crisis caused by the massive and rapid propagation of antibiotic resistance genes and the associated emergence of multidrug-resistant pathogenic bacteria. SXT/R391 ICEs contribute to this phenomenon not only in clinical and environmental vibrios but also in several members of the familyEnterobacteriaceae. We have identified and characterized here the regulator CroS as a key factor in the stimulation of conjugative transfer of these ICEs in response to DNA-damaging agents. We have also untangled conflicting evidence regarding autoactivation of transfer by the master activator of SXT/R391 ICEs, SetCD. Discovery of CroS provides a clearer and more complete understanding of the regulatory network that governs the dissemination of SXT/R391 ICEs in bacterial populations.
18
Drewnowski, Jakub. "Advanced Supervisory Control System Implemented at Full-Scale WWTP—A Case Study of Optimization and Energy Balance Improvement." Water 11, no. 6 (June 11, 2019): 1218. http://dx.doi.org/10.3390/w11061218.
Full textAbstract:
In modern and cost-effective Wastewater Treatment Plants (WWTPs), processes such as aeration, chemical feeds and sludge pumping are usually controlled by an operating system integrated with online sensors. The proper verification of these data-driven measurements and the control of different unit operations at the same time has a strong influence on better understanding and accurately optimizing the biochemical processes at WWTP—especially energy-intensive biological parts (e.g., the nitrification zone/aeration system and denitrification zone/internal recirculation). In this study, by integrating a new powerful PreviSys with data driven from the Supervisory Control and Data Acquisition (SCADA) software and advanced algorithms such as Model Predictive Control (MPC) by using the WEST computer platform, it was possible to conduct different operation strategies for optimizing and improving the energy balance at a full-scale “Klimzowiec” WWTP located in Chorzow (Southern Poland). Moreover, the novel concept of double-checking online data-driven measurements (from installed DO, NO3, NH4 sensors, etc.) by mathematical modelling and computer simulation predictions was applied in order to check the data uncertainty and develop a support operator system (SOS)—an additional tool for the widely-used in-operation and control of modern and cost-effective WWTPs. The results showed that by using sophisticated PreviSys technology, a better understanding and accurate optimization of biochemical processes, as well as more sustainable WWTP operation, can be achieved.
19
YANG, CHEN NING, and S. C. ZHANG. "SO4 SYMMETRY IN A HUBBARD MODEL." International Journal of Modern Physics B 05, no. 06n07 (April 1991): 977–84. http://dx.doi.org/10.1142/s021797929100050x.
Full textAbstract:
For a simple Hubbard model, using a particle-particle pairing operator η and a particle-hole pairing operator ζ, it is shown that one can write down two commuting sets of angular momenta operators J and J′, both of which commute with the Hamiltonian. These considerations allow the introduction of quantum numbers j and j′, and lead to the fact that the system has SO 4 = ( SU 2 × SU 2)/ Z 2 symmetry. j is related to the existence of superconductivity for a state and j′ to its magnetic properties.
20
YANG, CHEN NING, and S. C. ZHANG. "SO4 SYMMETRY IN A HUBBARD MODEL." Modern Physics Letters B 04, no. 11 (June 1990): 759–66. http://dx.doi.org/10.1142/s0217984990000933.
Full textAbstract:
For a simple Hubbard model, using a particle-particle pairing operator η and a particle-hole pairing operator ζ, it is shown that one can write down two commuting sets of angular momenta operators J and J′, both of which commute with the Hamiltonian. These considerations allow the introduction of quantum numbers j and j′ and lead to the fact that the system has SO 4=( SU 2× SU 2)/Z2 symmetry, j is related to the existence of superconductivity for a state and j′ to its magnetic properties.
21
Awono, O., and J. Tagoudjeu. "A Preconditioned Minimal Residual Solver for a Class of Linear Operator Equations." Computational Methods in Applied Mathematics 10, no. 2 (2010): 119–36. http://dx.doi.org/10.2478/cmam-2010-0007.
Full textAbstract:
Abstract We consider the class of linear operator equations with operators admitting self-adjoint positive definite and m-accretive splitting (SAS). This splitting leads to an ADI-like iterative method which is equivalent to a fixed point problem where the operator is a 2 by 2 matrix of operators. An infinite dimensional adaptation of a minimal residual algorithm with Symmetric Gauss-Seidel and polynomial preconditioning is then applied to solve the resulting matrix operator equation. Theoretical analysis shows the convergence of the methods, and upper bounds for the decrease rate of the residual are derived. The convergence of the methods is numerically illustrated with the example of the neutron transport problem in 2-D geometry.
22
Van der Straaten, Rob, Amber K. B. D. Bruijnes, Benedicte Vanwanseele, Ilse Jonkers, Liesbet De Baets, and Annick Timmermans. "Reliability and Agreement of 3D Trunk and Lower Extremity Movement Analysis by Means of Inertial Sensor Technology for Unipodal and Bipodal Tasks." Sensors 19, no. 1 (January 3, 2019): 141. http://dx.doi.org/10.3390/s19010141.
Full textAbstract:
This study evaluates the reliability and agreement of the 3D range of motion (ROM) of trunk and lower limb joints, measured by inertial measurement units (MVN BIOMECH Awinda, Xsens Technologies), during a single leg squat (SLS) and sit to stand (STS) task. Furthermore, distinction was made between movement phases, to discuss the reliability and agreement for different phases of both movement tasks. Twenty healthy participants were measured on two testing days. On day one, measurements were conducted by two operators to determine the within-session and between-operator reliability and agreement. On day two, measurements were conducted by the same operator, to determine the between-session reliability and agreement. The SLS task had lower within-session reliability and agreement compared with between-session and between-operator reliability and agreement. The reliability and agreement of the hip, knee, and ankle ROM in the sagittal plane were good for both phases of the SLS task. For both phases of STS task, within-session reliability and agreement were good, and between-session and between-operator reliability and agreement were lower in all planes. As both tasks are physically demanding, differences may be explained by inconsistent movement strategies. These results show that inertial sensor systems show promise for use in further research to investigate (mal)adaptive movement strategies.
23
Gebler, Daniel, and Simone Tini. "SOS specifications for uniformly continuous operators." Journal of Computer and System Sciences 92 (March 2018): 113–51. http://dx.doi.org/10.1016/j.jcss.2017.09.011.
Full text
24
Samijayani, Octarina Nur, Rahsanjani, and Fadjar Iftikar. "Perancangan Sistem Penulisan Teks pada Running text Menggunakan SMS." JURNAL Al-AZHAR INDONESIA SERI SAINS DAN TEKNOLOGI 2, no. 3 (November 2, 2015): 164. http://dx.doi.org/10.36722/sst.v2i3.137.
Full textAbstract:
<p><em>Abstrak</em><strong> – Teknologi yang dinilai efisien digunakan untuk menyampaikan informasi di tempat-tempat umum adalah menggunakan papan <em>running text</em>. Penulisan teks yang akan dikirim ke <em>running text</em> saat ini mengandalkan peranti komputer ataupun remote. Peranti komputer akan dihubungkan dengan kabel ke papan running text sehingga harus tersedia komputer di dekat tampilan running text, sedangkan secara wireless digunakan remote namun memiliki jarak yang terbatas. Dengan memanfaatkan modul GSM sebagai <em>transceiver</em> penulisan teks dari jarak jauh melalui SMS dapat dilakukan. Penulisan teks melalui SMS dapat mendukung penulisan yang lebih efisien terutama untuk menyebarkan informasi yang sama pada beberapa lokasi <em>running text</em>, sehingga penulisan teks tidak lagi harus berada di dekat <em>running text</em> melainkan dapat dilakukan dipusat informasi yang jauh dari letak <em>running text</em>. Penulisan teks pada <em>running text</em> dilakukan melalui SMS dari ponsel, kemudian pesan diterima oleh modul GSM dan diteruskan ke mikrokontroller untuk menampilkan teks pada display <em>running text</em>. Uji coba dilakukan untuk mengukur waktu pengiriman teks sampai tulisan berhasil ditampilkan. Berdasarkan hasil uji coba, waktu pengiriman SMS berbanding lurus dengan jumlah karakter yang dikirimkan. Rata - rata waktu pengiriman teks menggunakan operator yang sama adalah sekitar 28.31 detik dan bila menggunakan operator yang berbeda adalah sekitar 31.20 detik. Sistem penulisan teks akan semakin cepat apabila digunakan operator GSM yang sama pada ponsel dan modul GMS di sisi display <em>running text</em>. </strong></p><p><em> </em></p><p><em>Abstract –</em><strong> The running text board technology is efficient in conveying information in public places. The writing of running text currently relies on a remote computer. Handheld computers is connected by cable to the running text and should be available near the display, while the use of wireless remote still has a limited distance. By utilizing the GSM module as a transceiver the writing of text can be done remotely via SMS. Text entry through SMS can support a more efficient writing primarily to broadcast the same information in multiple locations running text. So that the writing of text is no longer have to be near the display, but can be done from the information center which is far from the location of the display. Time needed from send SMS until the message is increasing according to the rising of SMS number characters. Average time needed from sending to displayed message when using same operators is 28.31 seconds and 31.20 seconds when using different operators. The system will process the message from sending to display faster when using same GSM operators than different GSM operators.</strong></p><p> </p><strong><em>Keywords </em></strong>– <em>Notice board, GSM modem, SMS, LCD, microcontroller ATMEGA8535.</em>
25
Lysetsky, Yu M., and S. I. Bobrov. "Security Operation System." Mathematical machines and systems 2 (2020): 51–59. http://dx.doi.org/10.34121/1028-9763-2020-2-51-59.
Full textAbstract:
The number of cyber attacks and cyber crimes grows every year. This is why there constantly appear new products, technologies and tools for protection against cyber threats. Security Operation Center (SOC) is one of the most up-to-date and reliable cybersecurity tools of enterprise level. There are already several SOCs in Ukraine in government and law enforcement bodies and there is strong interest to their implemen-tation shown by organizations and enterprises of practically every industry of national economy. SOC al-lows monitoring, detection and quick response to incidents which is necessary to reduce damage and fi-nancial losses caused by such incidents. Implementation of SOC requires significant expenses which can be afforded only by some organizations and enterprises. This is why creation of similar but more affordable tool is very urgent. The paper describes Security Operation System (SOS) designed for effective protection against cyber threats and cyber attacks, which collects, normalizes, correlates and analyses events in or-ganization’s IT infrastructure. Main advantage of this system is ability to receive information on events from different sources and their correlation which is important as today attacks can only be discovered on the basis of combination of events in the IT infrastructure. Another advantage of SOS is ability to add new correlation rules into analytical module which can be based on the unique experience of system exploita-tion, analysis of new attacks against organization’s IT infrastructure or borrowing such correlation rules from other organizations.
26
Utomo, Darmawan. "Perancangan dan Realisasi Grup SMS dengan Sistem Tertanam." Techné : Jurnal Ilmiah Elektroteknika 14, no. 02 (October 1, 2015): 103–11. http://dx.doi.org/10.31358/techne.v14i02.129.
Full textAbstract:
SMS merupakan media pengiriman pesan teks yang telah ada sejak telepon seluler generasi awal hingga sekarang. Selain itu, setiap operator telekomunikasi masih menyediakan layanan ini. Untuk melayani grup pengguna sms, operator hanya melayani sesama operator. Untuk itu, telah dirancang dan dibuat sebuah sistem yang berperilaku seperti SMS untuk grup tak tergantung operator. Grup SMS ini memiliki dua fasilitas pengiriman, yaitu berdasarkan moderator dan tidak. Fasilitas pendaftaran anggota baik melalui perangkat maupun via SMS. Selain itu juga fasilitas pengiriman USSD, dan Kirim/Terima SMS melalui perangkat maupun SMS.
27
Akram, Muhammad, Gulfam Shahzadi, Muhammad Arif Butt, and Faruk Karaaslan. "A hybrid decision making method based on q-rung orthopair fuzzy soft information." Journal of Intelligent & Fuzzy Systems 40, no. 5 (April 22, 2021): 9815–30. http://dx.doi.org/10.3233/jifs-202336.
Full textAbstract:
Soft set (SfS) theory is a basic tool to handle vague information with parameterized study during the process as compared to fuzzy as well as q-rung orthopair fuzzy theory. This research article is devoted to establish some general aggregation operators (AOs), based on Yager’s norm operations, to cumulate the q-rung orthopair fuzzy soft data in decision making environments. In this article, the valuable properties of q-rung orthopair fuzzy soft set (q - ROFSfS) are merged with the Yager operator to propose four new operators, namely, q-rung orthopair fuzzy soft Yager weighted average (q - ROFSfYWA), q-rung orthopair fuzzy soft Yager ordered weighted average (q - ROFSfYOWA), q-rung orthopair fuzzy soft Yager weighted geometric (q - ROFSfYWG) and q-rung orthopair fuzzy soft Yager ordered weighted geometric (q - ROFSfYOWG) operators. The dominant properties of proposed operators are elaborated. To emphasize the importance of proposed operators, a multi-attribute group decision making (MAGDM) strategy is presented along with an application in medical diagnosis. The comparative study shows superiorities of the proposed operators and limitations of the existing operators. The comparison with Pythagorean fuzzy TOPSIS (PF-TOSIS) method shows that PF-TOPSIS method cannot deal with data involving parametric study but developed operators have the ability to deal with decision making problems using parameterized information.
28
Czaplewski, Bartosz, Sylwester Kaczmarek, Jacek Litka, and Mariusz Miszewski. "Visualization of events using various kinds of synchronized data for the Border Guard." Zeszyty Naukowe Akademii Marynarki Wojennej, no. 2 (June 30, 2017): 5–13. http://dx.doi.org/10.5604/01.3001.0010.4059.
Full textAbstract:
STRADAR project is dedicated to streaming real-time data in a distributed dispatcher and teleinformation system of the Border Guard. The Events Visualization Post is a software designed for simultaneous visualization of data of different types in BG headquarters. The software allows the operator to visualize files, images, SMS, SDS, video, audio, and current or archival data on naval situation on digital maps. All the visualized data can be synchronized in time.
29
Tolstykh, S. A., and V. D. Sharov. "METHOD OF SMS BASIC ELEMENTS DEVELOPMENT FOR THE AERODROME OPERATOR." Civil Aviation High TECHNOLOGIES 21, no. 4 (August 28, 2018): 29–38. http://dx.doi.org/10.26467/2079-0619-2018-21-4-29-38.
Full textAbstract:
In developing and implementing the safety management System (SMS), which is mandatory in accordance with ICAO SARPs and the requirements of the air legislation of the Russian Federation, civil aviation aerodrome operators face methodological problems mainly in two components of the SMS – risk management and calculation of the safety performance indicators. To solve these problems, the article proposes to use a new approach for risk management in the airlines, developed by the Airline Risk Management Solution Group (ARMS). When adapting the method to the activities of the airport operator, the specifics of aviation events at the airport are taken into account. Manifestations of hazard factors in the form of events and deviations from the norms are proposed to be structured in accordance with the classification of activities in ground handling according to ISAGO Manual. A method for calculating and monitoring the safety performance indicator for the airport operator having extremely rare aviation events is proposed. The advantages of the ARMS approach in the implementation of the main prognostic part of the risk assessment, which directly considers the ability of the system to counteract the dangerous situation under the influence of hazards are shown. A threelevel scheme of safety management at the airport is proposed. The method proposed in the article was used as a basis for SMS implemented at two international aerodromes of the Russian Federation.
30
Mahmood, Tahir, Jabbar Ahmmad, Zeeshan Ali, Dragan Pamucar, and Dragan Marinkovic. "Interval Valued T-Spherical Fuzzy Soft Average Aggregation Operators and Their Applications in Multiple-Criteria Decision Making." Symmetry 13, no. 5 (May 9, 2021): 829. http://dx.doi.org/10.3390/sym13050829.
Full textAbstract:
This paper deals with uncertainty, asymmetric information, and risk modelling in a complex power system. The uncertainty is managed by using probability and decision theory methods. Multiple-criteria decision making (MCDM) is a very effective and well-known tool to investigate fuzzy information more effectively. However, the selection of houses cannot be done by utilizing symmetry information, because enterprises do not have complete information, so asymmetric information should be used when selecting enterprises. In this paper, the notion of soft set (SftS) and interval-valued T-spherical fuzzy set (IVT-SFS) are combined to produce a new and more effective notion called interval-valued T-spherical fuzzy soft set (IVT−SFSftS). It is a more general concept and provides more space and options to decision makers (DMs) for making their decision in the field of fuzzy set theory. Moreover, some average aggregation operators like interval-valued T-spherical fuzzy soft weighted average (IVT−SFSftWA) operator, interval-valued T-spherical fuzzy soft ordered weighted average (IVT−SFSftOWA) operator, and interval-valued T-spherical fuzzy soft hybrid average (IVT−SFSftHA) operators are explored. Furthermore, the properties of these operators are discussed in detail. An algorithm is developed and an application example is proposed to show the validity of the present work. This manuscript shows how to make a decision when there is asymmetric information about an enterprise. Further, in comparative analysis, the established work is compared with another existing method to show the advantages of the present work.
31
Labazi, Mohamed, Alfonso Rey, Antonio R. Fernandez de Henestrosa, and Jordi Barbé. "A consensus sequence for the Rhodospirillaceae SOS operators." FEMS Microbiology Letters 171, no. 1 (February 1999): 37–42. http://dx.doi.org/10.1111/j.1574-6968.1999.tb13409.x.
Full text
32
Semenova, Maryna, and Maryna Gunare. "Directions of improvement of economic and legal regulation of the activities of tour operators in due with COVID-19." Law and innovations, no. 2 (30) (June 2, 2020): 39–44. http://dx.doi.org/10.37772/2518-1718-2020-2(30)-5.
Full textAbstract:
Problem setting. COVID-19 and global quarantine have changed the lives of the world and dealt a devastating blow to business and the economy. The most affected industry, of course, can be considered tourism. According to Bloomberg, the global tourism industry in 2020 will lose $ 1.7 trillion. The tourism industry around the world and in Ukraine has virtually come to a complete halt. This is primarily due to the closure of borders, the cessation of passenger traffic, the shutdown of hotels, tour desks, guides and restaurants. The cancellation of tours and the refusal of tourists to travel, has led to the fact that many tourism entities suffer losses, and some are on the verge of bankruptcy. And those who want to start their own tourism business and develop the tourism industry have many difficulties. All these factors make it necessary to consider simplifying the activities of tour operators. All these factors together make it necessary to consider the issue of simplifying the activities of the main actors in the tourism industry and especially tour operators. The purpose of this study is to analyze the possibility of simplifying the activities of tour operators in terms of the abolition of licensing of tour operators in view of the priority of ensuring the interests of consumers of tourism services and taking into account the successful experience of the Baltic States. Analysis of resent researches and publications. The licensing of tourism in Ukraine and security in the field of tourism, including in the context of international experience, considered by the following scientists: S.S. Galasyuk, V.G. Gerasimenko, A.G. Okhrimenko and others. However, issues related to the liberalization of tourism need further research. Aricle’s main body. Based on the study and generalization of scientific sources and international experience of tourism licensing, taking into account the difficult situation in which tourism entities in connection with COVID-19, we consider it appropriate to propose the abolition of tour operator licensing, while providing for several existing legislation. at the same time other means of influence: 1) financial security in the amount which depends not only on the type of tourist activity, but also on the annual volume of provided tourist services. Establish the obligation of the tour operator to independently assess the adequacy of the amount of financial security and, if necessary, increase its size. Introduce a mechanism of liability for violation of the requirements for an adequate amount of financial security in the event of negative consequences; 2) the Unified State Register of Tour Operators, having established that tour operators may carry out activities only if information about them is entered into the Unified State Register of Tour Operators; 3) compulsory liability insurance of the tour operator. Conlusions and prospect of development. In turn, the imperfection of the legal regulation of tourism entities, the need to improve the mechanism of financial support of tour operators and travel agents, the conditions of the Unified State Register of Tour Operators and compulsory liability insurance of a tour operator, confirms the need and prospects for further research.
33
Du, Shigui, Jun Ye, Rui Yong, and Fangwei Zhang. "SIMPLIFIED NEUTROSOPHIC INDETERMINATE DECISION MAKING METHOD WITH DECISION MAKERS’ INDETERMINATE RANGES." JOURNAL OF CIVIL ENGINEERING AND MANAGEMENT 26, no. 6 (June 23, 2020): 590–98. http://dx.doi.org/10.3846/jcem.2020.12919.
Full textAbstract:
There exists the indeterminate situations of truth, falsity, indeterminacy degrees due to the uncertainty and inconsistency of decision makers’ arguments in a complicated decision making (DM) problem. Then, existing neutrosophic set cannot describe the indeterminate information of truth, falsity, indeterminacy degrees. It is noted that the simplified neutrosophic set (SNS) is depicted by truth, falsity, indeterminacy degrees, while a neutrosophic number (NN) can be flexibly depicted by its determinate part and its indeterminate part. Regarding the indeterminate situations of truth, falsity, indeterminacy degrees in indeterminate DM problems, this study first presents a simplified neutrosophic indeterminate set (SNIS) to express the hybrid information of SNS and NN and defines the score, accuracy, and certainty functions of simplified neutrosophic indeterminate elements (SNIEs) with indeterminate ranges to compare SNIEs. Then, we introduce a SNIE weighted arithmetic averaging (SNIEWAA) operator and a SNIE weighted geometric averaging (SNIEWGA) operator to aggregate simplified neutrosophic indeterminate information. Next, a multi-attribute DM approach with decision makers’ indeterminate ranges is established regarding the SNIEWAA and SNIEWGA operators in SNIS setting. Finally, the proposed DM approach is applied in a DM example on choosing a suitable slope design scheme to indicate the applicability and suitability of the proposed approach.
34
Bozorg-Haddad, Omid, Ali Azarnivand, Seyed-Mohammad Hosseini-Moghari, and Hugo A. Loáiciga. "Optimal operation of reservoir systems with the symbiotic organisms search (SOS) algorithm." Journal of Hydroinformatics 19, no. 4 (March 15, 2017): 507–21. http://dx.doi.org/10.2166/hydro.2017.085.
Full textAbstract:
This work introduces the symbiotic organisms search (SOS) evolutionary algorithm to the optimization of reservoir operation. Unlike the genetic algorithm (GA) and the water cycle algorithm (WCA) the SOS does not require specification of algorithmic parameters. The solution effectiveness of the GA, SOS, and WCA was assessed with a single-reservoir and a multi-reservoir optimization problem. The SOS proved superior to the GA and the WCA in optimizing the objective functions of the two reservoir systems. In the single reservoir problem, with global optimum value of 1.213, the SOS, GA, and WCA determined 1.240, 1.535, and 1.262 as the optimal solutions, respectively. The superiority of SOS was also verified in a hypothetical four-reservoir optimization problem. In this case, the GA, WCA, and SOS in their best performance among 10 solution runs converged to 97.46%, 99.56%, and 99.86% of the global optimal solution. Besides its better performance in approximating optima, the SOS avoided premature convergence and produced lower standard deviation about optima.
35
Patrianesha, Bisma Barron, Ajat Sudrajat, Fitria Hidayanti, and Hari Suryanto. "SISTEM MONITORING ALARM DAN KENDALI JARAK JAUH POMPA TANGKI LIMBAH RADIOAKTIF CAIR BERBASIS SMS." Jurnal Forum Nuklir 8, no. 2 (October 18, 2017): 125. http://dx.doi.org/10.17146/jfn.2014.8.2.3703.
Full textAbstract:
SISTEM MONITORING ALARM DAN KENDALI JARAK JAUH POMPA TANGKI LIMBAH RADIOAKTIF CAIR BERBASIS SMS. Tangki Limbah Radioaktif Cair di Pusat Radioisotop dan Radiofarmaka (PRR) - BATAN memerlukan sistem level alarm yang terkoneksi dengan peralatan pribadi operator agar potensi banjir akibat meluapnya Tangki Limbab Cair dapat dihindari. Salah satu fitur yang dewasa ini dapat digunakan adalah SMS. Tidak hanya level alarm yang digunakan untuk melakukan monitoring melalui SMS. tetapi pompa tangki juga dapat dikendalikan melalui SMS. Sensor yang digunakan untuk mengukur level limbah radioaktif cair adalah Ultrasonic rangefinder, data level tersebut diakuisisi oleh mikrokontroler dengan setting alarm level tertentu. Alarm tersebut melalui RMC akan mengirimkan SMS ke operator. Selanjutnya pompa akan dioperasikan secara otomatis atau operator juga dapat melakukan kendali pompa dengan mengirimkan SMS ke RMC.Kata kunci: Monitoring. alarm kendali, tangki limbah, mikrokontroler, SMS
36
Manzano, Wallace, Valdemar Vicente Graciano Neto, and Elisa Yumi Nakagawa. "Dynamic-SoS: An Approach for the Simulation of Systems-of-Systems Dynamic Architectures." Computer Journal 63, no. 5 (April 12, 2019): 709–31. http://dx.doi.org/10.1093/comjnl/bxz028.
Full textAbstract:
Abstract Systems-of-Systems (SoS) combine heterogeneous, independent systems to offer complex functionalities for highly dynamic smart applications. Besides their dynamic architecture with continuous changes at runtime, SoS should be reliable and work without interrupting their operation and with no failures that could cause accidents or losses. SoS architectural design should facilitate the prediction of the impact of architectural changes and potential failures due to SoS behavior. However, existing approaches do not support such evaluation. Hence, these systems have been usually built without a proper evaluation of their architecture. This article presents Dynamic-SoS, an approach to predict/anticipate at design time the SoS architectural behavior at runtime to evaluate whether the SoS can sustain their operation. The main contributions of this approach comprise: (i) characterization of the dynamic architecture changes via a set of well-defined operators; (ii) a strategy to automatically include a reconfiguration controller for SoS simulation; and (iii) a means to evaluate architectural configurations that an SoS could assume at runtime, assessing their impact on the viability of the SoS operation. Results of our case study reveal Dynamic-SoS is a promising approach that could contribute to the quality of SoS by enabling prior assessment of its dynamic architecture.
37
Aceto, Luca, Anna Ingolfsdottir, and Eugen-Ioan Goriac. "SOS rule formats for idempotent terms and idempotent unary operators." Journal of Logic and Algebraic Programming 83, no. 1 (January 2014): 64–80. http://dx.doi.org/10.1016/j.jlap.2013.07.003.
Full text
38
Alchamdani, Alchamdani. "NO2 and SO2 Exposure to Gas Station Workers Health Risk in Kendari City." JURNAL KESEHATAN LINGKUNGAN 11, no. 4 (October 31, 2019): 319. http://dx.doi.org/10.20473/jkl.v11i4.2019.319-330.
Full textAbstract:
Gas station workers played an important role in providing fuel needs in the community for the transportation system to run smoothly. The higher motor vehicle user, the intensity of refueling also increases. They were at high risk of being exposed to hazardous pollutants from both vehicle emissions and fuel vapors. Although NO2 and SO2 had non-carcinogenic effects, they are still irritants that cause chronic airway disorders. This study aims to analyze the health risks experienced by gas station workers due to NO2 and SO2 exposure in Kendari City. This research was a Quantitative Descriptive study with Environmental Health Risk Method Analysis. The number of samples was 13 operators chosen with total sampling. Measurement of NO2 and SO2 concentrations were carried out in the morning, afternoon and evening. The results of this study showed the highest intake value obtained for NO2 (real-time) was 0.00635 mg/kg/day and SO2 (real-time) 0.00057 mg/kg/day. The highest risk level obtained for NO2 is 0,31775 (RQ<1) and SO2 0,00275 (RQ<1). The conclusion of this study is the quality of ambient air NO2 and SO2 at SPBU 74,931.10 is still safe and meets the National Ambient Air Quality Standard in a short time. But otherwise, it will be at high risk for health if the operator was exposed for a long time and continuously. It should be made an effort to monitor and control air pollution. As well as the policy of using Personal Protective Equipment to minimizing exposure to ambient pollutants.
39
VEGA, H. J. DE. "FACE ALGEBRAS AND EXACT BETHE ANSATZ SOLUTIONS FOR SOS MODELS." International Journal of Modern Physics A 05, no. 08 (April 20, 1990): 1611–32. http://dx.doi.org/10.1142/s0217751x90000738.
Full textAbstract:
An analog of the Yang-Baxter Algebra (YBA) is defined in face language. The operators tαα′,ββ′(θ) introduced here enjoy all essential properties of the vertex language YBA. Using this face YBA an algebraic Bethe Ansatz (BA) is constructed for SOS models (unrestricted IRF models). The face dual of the six-vertex model and the critical ABF model are worked out explicitly. Eigenvectors and eigenvalues of the transfer matrix are found and the corresponding BA equations derived and compared with the six vertex BAE.
40
Prayogo, Doddy, Min-Yuan Cheng, Yu-Wei Wu, A. A. N. Perwira Redi, Vincent F. Yu, Satria Fadil Persada, and Reny Nadlifatin. "A Novel Hybrid Metaheuristic Algorithm for Optimization of Construction Management Site Layout Planning." Algorithms 13, no. 5 (May 6, 2020): 117. http://dx.doi.org/10.3390/a13050117.
Full textAbstract:
Symbiotic organisms search (SOS) is a promising metaheuristic algorithm that has been studied recently by numerous researchers due to its capability to solve various hard and complex optimization problems. SOS is a powerful optimization technique that mimics the simulation of the typical symbiotic interactions among organisms in an ecosystem. This study presents a new SOS-based hybrid algorithm for solving the challenging construction site layout planning (CSLP) discrete problems. A new algorithm called the hybrid symbiotic organisms search with local operators (HSOS-LO) represents a combination of the canonical SOS and several local search mechanisms aimed at increasing the searching capability in discrete-based solution space. In this study, three CSLP problems that consist of single and multi-floor facility layout problems are tested, and the obtained results were compared with other widely used metaheuristic algorithms. The results indicate the robust performance of the HSOS-LO algorithm in handling discrete-based CSLP problems.
41
Freitas, M., V. Macedo Silva, C. Arieira, T. Cúrdia Gonçalves, F. Dias de Castro, S. Leite, M. J. Moreira, and J. Cotter. "P134 Ultrasonographic scores for Crohn’s disease activity assessment – still lag behind CEUS." Journal of Crohn's and Colitis 15, Supplement_1 (May 1, 2021): S222—S223. http://dx.doi.org/10.1093/ecco-jcc/jjab076.261.
Full textAbstract:
Abstract Background Intestinal ultrasound (IUS) is an increasingly used non-invasive tool to monitor Crohn‘s disease (CD) activity. Currently, there is no widely accepted, reproducible IUS activity index to evaluate inflammatory activity. In 2020, two new scores emerged: the Simple Ultrasound Activity Score for CD (SUS-CD) and International Bowel Ultrasound Segmental Activity Score (IBUS-SAS). We aimed to compare the accuracy of SUS-CD, IBUS-SAS and contrast ultrasound (CEUS) in predicting inflammatory activity in the terminal ileum in ileocolonoscopy. Methods Retrospective study including all IBD patients submitted to conventional IUS and CEUS with contrast SonoVue® directed to the terminal ileum performed by a single operator between April 2016 and March 2020. Examinations were performed using an ultrasound Hitachi HI VISION Avius®. Qualitative and quantitative parameters from the conventional IUS analysis including wall thickness, stratification, colour Doppler and inflammatory fat were evaluated, and segmental SUS-CD and IBUS-SAS were calculated. A quantitative measurement of contrast bowel wall enhancement, peak intensity, was evaluated using CEUS. The CD activity was assessed with ileocolonoscopy by Simple Endoscopic Score for CD (SES-CD). Disease activity was graded as inactive (SES-CD<7) or active (SES-CD≥7). Results Fifty patients were included, 54.0% female, with mean age of 33±12years. Patients had a mean SUS-CD of 3.4±1.0, IBUS-SAS of 58.9±25.9 and CEUS peak intensity of 12.6±12.2. SUS-CD and IBUS-SAS were not different between patients with active or inactive disease (p=0.15; 0.57, respectively) with a poor capability to predict endoscopic activity (AUC 0.62, 95% CI 0.45–0.78; 0.55, 95% CI 0.38–0.72, respectively). Peak intensity in CEUS was significantly different in patients with active or inactive disease (p=0.004) with a good capability to predict endoscopic activity (AUC 0.80; 95% CI 0.64–0.92). A peak intensity optimal cut-off to predict active disease was 8.2 with a sensitivity of 71.4% and a specificity of 78.9%. Conclusion SUS-CD and IBUS-SAS were not able to predict with good accuracy endoscopic activity in terminal ileum in CD. On the other hand, CEUS with peak intensity assessment showed a good diagnostic accuracy for active inflammation in CD. Therefore, CEUS is a non-invasive emerging method, that should be routinely integrated in the ultrasonographic evaluation in CD.
42
Fauzi, Firman. "MANAJEMEN RESIKO DI TENGAH PERUBAHAN MODEL BISNIS TELEKOMUNIKASI." Jurnal Teknik Mesin 5, no. 4 (November 5, 2016): 32. http://dx.doi.org/10.22441/jtm.v5i4.1222.
Full textAbstract:
Dalam era data / internet, para operator telekomunikasi tentu saja mulai memfokuskan bisnis dan layanannya pada data, yang semula hanya sebagai salah satu value added service (VAS) hingga kemudian menjadi bagian core business para operator. Sayangnya pada era data ini, sepertinya resiko yang dihadapi operator adalah harus berbagi “kue” revenue dengan “banyak pemain lain” di luar operator telekomunikasi. Kemungkinan nilai yang didapatkan tidak akan sebesar saat era voice dan SMS yang masih mendominasi layanan telekomunikasi saat itu. Tetapi pertumbuhan pendapatan terus tertekan. Untuk mengatasi resiko tersebut maka operator telekomunikasi perlu manajemen resiko yang lebih handal lagi.
43
Trijayanto, Danang. "Analisis Isi SMS Iklan Layanan Telekomunikasi Telkomsel Berdasarkan Undang-undang No. 11 Tahun 2008 Pasal ke-9 Tentang Informasi dan Transaksi Elektronik Periode 2013." Jurnal Penelitian Pos dan informatika 6, no. 1 (October 17, 2016): 79. http://dx.doi.org/10.17933/jppi.2016.060105.
Full textAbstract:
<span>SMS advertising menjadi salah satu metode pemasaran produk saat ini. Layanan produk telekomunikasi bisa diiklankan melalui pesan iklan. Dalam perundang-undangan terdapat Undang-undang No.11 tahun 2011 tentang Informasi dan Transaki ELektronik yang menjadi payung hukum dalam mengatur aktivitas tersebut, khususnya dalam pasal ke-9 tentang kelengkapan informasi produsen, produk serta syarat kontrak dalam pemasaran melalui media elektronik. Operator Telkomsel merupakan salah satu operator dengan pengguna terbanyak yang sering memanfaatkan sms advertising untuk memasarkan produk layanannya. Penelitian ini melihat kesesuaian sms advertising dengan pasal ke-9 Undang-undang ITE. Metode yang digunakan dengan analisis is isms advertsing pada Telkomsel Simpati dan Telkomsel As. Hasil dari penelitian menunjukkan bahwa isi sms advertisng Telkomsel lengkap pada informasi produsen dan produk, namun kekurangan informasi dalam syarat kontrak.</span>
44
Morita, Takashi. "Scalar implicatures in non-monotonic environments." Semantics and Linguistic Theory 26 (October 15, 2016): 205. http://dx.doi.org/10.3765/salt.v26i0.3799.
Full textAbstract:
Scalar implicatures (SIs) have been traditionally analyzed as pragmatic inferences that arise after semantic computation. Recent studies, however, have presented various challenges to this classic analysis; for instance, it has been claimed that SIs can be interpreted within the scope of various semantic operators. These observations motivate a grammatical analysis of SIs: SIs are derived during or before semantic computation. Among various kinds of evidence for the grammati- cal approach to SIs, especially convincing one is SIs embedded in non-monotonic (NM) environments, which post-semantic analyses have difficulty deriving. This paper introduces a new example of NM operators that allow the SI-embedding in their scope, and I thereby provide further empirical support for the grammatical analysis. On the other hand, I will also show that not all NM operators behave in the same way with respect to SI-embedding. It will turn out that Strawson non- monotonicity is required to embed SIs in the negative component of NM envi- ronments; i.e. SI-embedding is unavailable if the NMity can be decomposed into monotonic assertion and monotonic presupposition.
45
Oureilidis, Konstantinos, Kyriaki-Nefeli Malamaki, Konstantinos Gallos, Achilleas Tsitsimelis, Christos Dikaiakos, Spyros Gkavanoudis, Milos Cvetkovic, et al. "Ancillary Services Market Design in Distribution Networks: Review and Identification of Barriers." Energies 13, no. 4 (February 18, 2020): 917. http://dx.doi.org/10.3390/en13040917.
Full textAbstract:
The high proliferation of converter-dominated Distributed Renewable Energy Sources (DRESs) at the distribution grid level has gradually replaced the conventional synchronous generators (SGs) of the transmission system, resulting in emerging stability and security challenges. The inherent characteristics of the SGs are currently used for providing ancillary services (ASs), following the instructions of the Transmission System Operator, while the DRESs are obliged to offer specific system support functions, without being remunerated for these functions, but only for the energy they inject. This changing environment has prompted the integration of energy storage systems as a solution for transfusing new characteristics and elaborating their business in the electricity markets, while the smart grid infrastructure and the upcoming microgrid architectures contribute to the transformation of the distribution grid. This review investigates the existing ASs in transmission system with the respective markets (emphasizing the DRESs’ participation in these markets) and proposes new ASs at distribution grid level, with emphasis to inertial response, active power ramp rate control, frequency response, voltage regulation, fault contribution and harmonic mitigation. The market tools and mechanisms for the procurement of these ASs are presented evolving the existing role of the Operators. Finally, potential barriers in the technical, regulatory, and financial framework have been identified and analyzed.
46
Gray, David A. "Initial Operation of the SNS." IEEE Transactions on Nuclear Science 32, no. 5 (1985): 2638–42. http://dx.doi.org/10.1109/tns.1985.4334006.
Full text
47
Guo, Yan Ying, and Yan Ying Guo. "A Novel Improved Edge Detection Method." Advanced Materials Research 225-226 (April 2011): 1096–99. http://dx.doi.org/10.4028/www.scientific.net/amr.225-226.1096.
Full textAbstract:
In this paper, a novel morphological edge detection using adaptive weighted morphological operators is presented. The newly introduced operators employ weighted structuring element (SE) and apply multiplication or division in place of addition and subtraction in classical morphological operations. It judges its edge and its direction by means of training method and differentiable equivalent representations for the operators, efficient adaptive algorithms to optimize SEs are derived. The gradient of the adaptive weighted morphology utilizes a set of SEs to detect the edge strength with a view to decrease the spurious detail edge and suppressed the noise. Results will be presenting for images in comparison with the others edging detectors.
48
Liu, He-Long, Jing-Yuan Yu, and Guang-Tian Zhu. "Stability Results for an Age-Structured SIS Epidemic Model with Vector Population." Journal of Applied Mathematics 2015 (2015): 1–12. http://dx.doi.org/10.1155/2015/838312.
Full textAbstract:
We formulate an age-structured SIS epidemic model with periodic parameters, which includes host population and vector population. The host population is described by two partial differential equations, and the vector population is described by a single ordinary differential equation. The existence problem for endemic periodic solutions is reduced to a fixed point problem of a nonlinear integral operator acting on locally integrable periodic functions. We obtain that if the spectral radius of the Fréchet derivative of the fixed point operator at zero is greater than one, there exists a unique endemic periodic solution, and we investigate the global attractiveness of disease-free steady state of the normalized system.
49
Tolstykh, S. A. "Method of optimization of decision-making during management of safety of flights in the activities of operators of aerodromes." Civil Aviation High Technologies 23, no. 5 (October 28, 2020): 54–66. http://dx.doi.org/10.26467/2079-0619-2020-23-5-54-66.
Full textAbstract:
In modern conditions of limited budget for enterprises of aerodrome operators, the task of optimizing decision making in flight safety management is becoming extremely urgent. Management decisions, which are a safety management tool, must be not only effective in terms of expected improvements in safety, but also cost-effective and appropriate for the enterprise. Optimization in this article should be understood in terms of the mentioned criteria. The article presents a method for supporting management decision-making as part of a safety management strategy for the activities of aerodrome operators. In the presented methodology, an important place is given to indicators of the level of safety of flights and their use in making managerial decisions. Along with the safety indicator, an indicator of financial damage from recorded events is used, which is calculated in value terms taking into account direct and indirect damage to the aerodrome operator. Regression modeling is used in conjunction with the decision-making technique of “human-machine procedures”. Regression analysis is performed using STATISTICA software, and allows you to identify the dependence of indicators on the degree of influence of hazard factors. The resulting model, based on data from last year, makes it possible to forecast the values of indicators for the next. Using the decision-making methodology of “human-machine procedures”, an assessment is made of the priority of implementing managerial decisions based on an integrated criterion. The methodology ensures compliance with the requirements of Russian and international air legislation for operators of certified aerodromes. The scope of its application can be expanded to SMS of all aviation service providers, taking into account the relevant specifics of the services provided and the existing hazard factors.
50
Kozma, Dániel, Pál Varga, and Felix Larrinaga. "System of Systems Lifecycle Management—A New Concept Based on Process Engineering Methodologies." Applied Sciences 11, no. 8 (April 9, 2021): 3386. http://dx.doi.org/10.3390/app11083386.
Full textAbstract:
In order to tackle interoperability issues of large-scale automation systems, SOA (Service-Oriented Architecture) principles, where information exchange is manifested by systems providing and consuming services, have already been introduced. However, the deployment, operation, and maintenance of an extensive SoS (System of Systems) mean enormous challenges for system integrators as well as network and service operators. The existing lifecycle management approaches do not cover all aspects of SoS management; therefore, an integrated solution is required. The purpose of this paper is to introduce a new lifecycle approach, namely the SoSLM (System of Systems Lifecycle Management). This paper first provides an in-depth description and comparison of the most relevant process engineering methodologies and ITSM (Information Technology Service Management) frameworks, and how they affect various lifecycle management strategies. The paper’s novelty strives to introduce an Industry 4.0-compatible PLM (Product Lifecycle Management) model and to extend it to cover SoS management-related issues on well-known process engineering methodologies. The presented methodologies are adapted to the PLM model, thus creating the recommended SoSLM model. This is supported by demonstrations of how the IIoT (Industrial Internet of Things) applications and services can be developed and handled. Accordingly, complete implementation and integration are presented based on the proposed SoSLM model, using the Arrowhead framework that is available for IIoT SoS.