To see the other types of publications on this topic, follow the link: Spotted tail.
Journal articles on the topic 'Spotted tail'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Spotted tail.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Mason, Kevin. "Spotted Tail." Annals of Iowa 79, no. 2 (April 2020): 198–99. http://dx.doi.org/10.17077/0003-4827.12669.
Full text
2
Van Kirk, Levi S., Stanley F. Hayes, and Robert A. Heinzen. "Ultrastructure of Rickettsia rickettsiiActin Tails and Localization of Cytoskeletal Proteins." Infection and Immunity 68, no. 8 (August 1, 2000): 4706–13. http://dx.doi.org/10.1128/iai.68.8.4706-4713.2000.
Full textAbstract:
ABSTRACT Actin-based motility (ABM) is a mechanism for intercellular spread that is utilized by vaccinia virus and the invasive bacteria within the genera Rickettsia, Listeria, andShigella. Within the Rickettsia, ABM is confined to members of the spotted fever group (SFG), such asRickettsia rickettsii, the agent of Rocky Mountain spotted fever. Infection by each agent induces the polymerization of host cell actin to form the typical F (filamentous)-actin comet tail. Assembly of the actin tail propels the pathogen through the host cytosol and into cell membrane protrusions that can be engulfed by neighboring cells, initiating a new infectious cycle. Little is known about the structure and morphogenesis of the Rickettsia rickettsii actin tail relative to Shigellaand Listeria actin tails. In this study we examined the ultrastructure of the rickettsial actin tail by confocal, scanning electron, and transmission electron microscopy. Confocal microscopy of rhodamine phalloidin-stained infected Vero cells revealed the typhus group rickettsiae, Rickettsia prowazekii andRickettsia typhi, to have no actin tails and short (∼1- to 3-μm) straight or hooked actin tails, respectively. The SFG rickettsia, R. rickettsii, displayed long actin tails (>10 μm) that were frequently comprised of multiple, distinct actin bundles, wrapping around each other in a helical fashion. Transmission electron microscopy, in conjunction with myosin S1 subfragment decoration, revealed that the individual actin filaments of R. rickettsii tails are >1 μm long, arranged roughly parallel to one another, and oriented with the fast-growing barbed end towards the rickettsial pole. Scanning electron microscopy of intracellular rickettsiae demonstrated R. rickettsii to have polar associations of cytoskeletal material and R. prowazekii to be devoid of cytoskeletal interactions. By indirect immunofluorescence, both R. rickettsii and Listeria monocytogenesactin tails were shown to contain the cytoskeletal proteins vasodilator-stimulated phosphoprotein profilin, vinculin, and filamin. However, rickettsial tails lacked ezrin, paxillin, and tropomyosin, proteins that were associated with actin tails of cytosolic or protrusion-bound Listeria. The unique ultrastructural and compositional characteristics of the R. rickettsii actin tail suggest that rickettsial ABM is mechanistically different from previously described microbial ABM systems.
3
Brossman, K. H., B. E. Carlson, L. Swierk, and T. Langkilde. "Aquatic tail size carries over to the terrestrial phase without impairing locomotion in adult Eastern Red-spotted Newts (Notophthalmus viridescens viridescens)." Canadian Journal of Zoology 91, no. 1 (January 2013): 7–12. http://dx.doi.org/10.1139/cjz-2012-0180.
Full textAbstract:
Many species have evolved phenotypic flexibility to adjust to seasonal changes in their environment, including seasonal breeding phenotypes that increase reproductive success. If there are limits to this flexibility, such that traits carry over across seasons, there may be costs incurred as a result of trade-offs in optimal performance. Male and female Eastern Red-spotted Newts (Notophthalmus viridescens viridescens (Rafinesque, 1820)) increase tail size for the aquatic breeding season, and reduce their tail size as they return to the terrestrial environment after reproducing. We tested whether large aquatic tails (which should increase swim performance) carry over to become larger tails in the terrestrial phase (relative to body size), and whether this incurs a cost of decreased walking speed on land. We found a strong correlation between tail size in both phases, suggesting that this trait does carry-over between seasons and environments. Tail size was positively related to locomotor speed in the aquatic phase, but we found no evidence of a locomotor trade-off associated with tail size in the terrestrial phase. Further research that tests for alternative costs of developing large aquatic tails that are then carried over to the terrestrial environment would help to clarify the evolution of this life-cycle staging trait.
4
Bondeson, J. "Historical analysis of Newfoundland dog fur colour genetics." Open Veterinary Journal 5, no. 2 (2015): 85. http://dx.doi.org/10.5455/ovj.2015.v5.i1.p85.
Full textAbstract:
This article makes use of digitized historic newspapers to analyze Newfoundland dog fur colour genetics, and fur colour variations over time. The results indicate that contrary to the accepted view, the ‘Solid’ gene was introduced into the British population of Newfoundland dogs in the 1840s. Prior to that time, the dogs were white and black (Landseer) or white and brown, and thus spotted/spotted homozygotes. Due to ‘Solid’ being dominant over ‘spotted’, and selective breeding, today the majority of Newfoundland dogs are solid black. Whereas small white marks on the chest and/or paw appears to be a random event, the historical data supports the existence of an ‘Irish spotted’ fur colour pattern, with white head blaze, breast, paws and tail tip, in spotted/spotted homozygotes.
5
Flynn, Sean J. "Spotted Tail: Warrior and Statesman by Richmond L. Clow." Great Plains Quarterly 40, no. 3 (2020): 241. http://dx.doi.org/10.1353/gpq.2020.0035.
Full text
6
Indriyani, Susi, Bainah Sari Dewi, and Niskan Walid Masruri. "Analisis Preferensi Pakan Drop In Rusa Sambar (Cervus unicolor) dan Rusa Totol (Axis axis) di Penangkaran PT. Gunung Madu Plantations Lampung Tengah." Jurnal Sylva Lestari 5, no. 3 (July 31, 2017): 22. http://dx.doi.org/10.23960/jsl3522-29.
Full textAbstract:
Gunung Madu Plantations (GMP) has built deer sanctuary as a part of conservation effort for sambar deer (Cervus unicolor) and spotted deer (Axis axis), this faunas has suppresed by extinction in its natural habitat which means need to be protected by ex-situ concervation effort. Important to conduct the research with aimed to recognize deer’s preference towards its served feeder (drop-in) and its availability. The research conducted in October to November 2015 in GMP’s deer sanctuary . The method used in the research palatability test method and direct observation method through 8 tail sambar deer (Cervus unicolor) and 10 tail spotted deer (Axis axis). According to the result, food preference of deer in GMP ’s Deer Sanctuary were elephant grass (Pennisetum purpureum)25.9 %, sauhen grass (Penicum colonum) 22.25%, rayutan (Hypoestes polythyrsa) 21.87%, lamtoro (Leucaena leucocephala) 21.24% and rice mixture (Dedak oriza sativa) 8.74%. Key words: Preference, Sambar deer (Cervus unicolor), Spotted deer (Axis axis), Sanctuary
7
Kristan, Deborah M., R. J. Gutiérrez, and Alan B. Franklin. "Adaptive significance of growth patterns in juvenile spotted owls." Canadian Journal of Zoology 74, no. 10 (October 1, 1996): 1882–86. http://dx.doi.org/10.1139/z96-212.
Full textAbstract:
We examined relative growth patterns of six morphological features of fledgling spotted owls (Strix occidentalis). Juvenile spotted owls exhibit early nest desertion, possibly to avoid parasitism or detection by predators or to reduce thermal stress. Because juveniles leave the nest before they are capable fliers, they primarily use morphological features other than their wings and tail to move among roost locations. When juveniles fledged, mass, wing chord, and tail length were still increasing, whereas tarsus length and bill depth were near adult size. Moreover, juvenile bill length was greater than mean adult bill length for nearly all time periods. Early growth in tarsi and bills may increase juveniles' ability to effectively locomote after they have fledged but before they can adequately fly.
8
Santos, Patrícia Andrade dos, Vânia Maria França Ribeiro, Augusto Luiz Faino Alves, Vanessa Lima da Silva, Breno Kalyl Freitas Nascimento, Rafael Augusto Satrapa, and Fernando Andrade Souza. "Morphology, morphometry, and membrane integrity of epididymal spermatozoa of spotted pacas (Cuniculus paca, Linnaeus 1766)." Semina: Ciências Agrárias 41, no. 1 (January 10, 2020): 181. http://dx.doi.org/10.5433/1679-0359.2020v41n1p181.
Full textAbstract:
The objective of this study was to evaluate the morphology, morphometry, and membrane integrity of epididymal spermatozoa of spotted pacas using spermatic cells collected from the epididymal tails of five animals. The flotation method using the ACP-123® and Botusemen Special® extenders was performed, and samples were stained in Diff-Quick and eosin-nigrosine. Descriptive statistics of data were obtained and Student’s t-test was performed. The morphology of 200 Diff-Quick-stained spermatozoa showed that they had an oval head with three vesicles in the acrosomal region, a midpiece, an elongated tail; moreover, 27% of the spermatozoa exhibited cellular defects. The morphometry of 100 sperm cells (analyzed with an optical microscope and the EZ Leica LAS software for Windows) presented the following measurements (mean ± SD): total length 43.87 ± 4.91 ?m, head 7.54 ± 0.82 ?m, midpiece 5.35 ± 0.83 ?m, tail 30.72 ± 2.55 ?m, and head width 5.30 ± 0.68 ?m. Of the 2,000 cells stained with eosin-nigrosine for membrane integrity evaluation, 83.8% diluted in ACP-123® and 72.9% diluted in Botusemen® had intact membranes. The results of this study suggest that epididymal spermatozoa of pacas can be used in assisted reproduction programs; moreover, our study adds knowledge to the reproductive biology of wild animals, and encourages further research on the role of the three acrosomal vesicles present in this species.
9
Grimholt, Unni, Kentaro Tsukamoto, Keiichiro Hashimoto, and Johannes M. Dijkstra. "Discovery of a Novel MHC Class I Lineage in Teleost Fish which Shows Unprecedented Levels of Ectodomain Deterioration while Possessing an Impressive Cytoplasmic Tail Motif." Cells 8, no. 9 (September 9, 2019): 1056. http://dx.doi.org/10.3390/cells8091056.
Full textAbstract:
A unique new nonclassical MHC class I lineage was found in Teleostei (teleosts, modern bony fish, e.g., zebrafish) and Holostei (a group of primitive bony fish, e.g., spotted gar), which was designated “H” (from “hexa”) for being the sixth lineage discovered in teleosts. A high level of divergence of the teleost sequences explains why the lineage was not recognized previously. The spotted gar H molecule possesses the three MHC class I consensus extracellular domains α1, α2, and α3. However, throughout teleost H molecules, the α3 domain was lost and the α1 domains showed features of deterioration. In fishes of the two closely related teleost orders Characiformes (e.g., Mexican tetra) and Siluriformes (e.g., channel catfish), the H ectodomain deterioration proceeded furthest, with H molecules of some fishes apparently having lost the entire α1 or α2 domain plus additional stretches within the remaining other (α1 or α2) domain. Despite these dramatic ectodomain changes, teleost H sequences possess rather large, unique, well-conserved tyrosine-containing cytoplasmic tail motifs, which suggests an important role in intracellular signaling. To our knowledge, this is the first description of a group of MHC class I molecules in which, judging from the sequence conservation pattern, the cytoplasmic tail is expected to have a more important conserved function than the ectodomain.
10
Kleba, Betsy, Tina R. Clark, Erika I. Lutter, Damon W. Ellison, and Ted Hackstadt. "Disruption of the Rickettsia rickettsii Sca2 Autotransporter Inhibits Actin-Based Motility." Infection and Immunity 78, no. 5 (March 1, 2010): 2240–47. http://dx.doi.org/10.1128/iai.00100-10.
Full textAbstract:
ABSTRACT Rickettsii rickettsii, the etiologic agent of Rocky Mountain spotted fever, replicates within the cytosol of infected cells and uses actin-based motility to spread inter- and intracellularly. Although the ultrastructure of the actin tail and host proteins associated with it are distinct from those of Listeria or Shigella, comparatively little is known regarding the rickettsial proteins involved in its organization. Here, we have used random transposon mutagenesis of R. rickettsii to generate a small-plaque mutant that is defective in actin-based motility and does not spread directly from cell to cell as is characteristic of spotted fever group rickettsiae. The transposon insertion site of this mutant strain was within Sca2, a member of a family of large autotransporter proteins. Sca2 exhibits several features suggestive of its apparent role in actin-based motility. It displays an N-terminal secretory signal peptide, a C-terminal predicted autotransporter domain, up to four predicted Wasp homology 2 (WH2) domains, and two proline-rich domains, one with similarity to eukaryotic formins. In a guinea pig model of infection, the Sca2 mutant did not elicit fever, suggesting that Sca2 and actin-based motility are virulence factors of spotted fever group rickettsiae.
11
Levens, Gregory P., Gary Watson, and Dalen W. Agnew. "Glandular Hypertrophy and Ulceration along the Tail Dorsum of a Spotted Salamander, Ambystoma maculatum." Journal of Herpetological Medicine and Surgery 18, no. 1 (January 2008): 9–11. http://dx.doi.org/10.5818/1529-9651.18.1.9.
Full text
12
Saikia, Dibya J., Pritam Chattopadhyay, Goutam Banerjee, Bandita Talukdar, and Dandadhar Sarma. "Identification and Pathogenicity ofPseudomonas aeruginosaDJ1990 on Tail and Fin Rot Disease in Spotted Snakehead." Journal of the World Aquaculture Society 49, no. 4 (November 1, 2017): 703–14. http://dx.doi.org/10.1111/jwas.12476.
Full text
13
Bloch, A. M., and K. L. Grayson. "Reproductive costs of migration for males in a partially migrating, pond-breeding amphibian." Canadian Journal of Zoology 88, no. 11 (November 2010): 1113–20. http://dx.doi.org/10.1139/z10-079.
Full textAbstract:
Migratory animals face costs and benefits related to traveling to another habitat and the timing of the journey. These trade-offs can be sex-specific, with male reproductive success expected to be influenced by arrival time at the breeding habitat. In this study, we examined mating success in a population of partially migrating Red-Spotted Newts ( Notophthalmus viridescens viridescens (Rafinesque, 1820)). We tested the hypothesis that migrant males are at a disadvantage for spring mating opportunities compared with resident males owing to (i) later arrival time at the breeding pond and (ii) delay in developing the aquatic tail fin, which reduces their competitiveness. We measured the tail heights of successfully courting males compared with the general male population, as well as the time required for migrating males to develop tail fins. Temporally, migrant males arrived at the breeding pond before the majority of mating activity. However, we found that the time required for migrating males to acquire tail-fin heights necessary to be competitive for mating opportunities places them at a significant reproductive disadvantage compared with resident males. For partial migration to be maintained in the population, a reproductive cost for migrants could either trade off with another life-history trait or migration could be condition-dependent.
14
Glimm, Tilmann, Maria Kiskowski, Nickolas Moreno, and Ylenia Chiari. "Capturing and analyzing pattern diversity: an example using the melanistic spotted patterns of leopard geckos." PeerJ 9 (September 10, 2021): e11829. http://dx.doi.org/10.7717/peerj.11829.
Full textAbstract:
Animal color patterns are widely studied in ecology, evolution, and through mathematical modeling. Patterns may vary among distinct body parts such as the head, trunk or tail. As large amounts of photographic data is becoming more easily available, there is a growing need for general quantitative methods for capturing and analyzing the full complexity and details of pattern variation. Detailed information on variation in color pattern elements is necessary to understand how patterns are produced and established during development, and which evolutionary forces may constrain such a variation. Here, we develop an approach to capture and analyze variation in melanistic color pattern elements in leopard geckos. We use this data to study the variation among different body parts of leopard geckos and to draw inferences about their development. We compare patterns using 14 different indices such as the ratio of melanistic versus total area, the ellipticity of spots, and the size of spots and use these to define a composite distance between two patterns. Pattern presence/absence among the different body parts indicates a clear pathway of pattern establishment from the head to the back legs. Together with weak within-individual correlation between leg patterns and main body patterns, this suggests that pattern establishment in the head and tail may be independent from the rest of the body. We found that patterns vary greatest in size and density of the spots among body parts and individuals, but little in their average shapes. We also found a correlation between the melanistic patterns of the two front legs, as well as the two back legs, and also between the head, tail and trunk, especially for the density and size of the spots, but not their shape or inter-spot distance. Our data collection and analysis approach can be applied to other organisms to study variation in color patterns between body parts and to address questions on pattern formation and establishment in animals.
15
McLean, Chris M., Angelica Vårhammar, and Katarina M. Mikac. "Corrigendum to: Use of motion activated remote cameras to detect the endangered spotted-tail quoll (Dasyurus maculatus): results from a pilot study." Australian Mammalogy 37, no. 2 (2015): 264. http://dx.doi.org/10.1071/am14034_co.
Full textAbstract:
A survey of the spotted-tailed quoll (Dasyurus maculatus) was conducted in the Watagan Mountains of New South Wales using baited remote cameras. Nine individuals were detected, of which seven occurred at meat-baited sites and two at sites with a general mammal bait. This confirms the expectation that a meat-based bait increases the ability to detect this species using remote cameras.
16
YAO, CHEN-WEN, JIANN-HORNG LEU, CHUAN CHIN, CHEN-KUNG CHOU, and CHANG-JEN HUANG. "Round-Spotted Pufferfish (Tetraodon fluviatilis)snf5Gene Is Oriented in a Tail-to-Tail Manner With thesetGene Which Encodes an Inhibitor of Protein Phosphatase 2A." DNA and Cell Biology 17, no. 1 (January 1998): 69–82. http://dx.doi.org/10.1089/dna.1998.17.69.
Full text
17
Fu, Li-rong, Bin He, Robert Murphy, Ji-chao Wang, Yong-gang Ma, Yu-xiang Liu, Hai-tao Shi, and Jonathan Fong. "An analysis of courtship behaviour in the four-eyed spotted turtle, Sacalia quadriocellata (Reptilia: Testudines: Geoemydidae)." Amphibia-Reptilia 29, no. 2 (2008): 185–95. http://dx.doi.org/10.1163/156853808784124901.
Full textAbstract:
Abstract A total of 168 courtship sequences from 12 male and 18 female adult captive Sacalia quadriocellata were recorded on video. Thirty male and four female discrete motor patterns were defined and described. The behavioural sequences were summarized in an intra-individual dyadic transition matrix and analyzed using chi-square and kappa analyses. Courtship behaviour models and a flow diagram were constructed for this species. The male display patterns involved tactical and visual signals to induce female receptivity to mating. In response, females may emit olfactory signals for gender recognition. Female rejection of male suitors resulted in a male success rate of 4.17%. Only seven copulations were observed. Copulation only occurred when a female became quiescent and relaxed her tail for coition.
18
Kanzaki, Natsumi, Kaku Tsuda, and Kazuyoshi Futai. "Description of Bursaphelenchus conicaudatus n. sp. (Nematoda: Aphelenchoididae), isolated from the yellow-spotted longicorn beetle, Psacothea hilaris (Coleoptera: Cerambycidae) and fig trees, Ficus carica." Nematology 2, no. 2 (2000): 165–68. http://dx.doi.org/10.1163/156854100509051.
Full textAbstract:
Abstract Bursaphelenchus conicaudatus n. sp. is described and figured. Specimens were collected from a 3-week-old culture on Botrytis cinerea. The new species is characterised by the roundish trapezoid bursa of males and tapered and mucronate tail of females. The new species is closely related to B. xylophilus, B. mucronatus and B. fraudulentus in the shapes of spicule and vulval flap, but was easily distinguished from these three species by the shapes of the bursa and female tail. Bursaphelenchus conicaudatus n. sp. est décrit et illustré. Des spécimens ont été collectés à partir d’une culture de 3 semaines sur Botrytis cinerea. La nouvelle espèce est caractérisée par une bourse trapézoïdate et arrondie chez le mâle et par l’extrémité mucronée de la queue chez la femelle. La nouvelle espèce est très proche de B. xylophilus, B. mucronatus et B. fraudulentus par la forme des spicules et du volet vulvaire mais elle a été facilement différenciée de ces trois espèces par la forme de la bourse du mâle et de la queue de la femelle.
19
Ignacio Areta, Juan. "Behavior and Phylogenetic Position of Premnoplex Barbtails (Furnariidae)." Condor 109, no. 2 (May 1, 2007): 399–407. http://dx.doi.org/10.1093/condor/109.2.399.
Full textAbstract:
Abstract The Margarornis assemblage includes four genera: Margarornis, Premnoplex, Premnornis, and Roraimia, all thought to be closely related. Differences in vocalizations and habitat use between Premnoplex brunnescens (Spotted Barbtail) and P. tatei (White-throated Barbtail) are consistent with their full species status. In light of the weak anatomical (hindlimb musculature) evidence supporting the inclusion of Premnornis in the Margarornis assemblage, the convergence-prone nature of characters associated with climbing habits, and the differences in their nests and foraging behavior, I propose that Premnornis is not a member of the Margarornis assemblage and that Premnoplex is closely related only to Margarornis. These results are supported by recent molecular phylogenetic analyses. Although Roraimia differs in plumage, tail shape, and song from other members of the Margarornis assemblage, it must be provisionally included in the assemblage until evidence clarifies its phylogenetic position.
20
Kuzmina, N. V., D. D. Ostapiv, O. I. Chajkovska, R. D. Ostapiv, and O. P. Panych. "ACTIVITY OF MALATE-ASPARTATE SHUTTLE ENZYMES OF BULLS AND BOARS REPRODUCTIVE ORGANS AND EPIDIDIMAL SPERMATOZOA." Scientific and Technical Bulletin оf State Scientific Research Control Institute of Veterinary Medical Products and Fodder Additives аnd Institute of Animal Biology 21, no. 2 (October 27, 2020): 86–89. http://dx.doi.org/10.36359/scivp.2020-21-2.11.
Full textAbstract:
The activity of malate-aspartate shuttle enzymes in the reproductive organs and epididimal sperm of bulls and boars was studied.
The research was conducted on bulls of the Ukrainian black-spotted dairy breed (n = 5; aged 14 - 16 months) and boars of the Great White breed (n = 3; aged 10 - 12 months). After slaughter, the testes and testicular appendages were removed and the spermatozoa were washed with 0.9% sodium chloride solution. Testicular and epididimal tissues were homogenized and centrifuged. Aspartate aminotransferase (AST), malate dehydrogenase (MDG) and protein concentration were determined in the supernatant and epididimal sperm.
The specie and tissue specificity of aspartate aminotransferase and malate dehydrogenase activity have been established. In particular, in bulls, the activity of AST in the tissues of the testis, head and body of the epididymis of bulls is almost the same (116.5 - 118.3 nmol/min×mg of protein) and on 18.5 - 19.7% (р<0,05) higher in the tail of the appendix. In this case, MDG activity in the reproductive organs shows wavy changes: in the testicular tissue is high (1.96 ± 0.15 nmol / min × mg of protein), and in the epididymis: in the head is reduced (3.5 times ; p <0,001), increased in the body (p <0,05) and decreased again in the tail. In the sperm of bulls, the activity of AST from the head of the appendix - 69.3 ± 8.06 nmol / min × mg of protein, from the body - increased (p <0.05) and again (p <0.001) decreased from the tail of the appendix. MDG activity in sperm from the head of the epididymis was 0.50 ± 0.04 nmol/min×mg of protein, lower by 38.0% (p <0.05) from the body and 50.0% (p <0.001) higher in the tail.
In boars, the activity of AST in testicular tissue - 20.3 ± 5.22 nmol / min × mg of protein and higher in the appendix: 45.6% - in the head, 59.0% - in the body and 64.0 % - in the tail. Similarly, the activity of MDG in testicular tissue was 0.22 ± 0.02 nmol / min × mg of protein, increases by 40.6% in the head and remained at the same level in the body of the appendix, and in the tail tissue above 2, 5 - 2.7 times (p <0.001). In bovine germ cells, the activity of AST and MDG from the body of the appendix was, respectively, 102.3 ± 6.1 and 13.20 ± 0.15 nmol / min × mg of protein, lowered twice (p <0,001) and 10.7 % in the head and more than four times (p <0,001) and 61,2% (p <0,001) in the tail of the appendix.
21
Baldridge, Gerald D., Nicole Y. Burkhardt, Jason A. Simser, Timothy J. Kurtti, and Ulrike G. Munderloh. "Sequence and Expression Analysis of the ompA Gene of Rickettsia peacockii, an Endosymbiont of the Rocky Mountain Wood Tick, Dermacentor andersoni." Applied and Environmental Microbiology 70, no. 11 (November 2004): 6628–36. http://dx.doi.org/10.1128/aem.70.11.6628-6636.2004.
Full textAbstract:
ABSTRACT The transmission dynamics of Rocky Mountain spotted fever in Montana appears to be regulated by Rickettsia peacockii, a tick symbiotic rickettsia that interferes with transmission of virulent Rickettsia rickettsii. To elucidate the molecular relationships between the two rickettsiae and glean information on how to possibly exploit this interference phenomenon, we studied a major rickettsial outer membrane protein gene, ompA, presumed to be involved in infection and pathogenesis of spotted fever group rickettsiae (SFGR) but which is not expressed in the symbiont. Based on PCR amplification and DNA sequence analysis of the SFGR ompA gene, we demonstrate that R. peacockii is the most closely related of all known SFGR to R. rickettsii. We show that R. peacockii, originally described as East Side agent in Dermacentor andersoni ticks from the east side of the Bitterroot Valley in Montana, is still present in that tick population as well as in D. andersoni ticks collected at two widely separated locations in Colorado. The ompA genes of R. peacockii from these locations share three identical premature stop codons and a weakened ribosome binding site consensus sequence relative to ompA of R. rickettsii. The R. peacockii ompA promoter closely resembles that of R. rickettsii and is functional based on reverse transcription-PCR results. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotting showed that OmpA translation products were not detected in cultured tick cells infected with R. peacockii. Double immunolabeling studies revealed actin tail structures in tick cells infected with R. rickettsii strain Hlp#2 but not in cells infected with R. peacockii.
22
Aluko, F. A., O. E. Daramola, and B. B. A. Taiwo. "Effect of age, sex and local government area on linear body measurements of WAD goat in Ogun State, Nigeria." Nigerian Journal of Animal Production 40, no. 2 (December 28, 2020): 143–50. http://dx.doi.org/10.51791/njap.v40i2.1128.
Full textAbstract:
One hundred and twenty West African Dwarf goats were used in this study. Observations were made from twelve different towns in Yewa North, Yewa South and Abeokuta North Local Government. West African dwarf goats were evaluated for phenotypic variation at different ages ranges from 1, 2 and 3 years. Variations in live weight and body measurements such as height at wither; body length, heart girth, fore limb length, hind limb length, face length, ear length, ear width, hip width and tail length were taken. The local government areas significantly (P<0.05, 0.001) affected body length, fore limb length, ear length, ear width, hip width and live weight. Age and sex significantly (P<0.01) affected all the body measurements. The mean live weight by age groups are 6.61 + 0.31kg, 13.10 + 0.60kg and 20.18 + 0.95kg for ages 1,2 and 3 respectively. The coat colour varied from black, brown, grey to white in WAD goats. Some colours were in patches, some uniform while others were spotted
23
Yooyen, T., F. Moravec, and C. Wongsawad. "Raphidascaris (Ichthyascaris) arii sp. n. (Nematoda: Anisakidae), a new ascaridoid nematode from marine catfishes in the Gulf of Thailand." Helminthologia 48, no. 4 (December 1, 2011): 262–67. http://dx.doi.org/10.2478/s11687-011-0037-z.
Full textAbstract:
AbstractA new nematode species, Raphidascaris (Ichthyascaris) arii sp. n. (Anisakidae), is described from male and female specimens found in the intestine of two species of marine siluriform fishes, the spotted catfish Arius maculatus (Thunberg) (Ariidae) (type host) and the striped eel catfish Plotosus lineatus (Thunberg) (Plotosidae) from the coastal region of the Gulf of Thailand, Thailand. Based on light and scanning electron microscopy examinations, the new species differs from other nine representatives of the subgenus Ichthyascaris Wu, 1949 mainly in the length of spicules (210–333 μm), body length of gravid females (10–17 mm), and in the presence of small cuticular spines or protuberances on the tail tip of both sexes and 21–30 pairs of preanal and 8 pairs of postanal papillae in the male. This is the first species of this subgenus reported from fishes of the order Siluriformes and the first species of the subgenus Ichthyascaris Wu, 1949 recorded from the Gulf of Thailand.
24
ZIEGLER, THOMAS, CUONG THE PHAM, TAN VAN NGUYEN, TRUONG QUANG NGUYEN, JIAN WANG, YING-YONG WANG, BRYAN L. STUART, and MINH DUC LE. "A new species of Opisthotropis from northern Vietnam previously misidentified as the Yellow-spotted Mountain Stream Keelback O. maculosa Stuart & Chuaynkern, 2007 (Squamata: Natricidae)." Zootaxa 4613, no. 3 (June 6, 2019): 578. http://dx.doi.org/10.11646/zootaxa.4613.3.9.
Full textAbstract:
The Yellow-spotted Mountain Stream Keelback Opisthotropis maculosa was originally described based on a single male specimen from northeastern Thailand. Recently, based on morphological data, new records of this species were published initially from southern China and subsequently from northern Vietnam. In this study, we provide the first molecular comparisons between the holotype and other populations in China and Vietnam using the mitochondrial cytochrome b gene and use an integrative taxonomic approach to show that the population from Vietnam represents a distinct taxon. Opisthotropis haihaensis sp. nov. is characterized by a combination of the following characters: internasal not in contact with loreal; prefrontal not touching supraocular; frontal touching preocular; one preocular; one postocular; one anterior temporal; one posterior temporal; eight supralabials, fourth and fifth in contact with eye; 24 maxillary teeth; anterior pair of chin shields longer than posterior pair; 169 ventrals + 2 preventrals); 79 subcaudals, paired; 15 dorsal scale rows at neck, at midbody and before vent; body and tail scales smooth; chin shields yellow with brownish black mottling; body and tail dorsum dark with each a light spot per scale. Phylogenetically, the new species is supported as the sister taxon to “O. maculosa” from China (but separated by approximately 10% uncorrected pairwise sequence divergence) and is distantly related to O. maculosa sensu stricto from Thailand, warranting a taxonomic revision of the maculosa-like species. According to our results, O. maculosa should be delisted from the herpetofauna of Vietnam, which currently consists of nine Opisthotropis species. Five species, O. cucae, O. daovantieni, O. haihaensis, O. tamdaoensis, and O. voquyi, are endemic to the country.
25
Geromo, Ronel B., Dinah M. Espina, Milagros C. Bales, and Masahide Nishibori. "Morphological Characterization of Native Pigs (Sus scrofa domesticus L.) in Bohol Province, Philippines." Science and Humanities Journal 14, no. 1 (December 12, 2020): 1–15. http://dx.doi.org/10.47773/shj.1998.141.1.
Full textAbstract:
This study assessed the morphological characteristics of the native pig population in Bohol Island, Philippines. A total of 100 sexually-mature native pigs (80% gilt/sow and 20% barrow/boar) were selected from the municipalities of Balilihan, Bilar, Talibon, Ubay, Loon, Guindulman, Mabini, San Miguel, Pilar, and Alburquerque, which are densely populated with native pigs (based on the data of the Office of the Provincial Veterinarian-Bohol). Purposive sampling was used to select the experimental pigs based on the phenotypic traits that qualify them as native. Likewise, remote barangays where native pigs are most likely raised were selected as sample sites. The qualitative (hair color, color pattern, and ear orientation) and quantitative (tail length, teat number, estimated body weight using body length, and heart girth measurements) traits were recorded based on subjective observation and actual measurements, respectively. Qualitatively, the native pigs in Bohol have predominantly (73%) black hair. In terms of color pattern, plain color (91%), spotted (4%), and patchy (5%) were noted. The native pigs also revealed droopy (54%), slightly droopy (37%), and erect (9%) ear orientations. Meanwhile, quantitative traits revealed an overall body length of 38.07 ± 8.75 inches, heart girth of 36.9 ± 8.83 inches, body weight of 67.29 ± 41.15 kg, tail length of 9.78 ± 2.45 inches, and 12.38 ± 1.33number of teats. Significant differences across sampling areas(p<0.05)and sex (p<0.01) were observed. Generally, females had higher values than males, and there was a significant difference (p<0.05) in trait values among age groups.
26
Malhotra, A., N. Jaiswal, A. K. Malakar, M. S. Verma, H. R. Singh, W. S. Lakra, S. K. Malhotra, and S. Shamsi. "The morphology and genetic characterization of Iheringascaris goai n. sp. (Nematoda: Raphidascarididae) from the intestine of the silver whiting and spotted catfish off the central west coast of India." Journal of Helminthology 86, no. 3 (August 17, 2011): 353–62. http://dx.doi.org/10.1017/s0022149x11000472.
Full textAbstract:
AbstractIn this study a new species of nematode, Iheringascaris goai n. sp., is reported from two fish hosts, including silver whiting, Sillago sihama, and spotted catfish, Arius maculatus, caught off the Central West Coast of India at Goa. The new species can be differentiated morphologically from I. inquies, the most closely related species collected from cohabiting marine fish. The distinguishing characteristics are distinct cuticular striations, a unilateral excretory system, the presence of dentigerous ridges on the inner margin of the lips and the ratio of oesophagus to body length. In males, the ratio of spicules to body length is higher and the number of pre-anal papillae is less in comparison to those in I. inquies. In addition, the tail curves ventrad in males, while in females, the vulva is post-equatorial. The sequence alignment of 18S rDNA and cytochrome c oxidase subunit I with sequences of known species selected from the same superfamily shows a significant difference. The morphological and molecular differences reported here can, therefore, be used to assign the specimen to a new species.
27
Lambert, Frank R. "Some key sites and significant records of birds in the Philippines and Sabah." Bird Conservation International 3, no. 4 (December 1993): 281–97. http://dx.doi.org/10.1017/s0959270900002562.
Full textAbstract:
SummaryBetween June 1989 and October 1990 casual records of rare birds were made in Sabah and on Sipadan Island, Malaysia, and on Luzon, Negros, Bohol and Mindanao, Philippines, with additional observations on Palawan and Tawitawi, Philippines, in August and September 1991. Key sites for bird conservation profiled here are the Angat watershed, Quezon National Park and Candaba Marsh (all on Luzon), Mt Canlaon (Negros), Rajah Sukituna National Park (Bohol), Mt Katanglad (Mindanao), remaining forest on both Tawitawi and Sipadan, and the Danum Valley in Sabah. Notes are provided on 31 species of bird, 17 already considered threatened, three near-threatened. While one threatened species (Nicobar Pigeon Caloenas nicobarica) should be downlisted, at least six species (Spotted Imperial-pigeon Ducula carola, Blue-winged Racquet-tail Prioniturus verticalis, Blue-naped Parrot Tanygnathus lucionensis, McGregor's Cuckoo-shrike Coracina mcgregori, Falcated Wren-babbler Ptilocichla falcata and Palawan Flycatcher Ficedula platenae) should be elevated to threatened status. Records for other species supplement and reinforce current assessments of threat or indicate new distributional or taxonomic information on non-threatened forms.
28
Konte, A. F. "GENETIC VARIABILITY OF CONSTITUTION ASSESSMENT OF FIRST-CALF COWS OF HOLSTEIN BLACK-SPOTTED BREED OF DIFFERENT LINES." Vestnik of Ulyanovsk state agricultural academy 230 (September 25, 2021): 191–99. http://dx.doi.org/10.18286/1816-4501-2021-3-191-199.
Full textAbstract:
Exterior assessment is important for specification of constitutional strength of an individual animal and its acclimatization ability, as well as its productive orientation. The object of our research was Holstein first-calf heifers of the black-and-white breed prevailing on the farms of Moscow region. Studies were conducted with application of linear estimation of the animal body type of 54,170 animals. Animals are divided into 5 groups depending on the lineage: Vis Back Ideal 1013415, Reflection Sovering 198998, Pabst Governer 882933, Montvik Chieftain 95679 and other lines. Most of the animals had parameters in the range of 4 ... 6 points. With greater reliability (p≤0.001) and in the course of the dispersion analysis, it was found that it affects the rump bone height, position of the quarters, the height of the back lobes, the length of the nipples, the width of the quarters and the angle of the back legs from the side (p≤0.01). The heritability of the rump bone height (0.27 ... 0.38) and milk type (0.16 ... 0.36) in almost of all studied lines was within moderate limits. A high occurrence of such constitutional defects as soft ankles (4.16 ... 13%), oblique udder bottom (1.78 ... 5.02%), high tail (2.75 ... 8.07%) and roof-like quarters (1.08 ... 3.77%) was noted in such lines of first-calf heifers as Vis Back Ideal 1013415, Reflection Sovering 198998 and Montvik Chieftain 95679. Animals of all the studied groups have high genetic correlations between the rump bone height and other parameters of constitutional assessment: Montvik Chieftain line has 95679 positive pairs 8 ( 0.63 ± 0.0032 ... 0.97 ± 0.0005) and 5 negative pairs (-0.66 ± 0.0041 ... -0.97 ± 0.0045); Vis Back Ideal 1013415 - 2 positive pairs (0.48 ± 0.0007... 0.66 ± 0.0006); Reflection Sovering 198998 - 4 positive pairs (0.41 ± 0.0009 ... 0.62 ± 0.0007); Pabst Governer 882933 - 3 positive (0.55 ± 0.0092 ... 0.74 ± 0.0071) and 2 negative pairs (-0.62 ± 0.0174). The obtained results reveal wide selection possibilities in dairy herds.
29
Zhong, Chaoyue, Yuhao Tao, Meifeng Liu, Xi Wu, Yang Yang, Tong Wang, Zining Meng, Hongyan Xu, and Xiaochun Liu. "Establishment of a Spermatogonial Stem Cell Line with Potential of Meiosis in a Hermaphroditic Fish, Epinephelus coioides." Cells 11, no. 18 (September 14, 2022): 2868. http://dx.doi.org/10.3390/cells11182868.
Full textAbstract:
Spermatogonial stem cells (SSCs) are unique adult stem cells capable of self-renewal and differentiation into sperm. Grouper is a protogynous hermaphroditic fish farmed widely in the tropical and subtropical seas. In this study, we established an SSC line derived from adult testis of orange-spotted grouper, Epinephelus coioides. In the presence of basic fibroblast growth factor (bFGF) and leukemia inhibitory factor (LIF), the cells could be maintained with proliferation and self-renewal over 20 months and 120 passages under in vitro culture conditions. The cells exhibited strong alkaline phosphatase activity and the characteristics of SSCs with the expression of germ cell markers, including Vasa, Dazl, and Plzf, as well as the stem cell markers Nanog, Oct4, and Ssea1. Furthermore, the cultured cells could be induced by 11-ketotestosterone treatment to highly express the meiotic markers Rec8, Sycp3, and Dmc1, and produce some spherical cells, and even sperm-like cells with a tail. The findings of this study suggested that the cultured grouper SSC line would serve as an excellent tool to study the molecular mechanisms behind SSCs self-renewal and differentiation, meiosis during spermatogenesis, and sex reversal in hermaphroditic vertebrates. Moreover, this SSC line has great application value in grouper fish aquaculture, such as germ cell transplantation, genetic manipulation, and disease research.
30
Chusna, R. Q., Y. F. Ramadhan, G. T. Fadhilah, A. T. Warman, D. Maharani, B. A. Atmoko, and E. Baliarti. "The difference in qualitative characteristics between Simmental-Bali (SIMBAL) crossed cows and Bali cows in West Nusa Tenggara, Indonesia." IOP Conference Series: Earth and Environmental Science 1114, no. 1 (December 1, 2022): 012059. http://dx.doi.org/10.1088/1755-1315/1114/1/012059.
Full textAbstract:
Abstract The research was conducted to explore the difference in qualitative characteristics between Simmental-Bali (SimBal) crossed cows and Bali cows. Research was done in Lombok Tengah Regency, West Nusa Tenggara Indonesia. The material used in this research was 60 cows consisting of 30 Bali and 30 Simmental-Bali crossed cows, about 2.5 years old. This research was carried out by direct observation. The cows used to belong to the farmers, kept by each owner intensively in a stall. Qualitative characteristics were analyzed descriptively and presented in percentages. The results show that Simmental-Bali crossed cows had different exterior characteristics from Bali cows. Among others, the body was dominant in brick red to dark brown, the legs were brown, the muzzle was pink spotted in black, the buttock was light brown, the tail hair was brown, the face vector was white, and the horn was upwards. It is concluded that Simmental-Bali (Simbal) crossed cows and Bali cows have different qualitative characteristics. This difference in qualitative properties does not become a problem for farmers in West Nusa Tenggara, so the cross-program using an exotic straw that has qualitative properties different from pure Bali cattle in the future can be continued.
31
Rahman, Md Imtiaz, Md Sadiqul Islam, Md Saddam Hossain, Md Ripon Ali, Bipresh Das, Mohammad Amzad Hossain, and Mohammed Mahbub Iqbal. "INDUCED SPAWNING AND LARVAL DEVELOPMENT OF VIETNAMESE KOI, Anabas testudineus (Bloch, 1792), USING SALMON GONADOTROPIN RELEASING HORMONE ANALOGUE (S-GnRHA)." Indonesian Aquaculture Journal 16, no. 1 (June 26, 2021): 21. http://dx.doi.org/10.15578/iaj.16.1.2021.21-27.
Full textAbstract:
The present research work has been carried out to obtain evidence on breeding and embryonic growth of A. testudineus by using S-GnRHa. Fish were injected with three different doses (0.25, 0.5, and 1.0 mL/kg body weight) of synthetic hormone S-GnRHa each with three replications, where male brood fish received half of the doses of female. The fecundity of A. testudineus was ranged from 47,227 to 77,561 during the study period and except control group all the hormone received group ovulated within 12 hours of hormone injection. Among all groups, the highest fertilization rate (89.33%), highest hatching rate (79.5%) as well as highest survival rate (67.0%) was obtained at 0.5 mL/kg body weight hormone dose recipient group. The fertilized egg’s diameter was recorded as 77.59 ± 3.50 µm. The first cleavage had appeared within 18-25 min of fertilization and eventually the morula, blastula, and gastrula stages were observed at 3:10 h, 4 h, and 5:30 h, respectively after fertilization. Larvae with distinguished head, body form and tail appendage spotted between 17-22 h and the larvae started hatching at 19 h after fertilization. The average length of larvae accounted as 105.41 ± 3.73 µm. The findings of present study revealed that 0.5 mL/kg S-GnRHa could be efficient dose for successful induced breeding of A. testudineus.
32
Cruciani, Véronique, and Svein-Ole Mikalsen. "Evolutionary selection pressure and family relationships among connexin genes." Biological Chemistry 388, no. 3 (March 1, 2007): 253–64. http://dx.doi.org/10.1515/bc.2007.028.
Full textAbstract:
Abstract We suggest an extension of connexin orthology relationships across the major vertebrate lineages. We first show that the conserved domains of mammalian connexins (encoding the N-terminus, four transmembrane domains and two extracellular loops) are subjected to a considerably more strict selection pressure than the full-length sequences or the variable domains (the intracellular loop and C-terminal tail). Therefore, the conserved domains are more useful for the study of family relationships over larger evolutionary distances. The conserved domains of connexins were collected from chicken, Xenopus tropicalis, zebrafish, pufferfish, green spotted pufferfish, Ciona intestinalis and Halocynthia pyriformis (two tunicates). A total of 305 connexin sequences were included in this analysis. Phylogenetic trees were constructed, from which the orthologies and the presumed evolutionary relationships between the sequences were deduced. The tunicate connexins studied had the closest, but still distant, relationships to vertebrate connexin36, 39.2, 43.4, 45 and 47. The main structure in the connexin family known from mammals pre-dates the divergence of bony fishes, but some additional losses and gains of connexin sequences have occurred in the evolutionary lineages of subsequent vertebrates. Thus, the connexin gene family probably originated in the early evolution of chordates, and underwent major restructuring with regard to gene and subfamily structures (including the number of genes in each subfamily) during early vertebrate evolution.
33
IVANEK, RENATA, YRJÖ T. GRÖHN, MARTIN T. WELLS, SARITA RAENGPRADUB, MARK J. KAZMIERCZAK, and MARTIN WIEDMANN. "Extreme value theory in analysis of differential expression in microarrays where either only up- or down-regulated genes are relevant or expected." Genetics Research 90, no. 4 (August 2008): 347–61. http://dx.doi.org/10.1017/s0016672308009427.
Full textAbstract:
SummaryWe propose an empirical Bayes method based on the extreme value theory (EVT) (BE) for the analysis of data from spotted microarrays where the interest of the investigator (e.g. to identify up-regulated gene markers of a disease) or the design of the experiment (e.g. in certain ‘wild-type versus mutant’ experiments) limits identification of differentially expressed genes to those regulated in a single direction (either up or down). In such experiments, unlike in genome-wide microarrays, analysis is restricted to the tail of the distribution (extremes) of all the genes in the genome. The EVT provides a platform to account for this extreme behaviour, and is therefore a natural candidate for inference about differential expression. We compared the performance of the developed BE method with two other empirical Bayes methods on two real ‘wild-type versus mutant’ datasets where a single direction of regulation was expected due to experimental design, and in a simulation study. The BE method appears to have a better fit to the real data. In the analysis of simulated data, the BE method showed better accuracy and precision while being robust to different characteristics of microarray experiments. The BE method, therefore, seems promising and useful for inference about differential expression in microarrays where either only up- or down-regulated genes are relevant or expected.
34
Wilhelm, Jochen, Jai Prakash Muyal, Johannes Best, Grazyna Kwapiszewska, Maria Magdalena Stein, Werner Seeger, Rainer Maria Bohle, and Ludger Fink. "Systematic Comparison of the T7-IVT and SMART-Based RNA Preamplification Techniques for DNA Microarray Experiments." Clinical Chemistry 52, no. 6 (June 1, 2006): 1161–67. http://dx.doi.org/10.1373/clinchem.2005.062406.
Full textAbstract:
Abstract Background: Small biological samples obtained from biopsies or laser microdissection often do not yield sufficient RNA for successful microarray hybridization; therefore, RNA amplification is performed before microarray experiments. We compared 2 commonly used techniques for RNA amplification. Methods: We compared 2 commercially available methods, Arcturus RiboAmp for in vitro transcription (IVT) and Clontech BD SMART™ for PCR, to preamplify 50 ng of total RNA isolated from mouse livers and kidneys. Amplification factors of 3 sequences were determined by real-time PCR. Differential expression profiles were compared within and between techniques as well as with unamplified samples with 10K 50mer oligomer-spotted microarrays (MWG Biotech). The microarray results were validated on the transcript and protein levels by comparison with public expression databases. Results: Amplification factors for specific sequences were lower after 2 rounds of IVT than after 12 cycles of SMART. Furthermore, IVT showed a clear decrease in amplification with increasing distance of the amplified sequences from the polyA tail, indicating generation of smaller products. In the microarray experiments, reproducibility of the duplicates was highest after SMART. In addition, SMART-processed samples showed higher correlation when compared with unamplified samples as well as with expression databases. Conclusions: Whenever 1 round of T7-IVT does not yield sufficient product for microarray hybridization, which is usually the case when <200 ng of total RNA is used as starting material, we suggest the use of SMART PCR for preamplification.
35
Girma, Endalkachew, Kefyalew Alemayehu, Solomon Abegaze, and Damitie Kebede. "Phenotypic characterization, population structure, breeding management and recommend breeding strategy for Fogera cattle (Bos indicus) in Northwestern Amhara, Ethiopia." Animal Genetic Resources/Ressources génétiques animales/Recursos genéticos animales 58 (April 6, 2016): 13–29. http://dx.doi.org/10.1017/s2078633616000035.
Full textAbstract:
SummaryThe study was carried out in selected districts in the Northwestern Amhara, from October 2012 to May 2013. The objective of the study were to undertake on-farm and on-station phenotypic characterization of Fogera Cattle in comparison with two different local cattle population, to characterize the population structure and to identifying trait preferences, breeding management and to recommend breeding strategy for Fogera cattle. Both purposive and random samplings were employed. Data were gathered through semi-structured questionnaire, focus group discussions, field observations, census data, direct count and body measurements. About 126 smallholder farmers were interviewed. About 21 quantitative and 17 qualitative phenotypic data types were also generated from 332 cattle. The Effective population size (Ne) and rate of inbreeding (ΔF) were calculated from the counted population structure data. Both GLM procedures of SAS and descriptive statistics of SPSS software's were employed for data analyses. The results indicated that Fogera cattle were kept mostly for milk (97.62 percent). The main threats identified for the survival of Fogera cattle were scarcity of feed resources and interbreeding with other indigenous cattle, which are less demanding in terms of feed. Fogera cattle population has specific morphological appearance. Generally about 65.2 percent of male pure-Fogera cattle population are having large hump and large dewlap (93.5 percent) with cervico-thoracic (82.6 percent) hump position and long tail (97.8 percent), respectively. The coat pattern of male pure-Fogera cattle is dominated by the spotted coat pattern (82.6 percent) with 43.5 percent white black and 39.1 percent black white coat colour. Female Fogera cattle have medium (94.4 percent) hump size at cervico-thoracic positions (73.2 percent), large dewlap (62.7 percent) and long tail which is well below the hock (91.5 percent). The coat pattern of female pure-Fogera cattle is dominated by white spotted (80.3 percent) with 43.0 percent white black and 33.1 percent black white coat colour Most of the quantitative traits were highly significantly (P≤ 0.001) affected by breed type. Except horn length and horn space all of quantitative traits for both sexes of pure-Fogera cattle from on-station were significantly (P≤ 0.05) larger than those of the on-farm. The average linear body measurement taken on a total of 46 male pure-Fogera cattle populations were 42.68 ± 0.56 cm (mouth circumference), 16.35 ± 0.72 cm (horn length), 37.04 ± 1.16 cm (dewlap width) and 129.17 ± 1.33 cm (height at wither). The average linear body measurements for female pure-Fogera cattle were 38.23 ± 0.18 cm (mouth circumference), 13.81 ± 0.37 cm (horn length), 27.20 ± 0.42 cm (dewlap width) and 123.68 ± 0.52 cm (height at wither). The population structure were dominated by Pure-Fogera constituting 37.02 percent, Interbred with Fogera (33.71 percent) and non-Fogera (29.23 percent). The effective population size of pure-Fogera cattle was 4295, with 9016 total population. The average inbreeding level for the population was 0.012 percent. Inbreeding is at a low level and the effective population size is large. The calculated parameters indicate satisfactory genetic diversity in Fogera cattle. Milk yield, colour, power, body size and growth rate of Fogera were the most dominant traits perceived to be good by the respondents. The special qualification of this breed is to live at high amount of flooding areas with adapting other very challenging environment. Pure breeding of pure-Fogera, interbred with Fogera and non-Fogera type of breeds was used for breeding practice with natural mating. The Andassa Research Center established in 1964 as Fogera cattle population improving centre, but according to different source, population viability and population structure indicated that the population are not viable and highly admixture with other indigenous cattle breeds. According to this in order to improve the population status of Fogera cattle we recommended control with open-nucleus breeding strategy. So in order to minimize the risk status of this breed and conserve for the future generation any responsible agent should be given priority.
36
Baeckens, Simon, Tess Driessens, and Raoul Van Damme. "The brown anole dewlap revisited: do predation pressure, sexual selection, and species recognition shape among-population signal diversity?" PeerJ 6 (May 8, 2018): e4722. http://dx.doi.org/10.7717/peerj.4722.
Full textAbstract:
Animal signalling structures are amongst the most variable characteristics, as they are subjected to a diversity of selection pressures. A well-known example of a diverse signalling system in the animal kingdom is the dewlap ofAnolislizards. Dewlap characteristics can vary remarkably among and within species, and also between sexes. Although a considerable amount of studies have attempted to disentangle the functional significance of the staggering dewlap diversity inAnolis, the underlying evolutionary processes remain elusive. In this study, we focus on the contribution of biotic selective pressures in shaping geographic variation in dewlap design (size, colour, and pattern) and dewlap display behaviour at the intraspecific level. Notably, we have tried to replicate and extend previously reported results hereof in both sexes of the brown anole lizard (Anolis sagrei). To do this, we assembled a dataset consisting of 17A. sagreiheterogeneous island populations from the Caribbean and specifically tested whether predation pressure, sexual selection, or species recognition could explain interpopulational variation in an array of dewlap characteristics. Our findings show that in neither males nor females estimates of predation pressure (island size, tail break frequency, model attack rate, presence of predatoryLeiocephaluslizards) or sexual selection (sexual size dimorphism) could explain variation in dewlap design. We did find thatA. sagreimales from larger islands showed higher dewlap display intensities than males from smaller islands, but the direct connection with predation pressure remains ambiguous and demands further investigation. Last, we could show indirect support for species recognition only in males, as they are more likely to have a ‘spotted’ dewlap pattern when co-occurring with a higher number of syntopicAnolisspecies. In conclusion, we found overall limited support for the idea that the extensive interpopulational variability in dewlap design and use inA. sagreiis mediated by variation in their biotic environment. We propose a variety of conceptual and methodological explanations for this unexpected finding.
37
Vij, P. K., M. S. Tantia, and R. K. Vijh. "Characterization of Punjab Brown chicken." Animal Genetic Resources Information 39 (April 2006): 65–76. http://dx.doi.org/10.1017/s1014233900002145.
Full textAbstract:
SummaryA survey was conducted in the native tract of the Punjab Brown breed of chicken to study management practices, as well as morphological, performance and egg quality parameters. The study covered the three districts of Gurdaspur district in Punjab, and Ambala and Yamunanagar districts in Haryana, and included 532 birds and 61 families. Twenty-six microsatellite loci were used to assess genetic variability. The Punjab Brown is a multi-purpose breed, yielding good quality meat and eggs. Birds are reared in the backyard system and shelter is provided only during the night in the form of small enclosures mostly made up of mud and sometimes of wood. Average flock size is 8.7. Plumage colour is mostly brown and the pattern is usually solid but is sometimes spotted or striped. Males in particular have black spots/stripes on their neck, wings and tail. The comb is red, of single type and erect in position. The average weight of cocks and hens is 2.15±0.94 and 1.57±0.04 kg respectively. Hens start laying eggs at the age of about five to six months. Clutch size is about four to five. Average egg production is around 60–80 eggs per year. Eggshell colour is mostly light brown and average egg weight is 46.0±1.91g. The average weight of shell, albumin and yolk were 5.4±0.21, 24.4±0.63 and 16.2±0.48g respectively. Yolk index, albumin index and Haugh units were 0.41±0.005, 0.10±0.006 and 82.80±0.98 respectively. A total of 218 alleles were observed. The number of alleles per locus varied from 4–14. The mean PIC value for all the loci was 0.744. Twenty-four loci were found to be neutral (P<0.05) using Ewens Watterson test of neutrality. The exact test revealed that 15 loci deviated from Hardy Weinberg Equilibrium. The population has not undergone any recent bottleneck as revealed by quantitative and graphical qualitative tests.
38
Saravanan, Kalaimani, Lisha Jha, John A. J. Prakash, Rajasekar Aruliah, and Ernest David. "Seroprevalence of Scrub Typhus, Spotted Fever, and Murine Typhus in Vellore District, Tamil Nadu (Research Article)." International Journal of Pharmacy and Biological Sciences 11, no. 1 (January 1, 2021): 56–60. http://dx.doi.org/10.21276/ijpbs.2021.11.1.7.
Full text
39
Munderloh, Ulrike G., Stanley F. Hayes, Joel Cummings, and Timothy J. Kurtti. "Microscopy of Spotted Fever Rickettsia Movement through Tick Cells." Microscopy and Microanalysis 4, no. 2 (April 1998): 115–21. http://dx.doi.org/10.1017/s1431927698980096.
Full textAbstract:
Spotted fever group (SFG) rickettsiae are obligate intracellular prokaryotes that include tick-borne pathogens of vertebrates as well as nonpathogenic organisms living in symbiotic association with their tick hosts. We investigated the ability of SFG rickettsiae to move between and within host cells using tick cell culture and a SFG rickettsial isolate from a lone star tick (Amblyomma americanum) collected in Missouri. The isolate (MOAa), which is closely related to Rickettsia montana, grew in cell lines from the ticks Ixodes scapularis and Rhipicephalus appendiculatus. Transmission electron microscopy demonstrated that immediately following entry into tick cells, rickettsiae escaped from the host cell membrane, and intracellular rickettsiae came to lie in direct contact with host-cell cytoplasm. There was evidence of damage to the endoplasmic reticulum membrane which was broken down into vesicular structures. When rickettsiae exited host cells, host membrane stretched around them but was lost before re-entry. Use of a fluorescein-tagged monoclonal antibody to rickettsial outer membrane protein B and rhodamine-labeled phalloidin demonstrated association of actin tails with rickettsiae and suggested that SFG rickettsiae utilized host cytoskeletal components for movement. During early stages of infection, when cells harbored only one or a few organisms, “comet tails” of F-actin formed on one end of rickettsial cells, presumably pushing them ahead. Actin tails were not seen during later stages of infection when tick cells became completely filled with rickettsiae.
40
Gillis, A., K. Counsell, A. Julien, R. Marcec, A. Kouba, and C. Vance. "23 Viability staining techniques for cryopreserved spermatozoa in 3 caudata species." Reproduction, Fertility and Development 31, no. 1 (2019): 137. http://dx.doi.org/10.1071/rdv31n1ab23.
Full textAbstract:
Salamanders are the most threatened vertebrate taxa; thus, conservation-based research including spermatozoa cryopreservation and other assisted reproductive technologies is essential to their survival. To determine the effectiveness of sperm cryopreservation, methods for evaluating sperm quality are necessary but underdeveloped in caudate research. Evaluating motility has been the primary analysis for sperm viability but is difficult to perform due to the scythe-like morphology, slow rotating progression, and minute undulations of the tail membrane. Estimating apoptosis is a new approach to evaluating caudate spermatozoa survival through cryostress. Fluorescent dyes, such as SYBR-14, annexin-V, and propidium iodide (PI), are valuable tools for identifying degrees of cell viability, apoptosis, and necrosis. Annexin-V marks the externalization of phosphatidylserine on the cell membrane indicating early steps in the apoptosis signalling cascade. Compromised membranes allow PI, a nucleic acid stain, access to DNA, marking cellular necrosis. The SYBR-14 is a nucleic acid stain that permeatesssss intact membranes, labelling live cells. These fluorescent stains were assessed for marking viability and stages of cell death in post-thaw spermatozoa across 3 caudate species: the Eastern tiger salamander (Ambystoma tigrinum), Kweichow Emperor newt (Tylototriton kweichowensis), and black-spotted newt (Notophthalmus meridionalis). For each species, spermic urine samples were acquired by hormone treatment and frozen based on protocols developed in A. tigrinum, yielding an average of 18.2% relative motility recovered at thaw. Straws were thawed for 5min at 20°C. Viability was tested by staining 5μL 1:1 with a 1:50 dilution of SYBR-14 and 2μL of PI. Stages of cell death were evaluated by staining 10μL with 2μL of annexin-V and 2μL of PI. Cell viability was assessed immediately under a fluorescence microscope. For each of the 3 species, 2 samples were stained with both assays in triplicate. Sperm stained with SYBR-14 alone were considered viable, and sperm stained with any annexin-V or PI were considered not viable. Visible dynamic shifting from SYBR-14 to PI staining was observed in real time, indicating rapid necrosis. Morphological abnormalities, not observed in unstained samples, were prevalent across all species following staining, signifying a possible cytotoxic effect of the dyes. High mortality and abnormality rates suggest that fluorescent dyes have elevated toxicity and permeability in caudate sperm. Caudate spermic urine has a very low osmolality, implying high permeability, which could lead to rapid staining and toxicity effects. Shorter incubation times may be required for accurate staining. Results may also indicate that cryopreservation protocols need to be species specific and do not transfer well across taxa. This is one of the earliest studies to evaluate the use of fluorescent stain protocols on measuring cell viability in caudate sperm and indicates that further refinement is required.
41
Grančič, Peter, and Daniel Tunega. "Hydrophobicity and Charge Distribution Effects in the Formation of Bioorganoclays." Minerals 11, no. 10 (October 8, 2021): 1102. http://dx.doi.org/10.3390/min11101102.
Full textAbstract:
Interactions of bioorganic moieties with clay minerals have attracted attention not only from the perspective of novel bioclay materials but also because they play a crucial role in our understanding of physical and chemical processes in soils. The aim of the present article is to explore the interactions responsible for the formation of a phosphatidylcholine-kaolinite bioclay by employing a series of classical molecular dynamic simulations. Detailed analysis of the structure and energies of the resulting bioclays reveals that the phosphatidylcholine molecules bind to the kaolinite surface either via their zwitterionic heads or hydrophobic aliphatic tails, depending on the kaolinite surface characteristics and the density of organic coating. The phosphatidylcholine molecules have a tendency to form irregular layers with a preferred parallel orientation of molecules with respect to the kaolinite surface. The tails exhibit varying degrees of flexibility and disorder depending on their distance from the surface and the density of surface coating. Significant differences in the binding can be spotted with respect to the two types of kaolinite basal surfaces, i.e., the hydrophobic siloxane surface, which possesses a considerable dispersion character, and the hydrophilic alumina surface, polarized by the surface hydroxyl groups.
42
Ye, W., Y. Zeng, and J. Kerns. "First Report of Trichodorus obtusus on Turfgrass in North Carolina, U.S.A." Plant Disease 99, no. 2 (February 2015): 291. http://dx.doi.org/10.1094/pdis-08-14-0830-pdn.
Full textAbstract:
In May 2014, 11 sandy soil samples were collected at a depth of about 5 to 15 cm from a golf course community in Wilmington, NC, composed of Bermudagrass (Cynodon dactylon) from the fairway, St. Augustinegrass (Stenotaphrum secundatum) from the lawn, and Zoysiagrass (Zoysia japonica) from the tee, all of which showed spotted yellowing and necrosis. Plant-parasitic nematodes were extracted from soil samples by a combination of elutriation and sugar centrifugal-flotation methods at the North Carolina Department of Agriculture and Consumer Services, Nematode Assay Lab, Raleigh, NC. The results revealed the presence of several plant-parasitic nematodes, with a stubby-root nematode (Trichodoridae) present. Population densities of stubby-root nematodes were 10 to 90 (average 50) nematodes per 500 cm3 of soil. This species was clearly different from the parthenogenetic stubby-root nematode Nanidorus minor (Colbran, 1956) Siddiqi, 1974 commonly found in North Carolina because of the presence of males and larger body size. Morphological and molecular analyses of this nematode identified the species as Trichodorus obtusus Cobb, 1913. Morphological features of T. obtusus specimens were examined in glycerol permanent mounts. Males (n = 5) had a ventrally curved spicule, three ventromedian precloacal papillae (one ventromedian cervical papilla anterior to the excretory pore, one pair of lateral cervical pores at the level of the ventromedian cervical papilla), and a tail with a non-thickened terminal cuticle. Males were 860 to 1,120 (average 1,018) μm long, body width 38 to 48 (42) μm, onchiostyle 53 to 60 (56) μm, and spicule 54 to 62 (59) μm. Females (n = 5) had a pore-like vulva, a barrel-shaped vagina, and one or two postadvulvar lateral body pores on each side. Females were 990 to 1,330 (1,148) μm long, body width 43 to 56 (48) μm, onchiostyle 50 to 64 (58) μm, and V 49.0 to 57.5% (53.0%). The morphology agreed with the description of T. obtusus (2). DNA was prepared by squashing a single nematode (n = 3) on a microscope slide and collecting in 50 μl of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0). The 18S rDNA region was amplified with the forward primers 18S-G18S4 (5′ GCTTGTCTCAAAGATTAAGCC 3′), SSUF07 (AAAGATTAAGCCATGCATG), and 18S965 (GGCGATCAGATACCGCCCTAGTT) and reverse primers 18S-18P (TGATCCWKCYGCAGGTTCAC), SSUR26 (CATTCTTGGCAAATGCTTTCG), and 18S1573R (TACAAAGGGCAGGGACGTAAT). The 28S D2/D3 region was amplified with the forward primer 28S391a (AGCGGAGGAAAAGAAACTAA) and reverse primer 28S501 (TCGGAAGGAACCAGCTACTA) (4). The resulting 18S (1,547-bp) and 28S D2/D3 (925-bp) sequences were deposited in GenBank under the accession numbers KM276665 and KM276666. The 18S sequence data was 100% homologous with two populations of T. obtusus (JX279930, 898 bp, and JX289834, 897 bp) from South Carolina and one (AY146460, 634 bp) from an unknown source, each with a 1-bp difference in a Blastn search. The 28S D2/D3 sequence data was less than 90% homologous with many Trichodorus species, but no T. obtusus sequence data was available. T. obtusus is known to occur only in the United States and to damage turfgrasses. It is reported in the states of Virginia, Florida, South Carolina, Texas, Iowa, Kansas, Michigan, New York, and South Dakota. This nematode has been reported as a pathogen of bermudagrass in Florida (1) and South Carolina (3), but pathogenicity to St. Augustinegrass and Zoysiagrass is unknown. To our knowledge, this is the first report of T. obtusus on turfgrasses in North Carolina. References: (1) W. T. Crow and J. K. Welch. Nematropica 34:31, 2004. (2) W. Decraemer. The Family Trichodoridae: Stubby Root and Virus Vector Nematodes. Kluwer Academic Publishers, Dordrecht, The Netherlands, 1995. (3) J. B. Shaver et al. Plant Dis. 97:852, 2013. (4) G. R. Stirling et al. Nematology 15:401, 2013.
43
De Oliveira, Ricardo Santos. "Prof. James Tait Goodrich 1946 - 2020+." Archives of Pediatric Neurosurgery 2, no. 2(May-August) (June 18, 2020): e472020. http://dx.doi.org/10.46900/apn.v2i2(may-august).47.
Full textAbstract:
James Tait Goodrich was born on April 16, 1946 in Portland, Oregon, United States, the son of Richard Goodrich and Gail (Josselyn) Goodrich. Dr. Goodrich served as a Marine officer during the Vietnam War, during which time he decided his next step would be to pursue a medical career. Not only was he an elite surgeon, but over the years he was also a generous mentor and teacher who shared his craft with many young surgeons who wanted to follow in his footsteps. During the Tet Offensive, he spotted a Vietnamese surgeon in a medical tent opening up a soldier’s head. “Cool,” he thought. “I want to do that” (1). Upon return to the USA, Jim married Judy Loudin on December 27, 1970, the love of his life who gave him the confidence and support to pursue his dreams. Dr. Goodrich completed his undergraduate work at the University of California, Irvine and his graduate studies at the School of Arts and Sciences of Columbia University (1972), receiving his Masters and Doctor of Philosophy degrees in 1978 and 1980, respectively. He received his Medical Degree from Columbia University College of Physicians and Surgeons. After an internship at Columbia- Presbyterian Medical Center (1980-1981), he completed his residency training at the Presbyterian Hospital in New York City and the New York Neurological Institute (1981-1986). He also holds the rank of Professor Contralto of Neurological Surgery at the University of Palermo in Palermo, Italy. He was Director of the Division of Pediatric Neurosurgery at the Children’s Hospital of Montefiore Health System and he served as a Professor of Clinical Neurological Surgery, Pediatrics, Plastic and Reconstructive Surgery at the Albert Einstein College of Medicine since 1998 (2). Dr. James T. Goodrich dedicated his life to saving children with complex neurological conditions. He had a particular interest in the treatment of craniofacial abnormalities. He was a pioneer in this field and developed a multi-stage approach for separating craniopagus twins who have their brain and skull conjoined. In 2016, he famously led a team of 40 doctors in a 27-hour procedure to separate the McDonald twins. Throughout his distinguished career, he became known as the world’s leading expert on this lifesaving procedure. He has been consulted on hundreds of cases, and he routinely traveled the world sharing his vast knowledge and expertise with colleagues (3,4). In Brazil, Dr. Goodrich played a very important role in leading the processes to successfully separate craniopagus sets in Ribeirao Preto (2017-2018), and in Brasilia (2019). A classical multistage surgery was performed to separate the Ribeirao Preto conjoined twins, and Dr. Goodrich participated on all the neurosurgical procedures as a great mentor. In the final operation, on October 28, 2019, some members of Montefiore Hospital medical staff (Dr. Oren Tepper, plastic surgeon, Dr. Carlene Broderick, pediatric anesthesiologist and Kamilah A. Dowling, nurse) also worked alongside Jim and the Brazilian team. An extraordinary and humble man, his words after the first surgical step, during an interview for a TV channel, were that in “this particular surgery we were able to do more than we expected because the anatomy was very good and the team had exceptional skills that made the difference”. Dr. Goodrich was a chief supporter of the Latin American Pediatric Neurosurgery Course (LACPN), having participated in all editions since 2004. In these events, he did not hesitate to share his knowledge during the hands-on sessions and, likewise, his wonderful conferences. Prof. Goodrich was officially honored by the Brazilian Society for Pediatric Neurosurgery during the “XII Brazilian Congress of Pediatric Neurosurgery”, in Florianopolis, Brazil. Dr. Goodrich was a gentle and truly caring man. He did not crave the limelight and was beloved by his colleagues and staff. He has authored numerous book chapters and articles on Pediatric Neurosurgery and is known worldwide as a prominent lecturer in this field. Outside his work, he was also known for his passion for historical artifacts, travelling, wine, and surfing. Dr. Goodrich was an incredible human being. In March 30th, 2020, he passed away after complications due to Covid-19 (5). In that day the world has become a little less bright without Jim. Our sympathy and prayers go to his wife Judy, his three sisters, and all those who were close to him
44
Simser, Jason A., Ann T. Palmer, Volker Fingerle, Bettina Wilske, Timothy J. Kurtti, and Ulrike G. Munderloh. "Rickettsia monacensis sp. nov., a Spotted Fever Group Rickettsia, from Ticks (Ixodes ricinus) Collected in a European City Park." Applied and Environmental Microbiology 68, no. 9 (September 2002): 4559–66. http://dx.doi.org/10.1128/aem.68.9.4559-4566.2002.
Full textAbstract:
ABSTRACT We describe the isolation and characterization of Rickettsia monacensis sp. nov. (type strain, IrR/MunichT) from an Ixodes ricinus tick collected in a city park, the English Garden in Munich, Germany. Rickettsiae were propagated in vitro with Ixodes scapularis cell line ISE6. BLAST analysis of the 16S rRNA, the citrate synthase, and the partial 190-kDa rickettsial outer membrane protein A (rOmpA) gene sequences demonstrated that the isolate was a spotted fever group (SFG) rickettsia closely related to several yet-to-be-cultivated rickettsiae associated with I. ricinus. Phylogenetic analysis of partial rompA sequences demonstrated that the isolate was genotypically different from other validated species of SFG rickettsiae. R. monacensis also replicated in cell lines derived from the ticks I. ricinus (IRE11) and Dermacentor andersoni (DAE100) and in the mammalian cell lines L-929 and Vero, causing cell lysis. Transmission electron microscopy of infected ISE6 and Vero cells showed rickettsiae within the cytoplasm, pseudopodia, nuclei, and vacuoles. Hamsters inoculated with R. monacensis had immunoglobulin G antibody titers as high as 1:16,384, as determined by indirect immunofluorescence assay. Western blot analyses demonstrated that the hamster sera cross-reacted with peptides from other phylogenetically distinct rickettsiae, including rOmpA. R. monacensis induced actin tails in both tick and mammalian cells similar to those reported for R. rickettsii. R. monacensis joins a growing list of SFG rickettsiae that colonize ticks but whose infectivity and pathogenicity for vertebrates are unknown.
45
Baldridge, Gerald D., Nicole Burkhardt, Michael J. Herron, Timothy J. Kurtti, and Ulrike G. Munderloh. "Analysis of Fluorescent Protein Expression in Transformants of Rickettsia monacensis, an Obligate Intracellular Tick Symbiont." Applied and Environmental Microbiology 71, no. 4 (April 2005): 2095–105. http://dx.doi.org/10.1128/aem.71.4.2095-2105.2005.
Full textAbstract:
ABSTRACT We developed and applied transposon-based transformation vectors for molecular manipulation and analysis of spotted fever group rickettsiae, which are obligate intracellular bacteria that infect ticks and, in some cases, mammals. Using the Epicentre EZ::TN transposon system, we designed transposons for simultaneous expression of a reporter gene and a chloramphenicol acetyltransferase (CAT) resistance marker. Transposomes (transposon-transposase complexes) were electroporated into Rickettsia monacensis, a rickettsial symbiont isolated from the tick Ixodes ricinus. Each transposon contained an expression cassette consisting of the rickettsial ompA promoter and a green fluorescent protein (GFP) reporter gene (GFPuv) or the ompB promoter and a red fluorescent protein reporter gene (DsRed2), followed by the ompA transcription terminator and a second ompA promoter CAT gene cassette. Selection with chloramphenicol gave rise to rickettsial populations with chromosomally integrated single-copy transposons as determined by PCR, Southern blotting, and sequence analysis. Reverse transcription-PCR and Northern blots demonstrated transcription of all three genes. GFPuv transformant rickettsiae exhibited strong fluorescence in individual cells, but DsRed2 transformants did not. Western blots confirmed expression of GFPuv in R. monacensis and in Escherichia coli, but DsRed2 was expressed only in E. coli. The DsRed2 gene, but not the GFPuv gene, contains many GC-rich amino acid codons that are rare in the preferred codon suite of rickettsiae, possibly explaining the failure to express DsRed2 protein in R. monacensis. We demonstrated that our vectors provide a means to study rickettsia-host cell interactions by visualizing GFPuv-fluorescent R. monacensis associated with actin tails in tick host cells.
46
THEAKSTON, ANNA L. "“The spotty cow tickled the pig with a curly tail”: How do sentence position, preferred argument structure, and referential complexity affect children's and adults’ choice of referring expression?" Applied Psycholinguistics 33, no. 4 (August 8, 2011): 691–724. http://dx.doi.org/10.1017/s0142716411000531.
Full textAbstract:
ABSTRACTIn this study, 5-year-olds and adults described scenes that differed according to whether (a) the subject or object of a transitive verb represented an accessible or inaccessible referent, consistent or inconsistent with patterns of preferred argument structure, and (b) a simple noun was sufficient to uniquely identify an inaccessible referent. Results showed that although adults did not differ in their choice of referring expression based on sentence position, 5-year-olds were less likely to provide informative referring expressions for subjects than for objects when the referent was inaccessible. In addition, under complex discourse conditions, although adults used complex noun phrases to identify inaccessible referents, 5-year-olds increased their use of pronominal/null reference for both accessible and inaccessible referents, thus reducing their levels of informativeness. The data suggest that 5-year-olds are still learning to integrate their knowledge of discourse features with preferred argument structure patterns, that this is particularly difficult in complex discourse contexts, and that in these contexts children rely on well-rehearsed patterns of argument realization.
47
Meeuwis, Michael. "Taalstrijd in Afrika: Het taalwetsartikel in het koloniaal charter van 1908 en de strijd van de Vlamingen en Afrikaners voor het Nederlands in Afrika tot 1960." WT. Tijdschrift over de geschiedenis van de Vlaamse beweging 75, no. 1 (April 1, 2016): 27–61. http://dx.doi.org/10.21825/wt.v75i1.16392.
Full textAbstract:
Het Koloniaal Charter, de organieke wet die in 1908 de overname van Congo door de Belgische staat uit de privé-handen van Koning Leopold II regelde, bevatte een artikel over taalrechten in de kolonie. Hoewel ook taalrechten voor de Congolezen erin vermeld werden, handelde het artikel in de eerste plaats over taalrechten voor de Belgische koloniserende minderheid. Het artikel is er gekomen op aandringen van enkele Vlaamse parlementsleden tijdens debatten gehouden in de Kamer van Volksvertegenwoordigers in de eerste helft van 1908. In deze bijdrage worden deze debatten besproken om zo de semantiek en taalideologische achtergronden van elk deel van het artikel van een historische verklaring te voorzien. Daarnaast wordt ook belicht hoe niet alleen in 1908 maar ook in de decennia erna (en tot aan de dekolonisatie in 1960), met name telkens wanneer Vlaamse politici de gebrekkige toepassing van het taalwetsartikel en de blijvende dominantie van het Frans in Belgisch-Congo aanklaagden, zij verwijzingen maakten naar de Afrikaners en het Afrikaans in Zuid-Afrika, om zo het argument kracht bij te zetten dat het Nederlands in heel Afrika onder de Sahara een taal van belang was of kon worden. Opmerkelijk is dat ook Zuid-Afrikaanse denkers en politici meermaals naar de aanwezigheid en het officiële statuut van het Nederlands in Belgisch-Congo verwezen, namelijk in hun strijd tegen de dominantie van het Engels tegenover het Nederlands/Afrikaans bij hen. Vanaf 1914 kwamen er bovendien rechtstreekse contacten tussen Vlaamse en Afrikaanse politici over deze materie. In een afsluitend deel wordt aangegeven hoe aan het eind van de Belgische kolonisatie de Congolese elite erg negatief reageerde op de Vlaamse eisen voor een tweetalige kolonie, omdat ze er een kolonialistische rem op hun kansen tot socio-economische emancipatie in zagen.___________
Language Struggle in Africa: The language law article in the Colonial Charter of 1908 and the fight of Flemings and Afrikaners for Dutch in Africa until 1960The Colonial Charter, the organic law that regulated the Belgian state’s takeover of Congo from the private ownership of King Leopold II in 1908, contained an article about language rights in the colony. While language rights for the Congolese were mentioned therein, the article primarily dealt with language rights for the colonizing Belgian minority. The article came about on the insistence of several Flemish members of parliament during debates held in the Chamber of Representatives in the first half of 1908. In this article, these debates are discussed in order to provide a historical explanation for the semantic and language-ideology background for each section of this article of the Charter. In addition, light will be shed on how not only in 1908, but also in the following decades (and until decolonization in 1960), particularly whenever Flemish politicians complained about the spotty application of the article and the continuing dominance of French in Belgian Congo, they pointed to the Afrikaners and Afrikaans in South Africa in order to make a strong argument that Dutch was, or could become, an important language in all of sub-Saharan Africa. Notably, South African thinkers and politicians also pointed out the presence and official status of Dutch in Belgian Congo on several occasions, namely in their own struggle against the domination of English over Dutch/Afrikaans. Moreover, from 1914 onward there were direct contacts between Flemish and Afrikaner politicians concerning this matter. The conclusion of this article suggests that in the last years of Belgian colonialism, the Congolese elite reacted quite negatively to Flemish demands for a bilingual colony because they saw in such demands a colonialist hindrance on their chances for socioeconomic emancipation.
48
Boutin-Bloomberg, Eric. "Spotted Tail: Warrior and Statesman. By Richmond L. Clow." Western Historical Quarterly, May 20, 2020. http://dx.doi.org/10.1093/whq/whaa052.
Full text
49
Nock, Adam M., Tina R. Clark, and Ted Hackstadt. "Regulator of Actin-Based Motility (RoaM) Downregulates Actin Tail Formation by Rickettsia rickettsii and Is Negatively Selected in Mammalian Cell Culture." mBio, March 14, 2022. http://dx.doi.org/10.1128/mbio.00353-22.
Full textAbstract:
The mechanism of actin-based motility of spotted fever group Rickettsia has been studied extensively, but here, we provide genetic evidence that motility is a regulated process in R. rickettsii . The findings also suggest that serial passage of rickettsial strains in cell culture may cause the bacteria to lose essential genes that are no longer conserved under natural selective pressure.
50
Donatelli, Cassandra M., Keegan Lutek, Keshav Gupta, and Emily M. Standen. "Body and Tail Coordination in the Bluespot Salamander (Ambystoma laterale) During Limb Regeneration." Frontiers in Robotics and AI 8 (May 28, 2021). http://dx.doi.org/10.3389/frobt.2021.629713.
Full textAbstract:
Animals are incredibly good at adapting to changes in their environment, a trait envied by most roboticists. Many animals use different gaits to seamlessly transition between land and water and move through non-uniform terrains. In addition to adjusting to changes in their environment, animals can adjust their locomotion to deal with missing or regenerating limbs. Salamanders are an amphibious group of animals that can regenerate limbs, tails, and even parts of the spinal cord in some species. After the loss of a limb, the salamander successfully adjusts to constantly changing morphology as it regenerates the missing part. This quality is of particular interest to roboticists looking to design devices that can adapt to missing or malfunctioning components. While walking, an intact salamander uses its limbs, body, and tail to propel itself along the ground. Its body and tail are coordinated in a distinctive wave-like pattern. Understanding how their bending kinematics change as they regrow lost limbs would provide important information to roboticists designing amphibious machines meant to navigate through unpredictable and diverse terrain. We amputated both hindlimbs of blue-spotted salamanders (Ambystoma laterale) and measured their body and tail kinematics as the limbs regenerated. We quantified the change in the body wave over time and compared them to an amphibious fish species, Polypterus senegalus. We found that salamanders in the early stages of regeneration shift their kinematics, mostly around their pectoral girdle, where there is a local increase in undulation frequency. Amputated salamanders also show a reduced range of preferred walking speeds and an increase in the number of bending waves along the body. This work could assist roboticists working on terrestrial locomotion and water to land transitions.