To see the other types of publications on this topic, follow the link: Steinernema.
Journal articles on the topic 'Steinernema'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Steinernema.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Prabowo, Heri, and I. G. A. A. Indrayani. "Potensi Nematoda Patogen Serangga Steinernema spp. dalam Pengendalian Hama Utama Tanaman Kapas." Buletin Tanaman Tembakau, Serat & Minyak Industri 1, no. 2 (October 10, 2016): 101. http://dx.doi.org/10.21082/bultas.v1n2.2009.101-110.
Full textAbstract:
<p>Steinernema spp. memiliki potensi untuk mengendalikan hama tanaman kapas seperti Helicoverpa armigera dan Pectinophora gossypiella. Steinernema spp. mampu menyebabkan mortalitas P. gossypiella dan H. armi-gera berturut-turut sebesar 31,6–55,4 dan 46,3–63,8%. Steinernema spp. memiliki kemampuan membunuh lebih baik pada P. gossypiella, sedangkan kemampuan reproduksi dalam inangnya lebih baik pada H. armi-gera. Steinernema spp. mampu menginfeksi serangga inang lebih baik pada stadium ulat lebih tua diban-dingkan stadium muda. Steinernema spp. dapat diproduksi secara in vivo dan in vitro. Produksi secara in vivo dapat menggunakan Tenebrio molitor, Tirathaba rufivena, dan Attacus atlas. Produksi secara in vitro dapat menggunakan usus ayam, lemak sapi, dan minyak kedelai. Perlu dikembangkan formulasi Steinerne-ma spp. yang murah dan efektif untuk mengendalikan hama di atas permukaan tanah. Selain itu diperlukan pencarian isolat Steinernema spp. yang virulen dan cepat membunuh hama sasaran.</p><p> </p><p>Steinernema spp. could be potentially used for controlling H. armigera and P. gossypiella on cotton. Steiner-nema spp. causes mortality on P. gossypiella and H. armigera 31,6–55,4 and 46,3–63,8% respectively. The nematode causes a higher mortality on P. gossypiella than on H. armigera, however, produces more juvenile infective on H. armigera than on P. gossypiella. Higher successful infections of Steinernema spp. occurs on late larval stadium than on early one. Production of Steinernema spp. can be in vivo using Tenebrio molitor, Tirathaba rufivena, and Attacus atlas; and in vitro using chicken intestinum, cow lipid, and soy bean oil. For effecttively use, this nematode need to be formulated especially for controlling insect pests on soil surface, as well as finding the more virulent isolates against the target insects.</p>
2
Rosyidi, Imron, Hari Purnomo, Nanang Tri Haryadi, and Mohammad Hoesain. "KOMPATIBILITAS CENDAWAN METARHIZIUM ANISOPLIAE (METSCHN.) SOROKIN DENGAN NEMATODA ENTOMOPATOGEN STEINERNEMA SP." JURNAL HAMA DAN PENYAKIT TUMBUHAN TROPIKA 17, no. 2 (October 1, 2017): 111. http://dx.doi.org/10.23960/j.hptt.217111-118.
Full textAbstract:
Compatibility Metarhizium anisopliae (Metschn.) Sorokin with entomopathogenic nematode Steinernema sp. Metarhizium anisopliae (Metschn.) Sorokin and entomopathogenic nematode Steinernema sp. can be used as biological control of insect pests. The objective of this research was to identify compatibility between fungus M. anisopliae with entomopathogenic nematode Steinernema sp. This research was conducted using a completely randomized design (CRD) consisting of 5 treatments and repeated 5 times. The treatment used was M. anisopliae isolates Jombang 1 with Steinernema sp. (M1), M. anisopliae Jombang 2 with Steinernema sp. (M2), M. anisopliae isolates Kediri with Steinernema sp. (M3), M. anisopliae isolates Bondowoso with Steinernema sp. (M4), and M. anisopliae isolates Banyuwangi with Steinernema sp. (M5). Based on this research result, compatibility between the fungus M. anisopliae with entomopathogenic nematode Steinernema sp. was antagonistic. This occurs due to the symbiotic bacteria Xenorhabdus sp. that produced compounds antimycotic and capable to inhibit the growth of fungus M. anisopliae.
3
Qian, Xiu Juan, Li Na Gu, Yu Fang Xing, and Chang ZHong Liu. "Entomopathogenic Nematodes Isolated from Gansu Province and Four New Species in China." Applied Mechanics and Materials 651-653 (September 2014): 328–36. http://dx.doi.org/10.4028/www.scientific.net/amm.651-653.328.
Full textAbstract:
With the morphological characters, anatomy and molecular biology research, 29 entomopathogenic nematodes populations isolated from Gansu province were identified and the resoult showed that they were 8 species of EPN, Steinernema feltiae,Steinernema bicornutum,Steinernema affin,Steinernema krusse and Steinernema karil were belong to Steinernema while Heterorhabditis brevicaudis,Heterorhabditis megidi and Heterorhabditis marelatu were belong to Heterorhabditis respectively. And what more research found that S. affin,S. krusse,S. karil and H. marelatu were new species in China.
4
Grewal, P. S., E. E. Lewis, R. Gaugler, and J. F. Campbell. "Host finding behaviour as a predictor of foraging strategy in entomopathogenic nematodes." Parasitology 108, no. 2 (February 1994): 207–15. http://dx.doi.org/10.1017/s003118200006830x.
Full textAbstract:
SUMMARYForaging strategies of eight species of entomopathogenic nematodes were predicted from their response to host volatile cues and dispersal behaviour on 2-dimensional substrates. Positive directional response to chemical cues and similar distances travelled on smooth (agar) or nictation substrates (agar overlaid with sand grains) by Heterorhabditis bacterio-phora, Heterorhabditis megidis, Steinernema anomali, and Steinernema glaseri suggest their cruising approach to finding hosts. The absence of directional response and less distance travelled on nictation substrate, than on smooth agar by Steinernema carpocapsae and Steinernema scapterisci suggest their ambushing mode of foraging. Steinernema feltiae and Steinernema sp. responded directionally to host volatiles, but travelled less distance on the nictation substrate than on smooth agar; the two species also did not nictate. The cruiser species located hosts more effectively in the sand columns, whereas the ambushers were more effective at finding hosts on filter paper. Steinernema feltiae and Steinernema sp. performed equally on filter paper and in the sand column. We conclude that H. bacteriophora, H. megidis, S. anomali and S. glaseri cruise to find hosts, whereas S. carpocapsae and S. scapterisci ambush hosts. Steinernema feltiae and Steinernema sp. are intermediary in the search continuum sharing some characteristics of both ambush and cruise foragers.
5
Mwaniki Ndiritu, Moses, Dora Kilalo, John Wangai Kimenju, and Shelmith Waruguru Mwaniki. "Pathogenicity of Selected Kenyan Entomopathogenic Nematodes of Genus Steinernema against Banana Weevil (Cosmopolites Sordidus)." Agriculture and Food Sciences Research 3, no. 1 (June 10, 2016): 29–36. http://dx.doi.org/10.20448/journal.512/2016.3.1/512.1.29.36.
Full textAbstract:
Banana weevil is a pest with a great impact on banana production in the world. The objective of this study was to evaluate the pathogenicity of the Kenyan entomopathogenic nematodes (EPNs) of genus Steinernema against the weevil Cosmopolites sordidus (Germar) under laboratory conditions. Adult weevils were trapped from banana fields in Maragua, Central Kenya and larvae extracted from the infested banana rhizomes. The adults were treated with three Kenyan EPNs Steinernema weiseri, Steinernema yirgalemense and the new Steinernema spp and with Steinernema carpocapsae ALL strain as a standard and plain distilled water as a control in five replicates. The treatments were 500ijs, 750ijs and 1000ijs per adult on petri dishes and 1000ijs, 3000ijs and 5000ijs per adult on pseudo-stems. The treatments for larvae in petri dishes were 300ijs, 400ijs and 500ijs. The adults were not susceptible to all the nematodes at all doses and preparations while larvae were highly susceptible to the four test EPNs at all concentrations. There was a significant difference at P<0.05 in the mortality of larvae between nematode Steinernema carpocapsae and Steinernema weiseri. A significant difference was observed between nematode Steinernema carpocapsae and Steinernema yirgalemense. There was also a significant difference between the new Steinernema spp and Steinernema weiseri and finally in the two nematodes the new Steinernema spp and Steinernema yirgalemense. All the test nematodes caused over 90 % larval mortality within 48 hours. The mean percent mortality of larva increased with nematode concentration for all the test nematodes. The results indicated that the four test EPNs significantly (P<0.05) caused high mortality within 24-48 hrs. The findings indicate that the banana weevil larvae are susceptible to the local entomopathogenic nematodes and potentially useful in the management of the banana weevil. It is however recommended that more research be conducted on the formulation and application technology to enhance their effectiveness in the field.
6
Kary, Naser Eivazian, Gholamreza Niknam, Seyed Abolgasem Mohammadi, Christine Griffin, and Mohammad Moghaddam. "A survey of entomopathogenic nematodes of the families Steinernematidae and Heterorhabditidae (Nematoda: Rhabditida) in the north-west of Iran." Nematology 11, no. 1 (2009): 107–16. http://dx.doi.org/10.1163/156854108x398453.
Full textAbstract:
AbstractDuring 2002-2004, a survey of entomopathogenic nematodes was conducted for the first time in Iran throughout the three provinces in the north-west of the country. Soil samples were tested for the presence of steinernematid and heterorhabditid nematodes by baiting with Galleria mellonella larvae. Of the 833 soil samples studied 27 were positive for entomopathogenic nematodes (3.2%), with 17 (2.0%) containing Heterorhabditis and ten (1.2%) Steinernema isolates. Morphological and molecular studies were carried out to characterise isolates. The Heterorhabditis isolates were identified as Heterorhabditis bacteriophora and Steinernema as Steinernema carpocapsae, S. bicornutum and S. feltiae. Heterorhabditis bacteriophora was the most common species, which was isolated from 17 sites across the three provinces. Steinernema feltiae was the most common species of Steinernema, which was isolated from eight sites but in only two provinces. Steinernema carpocapsae and S. bicornutum were each isolated from only one site. Steinernema spp. were isolated mainly from orchards and grasslands but Heterorhabditis was isolated mainly from grasslands and alfalfa fields.
7
Nikdel, Mostafa, Gholamreza Niknam, Christine T. Griffin, and Naser Eivazian Kary. "Diversity of entomopathogenic nematodes (Nematoda: Steinernematidae, Heterorhabditidae) from Arasbaran forests and rangelands in north-west Iran." Nematology 12, no. 5 (2010): 767–73. http://dx.doi.org/10.1163/138855410x12628646276168.
Full textAbstract:
Abstract A survey for entomopathogenic nematodes (EPN) was carried out in the Arasbaran forests and rangelands, East Azarbaijan province, north-west Iran, during 2006 to 2008. A total of 691 soil samples were collected from 62 localities across the region of which 21 samples (3%) were positive for EPN, including nine samples (1.3%) with heterorhabditids and 12 (1.7%) with steinernematids. Seven isolates (four Steinernema and three Heterorhabditis) were recovered from rangelands and 14 (eight Steinernema and six Heterorhabditis) from forest soil samples. Based on morphology and molecular studies, the Heterorhabditis isolates were identified as H. bacteriophora and the Steinernema isolates as S. carpocapsae, S. bicornutum, S. feltiae, S. glaseri, S. kraussei and three undescribed species referred to here as Steinernema sp. IRAZ7, Steinernema sp. IRAZ13 and Steinernema sp. IRAZ21. Heterorhabditis bacteriophora, the most common species, was present in nine soil samples collected across the forests and rangelands, and of the Steinernema species, S. bicornutum was obtained from three samples, the other species being found from only one or two samples.
8
Qodiriyah, Qodiriyah, Didik Sulistyanto, and Purwatiningsih Purwatiningsih. "Biological Control Entomopathogenic Nematodes Heterorhabditis sp. and Steinernema sp. Pest Control Termite Land As Coptotermes sp. and Microtermes sp. in The District Lumajang." Jurnal ILMU DASAR 16, no. 1 (October 30, 2015): 43. http://dx.doi.org/10.19184/jid.v16i1.1518.
Full textAbstract:
This research aims to find out the most effective concentration (LC50) and the most effective time (LT50) and to select a biological agent netamoda of nematodes Steinernema sp. dan Heterorhabditis sp. as the environmentally friendly biological control agents on the ground termite Coptotermes sp. and Microtermes sp. in Lumajang. All the data were analyzed by using the termite mortality percentage variance analysis. The LC50 and LT50 were tested by using the probit analysis. Therefore, the empirical probit values were obtained from the percentage of mortality after they were calculated by the Abbot formulation. The biological agents netamoda entomopathogenic Heterorhabditis sp. and Steinernema sp. had the high value on the pathogenicity of Coptotermes sp. and Microtermes sp., the LC50 values on Coptotermes sp. of nematodes Heterorhabditis sp. was 14.94 IJ/ml and Steinernema sp. was 15.22 IJ/ml., the LC50 values on Microtermes sp. of nematodes Heterorhabditis sp. was 16.54 IJ/ml and Steinernema sp. was 20.39 IJ/ml., the LT50 values on Coptotermes sp. of nematodes Heterorhabditis sp. was 1.29 hours and Steinernema sp. was 1.35 hours, and the LT50 values on Microtermes sp. of nematodes Heterorhabditis sp. was 2.14 hours and Steinernema sp. was 1.82 hours. Through pathogenicity test, the entomopathogenic nematodes Heterorhabditis sp. is more effective to control subterranean termites compared with the nematode Steinernema sp. This happens because Heterorhabditis sp. are actively engaged and looking for a host so that there are a large number of possibilities of contacting them with a very large subterranean termites.Keywords: Entomopathogenic nematodes, Heterorhabditis sp., Steinernema sp., LC50, LT50
9
López-Núñez, Juan Carlos, Liliana Cano, Carmenza Góngora-B., and S. Patricia Stock. "Diversity and evolutionary relationships of entomopathogenic nematodes (Steinernematidae and Heterorhabditidae) from the Central Andean region of Colombia." Nematology 9, no. 3 (2007): 333–41. http://dx.doi.org/10.1163/156854107781351972.
Full textAbstract:
Abstract A survey of entomopathogenic nematodes (EPN) was conducted in the Central Andean region of Colombia. Out of a total of 945 soil samples, 28 (3%) were positive for entomopathogenic nematodes. Of them, 26 samples (92.8%) contained Steinernema and two (7.2%) harboured Heterorhabditis isolates. Characterisation of the recovered isolates was done by analysis of rDNA sequences. The large subunit of rDNA (28S) was considered for diagnosis of Steinernema species whereas the internal transcribed spacer region (ITS) of rDNA was used to identify Heterorhabditis isolates recovered in this study. Five Steinernema spp. were isolated and identified as S. websteri and four new, undescribed species. Steinernema websteri was isolated from two sites: Naranjal and Paraguaicito stations. At Naranjal, this species was recovered from a coffee plantation and a forest habitat surrounding these plantations. At Paraguaicito, the same species was recovered from a coffee-guamo habitat. Steinernema sp. 1 was collected from nogal cafetero (Cordia allaidora) groves and forest habitats at Paraguaicito station. Steinernema sp. 2 was found in coffee-guamo habitats both at Naranjal and Paraguaicito stations. Steinernema sp. 3 was the only EPN species recovered at Santa Barbara station in association with plantain. This species was also found at La Catalina station in association with forest habitats and also from soil samples taken from a landscaped area with Heliconia sp. and grass cover (Arachis pintoi) at Cenicafé La Granja station and a coffee-guamo habitat at Naranjal station. Steinernema sp. 4 was found at La Catalina in a forest habitat, also associated with Steinernema sp. 3 (isolate JCL002) and Heterorhabditis sp. 1 (isolate JCL 003). The Heterorhabditis isolates were identified as two undescribed Heterorhabditis spp. Heterorhabditis sp. 1 (isolate JCL003) was recovered at La Catalina station associated with a forest habitat. Heterorhabditis sp. 2 (isolate JCL040) was collected from a coffee-guamo habitat at Naranjal station. Although limited to one geographic region, this study suggests entomopathogenic nematodes in Colombia are quite diverse and are perhaps widely distributed in this country. A more intensive survey covering all geographic regions is currently underway.
10
Sturhan, Dieter, and Marta Liskova. "Occurrence and distribution of entomopathogenic nematodes in the Slovak Republic." Nematology 1, no. 3 (1999): 273–77. http://dx.doi.org/10.1163/156854199508261.
Full textAbstract:
AbstractInfective-stage juveniles of entomopathogenic nematodes of the genera Steinernema and Heterorhabditis were recovered by direct extraction from 36% of a total of 111 soil samples collected in various biotopes from different regions of Slovakia. The rate of prevalence was highest in forest soil (58%). On the basis of morphological characters of the infective juveniles eight Steinernema and one Heterorhabditis species were distinguished. Steinernema affine, S. intermedium and S. feltiae were most prevalent (together 74% of all records). The other species of Steinernema encountered were S. kraussei, S. carpocapsae, S. bicornutum, a species of the S. glaseri group and an undescribed species earlier recorded from Germany. In 11 of the 40 soil samples positive for entomopathogenic nematodes mixtures of two to four species were present. Several species showed a distinct habitat preference, e.g., S. affine for arable soil and S. intermedium for woodland and river bank vegetation with trees. A preference for certain soil types was less apparent. Untersuchungen uber Vorkommen und Verbreitung entomopathogener Nematoden in der Slowakischen Republik - Insgesamt 111 Bodenproben, die in unterschiedlichen Biotopen aus verschiedenen Regionen der Slowakei entnommen worden waren, wurden auf entomopathogene Nematoden untersucht. Infektionsjuvenile der Gattungen Steinernema und Heterorhabditis waren uber eine direkte Extraktion der Nematoden aus dem Boden in 36% aller Proben nachweisbar. Der hochste Anteil "positiver" Proben fand sich bei Proben aus Waldern (58%). Anhand morphologischer Merkmale der Infektionsjuvenilen waren acht Steinernema Arten und eine Heterorhabditis-Art differenzierbar. Steinernema affine, S. intermedium und S. feltiae waren die haufigsten Arten (insgesamt 74% aller Nachweise). S. kraussei, S. carpocapsae, S. bicornutum, eine Steinernema-Art der S. glaseri-Gruppe und eine noch unbeschriebene Steinernema-Art (bereits aus Deutschland bekannt) und Heterorhabditis sp. wurden seltener gefunden. In 11 aller 40 "positiven" Proben kamen zwei bis vier Arten nebeneinander vor. Einige der Arten zeigten eine deutliche Bevorzugung bestimmter Biotoptypen, so S. affine von Acker- und Gartenboden und S. intermedium von Waldern und Ufervegetation mit Baumen. Eine Bevorzugung bestimmter Bodenarten war dagegen kaum erkennbar.
11
Mariyono, Mariyono, Eko Yuliarsha Sidhi, and Nugraheni Hadiyanti. "Keefektifan Patogenesitas Steirmema Carpocapsae (all strain) terhadap Hama Plutella xylostella L." Jurnal Agrinika : Jurnal Agroteknologi dan Agribisnis 5, no. 1 (March 29, 2021): 51. http://dx.doi.org/10.30737/agrinika.v5i1.1555.
Full textAbstract:
The utilization of entomopathogenic nematodes is an example of the uses of an environmentally friendly biological agent. Entomopathogenic nematodes of the family Steinernematidae and Hetrorhabditidae are very potential to control insect pests. The purpose of this study was to study the pathogenicity of the entomopathogenic nematode Steinernema carpocapsae (all strains) as a biological control against Plutella xylostella. This research includes 2 stages, namely the preparation stage and laboratory experiments. The experimental design in this study was a completely randomized design (CRD) consisting of six treatments and three replications. The treatments tested were entomopathogenic nematode concentrations consisting of six levels: 0, 8, 16, 32, 64 and 128 infective juvenile per ml. The LC50 and LT50 values were calculated using Probit analysis. The results of observations of nematodes that enter the insect body and pest mortality were analyzed using analysis of variance (ANOVA), once showing a significant difference, it was then continued to the DMRT test at 5% level. Based on the results of the study, the highest pathogenicity against Plutella xylostella was Steinernema carpocapsae (all strains) when compared to Steinernema glaseri (NC) and Steinernema sp. local isolates. Resistance to Steinernema carpocapsae (all strains) and the LC50 value were determined by the age of Plutella xylostella larvae. The bigger and older the larvae, the more its resistance to Steinernema carpocapsae (All strains) and the LC50 value. The number of entomopathogenic nematodes that enter the body of Plutella xylostella increased with increasing length of contact time.Penggunaan nematoda entomopatogen merupakan salah satu pemanfaatan agensia hayati yang ramah lingkungan. Nematoda entomopatogen dari famili Steinernematidae dan Hetrorhabditidae sangat potensial untuk mengendalikan serangga hama. Tujuan dari penelitian ini adalah mempelajari patogenisitas nematoda entomopatogen Steinernema carpocapsae (all strain) sebagai pengendali hayati terhadap hama Plutella xylostella. Penelitian ini meliputi 2 tahap yaitu tahap persiapan dan percobaan laboratorium. Rancangan percobaan pada penelitian ini adalah Rancangan Acak Lengkap (RAL) yang terdiri enam perlakuan dan tiga ulangan. Perlakuan yang diujikan adalah konsentrasi nematoda entomopatogen yang terdiri enam taraf: 0, 8, 16, 32, 64 dan 128 infektif juvenile/ml. Nilai LC50 dan LT50 dihitung menggunakan analisis probit. Hasil pengamatan nematoda yang masuk dalam tubuh serangga dan mortalitas hama dianalisis menggunakan analisis sidik ragam (ANOVA), apabila menunjukkan beda nyata dilanjutkan uji DMRT taraf 5%. Berdasarkan hasil penelitian, patogenisitas tertinggi terhadap Plutella xylostella adalah Steinernema carpocapsae (all strain) bila dibandingkan dengan Steinernema glaseri (NC) dan Steinernema sp. isolat lokal. Ketahanan terhadap Steinernema carpocapsae (All strain) dan nilai LC50 ditentukan umur larva Plutella xylostella. Semakin besar dan tua umur larva, ketahanan terhadap Steinernema carpocapsae (All strain) dan nilai LC50 juga semakin meningkat. Jumlah nematoda entomopatogen yang masuk kedalam tubuh Plutella xylostella semakin banyak seiring dengan bertambah lamanya waktu kontak.
12
Prabowo, Heri, and I. G. A. A. Indrayani. "Keefektifan Nematoda Patogen Serangga Steinernema sp. Terhadap Achaea janata L., Serangga Pemakan Daun Jarak Kepyar (Ricinus communis)." Buletin Tanaman Tembakau, Serat & Minyak Industri 5, no. 2 (October 10, 2016): 58. http://dx.doi.org/10.21082/bultas.v5n2.2013.58-68.
Full textAbstract:
<p>Penggunaan pestisida kimia yang cukup tinggi pada akhir-akhir ini telah menimbulkan dampak negatif ter-hadap lingkungan, sehingga pengendalian hama yang ramah lingkungan sangat diperlukan. Saat ini, peng-gunaan nematoda entomopatogen terutama Steinernema sp., membuka peluang untuk digunakan sebagai pengendalian Achaea janata. Tujuan dari penelitian ini untuk mengetahui keefektifan Steinernema sp. ter-hadap A. Janata , dilaksanakan di laboratorium patologi serangga Balai Penelitan Tanaman Pemanis dan Serat pada bulan Maret sampai dengan Agustus 2011. Penelitian menggunakan rancanagan acak lengkap (RAL) dengan empat ulangan. Setiap ulangan menggunakan 25 larva A. janata instar 2. Larva diekspose de-ngan berbagai variasi konsentrasi Steinernema sp. dan kematian larva diamati setiap hari sampai 120 jam setelah infeksi. Konsentrasi Steinernema sp. yang digunakan adalah 0, 50, 100, 200, 300, dan 400 JI/larva. Hasil penelitian pemberian Steinernema sp. pada konsentrasi 200, 300, dan 400 JI/larva cukup efektif untuk membunuh A. janata dengan persentase berkisar antara 80–94% mulai 48–120 jam setelah perlakuan. Se-makin tinggi konsentrasi nematoda, semakin tinggi mortalitas A. janata. Steinernema sp. dengan konsen-trasi 400 JI/larva paling efektif membunuh larva, menurunkan bobot larva, bobot pupa, jumlah telur yang dihasilkan, dan fertilitas telur.</p><p> </p><p>High intensity of chemical pesticide application has become a serious concern of environmentalists in recent years, because of various negative impacts of it. Therefore, environmentally friendly techniques of controlling insect pest are needed. Recently, the use of entomopathogenic nematodes, especially Steinernema sp., has created new possibilities of promising control techniques against insect pests. The aim of this study was to evaluate the effectiveness of Steinernema sp. to A. janata larvae in laboratory. This research was conducted at the Laboratory of Insect Pathology Laboratory of Indonesian Sweetener and Fiber Crops Research Insti-tute from March to August 2011. Tests used the 2nd stage larvae of Achaea janata, the leaf eater of castor (Ricinus communis). Treatment arranged in a completely randomized design (CRD) with 4 replicates. For each test used 25 larvae which were exposed to various concentrations of Steinernema sp. Concentration of Steinernema sp. used was 0, 50, 100, 200, 300, and 400 infective juvenile/larvae. Daily mortality A. janata larvae, larval and pupal weight, the number of eggs laid, and number of hatch eggs were recorded. Steinernema sp. on concentration of 200; 300; and 400 IJ/larvae was effective to cause mortality of A. janata larvae (80–94% mortality after 48–120 hours). The higher the concentration of the nematode the higher larval mortality. Steinernema sp. with concentration of 400 IJ/ larvae was effective decreasing larval and pupal weight, the number of eggs laid, and fertility of the eggs produced.</p>
13
S., Khater,, El-lakwah, F., Abd-Elmonem, M., Ahmed, A., and Shoukry, F. "Biochemical Effects of Heterorhabditis bacteriophora, Steinernema carpocapsae, Steinernema scapterisi and Steinernema glaseri on Galleria mellonella Larvae (Lepidoptera: Pyrallidae)." Egyptian Academic Journal of Biological Sciences. C, Physiology and Molecular Biology 13, no. 1 (January 24, 2021): 13–26. http://dx.doi.org/10.21608/eajbsc.2021.143243.
Full text
14
Lewis, E. E., R. Gaugler, and R. Harrison. "Entomopathogenic nematode host finding: response to host contact cues by cruise and ambush foragers." Parasitology 105, no. 2 (October 1992): 309–15. http://dx.doi.org/10.1017/s0031182000074230.
Full textAbstract:
SUMMARYSearch behaviour of two entomopathogenic nematode species with different foraging strategies was compared by measuring parameters of unrewarded search after contact with host cues. Steinernema glaseri cruises in search of hosts. Steinernema carpocapsae ambushes hosts. Nematodes should respond to contact with relevant host cues by shifting their search from ranging to localized after contact with them. We predicted that cruising foragers rely on chemical cues more heavily than ambushers. These species were also tested for host affinities. Nematodes were tracked by image analysis after exposure to faeces, cuticle or food of either Popillia japonica or Spodoptera exiqua. Steinernema glaseri responded to selected host cues by shifting from ranging to localized search, characterized by decreased locomotory rate, distance travelled, search area and the proportion of the test period spent moving. Steinernema carpocapsae did not respond to host cues. Steinernema glaseri responds to selected chemical host cues for host location, whereas S. carpocapsae does not.
15
Moens, Maurice, Ngoc Chau Nguyen, and Ke Long Phan. "Steinernema loci sp. n. and Steinernema thanhi sp. n. (Rhabditida: Steinernematidae) from Vietnam." Nematology 3, no. 6 (2001): 503–14. http://dx.doi.org/10.1163/156854101753389112.
Full textAbstract:
AbstractTwo new species of Steinernema (Rhabditida), Steinernema loci sp. n. and S. thanhi sp. n., were isolated from beach soil in Thanhhoa and Hatinh provinces in the northern part of Vietnam. A combination of morphological, morphometric and rDNA-RFLP features indicated the distinctness of both species from other Steinernema spp. Diagnostic characters of Steinernema loci sp. n. include: total body length (896-1072 μm), distance from anterior end to excretory pore (EP = 71-86 μm), tail length (66-83 μm), lateral field in mid-body with eight ridges (nine distinct lines) and rounded, broad and smooth anterior end of the third stage infective juvenile; first generation males were characterised by body width, spicule length and the ratio spicule length : anal body width (SW). Diagnostic characters of Steinernema thanhi sp. n. third stage infective juveniles include: total body length (720-960 μm), EP (68-84 μm), tail length (52-72 μm), lateral field in mid-body with eight ridges (nine distinct lines) and rounded, broad and smooth anterior end. Spicule length, ratio SW and arrangement of genital papillae characterised the first generation males.
16
ROSERO-GUERRERO, MIRIAM, ALEX ENRIQUE BUSTILLO-PARDEY, JUAN CARLOS LÓPEZ-NÚÑEZ, ULISES CASTRO-VALDERRAMA, and EYDER DANIEL GÓMEZ-LÓPEZ. "Eficacia de entomonematodos para controlar estados de Aeneolamia varia (Hemiptera: Cercopidae) bajo condiciones de invernadero." Revista Colombiana de Entomología 38, no. 2 (December 31, 2012): 266–73. http://dx.doi.org/10.25100/socolen.v38i2.9003.
Full textAbstract:
Aeneolamia varia se registró en cultivos de caña en el Valle del Cauca entre 2007 y 2008 y sus infestaciones se extendieron a 25.000 ha, amenazando así la industria azucarera y panelera. Debido a esta situación, se inició una investigación con nematodos entomopatógenos, para evaluarlos en el control de esta plaga. Se evaluaron las especies Steinernema colombiense, Steinernema websteri, Steinernema sp.1, Steinernema sp.2, Heterorhabditis bacteriophora y una especie de Steinernema codificada como O1R1, en dosis de 100 y 1.500 juveniles infectivos (JI)/cm2 de área asperjada, sobre estadios ninfales de A. varia en plántulas de caña de azúcar en invernadero. El estado adulto se evaluó bajo condiciones de laboratorio empleando 100 JI/cm2 y los sistemas de bioensayo en cajas Petri y cilindros. El tercer estadio ninfal fue el menos susceptible y el cuarto fue el más susceptible a H. bacteriophora, presentando mortalidad de 89,1% con 100 JI/cm2. El estado adulto tuvo una mortalidad de 100% con todas las especies de nematodos evaluadas en el bioensayo en cajas Petri, mientras que en los cilindros la mortalidad varió entre 40 y 54%. El experimento para evaluar la habilidad de las especies de nematodos, para buscar el hospedero A. varia, reveló que todas son capaces de encontrar sus ninfas, pero H. bacteriophora y Steinernema sp.1 fueron las más eficaces causando mortalidades del 46% y 30%, respectivamente.
17
PRABOWO, HERI, and IGAA INDRAYANI. "VIABILITAS DAN EFEKTIVITAS FORMULA NEMATODA Steinernema sp. TERHADAP HAMA PENGGEREK BUAH KAPAS Helicoverpa armigera HUBNER." Jurnal Penelitian Tanaman Industri 18, no. 4 (June 19, 2020): 151. http://dx.doi.org/10.21082/jlittri.v18n4.2012.151-155.
Full textAbstract:
<p>ABSTRAK<br />Entomopatogen dari genus Steinernema berpotensi digunakan<br />sebagai pengendali berbagai serangga hama, terutama ordo Lepidoptera,<br />seperti Helicoverpa armigera. Penggunaan Steinernema untuk<br />pengendalian H. armigera akan menguntungkan karena aman terhadap<br />lingkungan, mudah diproduksi massal, toleran terhadap berbagai macam<br />pestisida, dapat aktif mencari serangga sasaran, tidak menyebabkan<br />resisten dan resurjensi, serta dapat diaplikasikan dengan alat semprot<br />standar. Namun, formula pestisida hayati mengandung Steinernema masih<br />sangat terbatas. Tujuan penelitian adalah membuat formula Steinernema<br />sp. yang efektif terhadap hama penggerek buah kapas (H. armigera).<br />Penelitian dilaksanakan di laboratorium Patologi Serangga, Balai<br />Penelitian Tanaman Pemanis dan Serat, Malang mulai bulan Mei-Juli<br />2010. Larva instar III Steinernema sp. dibuat dalam 6 macam formula<br />perlakuan dengan bahan pembawa (carrier) berbeda-beda, yaitu (1)<br />suspensi (akuades + sukrosa), (2) pellet-2 (sekam padi), (3) pellet-1<br />(tanah liat + arang), (4) agar + spon, (5) kapsul (Ca-alginat), dan (6)<br />kontrol (akuades). Setiap formula diinokulasikan 10 6 juvenil infektif (JI).<br />Masing-masing perlakuan disusun dalam rancangan acak lengkap (RAL)<br />dengan tiga kali ulangan. Penurunan jumlah juvenil infektif (JI) pada<br />setiap formula yang diamati per minggu selama ± 4 minggu. Isolat yang<br />digunakan untuk penelitian ini berasal dari Asembagus. Untuk<br />mengevaluasi efektivitas formula, larva H. armigera diperlakukan dengan<br />JI yang berasal dari masing-masing formula setiap minggu selama empat<br />minggu. Perlakuan ini menggunakan rancangan acak lengkap dengan<br />empat ulangan. Jumlah penurunan JI setiap minggu selama empat minggu<br />setelah perlakuan. Persentase JI yang hidup pada pellet-1, suspensi, pellet-<br />2, agar + spon, kapsul, dan kontrol berturut-turut sebesar 53; 12,4; 44;<br />63,8; 17,6; dan 5%. Pada minggu pertama sampai minggu keempat setelah<br />perlakuan terlihat bahwa formula yang paling baik mempertahankan JI<br />adalah agar + spon dan kemudian berturut-turut diikuti oleh pellet-1,<br />pellet-2, kapsul, suspensi. Steinernema sp. yang disimpan selama empat<br />minggu dalam berbagai bentuk formula terhadap H. armigera berkisar<br />antara 80-99%. Formula agar dan spon paling baik untuk menyimpan<br />Steinernema sp. selama empat minggu, karena formula ini memberikan<br />tingkat viabilitas dan efektivitas Steinernema sp. paling tinggi.<br />Kata kunci : efektivitas, formula, Helicoverpa armigera, Steinernema sp.,<br />viabilitas</p><p>ABSTRACT<br />Entomopathogenic nematodes genus Steinernema for are potential<br />to be used as a control for various insect pests, especially ordo<br />Lepidoptera, such as Helicoverpa armigera. The use of Steinernema to<br />control H. armigera is beneficial because it is environmentally friendly,<br />easy to produce, tolerant to several pesticides, actively search the target<br />insect, does not cause resistance and resurgence, and can be applied by<br />using standard sprayer. Unfortunately, biological pesticide containing<br />Steinernema is still limited. The study was aimed at formulating a<br />biological agen containing Steinernema sp. to control the cotton bollworm<br />weevil (H. armigera). The experiment was conducted at insect pathology<br />laboratory, Indonesian Sweetener and Fiber Crops Research Institute,<br />Malang from May to July 2010. Steinernema sp. instar III larvae was<br />formulated in six different forms such as Pellet-1 (clay+carbon),<br />suspension (distilled water+sucrose), Pellet-2 (rice husk), agar+sponge,<br />capsule (Ca-alginate), and control (distilled water). Each formulation was<br />inoculated with 10 6 Infective Juvenile (IJ). Each treatment was arranged in<br />completely randomized design (CRD) with three replicates. Each<br />formulation observed showed decrease in IJ number every week for + 4<br />weeks. Isolates used for this research were originated from Asembagus<br />experimental station. For evaluation of the formulation effectiveness, H.<br />armigera larvae was treated using IJ from the formula weekly for four<br />weeks. On the first week after treatment, the percentages of living IJ in<br />Pellet-1, suspension, Pellet-2, agar+sponge, capsule, and control were 53;<br />12.4; 44; 63.8; 17.6; and 5%, respectively. Effectiveness of Steinernema<br />sp. stored for four weeks in various formulations against H. armigera<br />ranged from 80-99%. The best formula of Steinernema sp for storage was<br />agar+sponge because of its ability to viability and effectiveness of<br />Steinernema sp.<br />Key words: effectiveness, formulation, Helicoverpa armigera, viability,<br />Steinernema sp.,</p>
18
KHALID, AYMAN WALEED, and SAMIRA A. KHLAYWI AND SAFAA ZAKARIA BAKER. "Identification and Molecular Analysis of Indigenous Entomopathogenic Nematodes, Steinernema, and Heterorhabditis in Iraq." BIOPESTICIDES INTERNATIONAL 19, no. 02 (December 2023): 207. http://dx.doi.org/10.59467/bi.2023.19.207.
Full textAbstract:
A survey was conducted in some northern regions of Iraq between 2021 and 2022 to evaluate the diversity of entomopathogenic nematodes in these areas. Entomopathogenic nematodes were isolated from soil using the Galleria trap technique. Molecular identification illustrated that these isolates belong to two genera of entomopathogenic nematodes, Heterorhabditis, and Steinernema. The results of the molecular analysis also showed the presence of Steinernema isolates in the Al-Rashidiyah region in Mosul, Iraq. Heterorhabditis nematodes were isolated from Salah Al-Din, Samarra, and Al-Jadriya, Baghdad. Some collected soil samples were negative and had no nematode species such as Dohuk, Sulaymaniyah, Erbil, and Anbar cities. Molecular analyses using 28S genes confirmed that the isolated nematodes were Heterorhabditis indica (OQ653109.1), Heterorhabditis bacteriophora (OR243201.1), and Steinernema carpocapsae (OR243196.1).. KEYWORDS :28S gene, Entomopathogens, EPNs, Heterorhabditis, Molecular identification, Steinernema
19
Çimen, H., M. M. Lee, J. Hatting, S. Hazir, and S. P. Stock. "Steinernema innovationi n. sp. (Panagrolaimomorpha: Steinernematidae), a new entomopathogenic nematode species from South Africa." Journal of Helminthology 89, no. 4 (April 3, 2014): 415–27. http://dx.doi.org/10.1017/s0022149x14000182.
Full textAbstract:
AbstractMorphological and molecular sequence data were combined with cross-hybridization studies and used to identify a new Steinernema sp. from Free State, South Africa. Molecular and morphological data indicate that the new species belongs to the ‘glaseri-group’ of Steinernema spp. Key morphological diagnostic characters for S. innovationi n. sp. include the morphometric features of the third-stage infective juveniles: total body length = 1054 (1000–1103) μm, tail length = 108 (97–117) μm, location of the excretory pore = 88 (82–91) μm, and D% = 58 (54–63), E% = 115 (104–137) and H% = 43 (37–46). Additionally, the morphology of the spicules and gubernaculum of the first-generation males are considered key diagnostic traits. Steinernema innovationi n. sp. was also characterized by analysis of both rDNA and mitochondrial gene sequence data, which further indicate the uniqueness of this Steinernema species.
20
Ngugi, C. N., P. M. Wachira, J. N. Mbaka, S. Okoth, S. Haukeland, and E. G. Thuranira. "Biocontrol Potential of Four Indigenous Entomopathogenic Nematodes From Kenya." Journal of Agricultural Science 13, no. 10 (September 15, 2021): 107. http://dx.doi.org/10.5539/jas.v13n10p107.
Full textAbstract:
Globally, vegetable production including tomato is constrained by pests and diseases. The tomato leafminer, Tuta absoluta (Meyrick.), is a major pest of tomato, mainly managed using chemical pesticides. There is a need for integrated pest management (IPM), approaches that are human and environmentally friendly. The study aimed at molecular identification and virulence evaluation of four entomopathogenic nematodes (EPNs) against T. absoluta larvae. The DNA was extracted, sequenced, and phylogeny analyzed. The EPNs virulence was evaluated using the insect baiting technique at different nematode concentrations (0-Control, 100, 150, 200, and 250 infective juveniles/ml of distilled water). Larval mortality data were collected for five days. Molecular identification resulted in nucleotide sequence lengths of 877-895 base pairs (bp). All the isolates were found to be Steinernema species of EPNs. The % similarity of the isolates and their close relatives ranged between 82-100%. The isolates closely matched Steinernema spp. AY230184 (Sri Lanka); AY230186 (Kenya), JN651414 (Ethiopia), and MW151701 (Kenya). The sequences were deposited to Genbank as Steinernema sp. Isolate Kalro 75 (MW150871), Steinernema sp. Isolate Kalro S86 (MW150872), Steinernema sp. isolate Kalro97 (MW150873) and Steinernema sp. Isolate KalroR52 (MW150874). All the EPN isolates were virulent against T. absoluta. Isolate Kalro R52 and Kalro S86 recorded the highest mortality of 76±7.5%; 72±15.0% respectively in the 48 h. There was a significant difference (P < 0.001), between all the isolates and the Control. The four EPNs were virulent and have bio-control potential against, T. absoluta. Research on their virulence against T. absoluta in the field is recommended.
21
Godjo, Anique, Leonard Afouda, Hugues Baimey, Marjolein Couvreur, Lionel Zadji, Gladys Houssou, Wim Bert, Anne Willems, and Wilfrida Decraemer. "Steinernema kandii n. sp. (Rhabditida: Steinernematidae), a new entomopathogenic nematode from northern Benin." Nematology 21, no. 2 (2019): 107–28. http://dx.doi.org/10.1163/15685411-00003201.
Full textAbstract:
Summary Two nematode isolates from the genus Steinernema were collected in northern Benin. Morphological, morphometric, molecular and cross-hybridisation studies placed these nematodes into a new species, Steinernema kandii n. sp., within the bicornutum-group. Phylogenetic analyses based on both ITS and D2-D3 regions of 28S rDNA revealed that S. kandii n. sp. is different from all known Steinernema species and sister to S. abbasi (97.3-97.6% ITS nucleotide similarity) and S. bifurcatum (98.3-98.4% D2-D3 similarity). Steinernema kandii n. sp. can be separated from other members of the bicornutum-group by the greater infective juvenile (IJ) max. body diam. of 35 (27-48) μm (type isolate). It differs from S. abbasi by the greater IJ body length 707 (632-833) μm (type isolate), EP distance 55 (52-60) μm (type isolate), spicule length 67 (57-75) μm (type isolate) and the occurrence of one pair of genital papillae at the cloacal aperture.
22
Tumialis, D., M. Łopieńska, A. Mazurkiewicz, E. Pezowicz, and I. Skrzecz. "Identification and intraspecific variability of Steinernema feltiae (Filipjev, 1934) isolates from different localities in Poland." Helminthologia 53, no. 3 (September 1, 2016): 304–8. http://dx.doi.org/10.1515/helmin-2016-0030.
Full textAbstract:
Summary Presented study is part of a project aimed at identifying entomopathogenic nematode (EPN) species and analysing their distribution in various habitats of Poland. Here, an attempt was undertaken to determine intraspecific variability of nematodes of the species Steinernema feltiae isolated from seven different localities in central and southern Poland. Molecular characteristic and phylogenetic analysis was performed based on nucleotide sequences in the ITS region. Research on the occurrence of EPNs in Poland have been conducted since the 1990s but there is still no data verified genetically, as well as data on the intraspecific variability of isolates Steinernema feltiae. This paper reports initial results of intraspecific variability Steinernema feltiae in Poland.
23
Pervez, R., S. J. Eapen, and S. Devasahayam. "Description of a new species of entomopathogenic nematode, Steinernema ramanai sp. n. from Kerala, India." Journal of Environmental Biology 45, no. 2 (March 23, 2024): 210–17. http://dx.doi.org/10.22438/jeb/45/2/mrn-5033.
Full textAbstract:
Aim: A novel species of entomopathogenic nematode (EPN) belonging to genus Steinernema was discovered in the rhizosphere of ginger grown at Kozhikode, Kerala, India. Methodology: Morphological and molecular characterization of new species of Steinernema and its phylogenetic relationships with other Steinernema species were investigated using DNA extracted and amplified rDNA of the ITS region using primers 18S (FORWARD) 5' TTGATTACGTCCCTGCCCTTT 3' and 26S (REVERSE) 5' TTTCACTCGCCG TTACTAAGG 3'. Results: New species described based on the length of infective juvenile, which was the smallest species among the described Steinernema species. S. ramanai sp. n. has five incisures in the lateral field, an elongate conoid tail that gradually tapered at the tip in infective juveniles; vulva with double flapped epipytigma and tail without post anal swelling in females; body 'J' shaped upon fixation, ten genital papillae, and a mucron on the tail terminus in males. This new species is distinguished genetically by its unique rDNA ITS region nucleotide sequence. The ITS sections of ribosomal DNA were sequenced to confirm this new species. Interpretation: Native EPNs may yield species and/or strains that are better suited for inundative release against local pests. This logic has prompted coordination of several surveys in the search for novel species and strains, particularly in areas where EPNs had previously remained undetected. Key words: Biocontrol, Morphology, Molecular characterization, Steinernema, Taxonomy
24
Lewis, E. E., S. Selvan, J. F. Campbell, and R. Gaugler. "Changes in foraging behaviour during the infective stage of entomopathogenic nematodes." Parasitology 110, no. 5 (June 1995): 583–90. http://dx.doi.org/10.1017/s0031182000065306.
Full textAbstract:
SUMMARYStudies of foraging strategies are often complicated by competing goals of the forager. In contrast, non-feeding infective juvenile entomopathogenic nematodes forage exclusively for a single host. Two questions were posed: (1) what is the relationship between metabolic rate, energy reserves and foraging strategy and (2) when a foraging strategy fails, will an infective-stage parasite switch strategies? Three species of entomopathogenic nematodes were stored in water and changes in their behaviour, metabolic rate, energy reserves, and infectivity were measured throughout the storage period. Steinernema carpocapsae ambushes insect hosts, whereas S. glaseri and Heterorhabditis bacteriophora cruise forage. Steinernema carpocapsae was least active and had the lowest metabolic rate. Heterorhabditis bacteriophora was more active and had the highest metabolic rate. Steinernema glaseri was most active and had an intermediate metabolic rate. Neither cruising species changed foraging strategy. Steinernema carpocapsae decreased nictation (a behaviour associated with ambushing only) and increased their locomotory rate. Any change in searching strategy occurred without assessment of the profitability or distribution of potential hosts, but the advantage this confers is unknown.
25
S, Prabhu, and M. John Sudheer. "EVALUATION OF TWO NATIVE ISOLATES OF ENTOMOPATHOGENIC NEMATODES STEINERNEMA SP. AND HETERORHABDITIS INDICA FROM ANDHRA PRADESH AGAINST AMSACTA ALBISTRIGA WALK IN GROUNDNUT." Journal of Biopesticides 1, no. 2 (December 1, 2008): 140–42. http://dx.doi.org/10.57182/jbiopestic.1.2.140-142.
Full textAbstract:
The efficacies of two native entomopathogenic nematodes viz., Steinernema sp. and Heterorhabditis indica was evaluated under laboratory and microplot conditions against red hairy caterpillar Amsacta albistriga walk in groundnut.80% and 42% of mortality was observed in filter paper assay within 24 h by H. indica and Steinernema sp. respectively. Steinernema was more virulent against 2nd and 3rd instar larvae, while H. indica showed virulence at all the stages. Microplot application of H. indica at 100000 IJ/ml showed more efficient control than other concentrations. Entomopathogenic nematodes remain viable in soil upto 3 months after treatment. To the best of author’s knowledge this is the first report of using entomopathogenic nematodes against red hairy cateriplllar.
26
Tumialis, D., R. Gromadka, I. Skrzecz, E. Pezowicz, A. Mazurkiewicz, and E. Popowska - Nowak. "Steinernema kraussei (Steiner, 1923) (Rhabditida: Steinernematidae) — the first record from Poland." Helminthologia 51, no. 2 (June 1, 2014): 162–66. http://dx.doi.org/10.2478/s11687-014-0224-9.
Full textAbstract:
Abstract This study reports the first record of Steinernema kraussei from Poland. The nematode was isolated from coniferous woodlands in 4 localities in central Poland. Preliminary identification of the species was done based on morphometric measurements. To confirm nematode species of the genus Steinernema the result was supported by the description of the ITS region.
27
Richardson, Paul, Gary Keane, Steve Long, and Deena Willmott. "Use of a monoclonal antibody in a field evaluation of the persistence and infectivity of Steinernema n. sp. D1 (Nematoda: Steinernematidae)." Nematology 2, no. 4 (2000): 425–34. http://dx.doi.org/10.1163/156854100509286.
Full textAbstract:
AbstractAt the end of a mushroom cropping house trial designed to determine the infectivity, to phorid flies, of the entomopathogenic nematode Steinernema D1 (isolate IOW45), the spent, nematode-infested substrate was deposited as a stack on the edge of a field. The introduced population of Steinernema D1 (IOW45) was monitored by bi-monthly sampling for eight months. The infectivity, to Galleria mellonella larvae, of nematodes extracted from cores of substrate taken from the stack, was determined. There was a decline (P < 0.01) in the numbers of nematodes extracted on each of the sample dates. After the first sample was taken, fewer (P < 0.001) nematodes were recovered from the top layer of the stack than from the bottom or middle layers. Nematode infectivity declined (P < 0.001) over the first two months in the field and then remained at a constant low level until month 8, when no G. mellonella were parasitised. After removal of the stack, subsequent soil samples taken from plots that had been underlying, or adjacent to it, were baited with G. mellonella larvae. Samples of the haemolymph taken from larvae that died in the soil were tested with a monoclonal antibody specific to the bacterial symbiont (Xenorhabdus sp.) of Steinernema D1 (IOW45). Using this method, Steinernema D1 (IOW45) was detectable in soil that had been underlying the compost stack for as long as 12 months after compost deposition. Utilisation d'anticorps monoclonaux pour l'évaluation au champ de la persistanceet du pouvoir infestant de Steinernema n. sp. D1 (Nematoda: Steinernematidae) - A la fin d'un essai sur une culture de champignons sous abri, essai destiné à déterminer le pouvoir infestant du nématode entomopathogène Steinernema D1 (isolat IOW45) envers des Diptères Phoridae, le substrat utilisé, infesté de nématodes, a été rassemblé en une meule, au coin du champ. La population de Steinernema D1 (IOW45) a ensuite été évaluée par des prélèvements bimensuels pendant 8 mois. Le pouvoir infestant des nématodes envers des larves de Galleria mellonella a été déterminé en prélevant des carottes dans la meule de substrat. Il s'est révélé que le nombre de nématodes extraits diminue (P < 0,01) au cours des prélèvements successifs. Après le premier prélèvement, il est récupéré moins de nématodes (P < 0,001) au sommet de la meule qu'au milieu ou au bas de celle-ci. Au champ, le pouvoir infestant du nématode décroit (P < 0,001) pendant les 2 premiers mois et reste ensuite au même niveau jusqu'au huitième mois où aucun G. mellonella n'est plus parasité. Après enlèvement de la meule, des échantillons supplémentaires dans le sol situé sous la meule ou à proximité de celle-ci ont été pourvus d'appâts (larves de G. mellonella). Des échantillons d'hémolymphe provenant de larves mortes dans le sol ont été testés à l'aide d'un anticorps monoclonal spécifique de la bactérie symbiote (Xenorhabdus sp.) de Steinernema D1 (IOW45). En utilisant cette méthode, Steinernema D1 (IOW45) peut être détecté dans le sol situé sous la meule pendant une période d'au moins 2 mois après l'enlèvement du compost.
28
Lewis, Edwin E., Randy Gaugler, and Robert Harrison. "Response of cruiser and ambusher entomopathogenic nematodes (Steinernematidae) to host volatile cues." Canadian Journal of Zoology 71, no. 4 (April 1, 1993): 765–69. http://dx.doi.org/10.1139/z93-101.
Full textAbstract:
Two species of entomopathogenic nematodes, an ambush forager (Steinernema carpocapsae) and a cruising forager (S. glaseri), were assayed for their responses to volatiles associated with Galleria mellonella (Insecta: Lepidoptera). The responses of entomopathogenic nematodes to six host-associated volatile treatments were assayed. Live G. mellonella, live G. mellonella with the cuticular hydrocarbons removed, live G. mellonella with carbon dioxide removed, dead G. mellonella, dead G. mellonella with the cuticular hydrocarbons removed, and volatiles from S. exiqua feces were assayed in a Y-tube choice aparatus. Steinernema glaseri were attracted only to treatments producing carbon dioxide. Steinernema carpocapsae showed no significant response to any treatments tested. To assess the directionality of the response toward live G. mellonella, net average movement per nematode after 5, 10, and 20 min was measured for both nematode species. The assay method was based on the "quadrant plate" bioassay, with a 9 cm Petri dish containing 2% agar. Steinernema carpocapsae showed little directionality of response, whereas S. glaseri was attracted to carbon dioxide. We conclude that carbon dioxide attracts S. glaseri to areas likely to hold hosts. Ambush foragers are less influenced by cues associated with hosts or their habitat.
29
Aguillera, Marineide M., Nancy C. Hodge, Robert E. Stall, and Grover C. Smart. "Bacterial Symbionts of Steinernema scapterisci." Journal of Invertebrate Pathology 62, no. 1 (July 1993): 68–72. http://dx.doi.org/10.1006/jipa.1993.1076.
Full text
30
Abdel-Ghany, Hoda S. M., Heba F. Alzan, Seham H. M. Hendawy, Hanan A. Elsadawy, and Sobhy Abdel-Shafy. "In vitro evaluation of the effect of entomopathogenic nematodes on different developmental stages of the brown dog tick Rhipicephalus sanguineus (Acari: Ixodidae)." Acarologia 64, no. 2 (June 30, 2024): 323–34. http://dx.doi.org/10.24349/1hyi-f1vq.
Full textAbstract:
The brown dog tick, Rhipicephalus sanguineus (R. sanguineus) is a worldwide ectoparasite of veterinary and medical concern. Entomopathogenic nematodes (EPNs) of the genera Steinernema and Heterorhabditis are occasionally used as bio-control agents for external parasites such as ticks and flies. This study aimed to evaluate the effect of five different concentrations of the EPNs Heterorhabditis bacteriophora HP88 and Steinernema sp. SII [4000, 2000, 1000, 500, and 250 infective juveniles per milliliter (IJs/ml)] on different developmental stages of R. sanguineus ticks. The EPN application caused mortality in both engorged larvae and newly molted nymphs [H. bacteriophora HP88 (10% - 40%) and Steinernema sp. SII (10% - 18%)]. However, mortality was much higher in both engorged nymphs and newly molted adults (54% - 82% with H. bacteriophora HP88 and 84% - 96% with Steinernema sp. SII). Both EPNs were 100% effective on engorged females 9 days post-exposure. As this life stage was the most susceptible, it was used to calculate the LC (lethal concentration) values in order to determine which EPN was most virulent. The LC<sub>50</sub> and LC<sub>95</sub> at 5 days post-exposure were 76 and 5421 IJs/ml for H. bacteriophora HP88 and 885 and 5700 IJs/ml for Steinernema sp. SII, respectively. In conclusion, although the efficacy of the two EPN species differed among tick life stages, both nematode species can induce mortality and could be used as an alternative option for the biological control of non-parasitic (off-host) tick stages.
31
Ahmed, Naglaa, Amna Maklad, Samia Yassin, and Shaker Abolmaaty. "Biochemical effects of Steinernema feltiae, Steinernema riobrave and Heterorhabditis bacteriophora on Spodoptera littoralis larvae." Egyptian Academic Journal of Biological Sciences. C, Physiology and Molecular Biology 6, no. 1 (June 1, 2014): 23–34. http://dx.doi.org/10.21608/eajbsc.2014.16044.
Full text
32
Menti, Hara, Denis Wright, and Roland Perry. "Infectivity of populations of the entomopathogenic nematodes Steinernema feltiae and Heterorhabditis megidis in relation to temperature, age and lipid content." Nematology 2, no. 5 (2000): 515–21. http://dx.doi.org/10.1163/156854100509439.
Full textAbstract:
AbstractThe infectivity of populations of the entomopathogenic nematodes Steinernema feltiae and Heterorhabditis megidis from Greece (GR) and the UK was compared using Galleria mellonella larvae as hosts. Dose-response tests showed that the two Steinernema populations did not differ in their establishment rates but they were more infective than H. megidis UK 211. The temperature range for infectivity was greater than that for development. However, the optimal temperature for infection and development for all populations was 23°C. Infectivity of Steinernema populations was not affected by storage for 12 weeks. However, 12 week-old H. megidis UK 211 infective juveniles (IJ) were less infective than fresh IJ. H. megidis GR showed very low establishment rates at all the doses and temperatures tested, before and after storage. The results are discussed in relation to the nematodes' climatic origin and lipid content. Pouvoir infestant de populations des nématodes entomopathogènes Steinernema feltiae et Heterorhabditis megidis suivant la température, l'âge et le contenu lipidique - Le pouvoir infestant de populations des nématodes entomopathogènes Steinernema feltiae et Heterorhabditis megidis provenant de Grèce et du Royaume Uni a été comparée, utilisant comme hôte Galleria mellonella. Les tests de dose/réaction ont montré que les taux d'établissement des deux populations ne diffèrent pas mais que leur pouvoir infestant était plus élevée que celle de H. megidis UK211. La plage des températures permettant l'infestation était plus étendue que celle relative au développement. Cependant, les températures optimales pour l'infestation et pour le développement étaient l'une et l'autre de 23°C pour toutes les populations. L'infestivité des populations de Steinernema n'a pas été affectée par un stockage de 12 semaines. Les juvéniles infestants de H. megidis UK211 âgés de 12 semaines montraient toutefois une infestivité plus faible que celle d'individus frais. Les specimens de H. megidis provenant de Grèce présentaient - que ce soit avant ou après le stockage - des taux d'établissement très faibles pour toutes les doses et les températures testées. Ces résultats sont discutés en relation avec l'origine climatique et le contenu lipidique des nématodes.
33
Tumialis, Dorota, Elżbieta Pezowicz, Iwona Skrzecz, Anna Mazurkiewicz, Justyna Maszewska, Joanna Jarmuł Pietraszczyk, and Kornelia Kucharska. "Occurrence of entomopathogenic nematodes in Polish soils." Ciência Rural 46, no. 7 (July 2016): 1126–29. http://dx.doi.org/10.1590/0103-8478cr20151542.
Full textAbstract:
ABSTRACT: Entomopathogenic nematodes ( Steinernematidaeand Heterorhabditidae) were studied in Polish soils according to the: season, habitat and altitude. In total, 167 soil samples were taken from 111 localities in Poland along north-south transect. Entomopathogenic nematodes were isolated from 53 soil samples (31.7%). Nematodes species were identified genetically from 16 samples, and in all other 37 samples nematodes were determined to the genus level. Three species of the genus Steinernema ( Steinernema kraussei, S. feltiae, S. carpocapsae) and one of the genus Heterorhabditis( Heterorhabditis megidis) were recorded. Steinernema feltiaewas the most common species. There was not a significant association between the occurrence of nematodes and season or altitude. The type of habitat significantly (P<0.05) affected the occurrence of nematodes. Nematodes were most frequent in samples collected from coniferous forests (20 findings).
34
Ngugi, C. N., P. M. Wachira, J. N. Mbaka, S. Okoth, S. Haukeland, H. M. Mburu, M. Adhiambo, and D. K. Sirengo. "Characterization and Pathogenicity Test of Entomopathogenic Nematode Steinernema Species-Kalro." Journal of Agricultural Science 13, no. 3 (February 15, 2021): 93. http://dx.doi.org/10.5539/jas.v13n3p93.
Full textAbstract:
Entomopathogenic nematodes (EPNs) are worldwide soil-dwelling insect parasitic nematodes. They are potential pest bio-control agents a key component of Integrated Pest Management (IPM) programs. This study aimed to characterize and evaluate the pathogenicity of an EPN isolate from Kenya. The nematode was isolated from soils using insect bait technique and both morphological and molecular identification was performed. Efficacy of the isolate was evaluated against Tomato leafminer larvae (Tuta absoluta Meyrick.) using dose-based treatments of 0-control, 100, 150, 200, and 250 infective juveniles (IJs/ml). Morphological analysis revealed body length (L) of 835(659-987) µm and 1781 (1297-2097) µm from fresh IJs and males respectively. Males lacked a mucron. The isolate was characterized by the partial sequence length of 877 bp of the ITS region. Blastn results indicated the EPN isolate had a similarity match of 81-92% with Afro-tropical Steinernema species. It matched with Steinernema sp. (AY230186.1) from Kenya at 92% and Sri Lanka (AY230184.1). Phylogenetic analysis placed the isolate together with Steinernema sp. (AY230186.1) and (AY230184.1) with a bootstrap value of 100%. Maximum mean larval mortality (80%; 96%) was achieved 24 and 48 h post-treatment at concentration 150 IJs/ml. All nematode concentrations achieved over 50% mean mortality after 24 h period. There was a significant difference (P = 0.001) between doses 150 and 200 IJs/ml. From the study, it was concluded that the nematode isolate was Steinernema sp now referred to as Steinernema sp. Kalro (Genebank Accession MW151701). The EPN has the potential for development as a biological control agent against T. absoluta.
35
Edgington, Steve, Alan G. Buddie, Dave Moore, Andrés France, Loreto Merino, Lukasz M. Tymo, and David J. Hunt. "Diversity and distribution of entomopathogenic nematodes in Chile." Nematology 12, no. 6 (2010): 915–28. http://dx.doi.org/10.1163/138855410x498897.
Full textAbstract:
Abstract A systematic programme of surveys for entomopathogenic nematodes (EPN) was done in Chile between 2006 and 2008. The survey spanned the principal ecosystems of mainland Chile as well as a number of islands, and covered a wide range of habitats including the Atacama Desert, Andean Altiplano, temperate rainforests and subpolar territory. Nearly 1400 soil samples were collected, of which 7% were positive for EPN. Of 101 EPN isolates obtained, 94 were Steinernema spp. and seven were Heterorhabditis sp. Of the 94 Steinernema isolates, 39 were identified as Steinernema feltiae, the remainder being distributed between two new species, S. unicornum (52 records) and S. australe (three records). The Heterorhabditis isolates, all designated as Heterorhabditis sp.1, are referred to herein as H. cf. safricana. Steinernema feltiae and S. unicornum were collected predominately in the south of Chile and were obtained from a range of habitats, including forests, open grassland, montane soils and coastal zones; neither species was recovered from the far north of the country (viz., desert soils in the Norte Grande region). Steinernema australe was found in only three soil samples, all from humid, cool, coastal localities in the south. Heterorhabditis cf. safricana was recovered from the northern regions, with most isolates found in or on the periphery of the Atacama Desert; they were not recovered from cooler, more humid regions of southern Chile. Molecular information indicated there were two subgroups of both S. unicornum and S. feltiae, with a geographical, intraspecific split of subgroups between the most southerly and the more central survey zones. All isolates were collected by ex situ baiting with waxmoth larvae and the natural hosts are unknown.
36
Sunarto, Toto, and Fahira Endaningsih Pubarianto. "Effect of Concentration of Entomopathogenic Nematodes (Steinernema spp.) to Bemisia tabaci Genn. (Hemiptera; Aleyrodidae) On Red Chili Plants." CROPSAVER - Journal of Plant Protection 4, no. 2 (January 22, 2022): 45. http://dx.doi.org/10.24198/cropsaver.v4i2.35979.
Full textAbstract:
Bemisia tabaci is an important pest on red chili plants. The entomopathogenic nematodes Steinernema spp. has the potential to control insect pest populations. The purpose of this study was to obtain the concentration of Steinernema spp. the most effective in controlling B. tabaci on red chili plants. The experiment was conducted at the Greenhouse, Faculty of Agriculture, Universitas Padjadjaran, Jatinangor, from January to September 2020. The study used experimental methods in-vitro and in-vivo. The in-vitro experiment used a completely randomized design to observe the mortality of B. tabaci. The in-vivo experiment used a Randomized Block Design to observe the population of B. tabaci. The experiment consisted of seven treatments and four replications. The treatments consisted of: control (without Steinernema spp.), 50, 100, 150, 200, 250, and 300 IJ/ml (IJ = third infective juvenile). Each treatment was infested with 20 second nymphs B. tabaci and using red chili plants 30 days after planting. The results showed that the entomopathogenic nematode Steinernema spp. at a concentration of 300 IJ/ml, the most effective in causing mortality of B. Tabaci and at concentration of 100 IJ/ml can suppress B. tabaci population on chilli plant at lower level in 12 days after application.
37
San-Blas, Ernesto, Barbara Pembroke, and Simon Gowen. "Scavenging or infection? Possible host choosing by entomopathogenic nematodes." Nematology 10, no. 2 (2008): 251–59. http://dx.doi.org/10.1163/156854108783476359.
Full textAbstract:
AbstractEntomopathogenic nematodes are able to survive by scavenging. We tested Steinernema feltiae, S. affine and Heterorhabditis megidis alone or in different combinations to evaluate the responses of these nematodes when dead or live Galleria mellonella larvae were offered. Steinernema feltiae and S. affine scavenged upon dead G. mellonella larvae and about 30% more dead larvae were penetrated than live ones. By contrast, H. megidis penetrated more live larvae than dead ones. When the nematode species were combined, the results varied among the combinations, but the dead larvae were always used as a host. The behaviour of natural field populations of S. feltiae and S. affine was also compared. Steinernema feltiae showed no difference between scavenging and performing 'normal infections', whereas S. affine scavenged to a reduced amount (around 60% less); this difference could be related to the particular foraging strategy of these nematodes.
38
Piggott, Simon, Roland Perry, and Denis Wright. "Hypo-osmotic regulation in entomopathogenic nematodes: Steinernema spp. and Heterorhabditis spp." Nematology 2, no. 5 (2000): 561–66. http://dx.doi.org/10.1163/156854100509349.
Full textAbstract:
Abstract Entomopathogenic nematodes were incubated in a balanced salt solution based on soil water analysis, supplemented with different concentrations of sodium chloride. Two nematode isolates from Malaysia, Steinernema sp. SSL85 (isolate 25) and Heterorhabditis indicus (isolate 11), showed an initial loss of water during the first 6 h of incubation in hyper-osmotic media (200 and 1000 mOsmKg-1) followed by a complete recovery of their water content during the next 18-48 h. A third Malaysian isolate, Steinernema sp. (M1), showed a more limited ability to regulate its water content. Studies on a wild type H. megidis (UK 211) and one desiccation tolerant mutant indicate that the ability for hypo-osmotic regulation does not necessarily involve permeability differences in the cuticle. Régulation hypo-osmotique chez les nématodes entomopathogènes: Steinernema spp. et Heterorhabditis spp. - Des nématodes entomopathogènes ont été mis en incubation dans une solution saline, équilibrée en fonction d'une analyse de l'eau contenue dans le sol, et additionnée de chlorure de sodium en concentration variable. Deux isolats de nématodes provenant de Malaisie, Steinernema sp. SSL 85 (isolat 25) et Heterorhabditis indicus (isolat 11), ont montré une perte initiale d'eau au cours des 6 premières heures d'incubation dans un milieu hyperosmotique (200 et 1000 mOsmKg-1), perte suivie par un rétablissement complet du contenu hydrique au cours des 18 à 48 h suivantes. Un troisième isolat malaisien, Steinernema sp. (M1) a montré une capacité plus limitée à réguler son contenu hydrique. Des études ayant concerné un type sauvage d' H. megidis (UK 211) et un mutant tolérant vis-à-vis de la dessication ont montré que la capacité d'une régulation hypo-osmotique n'infère pas une différence dans la perméabilité de la cuticule.
39
Chaerani, Chaerani, Y. Suryadi, T. P. Priyatno, D. Koswanudin, U. Rahmat, Sujatmo Sujatmo, Yusuf Yusuf, and C. T. Griffin. "ISOLASI NEMATODA PATOGEN SERANGGA STEINERNEMA DAN HETERORHABDITIS." Jurnal Hama dan Penyakit Tumbuhan Tropika 7, no. 1 (March 4, 2007): 1–9. http://dx.doi.org/10.23960/j.hptt.171-9.
Full textAbstract:
Isolation of Entomopathogenic Nematodes Steinernema and Heterorhabditis. Entomopathogenic nematodes from the genus Steinernema and Heterorhabditis (Rhabditida: Steinernematidae and Heterorhabditidae) are promising biological control agent of insect pests. Indigenous nematodes have been isolated and collected for the use in local biological control program of important insect pests. The nematodes were isolated using soil baiting method with insect larvae. Laboratory tests have shown that the mealworm larvae Tenebrio molitor (Coleoptera: Tenebrionidae) served as a good alternative to the standard insect bait, the greater wax moth larvae Galleria mellonella (Lepidoptera: Galleriidae) for isolation and maintenance of nematodes. Both nematodes were successfully isolated using T. molitor larvae from 13% soil samples (26 out of a total of 207) collected from 14 locations in West and Central Java and Lampung provinces in the period of 1993 until 2006. Heterorhabditis (9%) was more prevalent than Steinernema (4%). Both nematodes were successfully propagated on mealworm larvae.
40
Premachandra, Dammini, Christian Borgemeister, Oliver Berndt, Ralf-Udo Ehlers, and Hans-Michael Poehling. "Laboratory bioassays of virulence of entomopathogenic nematodes against soil-inhabiting stages of Frankliniella occidentalis Pergande (Thysanoptera: Thripidae)." Nematology 5, no. 4 (2003): 539–47. http://dx.doi.org/10.1163/156854103322683256.
Full textAbstract:
Abstract The efficacy of entomopathogenic nematodes (EPN) was evaluated in a laboratory trial against soil-dwelling stages, late second instar larvae and pupal stages of western flower thrips (WFT), Frankliniella occidentalis Pergande. Among the six EPN strains assessed for the first time, Steinernema feltiae (Nemaplus®) and Heterorhabditis bacteriophora (HD01) caused 65 and 59% mortality, respectively. Steinernema carpocapsae (Agriotos) and S. arenarium (Anomali) caused moderate mortality (40-45%) while Steinernema spp. (Morocco) and H. bacteriophora (Nematop®) had little effect. In a dose response study with concentrations of 100, 400 and 800 infective juveniles (IJ) per cm2 soil of H. bacteriophora (HK3), S. feltiae (Nemaplus®) and H. bacteriophora (HD01), mortality increased only up to 400 IJ cm-2. The rate of infectivity of H. bacteriophora (HK3) and S. feltiae (Nemaplus®) indicated that both strains could survive at least 6 days in the soil and infect WFT immature stages.
41
Qiu, Lihong, Yong Zhou, Khuong Nguyen, Xianqi Hu, and Yi Pang. "Steinernema beddingi n. sp. (Nematoda: Steinernematidae), a new entomopathogenic nematode from Yunnan, China." Nematology 7, no. 5 (2005): 737–49. http://dx.doi.org/10.1163/156854105775143026.
Full textAbstract:
AbstractA new entomopathogenic nematode (EPN), described here as Steinernema beddingi n. sp., was recovered from a single soil sample collected from a cabbage field in the suburb of Kunming, Yunnan province, China, during an EPN survey in 2002. DNA sequences of both the D3 domain of 28S and the ITS regions of rDNA showed congruently that S. beddingi n. sp. clustered with S. affine and S. intermedium but was clearly distinguished from both. The new species can be separated from all other described species of Steinernema, including the two most closely related species mentioned above, by morphological characters of various stages of the nematode, including lateral field pattern and tail shape of infective juvenile, the spicule and gubernaculum shape of the first generation male, and the tail morphology of the first generation female. Steinernema beddingi n. sp. can also be separated from S. affine and S. intermedium by cross-breeding tests.
42
Özdemir, Esengül, Şerife Bayram, and İ. Alper Susurluk. "First Record of the Entomopathogenic Nematode Steinernema litorale (Filipjev) (Rhabditida: Steinernematidae) and Its Symbiotic Bacterium from Turkey, and Its Efficacy Capability." Insects 11, no. 3 (February 25, 2020): 144. http://dx.doi.org/10.3390/insects11030144.
Full textAbstract:
The entomopathogenic nematode Steinernema litorale was isolated from Çamkoru Nature Park located in Ankara, Turkey, in September 2018. Steinernema litorale was recovered in 1 of 67 soil samples from a natural forest area; the soil was characterised as sandy loam. The isolated nematode S. litorale was identified based on morphological and molecular parameters. The symbiotic bacterium of S. litorale was determined as Xenorhabdus bovienii. Steinernema litorale was found for the first time in Turkey and the Middle East. The virulence of the isolate was tested on Galleria mellonella larvae. Different concentrations of the nematode (10, 25, 50, 75, and 100 infective juveniles (IJs/larvae) were used. While the LC50 values at 48 h, 72 h, and 96 h were 153.419, 51.005, and 15.439 IJs, respectively, and the LT50 values at 75 IJs and 100 IJs showed that this isolate is capable to control insect larvae within 50.083 and 36.266 h, respectively.
43
Zuluaga Cárdenas, Paola Andrea, Ana Milena Caicedo Vallejo, Nancy Cardozo Santamaría, Jaime Eduardo Muñoz Flórez, and Arturo Carabalí Muñoz. "Entomopatógenos asociados a cítricos y su patogenicidad sobre Compsus viridivittatus Guérin-Méneville (Coleoptera: Curculionidae)." Corpoica Ciencia y Tecnología Agropecuaria 16, no. 2 (January 21, 2016): 293. http://dx.doi.org/10.21930/rcta.vol16_num2_art:374.
Full textAbstract:
<p><span style="font-size: medium;">C. viridivittatus, picudo de los cítricos está distribuido en región andina y cafetera de Colombia. Las larvas se alimentan de raíces y los adultos de hojas y flores. En tres fincas citrícolas del Valle del Cauca se aislaron y evaluaron hongos y nematodos entomopatógenos M. anisopliae y B. bassiana y Steinernema sp. y Heterorabditis sp. Sobre larvas de C. viridivittatus 26, 36, 48 y 53 días de edad. En 120 de 132 muestras de suelo se encontraron 21 aislamientos de Metarhizium y Beauveria y ninguna con nematodos entomopatógenos. B. bassiana comercial, B9 y B10 causaron el 100 % de mortalidad en adultos en 4 y 4,3 días. M. anisopliae M6 y M7 causaron el 94 % y 97 % de mortalidad a los 4,3 y 5 días. Steinernema sp. UNS09 causó 65 % de mortalidad sobre larvas de 48 y 53 días de edad en siete días. No hubo diferencia entre Steinernema UNS09 y Heterorhabditis UNH16. Steinernema sp. UNS09 causó 85,7 % mortalidad a larvas de 53 días y 81,9 % y 81,1 % a larvas de 36 y 26 días y Heterorhabditis sp. UNH16 con 79 %, 81 % y 75,4 % de mortalidad sobre larvas de 36, 26 y 56 días a los siete días. En síntesis, los hongos y nematodos entomopatógenos pueden considerarse como alternativa de manejo de larvas de C. viridivittatus.</span></p>
44
Price, Claire, Heather Campbell, and Tom Pope. "Potential of Entomopathogenic Nematodes to Control the Cabbage Stem Flea Beetle Psylliodes chrysocephala." Insects 14, no. 7 (July 24, 2023): 665. http://dx.doi.org/10.3390/insects14070665.
Full textAbstract:
Cabbage stem flea beetle (CSFB) is an important pest of oilseed rape that was controlled by neonicotinoid seed treatments until they were banned for this use in 2013. Since then, CSFB has been a difficult pest to control, partly due to widespread resistance to pyrethroid insecticides. Alternate solutions are necessary. Here, four entomopathogenic nematode (EPN) species were tested against CSFB adults under laboratory conditions. In addition, a bioassay was completed to test for EPN compatibility with a range of adjuvants (glycerin, xanthan gum and flame retardant) to protect EPNs from UV radiation and desiccation. Results show that EPNs have the potential to control CSFB adults under laboratory conditions. Heterorhabditis bacteriophora caused 75% CSFB mortality at a concentration of 4000 nematodes/mL after six days, Steinernema feltiae caused 80% CSFB mortality when applied at a concentration of 40,000 nematodes/mL after two days, Steinernema carpocapsae caused 85% mortality at a concentration of 10,000 nematodes/mL after six days, and Steinernema kraussei caused no more than 70% CSFB mortality overall compared to the water control, which led to 23% mortality. Steinernema feltiae and H. bacteriophora survival was 100% when exposed to adjuvants, except S. feltiae with glycerin and H. bacteriophora with flame retardant. Further research to evaluate the efficacy of EPN and adjuvants under field conditions is necessary.
45
Menti, Hara, Mavji Patel, Denis Wright, and Roland Perry. "Lipid utilisation during storage of the entomopathogenic nematodes Steinernema feltiae and Heterorhabditis megidis from Greece and the UK." Nematology 5, no. 1 (2003): 31–37. http://dx.doi.org/10.1163/156854102765216669.
Full textAbstract:
Abstract The total lipid (TL) content and the fatty acid composition of the different lipid classes in infective juveniles of Steinernema feltiae and Heterorhabditis megidis isolates from Greece (GR) and from the United Kingdom (UK) were compared, and the changes during storage were determined. Steinernema feltiae GR had a greater amount of TL than S. feltiae UK, which was reflected in a greater neutral lipid (NL) content. The phospholipid and free fatty acid fractions of the two Steinernema populations were similar. The two Heterorhabditis populations did not differ in their lipid content. In both S. feltiae populations, NL decreased by ca 60% during the first 4 weeks but remained more or less stable during the next 16 weeks. In the two Heterorhabditis populations, NL decreased by ca 70% during the first 4 weeks and continued to decrease, with 3-5% remaining after 12 weeks. The fatty acid profiles and the percentages of saturation of NL and phospholipid fractions in each population were similar before and after storage.
46
Sari, Imielda Yuli Hartika, and Wagiyana Wagiyana. "Efektivitas Isolat Nematoda Entomopatogen Steinernema sp. Produksi PPAH Kabupaten Kediri terhadap Mortalitas Larva Spodoptera frugiperda J. E. Smith." Berkala Ilmiah Pertanian 6, no. 3 (August 1, 2023): 129. http://dx.doi.org/10.19184/bip.v6i3.35735.
Full textAbstract:
Spodoptera frugiperda J. E. Smith (Lepidoptera: Noctuidae) is a pest that has just entered Indonesia since 2019 and has adapted and become an important pest in corn plants. Therefore, we need a control by utilizing biological control agents that exist in nature, one of which is the entomopathogenic nematode type Steinernema sp. which has been developed by the Biological Agent Service Post (PPAH) "Sidodadi" in the Plosoklaten District, Kediri Regency. The methods used in this study were: collection and rearing of S. frugiperda pests; breeding of entomopathogenic nematodes Steinernema sp. in vivo. The application of an entomopathogenic nematode to test pathogenicity against 3rd instar S. frugiperda larvae. The application treatments used were population densities of 1.000 JI/ml, 800 JI/ml, 400 JI/ml, 200 JI/ml plus a control treatment. The study was designed with a single Completely Randomized Design (CRD) with six treatments and was repeated four times. Each replication consisted of 10 S. frugiperda larvae. Parameters observed included mortality of S. frugiperda larvae due to Steinernema sp.. Effectiveness of Steinernema sp. by calculating the LT50 value. Observation of biological symptoms of S. frugiperda infected with Steinernema sp. and calculation of the infection rate of Steinernema sp.. Data from observations were analyzed using a 5% ANOVA. If there is a significant difference, further DMRT testing is carried out. The effectiveness test was carried out by calculating the LT50 value using Finney's (1971) probit analysis. Based on observations for 120 hours, it was shown that entomopathogenic nematode PPAH isolate was effective in killing S. frugiperda larvae. PPAH isolate entomopathogenic nematode was effective in causing mortality in S. frugiperda larvae. The highest mortality value of S. frugiperda due to entomopathogenic nematode treatment was 97.5% in treatment with 800 JI/ml and 1000 JI/ml at 120 hours after application observation. The fastest LT50 value causing mortality in S. frugiperda larvae was in the 1000 JI/ml of 32.60 hours. The treatment with the longest LT50 value caused the mortality of 50% of the test insects, namely the 200 JI/ml over 95.88 hours. Observation of the infection rate showed the highest infection rate was found in the 1000 JI/ml at 24 hours after application with as many as 0.02% tails, this is because that the higher the inoculated entomopathogenic nematode population, the higher the infection rate value.
47
Borgonie, Gaetan, Wim Bert, and Julia Zograf. "The structure of the female reproductive system of nematodes from the genus Steinernema (Rhabditida: Steinernematidae)." Nematology 10, no. 6 (2008): 883–96. http://dx.doi.org/10.1163/156854108786161463.
Full textAbstract:
AbstractFemales of six species of nematodes from the genus Steinernema (S. affine, S. arenarium, S. bicornutum, S. carpocapsae, S. feltiae and S. glaseri) were studied using light microscopy. Investigation of the gonoduct morphology was completed with ultrastructural data for S. carpocapsae and S. feltiae. Except for S. bicornutum, all species studied show an overall similarity in reproductive system architecture, i.e., a swollen proximal region of the ovaries, an oviduct consisting of irregular rows with two to four cells in cross-section and a uterus divided into two morphologically distinguishable parts (except S. carpocapsae). Such a gonoduct structure is distinctive from any other known nematode gonoduct, especially the particular arrangement of the oviduct cells in mostly long irregular rows with two to four cells in cross-section (except S. bicornutum), which is, according to current knowledge, unique within the Rhabditida. These results indicate the coherence of the genus Steinernema as shown from other morphological and molecular studies. The distal swelling of the uterus is considered to be a spermatheca-uterus complex that possibly functions to store and activate sperm and as a fertilisation chamber. The diversity of the cellular architecture of the Steinernema gonoduct provides valuable information for the delineation of species within a morphologically conserved genus. Furthermore, limited results point to a congruence between the gonoduct characters and current molecular phylogenetic hypothesis within Steinernema. Future studies in this direction must ultimately lead to a better understanding of evolutionary processes within the genus.
48
Kovtun, A. "New locality records for Steinernema and Heterorhabditis (Nematoda: Rhabditida: Steinernematidae, Heterorhabditidae) fauna of Ukraine." Karantin i zahist roslin, no. 2 (June 21, 2023): 39–45. http://dx.doi.org/10.36495/2312-0614.2023.2.39-45.
Full textAbstract:
Goal. Of this study is to present new locality records (from agricultural ecosystems) for Steinernema and Heterorhabditis (Nematoda: Rhabditida: Steinernematidae, Heterorhabditidae) fauna of Ukraine.
Methods. The object of our research were entomopathogenic nematodes collected from different localities of Ukraine between 2016 and 2021. We used stereoscopic microscope MBS-9, light microscope Carl Zeiss Primo Star 100x—1000x and specialized keys for entomopathogenic nematodes identification.
Results. We analyzed 312 samples for entomopathogenic nematodes (Steinernematidae, Heterorhabditidae). Entomopathogenic nematodes were isolated from Zhytomyr region, Chernihiv region and Kyiv region. Entomopathogenic nematodes from Zhytomyr region and Chernihiv region is a new record for Ukraine. EPN-positive soil samples with Steinernema spp. were noticeably pre-dominating over the Heterorhabditis spp. (ratio 1.5 to 1). Three species of entomopathogenic nematodes (S. carpocapsae, Steinernema sp. «glaseri»-group and H. bacteriophora), have been described. The information on the specimens location and brief notes on the habitats is provided. In present study, we examined differences in the morphological and morphometric characters between two EPN species from different regions/zones of Ukraine.
Conclusions. We found new locality records for two entomopathogenic nematodes species: S. сarpocapsae and H. bacteriophora reported from Zhytomyr region and Chernihiv region of Ukraine for the first time. Further studies aiming to improve the knowledge on entomopathogenic nematodes (Steinernema and Heterorhabditis) fauna should focus on collecting in little-known areas and some specific habitats of Ukraine.
49
Ajri, Miftahul, Dinda Dewi Aisyah, and Azizah Ridha Ulilalbab. "Exploration of Entomopathogenic Nematodes in Organic Rice Field in Sleman Regency." SEAS (Sustainable Environment Agricultural Science) 7, no. 2 (October 26, 2023): 153–60. http://dx.doi.org/10.22225/seas.7.2.8266.153-160.
Full textAbstract:
Entomopathogenic nematodes (EPNs), consisting of genera Steinernema and Heterorhabditis are biological agents proven effective in killing insect pests. Organic rice fields and sandy soil textures are potential areas for exploring the presence of EPNs. This research aims to determine the diversity of genera and populations of entomopathogenic nematodes in organic rice fields in Sleman Regency. The study was conducted on organic rice fields and the UPN "Veteran" Yogyakarta Plant Protection Laboratory from July – August 2023. EPNs were obtained from Prambanan Sleman and Ngemplak Sleman, with six plots as sample units in every location. EPNs were isolated from soil samples by using Tenebri molitor larvae. The Whitehead tray method was used to isolate EPNs from the dead larvae, and the population of EPNs was counted. EPNs were identified based on the symptoms of color changes on the cuticle and morphological characters. The result showed that the cuticles of T. molitor larvae that died were blackish brown in Prambanan and Ngaliyan isolates, referred to Steinernema genera. EPNs were found in Prambanan_6, Ngaliyan_1, and Ngaliyan_2. The highest population of EPNs was on Ngaliyan_1 (38,00 EPNs/ml), and the lowest was on Prambanan_6 (2,13 EPNs/ml). Based on the morphological characters of EPNs, on the Prambanan_4, Ngaliyan_1, and Ngaliyan_2, EPNs were identified as Steinernema spp. The characteristics of Steinernema in the infective juvenile stage found are: slender body, anterior end slightly rounded and fused with the body, cylindrical stoma, no second cuticular sheath, not annulated, and conoid tail.
50
Spiridonov, Sergei, Erika Lyons, and Michael Wilson. "Steinernema kraussei (Rhabditida, Steinernematidae) from Iceland." Comparative Parasitology 71, no. 2 (July 2004): 215–20. http://dx.doi.org/10.1654/4100.
Full text