Log in

Relevant bibliographies by topics / Strawberry; Antifreeze protein gene / Journal articles

To see the other types of publications on this topic, follow the link: Strawberry; Antifreeze protein gene.

Journal articles on the topic 'Strawberry; Antifreeze protein gene'

Author: Grafiati

Published: 4 June 2021

Last updated: 4 February 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic 'Strawberry; Antifreeze protein gene.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Firsov, A. P., and S. V. Dolgov. "AGROBACTERIAL TRANSFORMATION AND TRANSFER OF THE ANTIFREEZE PROTEIN GENE OF WINTER FLOUNDER TO THE STRAWBERRY." Acta Horticulturae, no. 484 (December 1998): 581–86. http://dx.doi.org/10.17660/actahortic.1998.484.99.

Full text

APA, Harvard, Vancouver, ISO, and other styles

2

Scott, Gary K., Garth L. Fletcher, and Peter L. Davies. "Fish Antifreeze Proteins: Recent Gene Evolution." Canadian Journal of Fisheries and Aquatic Sciences 43, no. 5 (May 1, 1986): 1028–34. http://dx.doi.org/10.1139/f86-128.

Full text

Abstract:

A variety of antifreeze proteins is produced by marine teleosts inhabiting polar regions to ensure protection from internal ice formation at subzero temperatures. Combining evidence from paleoclimatology, teleostian evolution, and studies of antifreeze gene organization, the case is made for Cenozoic cooling as the force driving antifreeze evolution in marine teleosts. The distribution of antifreeze types amongst teleost suborders, families, genera, and species correlates with Cenozoic glaciation in the Southern Hemisphere preceding that in the Northern Hemisphere by approximately 25 million yr. The genomic organization of antifreeze genes suggests recent and extensive amplification, an event compatible with their proposed stress-induced origin. Also, a realignment of the nototheniids with the Gadiformes based on antifreeze protein data is suggested.

APA, Harvard, Vancouver, ISO, and other styles

3

Gauthier, Sherry, Yaling Wu, and Peter L. Davies. "Nucleotide sequence of a variant antifreeze protein gene." Nucleic Acids Research 18, no. 17 (1990): 5303. http://dx.doi.org/10.1093/nar/18.17.5303.

Full text

APA, Harvard, Vancouver, ISO, and other styles

4

Qin, Wensheng, and Virginia K. Walker. "Tenebrio molitor antifreeze protein gene identification and regulation." Gene 367 (February 2006): 142–49. http://dx.doi.org/10.1016/j.gene.2005.10.003.

Full text

APA, Harvard, Vancouver, ISO, and other styles

5

Fletcher, Garth L., David R. Idler, Allan Vaisius, and Choy L. Hew. "Hormonal regulation of antifreeze protein gene expression in winter flounder." Fish Physiology and Biochemistry 7, no. 1-6 (June 1989): 387–93. http://dx.doi.org/10.1007/bf00004733.

Full text

APA, Harvard, Vancouver, ISO, and other styles

6

Davies, Peter L., Choy L. Hew, and Garth L. Fletcher. "Fish antifreeze proteins: physiology and evolutionary biology." Canadian Journal of Zoology 66, no. 12 (December 1, 1988): 2611–17. http://dx.doi.org/10.1139/z88-385.

Full text

Abstract:

Many marine teleosts have adapted to ice-laden seawater by evolving antifreeze proteins and glycoproteins. These proteins are synthesized in the liver for export to the blood where they circulate at levels of up to 20 mg/mL. There are at least four distinct antifreeze protein classes differing in carbohydrate content, amino acid composition, protein sequence, and secondary structure. In addition to antifreeze structural diversity, fish species differ considerably with respect to mechanisms controlling seasonal regulation of plasma antifreeze concentrations. Some species synthesize antifreeze proteins immediately before the onset of freezing conditions, some synthesize them in response to such conditions, whereas others possess high concentrations all year. Endogenous rhythms, water temperature, photoperiod, and pituitary hormones have all been implicated as regulators of plasma antifreeze protein levels. The structural diversity of antifreeze proteins and their occurrence in a wide range of fish species suggest that they evolved separately and recently during Cenozoic glaciation. Invariably, the genes coding for these antifreeze proteins are amplified, sometimes as long tandem arrays, suggesting intense selective pressure to produce large amounts of protein. The distribution of antifreeze gene types among fish species suggests that they could serve as important tools for studying phylogenetic relationships.

APA, Harvard, Vancouver, ISO, and other styles

7

Hobbs, Rod S., Jennifer R. Hall, Laurie A. Graham, Peter L. Davies, and Garth L. Fletcher. "Antifreeze protein dispersion in eelpouts and related fishes reveals migration and climate alteration within the last 20 Ma." PLOS ONE 15, no. 12 (December 15, 2020): e0243273. http://dx.doi.org/10.1371/journal.pone.0243273.

Full text

Abstract:

Antifreeze proteins inhibit ice growth and are crucial for the survival of supercooled fish living in icy seawater. Of the four antifreeze protein types found in fishes, the globular type III from eelpouts is the one restricted to a single infraorder (Zoarcales), which is the only clade know to have antifreeze protein-producing species at both poles. Our analysis of over 60 unique antifreeze protein gene sequences from several Zoarcales species indicates this gene family arose around 18 Ma ago, in the Northern Hemisphere, supporting recent data suggesting that the Arctic Seas were ice-laden earlier than originally thought. The Antarctic was subject to widespread glaciation over 30 Ma and the Notothenioid fishes that produce an unrelated antifreeze glycoprotein extensively exploited the adjoining seas. We show that species from one Zoarcales family only encroached on this niche in the last few Ma, entering an environment already dominated by ice-resistant fishes, long after the onset of glaciation. As eelpouts are one of the dominant benthic fish groups of the deep ocean, they likely migrated from the north to Antarctica via the cold depths, losing all but the fully active isoform gene along the way. In contrast, northern species have retained both the fully active (QAE) and partially active (SP) isoforms for at least 15 Ma, which suggests that the combination of isoforms is functionally advantageous.

APA, Harvard, Vancouver, ISO, and other styles

8

Hew, Choy, Megan Miao, and Garth Fletcher. "Transcriptional regulation of the antifreeze protein gene in the winter flounder." Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 124 (August 1999): S4. http://dx.doi.org/10.1016/s1095-6433(99)90012-0.

Full text

APA, Harvard, Vancouver, ISO, and other styles

9

WANG, Yan. "Cold Tolerance of Transgenic Tobacco Carrying Gene Encoding Insect Antifreeze Protein." ACTA AGRONOMICA SINICA 34, no. 3 (March 20, 2008): 397–402. http://dx.doi.org/10.3724/sp.j.1006.2008.00397.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

Graham, Laurie A., Stephen C. Lougheed, K. Vanya Ewart, and Peter L. Davies. "Lateral Transfer of a Lectin-Like Antifreeze Protein Gene in Fishes." PLoS ONE 3, no. 7 (July 9, 2008): e2616. http://dx.doi.org/10.1371/journal.pone.0002616.

Full text

APA, Harvard, Vancouver, ISO, and other styles

11

Desjardins, Mariève, Laurie A. Graham, Peter L. Davies, and Garth L. Fletcher. "Antifreeze protein gene amplification facilitated niche exploitation and speciation in wolffish." FEBS Journal 279, no. 12 (May 22, 2012): 2215–30. http://dx.doi.org/10.1111/j.1742-4658.2012.08605.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

12

Fletcher, Garth L., Margaret A. Shears, Madonna J. King, Peter L. Davies, and Choy L. Hew. "Evidence for Antifreeze Protein Gene Transfer in Atlantic Salmon (Salmo salar)." Canadian Journal of Fisheries and Aquatic Sciences 45, no. 2 (February 1, 1988): 352–57. http://dx.doi.org/10.1139/f88-042.

Full text

Abstract:

Atlantic salmon (Salmo salar) freeze to death if they come into contact with ice at water temperatures below −0.7 °C. Consequently, sea-pen culture of this species in cold water is severely limited. Winter flounder (Pseudopleuronectes americanus) survive in ice-laden seawater by producing a set of antifreeze polypeptides (AFP). We are attempting to make the Atlantic salmon more freeze resistant by transferring antifreeze protein genes from the winter flounder to the genome of the salmon. Salmon eggs were microinjected with linearized DNA after fertilization. Individual fingerlings (1–2 g) were analyzed for flounder AFP genes by genomic Southern blotting. DNA from 2 out of 30 fingerlings showed hybridization to the flounder DNA probe. Hybridization bands following cleavage by restriction enzymes Sst l and Bam HI were identical to those of the injected DNA. Hybridization following Hind III digestion indicated that the flounder AFP gene was linked to the salmon genome. These hybridization signals were absent in the DNA from control fish. The intensity of the hybridization signals indicated that there was on average at least one copy of the AFP gene present per cell.

APA, Harvard, Vancouver, ISO, and other styles

13

Qin, Wensheng, Michael G. Tyshenko, Daniel Doucet, and Virginia K. Walker. "Characterization of antifreeze protein gene expression in summer spruce budworm larvae." Insect Biochemistry and Molecular Biology 36, no. 3 (March 2006): 210–18. http://dx.doi.org/10.1016/j.ibmb.2006.01.017.

Full text

APA, Harvard, Vancouver, ISO, and other styles

14

Yamazaki, Aya, Yoshiyuki Nishimiya, Sakae Tsuda, Koji Togashi, and Hiroyuki Munehara. "Freeze Tolerance in Sculpins (Pisces; Cottoidea) Inhabiting North Pacific and Arctic Oceans: Antifreeze Activity and Gene Sequences of the Antifreeze Protein." Biomolecules 9, no. 4 (April 6, 2019): 139. http://dx.doi.org/10.3390/biom9040139.

Full text

Abstract:

Many marine species inhabiting icy seawater produce antifreeze proteins (AFPs) to prevent their body fluids from freezing. The sculpin species of the superfamily Cottoidea are widely found from the Arctic to southern hemisphere, some of which are known to express AFP. Here we clarified DNA sequence encoding type I AFP for 3 species of 2 families (Cottidae and Agonidae) belonging to Cottoidea. We also examined antifreeze activity for 3 families and 32 species of Cottoidea (Cottidae, Agonidae, and Rhamphocottidae). These fishes were collected in 2013–2015 from the Arctic Ocean, Alaska, Japan. We could identify 8 distinct DNA sequences exhibiting a high similarity to those reported for Myoxocephalus species, suggesting that Cottidae and Agonidae share the same DNA sequence encoding type I AFP. Among the 3 families, Rhamphocottidae that experience a warm current did not show antifreeze activity. The species inhabiting the Arctic Ocean and Northern Japan that often covered with ice floe showed high activity, while those inhabiting Alaska, Southern Japan with a warm current showed low/no activity. These results suggest that Cottoidea acquires type I AFP gene before dividing into Cottidae and Agonidae, and have adapted to each location with optimal antifreeze activity level.

APA, Harvard, Vancouver, ISO, and other styles

15

SMALLWOOD, Maggie, Dawn WORRALL, Louise BYASS, Luisa ELIAS, David ASHFORD, Charlotte J. DOUCET, Chris HOLT, Julia TELFORD, Peter LILLFORD, and Dianna J. BOWLES. "Isolation and characterization of a novel antifreeze protein from carrot (Daucus carota)." Biochemical Journal 340, no. 2 (May 25, 1999): 385–91. http://dx.doi.org/10.1042/bj3400385.

Full text

Abstract:

A modified assay for inhibition of ice recrystallization which allows unequivocal identification of activity in plant extracts is described. Using this assay a novel, cold-induced, 36 kDa antifreeze protein has been isolated from the tap root of cold-acclimated carrot (Daucus carota) plants. This protein inhibits the recrystallization of ice and exhibits thermal-hysteresis activity. The polypeptide behaves as monomer in solution and is N-glycosylated. The corresponding gene is unique in the carrot genome and induced by cold. The antifreeze protein appears to be localized within the apoplast.

APA, Harvard, Vancouver, ISO, and other styles

16

Murray, Harry M., Choy L. Hew, Ken R. Kao, and Garth L. Fletcher. "Localization of cells from the winter flounder gill expressing a skin type antifreeze protein gene." Canadian Journal of Zoology 80, no. 1 (January 1, 2002): 110–19. http://dx.doi.org/10.1139/z01-209.

Full text

Abstract:

In situ hybridization on whole mounts and paraffin-sectioned winter flounder (Pleuronectes americanus) gill, using riboprobes specific to a skin type antifreeze protein (AFP) gene, showed a mRNA distribution associated with cells throughout the filament and the lamellae. Immunohistochemistry using antibodies for a skin-type AFP identified cells corresponding to those detected using in situ hybridization. Parallel experiments with antibodies for chloride-cell markers showed that these cells were not involved in antifreeze-protein expression. Similarly, goblet cells did not show cross-reactivity with the AFP antibodies. This general distribution suggested that pavement cells were likely involved. Reverse transcription polymerase chain reaction using gill cDNA templates and subsequent sequencing of the products confirmed the presence of skin type AFP transcripts in this tissue. Expression of a AFP in this area may act as a first line of defence against ice-crystal migration into peripheral tissues.

APA, Harvard, Vancouver, ISO, and other styles

17

Hayes, Pliny H., Peter L. Davies, and Garth L. Fletcher. "Population differences in antifreeze protein gene copy number and arrangement in winter flounder." Genome 34, no. 1 (February 1, 1991): 174–77. http://dx.doi.org/10.1139/g91-027.

Full text

Abstract:

Many marine fish in polar waters produce antifreeze proteins (AFPs) to depress their serum freezing point to below that of seawater. Winter flounder from the east coast of North America contain multiple AFP gene copies organized both as tandem repeats and as linked but irregularly spaced genes, with the tandemly repeated genes encoding the bulk of the circulating AFPs. We report here on AFP gene organization in winter flounder from nine locations ranging from Long Island, NY to Conception Bay, Nfld. There are clear differences in AFP gene copy number and arrangement between some of the populations. The greatest variation is seen in the size of the tandem component in fish from the warmer, deeper locations. This contrasts to the conservation of organization in the dispersed, β-tubulin multigene family used for comparative purposes. We suggest that variation in AFP gene family size and organization reflects a relaxation of selection in some geographical areas in the postglacial period.Key words: gene dosage, multigene family, tandem repeats, intrapopulation variation, glaciation.

APA, Harvard, Vancouver, ISO, and other styles

18

Young, Heather M., and Garth L. Fletcher. "Antifreeze protein gene expression in winter flounder pre-hatch embryos: Implications for cryopreservation." Cryobiology 57, no. 2 (October 2008): 84–90. http://dx.doi.org/10.1016/j.cryobiol.2008.05.005.

Full text

APA, Harvard, Vancouver, ISO, and other styles

19

Zhang, Junfang, Cheng Deng, Jianshe Wang, and Liangbiao Chen. "Identification of a two-domain antifreeze protein gene in Antarctic eelpout Lycodichthys dearborni." Polar Biology 32, no. 1 (July 31, 2008): 35–40. http://dx.doi.org/10.1007/s00300-008-0499-8.

Full text

APA, Harvard, Vancouver, ISO, and other styles

20

Wang, Junli, Huibo Ge, Shiqi Peng, Hongmei Zhang, Piling Chen, and Jiuru Xu. "Transformation of strawberry (Fragaria ananassaDuch.) with late embryogenesis abundant protein gene." Journal of Horticultural Science and Biotechnology 79, no. 5 (January 2004): 735–38. http://dx.doi.org/10.1080/14620316.2004.11511835.

Full text

APA, Harvard, Vancouver, ISO, and other styles

21

Rancourt, D. E., V. K. Walker, and P. L. Davies. "Flounder antifreeze protein synthesis under heat shock control in transgenic Drosophila melanogaster." Molecular and Cellular Biology 7, no. 6 (June 1987): 2188–95. http://dx.doi.org/10.1128/mcb.7.6.2188.

Full text

Abstract:

The gene coding for the most abundant antifreeze protein (AFP) in the winter flounder was placed downstream of the Drosophila melanogaster hsp70 promoter and introduced into the D. melanogaster germ line by P-element-mediated transformation. In each of six transgenic strains tested, heat shock treatment induced the expression of two major AFP gene transcripts and one minor one. All three transcripts were spliced despite the lack of an obvious D. melanogaster internal intron-splicing sequence. The variation in transcript length was caused by selection of different polyadenylation sites. Western blots showed the presence of immunoreactive AFP in hemolymph from heat-shocked transformants. The immunoreactive material had a molecular weight of 6,200, which is consistent with the loss of the signal sequence from the primary translation product and the retention of the pro sequence. Thus, all the signals for flounder pre-mRNA and preprotein processing were recognized in D. melanogaster.

APA, Harvard, Vancouver, ISO, and other styles

22

Rancourt, D. E., V. K. Walker, and P. L. Davies. "Flounder antifreeze protein synthesis under heat shock control in transgenic Drosophila melanogaster." Molecular and Cellular Biology 7, no. 6 (June 1987): 2188–95. http://dx.doi.org/10.1128/mcb.7.6.2188-2195.1987.

Full text

Abstract:

The gene coding for the most abundant antifreeze protein (AFP) in the winter flounder was placed downstream of the Drosophila melanogaster hsp70 promoter and introduced into the D. melanogaster germ line by P-element-mediated transformation. In each of six transgenic strains tested, heat shock treatment induced the expression of two major AFP gene transcripts and one minor one. All three transcripts were spliced despite the lack of an obvious D. melanogaster internal intron-splicing sequence. The variation in transcript length was caused by selection of different polyadenylation sites. Western blots showed the presence of immunoreactive AFP in hemolymph from heat-shocked transformants. The immunoreactive material had a molecular weight of 6,200, which is consistent with the loss of the signal sequence from the primary translation product and the retention of the pro sequence. Thus, all the signals for flounder pre-mRNA and preprotein processing were recognized in D. melanogaster.

APA, Harvard, Vancouver, ISO, and other styles

23

Muryoi, Naomi, Mika Sato, Shoji Kaneko, Hidehisa Kawahara, Hitoshi Obata, Mahmoud W. F. Yaish, Marilyn Griffith, and Bernard R. Glick. "Cloning and Expression of afpA, a Gene Encoding an Antifreeze Protein from the Arctic Plant Growth-Promoting Rhizobacterium Pseudomonas putida GR12-2." Journal of Bacteriology 186, no. 17 (September 1, 2004): 5661–71. http://dx.doi.org/10.1128/jb.186.17.5661-5671.2004.

Full text

Abstract:

ABSTRACT The Arctic plant growth-promoting rhizobacterium Pseudomonas putida GR12-2 secretes an antifreeze protein (AFP) that promotes survival at subzero temperatures. The AFP is unusual in that it also exhibits a low level of ice nucleation activity. A DNA fragment with an open reading frame encoding 473 amino acids was cloned by PCR and inverse PCR using primers designed from partial amino acid sequences of the isolated AFP. The predicted gene product, AfpA, had a molecular mass of 47.3 kDa, a pI of 3.51, and no previously known function. Although AfpA is a secreted protein, it lacked an N-terminal signal peptide and was shown by sequence analysis to have two possible secretion systems: a hemolysin-like, calcium-binding secretion domain and a type V autotransporter domain found in gram-negative bacteria. Expression of afpA in Escherichia coli yielded an intracellular 72-kDa protein modified with both sugars and lipids that exhibited lower levels of antifreeze and ice nucleation activities than the native protein. The 164-kDa AFP previously purified from P. putida GR12-2 was a lipoglycoprotein, and the carbohydrate was required for ice nucleation activity. Therefore, the recombinant protein may not have been properly posttranslationally modified. The AfpA sequence was most similar to cell wall-associated proteins and less similar to ice nucleation proteins (INPs). Hydropathy plots revealed that the amino acid sequence of AfpA was more hydrophobic than those of the INPs in the domain that forms the ice template, thus suggesting that AFPs and INPs interact differently with ice. To our knowledge, this is the first gene encoding a protein with both antifreeze and ice nucleation activities to be isolated and characterized.

APA, Harvard, Vancouver, ISO, and other styles

24

Hobbs, Rod S., and Garth L. Fletcher. "Tissue specific expression of antifreeze protein and growth hormone transgenes driven by the ocean pout (Macrozoarces americanus) antifreeze protein OP5a gene promoter in Atlantic salmon (Salmo salar)." Transgenic Research 17, no. 1 (September 2, 2007): 33–45. http://dx.doi.org/10.1007/s11248-007-9128-5.

Full text

APA, Harvard, Vancouver, ISO, and other styles

25

Scott, G. K., P. H. Hayes, G. L. Fletcher, and P. L. Davies. "Wolffish antifreeze protein genes are primarily organized as tandem repeats that each contain two genes in inverted orientation." Molecular and Cellular Biology 8, no. 9 (September 1988): 3670–75. http://dx.doi.org/10.1128/mcb.8.9.3670.

Full text

Abstract:

The antifreeze protein genes of the wolffish (Anarhichas lupus) constitute a large multigene family of 80 to 85 copies, which can be classified into two sets. One-third of the genes were linked but irregularly spaced. The other two-thirds were organized as 8-kilobase-pair (kbp) tandem direct repeats that each contained two genes in inverted orientation; DNA sequence analysis suggests that both genes are functional. Except for a single region specific to each gene, the genes and their immediate flanking sequences were 99.2% identical. This degree of identity ended soon after a putative transcription termination sequence; as the 3' ends of the genes were only 1.3 kbp apart, these sequences might confer mutual protection from interference by transcriptional runoff. A Southern blot of wolffish DNA restricted with enzymes that do not cut within the tandem repeats indicated that the repeats were clustered in groups of six or more. The organization of antifreeze protein genes in the wolffish was very similar to that in the unrelated winter flounder, which produces a completely different antifreeze. This similarity might reflect common dynamics by which their progenitors adapted to life in ice-laden sea water.

APA, Harvard, Vancouver, ISO, and other styles

26

Scott, G. K., P. H. Hayes, G. L. Fletcher, and P. L. Davies. "Wolffish antifreeze protein genes are primarily organized as tandem repeats that each contain two genes in inverted orientation." Molecular and Cellular Biology 8, no. 9 (September 1988): 3670–75. http://dx.doi.org/10.1128/mcb.8.9.3670-3675.1988.

Full text

Abstract:

The antifreeze protein genes of the wolffish (Anarhichas lupus) constitute a large multigene family of 80 to 85 copies, which can be classified into two sets. One-third of the genes were linked but irregularly spaced. The other two-thirds were organized as 8-kilobase-pair (kbp) tandem direct repeats that each contained two genes in inverted orientation; DNA sequence analysis suggests that both genes are functional. Except for a single region specific to each gene, the genes and their immediate flanking sequences were 99.2% identical. This degree of identity ended soon after a putative transcription termination sequence; as the 3' ends of the genes were only 1.3 kbp apart, these sequences might confer mutual protection from interference by transcriptional runoff. A Southern blot of wolffish DNA restricted with enzymes that do not cut within the tandem repeats indicated that the repeats were clustered in groups of six or more. The organization of antifreeze protein genes in the wolffish was very similar to that in the unrelated winter flounder, which produces a completely different antifreeze. This similarity might reflect common dynamics by which their progenitors adapted to life in ice-laden sea water.

APA, Harvard, Vancouver, ISO, and other styles

27

Fei Yunbiao, Yu Jiankang, Chen Liangbiao, Wang Yaping, Wand Weixian, Mao Zhongrong, Yan Shaoyi, and Jin Guanqin. "Isolation and identification of homologous sequences of antifreeze protein (AFP) gene from a freshwater teleost." Aquaculture 111, no. 1-4 (April 1993): 306. http://dx.doi.org/10.1016/0044-8486(93)90072-7.

Full text

APA, Harvard, Vancouver, ISO, and other styles

28

Xiong, Jinsong, Yibo Bai, Chuangju Ma, Hongyu Zhu, Dan Zheng, and Zongming Cheng. "Molecular Cloning and Characterization of SQUAMOSA-Promoter Binding Protein-Like Gene FvSPL10 from Woodland Strawberry (Fragaria vesca)." Plants 8, no. 9 (September 11, 2019): 342. http://dx.doi.org/10.3390/plants8090342.

Full text

Abstract:

SQUAMOSA-promoter binding protein-like (SPL) proteins are plant-specific transcript factors that play essential roles in plant growth and development. Although many SPL genes have been well characterized in model plants like Arabidopsis, rice and tomato, the functions of SPLs in strawberry are still largely elusive. In the present study, we cloned and characterized FvSPL10, the ortholog of AtSPL9, from woodland strawberry. Subcellular localization shows FvSPL10 localizes in the cell nucleus. The luciferase system assay indicates FvSPL10 is a transcriptional activator, and both in vitro and in vivo assays indicate FvSPL10 could bind to the promoter of FvAP1 and activate its expression. Ectopic expression of FvSPL10 in Arabidopsis promotes early flowering and increases organs size. These results demonstrate the multiple regulatory roles of FvSPL10 in plant growth and development and lay a foundation for investigating the biological functions of FvSPL10 in strawberry.

APA, Harvard, Vancouver, ISO, and other styles

29

Zhang, Shihong, Yi Wei, and Hongyu Pan. "Transgenic Rice Plants Expressing a Novel Antifreeze Glycopeptide Possess Resistance to Cold and Disease." Zeitschrift für Naturforschung C 62, no. 7-8 (August 1, 2007): 583–91. http://dx.doi.org/10.1515/znc-2007-7-821.

Full text

Abstract:

Freezing injury and disease are both restrictive factors in crop production. In order to improve the tolerance ability to these stresses, a better way is to carry out genetic engineering by transferring dualfunctional genes. A predicted rice antifreeze glycopeptide gene was purposefully selected from rice blast-induced cDNA library. Northern blot demonstrated that the gene is expressed not only in blast-infected rice leaves, but also in low temperature-treated rice. In addition, the expressed protein in Escherichia coli exhibits strong antifreeze activities. The gene was overexpressed in rice plants transformed via Agrobacterium tumefacient EHA105. Overall 112 T0 transformants were obtained in this research. Cold tolerance and disease resistance of T1 transformants were, respectively, investigated. The results showed that plants containing overexpressed transgene can withstand D1 ∞C for 24 h without severe chilling injury after thawed, and that disease symptoms of the parallel transformants are highly reduced in response to blast infection, when compared with controls. The relationship of the gene and several pathogenesis-related protein genes to be chosen was analyzed and discussed. All these results confirmed the dual role of the cloned gene, and implied that genetic engineering using this kind of gene is a promising method to reduce biotic and abiotic stresses

APA, Harvard, Vancouver, ISO, and other styles

30

Wang, Shu-Fang, Li-Na Hua, Xiaofeng Liu, and Yuanyue Shen. "Cloning, expression, and enzymatic activity analysis of strawberry S-adenosyl-L-metnionine synthetase gene FaSAMS1." JOURNAL OF ADVANCES IN AGRICULTURE 6, no. 1 (April 30, 2016): 841–45. http://dx.doi.org/10.24297/jaa.v6i1.5390.

Full text

Abstract:

The S-adenosyl methionine synthetase gene FaSAMS1 is involved in the regulation of strawberry fruit ripening, however, the biochemical properties of FaSAMS1 protein remain unclear. Here, a coding cDNA sequence of FaSAMS1 was cloned by RT-PCR and inserted into a recombinant yeast expression vector pPICZA, then transformed into the yeast expression strain X-33. The fusion protein FaSAMS1 was induced, expressed, and purified. The enzymatic activity analysis of FaSAMS1 showed that the reaction system contains 0.09 mg of FaSAMS1, protein concentration reached at 0.454 mgÂ·mL-1, the activity of the enzyme was 0.32 U, specific activity was 3.56 UÂ·mg-1. This study has provided biochemical evidence for the involvement of ethylene in the regulation of strawberry fruit ripening.Â

APA, Harvard, Vancouver, ISO, and other styles

31

Shin, Hye Young, Gi Hoon Kim, Sang Jae Kang, Jeung-Sul Han, and Cheol Choi. "Optimization of Agrobacterium-mediated transformation procedure for grapevine ‘Kyoho’ with carrot antifreeze protein gene." Journal of Plant Biotechnology 44, no. 4 (December 31, 2017): 388–93. http://dx.doi.org/10.5010/jpb.2017.44.4.388.

Full text

APA, Harvard, Vancouver, ISO, and other styles

32

Xu, Wen-li, Mei-qin Liu, Xin Shen, and Cun-fu Lu. "Expression of a carrot 36 kD antifreeze protein gene improves cold stress tolerance in transgenic tobacco." Forestry Studies in China 7, no. 4 (December 2005): 11–15. http://dx.doi.org/10.1007/s11632-005-0039-3.

Full text

APA, Harvard, Vancouver, ISO, and other styles

33

Cheng, Libao, Xuan Gao, Hussain Javeed, Li Zhang, Jiutong Sun, Yanzhen He, Hong Zhang, Zhijuan Feng, Guangxiao Yang, and Guangyuan He. "RETRACTED ARTICLE: Isolation and Functional Characterization of an Antifreeze Protein Gene, TaAFPIII, from Wheat (Triticum aestivum)." Plant Molecular Biology Reporter 30, no. 6 (February 28, 2012): 1513. http://dx.doi.org/10.1007/s11105-012-0415-9.

Full text

APA, Harvard, Vancouver, ISO, and other styles

34

Davis, Thomas M., Kevin M. Folta, M. M. Shields, Robin L. Brese, Laura M. R. DiMeglio, and Qian Zhang. "New Genomics Resources for Strawberry." HortScience 40, no. 4 (July 2005): 1146E—1147. http://dx.doi.org/10.21273/hortsci.40.4.1146e.

Full text

Abstract:

The past year has brought substantial progress in the development of functional and structural genomic tools for strawberry. Sequencing of cDNA library clones from the cultivated strawberry Fragaria × ananassa and the diploid model species Fragaria vesca has provided more than 3000 new EST sequences. We have also constructed a large (∼40 kb) insert genomic (fosmid) library from F. vesca. About 33,000 fosmid clones have been picked and spotted onto hybridization filters. Filters have been successfully probed with three single copy gene probes, one gene family probe, and chloroplast DNA (cpDNA) and mitochondrial DNA (mtDNA) probe sets. The combined cpDNA and mtDNA clone content of the library is about 11%. After correction for organelle insert content, the nuclear genome coverage of the library is about 6×. Complete sequencing of two fosmid clones identified 12 putative protein-encoding genes, four of which were organized in colinearity with the corresponding chromosomal region of Arabidopsis thaliana. We will sequence an additional 50 fosmid clones, and use the resulting sequence data as the basis for developing a novel marker technology, to be described. These genomic tools will provide a basis for connecting specific genes to specific traits in the octoploid, cultivated strawberry, paving the way for implementation of gene-based, marker assisted selection as a tool for strawberry breeders. Opportunity for cross-species comparisons of gene sequence and composition, as well as genome organization and linkage group structure, between Fragaria and other members of the economically important Rosaceae family has been significantly enhanced, thus expanding the relevance of the project results to peach, cherry, apple, rose, brambles, and many other Rosaceous species.

APA, Harvard, Vancouver, ISO, and other styles

35

Holmberg, Niklas, Judith Farrés, James E. Bailey, and Pauli T. Kallio. "Targeted expression of a synthetic codon optimized gene, encoding the spruce budworm antifreeze protein, leads to accumulation of antifreeze activity in the apoplasts of transgenic tobacco." Gene 275, no. 1 (September 2001): 115–24. http://dx.doi.org/10.1016/s0378-1119(01)00635-7.

Full text

APA, Harvard, Vancouver, ISO, and other styles

36

Arai, Tatsuya, Akari Yamauchi, Ai Miura, Hidemasa Kondo, Yoshiyuki Nishimiya, Yuji C. Sasaki, and Sakae Tsuda. "Discovery of Hyperactive Antifreeze Protein from Phylogenetically Distant Beetles Questions Its Evolutionary Origin." International Journal of Molecular Sciences 22, no. 7 (March 31, 2021): 3637. http://dx.doi.org/10.3390/ijms22073637.

Full text

Abstract:

Beetle hyperactive antifreeze protein (AFP) has a unique ability to maintain a supercooling state of its body fluids, however, less is known about its origination. Here, we found that a popular stag beetle Dorcus hopei binodulosus (Dhb) synthesizes at least 6 isoforms of hyperactive AFP (DhbAFP). Cold-acclimated Dhb larvae tolerated −5 °C chilled storage for 24 h and fully recovered after warming, suggesting that DhbAFP facilitates overwintering of this beetle. A DhbAFP isoform (~10 kDa) appeared to consist of 6−8 tandem repeats of a 12-residue consensus sequence (TCTxSxNCxxAx), which exhibited 3 °C of high freezing point depression and the ability of binding to an entire surface of a single ice crystal. Significantly, these properties as well as DNA sequences including the untranslated region, signal peptide region, and an AFP-encoding region of Dhb are highly similar to those identified for a known hyperactive AFP (TmAFP) from the beetle Tenebrio molitor (Tm). Progenitor of Dhb and Tm was branched off approximately 300 million years ago, so no known evolution mechanism hardly explains the retainment of the DNA sequence for such a long divergence period. Existence of unrevealed gene transfer mechanism will be hypothesized between these two phylogenetically distant beetles to acquire this type of hyperactive AFP.

APA, Harvard, Vancouver, ISO, and other styles

37

Sorhannus, Ulf. "Evolution of Antifreeze Protein Genes in the Diatom Genus Fragilariopsis: Evidence for Horizontal Gene Transfer, Gene Duplication and Episodic Diversifying Selection." Evolutionary Bioinformatics 7 (January 2011): EBO.S8321. http://dx.doi.org/10.4137/ebo.s8321.

Full text

APA, Harvard, Vancouver, ISO, and other styles

38

Liu, Xiangjian, Haiyan Peng, Jingxian Xie, Yuying Hu, Fenglin Liu, Xueying Wang, Shuting Yang, Zhaolin Liu, Qubo Zhu, and Songwen Tan. "Methods in Biosynthesis and Characterization of the Antifreeze Protein (AFP) for Potential Blood Cryopreservation." Journal of Nanomaterials 2021 (June 25, 2021): 1–8. http://dx.doi.org/10.1155/2021/9932538.

Full text

Abstract:

The cryopreservation of red blood cells (RBCs) is very important to modern medicine. Cryoprotectants (CPAs) such as dimethyl sulfoxide (DMSO), proline, trehalose, and polyvinyl alcohol (PVA) have been used in the cryopreservation of RBCs, but the results are not satisfactory. Marinomonas primoryensis antifreeze protein (MpAFP) is a Ca2+-dependent AFP derived from Antarctic bacteria, which can prevent bacteria from freezing under extremely cold conditions and may be suitable for cryopreservation of RBCs. The active region of MpAFP is located in region IV and is called MPAFP_RIV. In this paper, the gene of region IV of MpAFP is introduced into BL21 (DE3) competent cells, and MpAFP_RIV is obtained after culture, separation, and purification. The improved splat assay is proposed, and this method first proves that MpAFP_RIV has strong ice recrystallization inhibition (IRI) activity without Ca2+. The improved splat assay is easier to operate and lower the cost compared to the traditional one, and the results are consistent with the classic sucrose sandwich assay, proving that this method can accurately detect IRI activity. The feasibility of MPAFP_RIV combined with classical CPA for cryopreservation of RBCs and the methods to increase the yield of MPAFP_RIV are proposed.

APA, Harvard, Vancouver, ISO, and other styles

39

Fan, Y., B. Liu, H. Wang, S. Wang, and J. Wang. "Cloning of an antifreeze protein gene from carrot and its influence on cold tolerance in transgenic tobacco plants." Plant Cell Reports 21, no. 4 (November 1, 2002): 296–301. http://dx.doi.org/10.1007/s00299-002-0495-3.

Full text

APA, Harvard, Vancouver, ISO, and other styles

40

Georges, Fawzy, Mohammed Saleem, and Adrian J. Cutler. "Design and cloning of a synthetic gene for the flounder antifreeze protein and its expression in plant cells." Gene 91, no. 2 (July 1990): 159–65. http://dx.doi.org/10.1016/0378-1119(90)90083-4.

Full text

APA, Harvard, Vancouver, ISO, and other styles

41

Deng, Long-Qun, Hao-Qiang Yu, Yan-Ping Liu, Pei-Pei Jiao, Shu-Feng Zhou, Su-Zhi Zhang, Wan-Chen Li, and Feng-Ling Fu. "Heterologous expression of antifreeze protein gene AnAFP from Ammopiptanthus nanus enhances cold tolerance in Escherichia coli and tobacco." Gene 539, no. 1 (April 2014): 132–40. http://dx.doi.org/10.1016/j.gene.2014.01.013.

Full text

APA, Harvard, Vancouver, ISO, and other styles

42

Lazarus, Colin M., and Heather Macdonald. "Characterization of a strawberry gene for auxin-binding protein, and its expression in insect cells." Plant Molecular Biology 31, no. 2 (May 1996): 267–77. http://dx.doi.org/10.1007/bf00021789.

Full text

APA, Harvard, Vancouver, ISO, and other styles

43

Goetz, Frederick W., Linda McCauley, Giles W. Goetz, and Birgitta Norberg. "Using global genome approaches to address problems in cod mariculture1." ICES Journal of Marine Science 63, no. 2 (January 1, 2006): 393–99. http://dx.doi.org/10.1016/j.icesjms.2005.10.006.

Full text

Abstract:

Abstract A number of techniques, including expressed sequence tag (EST) analysis, serial analysis of gene expression, and micro-arrays, are available to study the global expression and regulation of genes. Many of these techniques are being used for intensively reared fish such as trout, salmon, and catfish to study genes involved in growth, reproduction, and health. In contrast, relatively little is known about the composition and regulation of transcriptomes in gadids. However, several bottlenecks in cod mariculture might benefit from the discovery and analysis of genes involved in reproduction, growth, and disease. As a result, we have begun EST analysis of genes in the cod ovary. Complimentary DNA (cDNA) libraries of cod ovaries taken from females at oocyte final maturation and ovulation have been constructed, and 1361 ESTs have been analysed. As expected, several oocyte-related genes were observed, including various zona pellucida egg membrane proteins. However, pivotal cell cycle regulators such as cyclins, genes involved in the regulation of apoptosis such as the Bcl-2-related ovarian killer protein, and hormone receptor components were also observed. Finally, a cDNA for a potential novel cod antifreeze protein was observed 12 times, suggesting the existence of a cod egg-specific antifreeze protein.

APA, Harvard, Vancouver, ISO, and other styles

44

Tzanetakis, I. E., W. M. Wintermantel, and R. R. Martin. "First Report of Beet pseudo yellows virus in Strawberry in the United States: A Second Crinivirus Able to Cause Pallidosis Disease." Plant Disease 87, no. 11 (November 2003): 1398. http://dx.doi.org/10.1094/pdis.2003.87.11.1398c.

Full text

Abstract:

During efforts to characterize strawberry pallidosis disease, we identified a single strawberry plant that indexed positive for pallidosis disease by grafting but it was not infected with the Strawberry pallidosis associated virus (SPaV) based on reverse transcription-polymerase chain reaction (1). Leaves of this plant were grafted onto Fragaria vesca UC-4 and UC-5 and F. virginiana UC-10 and UC-11 indicator plants. The F. vesca plants remained asymptomatic, while the F. virginiana plants gave typical pallidosis symptoms that included marginal leaf chlorosis and epinasty. The combination of these symptoms on F. virginiana and lack of symptoms on F. vesca is used to define pallidosis disease (1). We extracted dsRNA from the original plant, and synthesized and cloned cDNA as previously described (2). Sequence analysis revealed several clones that corresponded to the published sequence of the Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene (HSP70h). We transferred the isolate to Nicotiana benthamiana by using the whitefly vector, Trialeuroides vaporariorum, and then reisolated and cloned dsRNA from the infected N. benthamiana. Here we present the complete sequence of the HSP70h and minor coat protein (CPm) genes of the strawberry isolate of BPYV (GenBank Accession Nos. AY 267369 and AY 268107, respectively). Oligonucleotide primers BP CPm F (5′ TTCATATTAAGGATGCGCAGA 3′) and BP CPm R (5′ TGAAAG- ATGTCCACTAATGATA 3′) were designed to amplify a 334-nucleotide fragment of the CPm gene of the strawberry isolate of BPYV. Using this primer set, we were able to verify the presence of BPYV in 1- to 3-year-old plants from the major strawberry producing areas of the United States, including California, Oregon, and the Mid-Atlantic States. Infection rates were highest near Watsonville, CA where more than 20% of plants tested were infected with BPYV. To our knowledge, this is the first report of BPYV infecting strawberry. BPYV and the closely related SPaV (2) pose new concerns for the U.S. strawberry industry. Studies are currently underway to determine the effects of these two viruses on strawberry vigor and productivity. References: (1) N. W. Frazier and L. L. Stubbs. Plant Dis. Rep. 53:524, 1969. (2) I. E. Tzanetakis et al. (Abstr.) Phytopathology 92:S82, 2002.

APA, Harvard, Vancouver, ISO, and other styles

45

Zhang, Yuhua, and Ding S. Shih. "Isolation of an osmotin-like protein gene from strawberry and analysis of the response of this gene to abiotic stresses." Journal of Plant Physiology 164, no. 1 (January 2007): 68–77. http://dx.doi.org/10.1016/j.jplph.2006.02.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

46

Zhang, Geng, Sizhen Jia, Zhiming Yan, Yuanhua Wang, Fengxia Zhao, and Yefan Sun. "A strawberry mitogen-activated protein kinase gene, FaMAPK19, is involved in disease resistance against Botrytis cinerea." Scientia Horticulturae 265 (April 2020): 109259. http://dx.doi.org/10.1016/j.scienta.2020.109259.

Full text

APA, Harvard, Vancouver, ISO, and other styles

47

Schaart, Jan G., Lisbeth Mehli, and Henk J. Schouten. "Quantification of allele-specific expression of a gene encoding strawberry polygalacturonase-inhibiting protein (PGIP) using PyrosequencingTM." Plant Journal 41, no. 3 (December 14, 2004): 493–500. http://dx.doi.org/10.1111/j.1365-313x.2004.02299.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

48

Torrico, A. K., M. G. Celli, E. E. Cafrune, D. S. Kirschbaum, and V. C. Conci. "Genetic variability and recombination analysis of the coat protein gene of Strawberry mild yellow edge virus." Australasian Plant Pathology 45, no. 4 (July 6, 2016): 401–9. http://dx.doi.org/10.1007/s13313-016-0426-3.

Full text

APA, Harvard, Vancouver, ISO, and other styles

49

Leng, Xiangpeng, Dan Liu, Mizhen Zhao, Xin Sun, Yu Li, Qian Mu, Xudong Zhu, Pengyu Li, and Jinggui Fang. "Genome-wide identification and analysis of FK506-binding protein family gene family in strawberry (Fragaria×ananassa)." Gene 534, no. 2 (January 2014): 390–99. http://dx.doi.org/10.1016/j.gene.2013.08.056.

Full text

APA, Harvard, Vancouver, ISO, and other styles

50

Xiong, Jin-Song, Dan Zheng, Hong-Yu Zhu, Jian-Qiu Chen, Ran Na, and Zong-Ming Cheng. "Genome-wide identification and expression analysis of the SPL gene family in woodland strawberry Fragaria vesca." Genome 61, no. 9 (September 2018): 675–83. http://dx.doi.org/10.1139/gen-2018-0014.

Full text

Abstract:

SQUAMOSA promoter-binding protein-like (SPL) is a class of plant-specific transcription factors that play critical roles in regulating plant growth and development. However, little systematic research on SPL genes has been conducted in strawberry. In this study, 14 SPL genes were identified in the genome of woodland strawberry (Fragaria vesca), one of the model plants of the family Rosaceae. Chromosome localization analysis indicated that the 14 FvSPL genes were unevenly distributed on six chromosomes. Phylogenetic analysis indicated that the FvSPL proteins could be clustered into six groups (G1 to G6). Genes with similar structure were classified into the same group, implying their functional redundancy. In addition, nine out of the 14 FvSPL genes, belonging to G1, G2, and G5, were found to be the putative targets of FvmiR156 genes. Expression analysis indicated FvSPL genes exhibited highly diverse expression patterns in the tissues and organs examined. The transcript levels of most FvmiR156-targeted FvSPL genes in fruit were lower than those non-miR156-targeted genes. In addition, the expression of the FvmiR156-targeted FvSPL genes decreased during fruit ripening, whereas the expression of FvmiR156 genes increased in fruit during this process. The results provide a foundation for future functional analysis of FvSPL genes in strawberry growth and development.

APA, Harvard, Vancouver, ISO, and other styles

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!