Academic literature on the topic 'Tamil Reference books'

Aim of the study was to investigate the use and user perception towards the use of library for accessing information needs by the cherraan’s college of nursing students affiliated to Tamil Nadu Dr. MGR Medical University. The objectives were to determine the level of use and user perception with library information resources and services. Survey method was adopted and questionnaires method was used as a data collection tool. A 100% response rate. The result of the study showed that users were satisfied with the library collection and services and using web resources for information in the library. The findings of the study among the 92 respondents 95.65% of respondents purpose of visit is to refer Text/ Reference books, 81.52% of respondents visit library daily, 78.26% of respondents use library collections with Text/ Reference books, 81.52%% of respondents mostly use Library services with Text/ Reference books and computer/Internet facility, 73.91% of respondents use from e-consortium Dr. MGR Medical University.

This paper described that users visit the Tamilnadu Agricultural University library for collecting information from students and faculty members. The researchers have attempted to find out the perceptions and outlook of the university library users with highly response to utilize the facility is available. The study shows that the quality of collection with respect to books, Journals and e-resources. Google is most popular search engine among the user for browsing the net. Reference Service is the most prefer by the staff and students.

Innovation has become an irreplaceable marvel in contemporary time which has its effect on all social statuses and training isn’t an exemption to this. The educated understudies of today have effortlessly received the electronic course books as a substitution of printed reading material attributable to its usability, cost viability, and availability. Fluctuated sees on the understudies’ inclination of the predefined arrangement of reading material have laid the stage for more formal and centered exploration interests these days universally. Thusly, an exploration to separate the focal points and impediments of both the organizations and the reasons that are essential to decide on the one over the other at a provincial level is a lot of the need of great importance. The investigation planned to discover the premium and inclination that won in the brains of students of different collages in Dindigul District, Tamil Nadu regarding the embracing of electronic course readings over the printed course books as this sort of study has been completed a lot of restricted in this locale. The examination embraced a quantitative exploration plan and the poll as an examination instrument to gather the information. The outcome attests that a greater part of the understudies knows about both the configurations of reading material and are more open to utilizing electronic course books and have communicated their readiness to move from printed course readings to electronic course readings. By the by, the discoveries clarify that the understudies choose electronic course readings relying on the nature and difficulty of the subject.

Electronic is the electronic depiction of information. This information is available in various forms like e-books, e-journal, e-learning tutors, etc. The study aimed at finding the awareness and utilization of e-resources by the junior research fellows Christian Medical College and Hospital, Vellore. A questionnaire was distributed to the end- users to collect the data. The distribution was done to the selected samples; collect the sound samples. The study aims to find the awareness about the availability of e-resources. The result as reveal what type of e-resources preferred, what searching engine was used most, problem faced during accessing the e-resources, ranking of the available e-resources and to find the percentage of received e-resources from library services. The analysis also reveals few other data which should help to improve the library services.

There are many subscribed resources and open source resources utilized by the Students, Research Scholars and Faculty Members in higher educational institutions. Objective –of this study is to determine the Digital resources usage preferences in Arts & Science college libraries of Tamil Nadu, particularly Islamic Management Arts & Science colleges. This article also examines the usage of e-books, e-journals (both subscribed and open source), Library website and abstracting database. It also deals with the status of the colleges which are subscribing to the digital resources. Research methodology. A systematically designed questionnaire was distributed to the selected colleges and received the data for analysis. Quite a few interesting facts have come out. Findings -Accordingly the data reveals that the undergraduate and postgraduate users preferred opens access resources and Google as their search engine for quick access while on the other hand research scholars insisted that commercial resources are of help and have made a recommendation to increase them. In case of faculty they recommend more number of commercial resources for their study, research and teaching purpose. Suggestions were made by the users to improve the infrastructure facility, regular power connection and a speed increase in the high bandwidth internet connections and to conduct seminars/ workshops/ orientation to the users in order to create awareness to increase the both the category of digital resources.

The Transforming Science: Some Remarks on the Medico-Alchemical Teachings in Selected Works of Siddha Yākōpu, with Special Reference to the Kuru Nūl Aimpattaintu The paper explores the concept of variously conceived transformations associated with figurative transcendence of manifold limitations, referred to in medico-alchemical Tamil Siddha literature. The research has been based on the study of selected texts of Yākōpu alias Irāmatēvar, one of prominent Tamil Siddha authors dated to 17th–18th centuries. Special reference has been made to the Kuru Nūl Aimpattaintu (“Fifty-five [Verses] of the Book on the Excellence”), considered by its author as a book containing some essential teachings of his science. The transformations referred to in the text concern both the domains of the human body, and the non-biological matter, being the object of alchemical operations of the Siddha adept. Such transforming science taught by Yākōpu is based on the action of certain substances credited with extraordinary potency.

The study was intended to explain the potential Baitul Maal wat Tamwil for bringing economic growth to Indonesia. This method of research is done by reading reference books, journals and other media related to BMT. The concept of Baitul Maal wat Tamwil is to develop productive businesses and invest in developing the quality of macro and small economic activities, in part, it encourages savings and financing its economic activities. BMT is made up of two main functions: Baitul Tamwil (property development home), and Baitul Maal (treasure). This study shows that BMT has the potential to increase economic growth in Indonesia. It’s proven by several journals that there are among them as INFERENSI (a religious social research journal), SOSIO DIDAKTIKA: Social Science Education Journal, and HUMAN FALAH

AbstractThree characteristic features of the Song of Songs are its (a) disjointed or absent plot, (b) gynocentrism and (c) lack of theocentrism. Recognition of these features facilitates a reassessment of the book's allegorical readings, be they ancient or modern, Jewish or Christian, religious or ostensibly secular. The principal readings discussed are Rabin's reconsideration of the Song's intrinsic allegorical properties with reference to Tamil love poetry; M. Cohen's on the Song and Jewish mystical literature (the Shiur Qomah and Hekhalot Rabbati); Murphy's position of reading mutually reflected human love and divine love in the Song; Pope's identification of the Song's assumed, single female protagonist as a black goddess; and Fox's rejection of allegory because of his definitions of metaphor, metaphoric distance and meaning. In conclusion, some reflections on the (ancillary) development of the Jewish allegorical tradition and its links with the Song's cannonization are offered.

Boxwood (Buxus sempervirens L. and other species) is a popular evergreen shrub used in landscaping. In January 2012, three nursery-grown plants of cv. Green Gem boxwood were submitted from Warren County, Ohio to the C. Wayne Ellet Plant and Pest Diagnostic Clinic at The Ohio State University, an Ohio Plant Diagnostic Network laboratory. The plants, established for 4 years, exhibited orange to bronze discoloration of the foliage; foliage was not desiccated and dieback was not evident although stunting was present. Plant root symptoms ranged from nearly complete necrosis to distinct black lesions on living roots. A root scraping showed nematodes present in the lesions. Nematodes were extracted from root and soil subsamples with a Baermann funnel apparatus for 48 h (3). A high number of lesion nematodes (Pratylenchus sp.) were observed from both soil and root samples. Individual nematodes were handpicked and identified under a compound light microscope as Pratylenchus vulnus Allen & Jensen, 1951 according to morphologic and morphometric characteristics (2). Males and females were observed with stylets having rounded knobs, labial regions continuous with the body contour, and three to four lip annuli. The lateral field contained four incisures, with the two inner incisures closer to each other than to the outer ones. The esophagus overlapped the intestine ventrally. Female (n = 12) body length ranged from 410.3 to 654.5 μm (mean 583.0 μm), stylet length from 15.0 to 17.8 μm (mean 16.8 μm), tail length from 23.2 to 37.5 μm (mean 29.2 μm), vulva position from 78.9 to 85.6% (mean 81.7%), dorsal esophageal outlet (DGO) from 2.6 to 3.5 μm (mean 3.1 μm), and with functional oblong spermathecae. De Man ratios were as follows: a = 25.3 to 33.3 (mean 28.4), b = 4.1 to 7.6 (mean 6.0), c = 16.1 to 23.5 (mean 20.1), and c′ = 1.8 to 2.6 (mean 2.1). Male (n = 16) body length ranged from 478.0 to 589.0 μm (mean 537.9 μm), stylet length from 15.0 to 17.2 μm (mean 16.2 μm), tail length from 22.7 to 28.1 μm (mean 25.5 μm), spicule from 15.0 to 17.5 μm (mean 16.4 μm), gubernaculum from 3.5 to 4.7 μm (mean 4.0 μm), and DGO from 2.6 to 3.7 μm (mean 3.1 μm). De Man ratios were as follows: a = 26.4 to 36.3 (mean 30.5), b = 5.0 to 7.9 (mean 5.8), c = 19.1 to 23.0 (mean 21.1), and c′ = 1.6 to 2.4 (mean 2.0). DNA was extracted from single adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA (4). The PCR product was purified and sequenced. The sequence was deposited in GenBank (Accession No. JQ692308) and was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with P. vulnus (e.g., GenBank Accession Nos. HM469437.1, EU130886.1, and JQ003994.1). P. vulnus is a known pathogen of boxwood (1). To our knowledge, this is the first report of P. vulnus in Ohio. References: (1) K. R. Barker. Plant Dis. Rep. 58:991, 1974. (2) P. Castillo and N. Vovlas. Pratylenchus (Nematoda: Pratylenchidae): Diagnosis, Biology, Pathogenicity and Management. Koninklijke Brill NV, Leiden, the Netherlands, 2007. (3) D. J. Hooper. In: Laboratory Methods for Work with Plant and Soil Nematodes. J. F. Southey, ed. Reference book 402. Ministry of Agriculture, Fisheries and Food, London, 1986. (4) G. C. Tenente et al. Nematropica 34:1, 2004.

Matrix Metalloproteinases and TIMPs by J. Frederick Woessner and Hideaki Nagase Oxford University Press (2000) pp. 223. ISBN 0–19-850268-0 35.00 Ever since Gross discovered that collagenase was responsible for resorption of the tadpole tail, there has been a small group of outstanding scientists that have dedicated their careers to the study of matrix metalloproteinases (MMPs). The family of MMPs has now grown to over 20, and they have been implicated in multiple biological processes drawing the attention of scientists of many disciplines. Two leaders in the field who have ushered in the modern era of MMP biology are Fred Woessner and Hideake Nagase and they share their expertise in Matrix Metalloproteinases and TIMPs. In a concise, yet thorough manner, these authors provide the basic biochemical and biological basis for the study of MMPs. This information, laced with a strong sense of historical perspective, is conveyed in the same interesting manner in which they educated this reviewer and many others over late night scotch at MMP Gordon Conferences. For the interested novice, one will come away no longer needing a score card to keep track of MMP-1 through MMP-22 (perhaps more by now). One will understand which cells produce which MMPs and TIMPs in response to which stimuli. The reader will understand the multiple levels of regulation of MMP activity through gene transcription, proenzyme activation, and inhibition by TIMPs. The book is filled with readable tables depicting important concepts in classification, evolution, and substrate specificity. The authors provide extensive key references for further reading as only they can. The only area not extensively covered is the rapidly emerging in vivo function of MMPs that comes from transgenic and gene targeted mice and animal models. Perhaps this will be the sequel to this primer. As the biological role of these enzymes expands and it becomes more difficult for scientists to ignore MMPs, this book provides a meaningful and painless way to become fluent in the field. Upon completion of the text, readers will feel comfortable incorporating MMPs into their research endeavors. Hopefully this work will spark investigators to ask how these enzymes relate to one's own research interests thus broadening our general biological knowledge.

The reader, even if familiar with vectors, will find it useful to work through this chapter because it introduces notation that will be used throughout this book. We will take vectors to be entities that possess magnitude, orientation, and sense in three-dimensional space. Graphically, we will represent them as arrows with the sense from tail to head, magnitude proportional to the length, and orientation indicated by the angles they form with a given set of reference directions. Two different kinds of symbol will be used to designate vectors algebraically, boldface letters (and the boldface number zero for a vector of zero magnitude), and subscripted letters to be introduced later. The first problems deal with simple vector geometry and its algebraic representation. Multiplying a vector by a scalar affects only its magnitude (length) without changing its direction. Problem 1. State the necessary and sufficient conditions for the three vectors A, B, and C to form a triangle. (Problems 1–9, 12–14, 19–23, and 25 from Sokolnikoff & Redheffer, 1958.) Problem 2. Given the sum S = A + B and the difference D = A – B, find A and B in terms of S and D (a) graphically and (b) algebraically. Problem 3. (a) State the unit vector a with the same direction as a nonzero vector A. (b) Let two nonzero vectors A and B issue from the same point, forming an angle between them; using the result of (a), find a vector that bisects this angle. Problem 4. Using vector methods, show that a line from one of the vertices of a parallelogram to the midpoint of one of the nonadjacent sides trisects one of the diagonals. Two vectors are said to form with each other two distinct products: a scalar, the dot product, and a vector, the cross product.