To see the other types of publications on this topic, follow the link: Tamil Reference books.

Journal articles on the topic 'Tamil Reference books'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 41 journal articles for your research on the topic 'Tamil Reference books.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

., T. Kala, and R. Jayabal . "Use and User Perception of Library Collection and Services by the Cherraan’s College of Nursing Students, Coimbatore, Tamil Nadu." Indian Journal of Information Sources and Services 9, no. 2 (May 5, 2019): 34–37. http://dx.doi.org/10.51983/ijiss.2019.9.2.628.

Full text
Abstract:
Aim of the study was to investigate the use and user perception towards the use of library for accessing information needs by the cherraan’s college of nursing students affiliated to Tamil Nadu Dr. MGR Medical University. The objectives were to determine the level of use and user perception with library information resources and services. Survey method was adopted and questionnaires method was used as a data collection tool. A 100% response rate. The result of the study showed that users were satisfied with the library collection and services and using web resources for information in the library. The findings of the study among the 92 respondents 95.65% of respondents purpose of visit is to refer Text/ Reference books, 81.52% of respondents visit library daily, 78.26% of respondents use library collections with Text/ Reference books, 81.52%% of respondents mostly use Library services with Text/ Reference books and computer/Internet facility, 73.91% of respondents use from e-consortium Dr. MGR Medical University.
APA, Harvard, Vancouver, ISO, and other styles
2

Duraisekar, S., M. Palaniappan, and C. Vinoth Kumar. "Access Pattern of Scholarly Information at Tamil Nadu Agricultural University: A Case Study." Indian Journal of Information Sources and Services 8, no. 1 (May 5, 2018): 93–98. http://dx.doi.org/10.51983/ijiss.2018.8.1.496.

Full text
Abstract:
This paper described that users visit the Tamilnadu Agricultural University library for collecting information from students and faculty members. The researchers have attempted to find out the perceptions and outlook of the university library users with highly response to utilize the facility is available. The study shows that the quality of collection with respect to books, Journals and e-resources. Google is most popular search engine among the user for browsing the net. Reference Service is the most prefer by the staff and students.
APA, Harvard, Vancouver, ISO, and other styles
3

Durai, R., M. Sivakumar, and A. Sabarirajan. "A Study on the Preference of Students towards Digital Reading Materials with Reference to Dindigul District." Shanlax International Journal of Management 9, no. 1 (July 1, 2021): 54–59. http://dx.doi.org/10.34293/management.v9i1.3893.

Full text
Abstract:
Innovation has become an irreplaceable marvel in contemporary time which has its effect on all social statuses and training isn’t an exemption to this. The educated understudies of today have effortlessly received the electronic course books as a substitution of printed reading material attributable to its usability, cost viability, and availability. Fluctuated sees on the understudies’ inclination of the predefined arrangement of reading material have laid the stage for more formal and centered exploration interests these days universally. Thusly, an exploration to separate the focal points and impediments of both the organizations and the reasons that are essential to decide on the one over the other at a provincial level is a lot of the need of great importance. The investigation planned to discover the premium and inclination that won in the brains of students of different collages in Dindigul District, Tamil Nadu regarding the embracing of electronic course readings over the printed course books as this sort of study has been completed a lot of restricted in this locale. The examination embraced a quantitative exploration plan and the poll as an examination instrument to gather the information. The outcome attests that a greater part of the understudies knows about both the configurations of reading material and are more open to utilizing electronic course books and have communicated their readiness to move from printed course readings to electronic course readings. By the by, the discoveries clarify that the understudies choose electronic course readings relying on the nature and difficulty of the subject.
APA, Harvard, Vancouver, ISO, and other styles
4

Tamil Vanan, J., J. Manalan, D. Joyson Soundrarajan, and T. Raja. "Awareness and Utilization of Electronic Resources among Junior Research Fellows with Special Reference to Christian Medical College & Hospital, Vellore, Tamil Nadu." Indian Journal of Information Sources and Services 9, S1 (February 5, 2019): 32–36. http://dx.doi.org/10.51983/ijiss.2019.9.s1.569.

Full text
Abstract:
Electronic is the electronic depiction of information. This information is available in various forms like e-books, e-journal, e-learning tutors, etc. The study aimed at finding the awareness and utilization of e-resources by the junior research fellows Christian Medical College and Hospital, Vellore. A questionnaire was distributed to the end- users to collect the data. The distribution was done to the selected samples; collect the sound samples. The study aims to find the awareness about the availability of e-resources. The result as reveal what type of e-resources preferred, what searching engine was used most, problem faced during accessing the e-resources, ranking of the available e-resources and to find the percentage of received e-resources from library services. The analysis also reveals few other data which should help to improve the library services.
APA, Harvard, Vancouver, ISO, and other styles
5

Abdul Latheef, N., and T. K. Thiruvengada Mani. "Usage of Commercial and Open Source Digital Resources in Libraries: With Special Reference to Islamic Management Arts & Science Colleges of Tamil Nadu." Asian Journal of Information Science and Technology 9, S1 (February 5, 2019): 1–5. http://dx.doi.org/10.51983/ajist-2019.9.s1.232.

Full text
Abstract:
There are many subscribed resources and open source resources utilized by the Students, Research Scholars and Faculty Members in higher educational institutions. Objective –of this study is to determine the Digital resources usage preferences in Arts & Science college libraries of Tamil Nadu, particularly Islamic Management Arts & Science colleges. This article also examines the usage of e-books, e-journals (both subscribed and open source), Library website and abstracting database. It also deals with the status of the colleges which are subscribing to the digital resources. Research methodology. A systematically designed questionnaire was distributed to the selected colleges and received the data for analysis. Quite a few interesting facts have come out. Findings -Accordingly the data reveals that the undergraduate and postgraduate users preferred opens access resources and Google as their search engine for quick access while on the other hand research scholars insisted that commercial resources are of help and have made a recommendation to increase them. In case of faculty they recommend more number of commercial resources for their study, research and teaching purpose. Suggestions were made by the users to improve the infrastructure facility, regular power connection and a speed increase in the high bandwidth internet connections and to conduct seminars/ workshops/ orientation to the users in order to create awareness to increase the both the category of digital resources.
APA, Harvard, Vancouver, ISO, and other styles
6

Kędzia, Ilona. "The Transforming Science." Cracow Indological Studies 22, no. 1 (October 15, 2020): 155–85. http://dx.doi.org/10.12797/cis.22.2020.01.07.

Full text
Abstract:
The Transforming Science: Some Remarks on the Medico-Alchemical Teachings in Selected Works of Siddha Yākōpu, with Special Reference to the Kuru Nūl Aimpattaintu The paper explores the concept of variously conceived transformations associated with figurative transcendence of manifold limitations, referred to in medico-alchemical Tamil Siddha literature. The research has been based on the study of selected texts of Yākōpu alias Irāmatēvar, one of prominent Tamil Siddha authors dated to 17th–18th centuries. Special reference has been made to the Kuru Nūl Aimpattaintu (“Fifty-five [Verses] of the Book on the Excellence”), considered by its author as a book containing some essential teachings of his science. The transformations referred to in the text concern both the domains of the human body, and the non-biological matter, being the object of alchemical operations of the Siddha adept. Such transforming science taught by Yākōpu is based on the action of certain substances credited with extraordinary potency.
APA, Harvard, Vancouver, ISO, and other styles
7

Sahil, Irdlon. "POTENSI BAITUL MAAL WAT TAMWIL (BMT) DALAM MENINGKATKAN PERTUMBUHAN EKONOMI DI INDONESIA." Al-Insyiroh: Jurnal Studi Keislaman 5, no. 2 (September 4, 2019): 33–38. http://dx.doi.org/10.35309/alinsyiroh.v5i2.3515.

Full text
Abstract:
The study was intended to explain the potential Baitul Maal wat Tamwil for bringing economic growth to Indonesia. This method of research is done by reading reference books, journals and other media related to BMT. The concept of Baitul Maal wat Tamwil is to develop productive businesses and invest in developing the quality of macro and small economic activities, in part, it encourages savings and financing its economic activities. BMT is made up of two main functions: Baitul Tamwil (property development home), and Baitul Maal (treasure). This study shows that BMT has the potential to increase economic growth in Indonesia. It’s proven by several journals that there are among them as INFERENSI (a religious social research journal), SOSIO DIDAKTIKA: Social Science Education Journal, and HUMAN FALAH
APA, Harvard, Vancouver, ISO, and other styles
8

Brenner, Athalya. "To See Is To Assume: Whose Love Is Celebrated in the Song of Songs?1." Biblical Interpretation 1, no. 3 (1993): 265–84. http://dx.doi.org/10.1163/156851593x00160.

Full text
Abstract:
AbstractThree characteristic features of the Song of Songs are its (a) disjointed or absent plot, (b) gynocentrism and (c) lack of theocentrism. Recognition of these features facilitates a reassessment of the book's allegorical readings, be they ancient or modern, Jewish or Christian, religious or ostensibly secular. The principal readings discussed are Rabin's reconsideration of the Song's intrinsic allegorical properties with reference to Tamil love poetry; M. Cohen's on the Song and Jewish mystical literature (the Shiur Qomah and Hekhalot Rabbati); Murphy's position of reading mutually reflected human love and divine love in the Song; Pope's identification of the Song's assumed, single female protagonist as a black goddess; and Fox's rejection of allegory because of his definitions of metaphor, metaphoric distance and meaning. In conclusion, some reflections on the (ancillary) development of the Jewish allegorical tradition and its links with the Song's cannonization are offered.
APA, Harvard, Vancouver, ISO, and other styles
9

Lopez-Nicora, H. D., T. Mekete, N. J. Taylor, and T. L. Niblack. "First Report of Lesion Nematode (Pratylenchus vulnus) on Boxwood in Ohio." Plant Disease 96, no. 9 (September 2012): 1385. http://dx.doi.org/10.1094/pdis-03-12-0272-pdn.

Full text
Abstract:
Boxwood (Buxus sempervirens L. and other species) is a popular evergreen shrub used in landscaping. In January 2012, three nursery-grown plants of cv. Green Gem boxwood were submitted from Warren County, Ohio to the C. Wayne Ellet Plant and Pest Diagnostic Clinic at The Ohio State University, an Ohio Plant Diagnostic Network laboratory. The plants, established for 4 years, exhibited orange to bronze discoloration of the foliage; foliage was not desiccated and dieback was not evident although stunting was present. Plant root symptoms ranged from nearly complete necrosis to distinct black lesions on living roots. A root scraping showed nematodes present in the lesions. Nematodes were extracted from root and soil subsamples with a Baermann funnel apparatus for 48 h (3). A high number of lesion nematodes (Pratylenchus sp.) were observed from both soil and root samples. Individual nematodes were handpicked and identified under a compound light microscope as Pratylenchus vulnus Allen & Jensen, 1951 according to morphologic and morphometric characteristics (2). Males and females were observed with stylets having rounded knobs, labial regions continuous with the body contour, and three to four lip annuli. The lateral field contained four incisures, with the two inner incisures closer to each other than to the outer ones. The esophagus overlapped the intestine ventrally. Female (n = 12) body length ranged from 410.3 to 654.5 μm (mean 583.0 μm), stylet length from 15.0 to 17.8 μm (mean 16.8 μm), tail length from 23.2 to 37.5 μm (mean 29.2 μm), vulva position from 78.9 to 85.6% (mean 81.7%), dorsal esophageal outlet (DGO) from 2.6 to 3.5 μm (mean 3.1 μm), and with functional oblong spermathecae. De Man ratios were as follows: a = 25.3 to 33.3 (mean 28.4), b = 4.1 to 7.6 (mean 6.0), c = 16.1 to 23.5 (mean 20.1), and c′ = 1.8 to 2.6 (mean 2.1). Male (n = 16) body length ranged from 478.0 to 589.0 μm (mean 537.9 μm), stylet length from 15.0 to 17.2 μm (mean 16.2 μm), tail length from 22.7 to 28.1 μm (mean 25.5 μm), spicule from 15.0 to 17.5 μm (mean 16.4 μm), gubernaculum from 3.5 to 4.7 μm (mean 4.0 μm), and DGO from 2.6 to 3.7 μm (mean 3.1 μm). De Man ratios were as follows: a = 26.4 to 36.3 (mean 30.5), b = 5.0 to 7.9 (mean 5.8), c = 19.1 to 23.0 (mean 21.1), and c′ = 1.6 to 2.4 (mean 2.0). DNA was extracted from single adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA (4). The PCR product was purified and sequenced. The sequence was deposited in GenBank (Accession No. JQ692308) and was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with P. vulnus (e.g., GenBank Accession Nos. HM469437.1, EU130886.1, and JQ003994.1). P. vulnus is a known pathogen of boxwood (1). To our knowledge, this is the first report of P. vulnus in Ohio. References: (1) K. R. Barker. Plant Dis. Rep. 58:991, 1974. (2) P. Castillo and N. Vovlas. Pratylenchus (Nematoda: Pratylenchidae): Diagnosis, Biology, Pathogenicity and Management. Koninklijke Brill NV, Leiden, the Netherlands, 2007. (3) D. J. Hooper. In: Laboratory Methods for Work with Plant and Soil Nematodes. J. F. Southey, ed. Reference book 402. Ministry of Agriculture, Fisheries and Food, London, 1986. (4) G. C. Tenente et al. Nematropica 34:1, 2004.
APA, Harvard, Vancouver, ISO, and other styles
10

Shapiro, S. D. "A concise yet informative stroll through matrix metalloproteinases and TIMPs." Journal of Cell Science 113, no. 19 (October 1, 2000): 3355–56. http://dx.doi.org/10.1242/jcs.113.19.3355b.

Full text
Abstract:
Matrix Metalloproteinases and TIMPs by J. Frederick Woessner and Hideaki Nagase Oxford University Press (2000) pp. 223. ISBN 0–19-850268-0 35.00 Ever since Gross discovered that collagenase was responsible for resorption of the tadpole tail, there has been a small group of outstanding scientists that have dedicated their careers to the study of matrix metalloproteinases (MMPs). The family of MMPs has now grown to over 20, and they have been implicated in multiple biological processes drawing the attention of scientists of many disciplines. Two leaders in the field who have ushered in the modern era of MMP biology are Fred Woessner and Hideake Nagase and they share their expertise in Matrix Metalloproteinases and TIMPs. In a concise, yet thorough manner, these authors provide the basic biochemical and biological basis for the study of MMPs. This information, laced with a strong sense of historical perspective, is conveyed in the same interesting manner in which they educated this reviewer and many others over late night scotch at MMP Gordon Conferences. For the interested novice, one will come away no longer needing a score card to keep track of MMP-1 through MMP-22 (perhaps more by now). One will understand which cells produce which MMPs and TIMPs in response to which stimuli. The reader will understand the multiple levels of regulation of MMP activity through gene transcription, proenzyme activation, and inhibition by TIMPs. The book is filled with readable tables depicting important concepts in classification, evolution, and substrate specificity. The authors provide extensive key references for further reading as only they can. The only area not extensively covered is the rapidly emerging in vivo function of MMPs that comes from transgenic and gene targeted mice and animal models. Perhaps this will be the sequel to this primer. As the biological role of these enzymes expands and it becomes more difficult for scientists to ignore MMPs, this book provides a meaningful and painless way to become fluent in the field. Upon completion of the text, readers will feel comfortable incorporating MMPs into their research endeavors. Hopefully this work will spark investigators to ask how these enzymes relate to one's own research interests thus broadening our general biological knowledge.
APA, Harvard, Vancouver, ISO, and other styles
11

Joshaline, Chellappa Mabel, Subathra M., Subathra M., Shyamala M., Padmavathy S., and Rekha Rekha. "Automated Teller Machine (ATM)- A “Pathogen City” – A surveillance Report from Locations in and around Madurai City, Tamil Nadu, India." International Journal of Public Health Science (IJPHS) 3, no. 1 (March 1, 2014): 51. http://dx.doi.org/10.11591/.v3i1.4674.

Full text
Abstract:
<!--[if gte mso 9]><xml> <o:OfficeDocumentSettings> <o:RelyOnVML /> <o:AllowPNG /> </o:OfficeDocumentSettings> </xml><![endif]--><span style="font-size: 9.0pt; font-family: 'Times New Roman','serif'; mso-fareast-font-family: 'Times New Roman'; mso-ansi-language: EN-US; mso-fareast-language: EN-US; mso-bidi-language: AR-SA;">ATM is used by millions of people in a day. It is meant to be a public utility device.Hence the microorganism’s plays a major role in accommodating the safer place, ATM.Hence to this account an elaborate survey was taken for complete assessment of microbiology in and around Madurai city. Swabs were collected from each ATM screen, buttons, floor, user’s hand, exposure of plates and also extended the work in relation with microorganisms prevalent in ladies toilet the samples collected from ATM were plated in nutrient agar plates. The results showed the presence of increased bacterial count subsequently, most pathogens on characterization extended revealed the genus of the particular organism<em style="mso-bidi-font-style: normal;"> E-coli, Pseudomonas, Staphylococcus aures, Klebsiella, Micrococcus, Salmonella, Serratia </em>and fungal species included <em style="mso-bidi-font-style: normal;">Aspergillus sp, Mucor sp and Fusarium</em>. Antibiogram study of bacteria also provides us information about the antibiotic resistance pattern of the bacterial isolates.</span><!--[if gte mso 9]><xml> <w:WordDocument> <w:View>Normal</w:View> <w:Zoom>0</w:Zoom> <w:TrackMoves /> <w:TrackFormatting /> <w:PunctuationKerning /> <w:ValidateAgainstSchemas /> <w:SaveIfXMLInvalid>false</w:SaveIfXMLInvalid> <w:IgnoreMixedContent>false</w:IgnoreMixedContent> <w:AlwaysShowPlaceholderText>false</w:AlwaysShowPlaceholderText> <w:DoNotPromoteQF /> <w:LidThemeOther>EN-US</w:LidThemeOther> <w:LidThemeAsian>X-NONE</w:LidThemeAsian> <w:LidThemeComplexScript>X-NONE</w:LidThemeComplexScript> <w:Compatibility> <w:BreakWrappedTables /> <w:SnapToGridInCell /> <w:WrapTextWithPunct /> <w:UseAsianBreakRules /> <w:DontGrowAutofit /> <w:SplitPgBreakAndParaMark /> <w:DontVertAlignCellWithSp /> <w:DontBreakConstrainedForcedTables /> <w:DontVertAlignInTxbx /> <w:Word11KerningPairs /> <w:CachedColBalance /> </w:Compatibility> <m:mathPr> <m:mathFont m:val="Cambria Math" /> <m:brkBin m:val="before" /> <m:brkBinSub m:val=" " /> <m:smallFrac m:val="off" /> <m:dispDef /> <m:lMargin m:val="0" /> <m:rMargin m:val="0" /> <m:defJc m:val="centerGroup" /> <m:wrapIndent m:val="1440" /> <m:intLim m:val="subSup" /> <m:naryLim m:val="undOvr" /> </m:mathPr></w:WordDocument> </xml><![endif]--><!--[if gte mso 9]><xml> <w:LatentStyles DefLockedState="false" DefUnhideWhenUsed="true" DefSemiHidden="true" DefQFormat="false" DefPriority="99" LatentStyleCount="267"> <w:LsdException Locked="false" Priority="0" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Normal" /> <w:LsdException Locked="false" Priority="9" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="heading 1" /> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 2" /> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 3" /> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 4" /> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 5" /> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 6" /> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 7" /> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 8" /> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 9" /> <w:LsdException Locked="false" Priority="39" Name="toc 1" /> <w:LsdException Locked="false" Priority="39" Name="toc 2" /> <w:LsdException Locked="false" Priority="39" Name="toc 3" /> <w:LsdException Locked="false" Priority="39" Name="toc 4" /> <w:LsdException Locked="false" Priority="39" Name="toc 5" /> <w:LsdException Locked="false" Priority="39" Name="toc 6" /> <w:LsdException Locked="false" Priority="39" Name="toc 7" /> <w:LsdException Locked="false" Priority="39" Name="toc 8" /> <w:LsdException Locked="false" Priority="39" Name="toc 9" /> <w:LsdException Locked="false" Priority="35" QFormat="true" Name="caption" /> <w:LsdException Locked="false" Priority="10" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Title" /> <w:LsdException Locked="false" Priority="1" Name="Default Paragraph Font" /> <w:LsdException Locked="false" Priority="11" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Subtitle" /> <w:LsdException Locked="false" Priority="22" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Strong" /> <w:LsdException Locked="false" Priority="20" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Emphasis" /> <w:LsdException Locked="false" Priority="59" SemiHidden="false" UnhideWhenUsed="false" Name="Table Grid" /> <w:LsdException Locked="false" UnhideWhenUsed="false" Name="Placeholder Text" /> <w:LsdException Locked="false" Priority="1" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="No Spacing" /> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading" /> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List" /> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid" /> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1" /> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2" /> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1" /> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2" /> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1" /> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2" /> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3" /> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List" /> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading" /> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List" /> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid" /> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 1" /> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 1" /> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 1" /> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 1" /> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 1" /> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 1" /> <w:LsdException Locked="false" UnhideWhenUsed="false" Name="Revision" /> <w:LsdException Locked="false" Priority="34" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="List Paragraph" /> <w:LsdException Locked="false" Priority="29" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Quote" /> <w:LsdException Locked="false" Priority="30" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Intense Quote" /> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 1" /> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 1" /> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 1" /> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 1" /> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 1" /> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 1" /> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 1" /> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 1" /> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 2" /> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 2" /> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 2" /> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 2" /> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 2" /> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 2" /> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 2" /> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 2" /> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 2" /> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 2" /> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 2" /> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 2" /> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 2" /> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 2" /> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 3" /> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 3" /> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 3" /> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 3" /> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 3" /> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 3" /> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 3" /> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 3" /> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 3" /> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 3" /> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 3" /> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 3" /> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 3" /> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 3" /> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 4" /> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 4" /> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 4" /> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 4" /> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 4" /> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 4" /> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 4" /> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 4" /> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 4" /> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 4" /> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 4" /> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 4" /> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 4" /> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 4" /> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 5" /> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 5" /> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 5" /> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 5" /> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 5" /> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 5" /> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 5" /> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 5" /> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 5" /> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 5" /> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 5" /> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 5" /> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 5" /> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 5" /> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 6" /> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 6" /> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 6" /> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 6" /> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 6" /> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 6" /> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 6" /> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 6" /> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 6" /> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 6" /> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 6" /> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 6" /> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 6" /> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 6" /> <w:LsdException Locked="false" Priority="19" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Subtle Emphasis" /> <w:LsdException Locked="false" Priority="21" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis" /> <w:LsdException Locked="false" Priority="31" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Subtle Reference" /> <w:LsdException Locked="false" Priority="32" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Intense Reference" /> <w:LsdException Locked="false" Priority="33" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Book Title" /> <w:LsdException Locked="false" Priority="37" Name="Bibliography" /> <w:LsdException Locked="false" Priority="39" QFormat="true" Name="TOC Heading" /> </w:LatentStyles> </xml><![endif]--><!--[if gte mso 10]> <style> /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} </style> <![endif]--><p> </p>
APA, Harvard, Vancouver, ISO, and other styles
12

Joshaline, Chellappa Mabel, Subathra M., Subathra M., Shyamala M., Padmavathy S., and Rekha Rekha. "Automated Teller Machine (ATM)- A “Pathogen City” – A surveillance Report from Locations in and around Madurai City, Tamil Nadu, India." International Journal of Public Health Science (IJPHS) 3, no. 1 (March 1, 2014): 51. http://dx.doi.org/10.11591/ijphs.v3i1.4674.

Full text
Abstract:
<!--[if gte mso 9]><xml> <o:OfficeDocumentSettings> <o:RelyOnVML /> <o:AllowPNG /> </o:OfficeDocumentSettings> </xml><![endif]--><span style="font-size: 9.0pt; font-family: 'Times New Roman','serif'; mso-fareast-font-family: 'Times New Roman'; mso-ansi-language: EN-US; mso-fareast-language: EN-US; mso-bidi-language: AR-SA;">ATM is used by millions of people in a day. It is meant to be a public utility device.Hence the microorganism’s plays a major role in accommodating the safer place, ATM.Hence to this account an elaborate survey was taken for complete assessment of microbiology in and around Madurai city. Swabs were collected from each ATM screen, buttons, floor, user’s hand, exposure of plates and also extended the work in relation with microorganisms prevalent in ladies toilet the samples collected from ATM were plated in nutrient agar plates. The results showed the presence of increased bacterial count subsequently, most pathogens on characterization extended revealed the genus of the particular organism<em style="mso-bidi-font-style: normal;"> E-coli, Pseudomonas, Staphylococcus aures, Klebsiella, Micrococcus, Salmonella, Serratia </em>and fungal species included <em style="mso-bidi-font-style: normal;">Aspergillus sp, Mucor sp and Fusarium</em>. Antibiogram study of bacteria also provides us information about the antibiotic resistance pattern of the bacterial isolates.</span><!--[if gte mso 9]><xml> <w:WordDocument> <w:View>Normal</w:View> <w:Zoom>0</w:Zoom> <w:TrackMoves /> <w:TrackFormatting /> <w:PunctuationKerning /> <w:ValidateAgainstSchemas /> <w:SaveIfXMLInvalid>false</w:SaveIfXMLInvalid> <w:IgnoreMixedContent>false</w:IgnoreMixedContent> <w:AlwaysShowPlaceholderText>false</w:AlwaysShowPlaceholderText> <w:DoNotPromoteQF /> <w:LidThemeOther>EN-US</w:LidThemeOther> <w:LidThemeAsian>X-NONE</w:LidThemeAsian> <w:LidThemeComplexScript>X-NONE</w:LidThemeComplexScript> <w:Compatibility> <w:BreakWrappedTables /> <w:SnapToGridInCell /> <w:WrapTextWithPunct /> <w:UseAsianBreakRules /> <w:DontGrowAutofit /> <w:SplitPgBreakAndParaMark /> <w:DontVertAlignCellWithSp /> <w:DontBreakConstrainedForcedTables /> <w:DontVertAlignInTxbx /> <w:Word11KerningPairs /> <w:CachedColBalance /> </w:Compatibility> <m:mathPr> <m:mathFont m:val="Cambria Math" /> <m:brkBin m:val="before" /> <m:brkBinSub m:val=" " /> <m:smallFrac m:val="off" /> <m:dispDef /> <m:lMargin m:val="0" /> <m:rMargin m:val="0" /> <m:defJc m:val="centerGroup" /> <m:wrapIndent m:val="1440" /> <m:intLim m:val="subSup" /> <m:naryLim m:val="undOvr" /> </m:mathPr></w:WordDocument> </xml><![endif]--><!--[if gte mso 9]><xml> <w:LatentStyles DefLockedState="false" DefUnhideWhenUsed="true" DefSemiHidden="true" DefQFormat="false" DefPriority="99" LatentStyleCount="267"> <w:LsdException Locked="false" Priority="0" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Normal" /> <w:LsdException Locked="false" Priority="9" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="heading 1" /> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 2" /> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 3" /> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 4" /> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 5" /> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 6" /> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 7" /> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 8" /> <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 9" /> <w:LsdException Locked="false" Priority="39" Name="toc 1" /> <w:LsdException Locked="false" Priority="39" Name="toc 2" /> <w:LsdException Locked="false" Priority="39" Name="toc 3" /> <w:LsdException Locked="false" Priority="39" Name="toc 4" /> <w:LsdException Locked="false" Priority="39" Name="toc 5" /> <w:LsdException Locked="false" Priority="39" Name="toc 6" /> <w:LsdException Locked="false" Priority="39" Name="toc 7" /> <w:LsdException Locked="false" Priority="39" Name="toc 8" /> <w:LsdException Locked="false" Priority="39" Name="toc 9" /> <w:LsdException Locked="false" Priority="35" QFormat="true" Name="caption" /> <w:LsdException Locked="false" Priority="10" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Title" /> <w:LsdException Locked="false" Priority="1" Name="Default Paragraph Font" /> <w:LsdException Locked="false" Priority="11" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Subtitle" /> <w:LsdException Locked="false" Priority="22" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Strong" /> <w:LsdException Locked="false" Priority="20" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Emphasis" /> <w:LsdException Locked="false" Priority="59" SemiHidden="false" UnhideWhenUsed="false" Name="Table Grid" /> <w:LsdException Locked="false" UnhideWhenUsed="false" Name="Placeholder Text" /> <w:LsdException Locked="false" Priority="1" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="No Spacing" /> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading" /> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List" /> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid" /> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1" /> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2" /> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1" /> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2" /> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1" /> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2" /> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3" /> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List" /> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading" /> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List" /> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid" /> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 1" /> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 1" /> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 1" /> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 1" /> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 1" /> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 1" /> <w:LsdException Locked="false" UnhideWhenUsed="false" Name="Revision" /> <w:LsdException Locked="false" Priority="34" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="List Paragraph" /> <w:LsdException Locked="false" Priority="29" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Quote" /> <w:LsdException Locked="false" Priority="30" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Intense Quote" /> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 1" /> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 1" /> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 1" /> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 1" /> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 1" /> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 1" /> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 1" /> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 1" /> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 2" /> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 2" /> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 2" /> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 2" /> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 2" /> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 2" /> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 2" /> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 2" /> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 2" /> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 2" /> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 2" /> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 2" /> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 2" /> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 2" /> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 3" /> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 3" /> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 3" /> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 3" /> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 3" /> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 3" /> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 3" /> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 3" /> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 3" /> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 3" /> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 3" /> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 3" /> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 3" /> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 3" /> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 4" /> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 4" /> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 4" /> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 4" /> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 4" /> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 4" /> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 4" /> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 4" /> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 4" /> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 4" /> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 4" /> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 4" /> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 4" /> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 4" /> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 5" /> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 5" /> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 5" /> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 5" /> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 5" /> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 5" /> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 5" /> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 5" /> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 5" /> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 5" /> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 5" /> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 5" /> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 5" /> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 5" /> <w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 6" /> <w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 6" /> <w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 6" /> <w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 6" /> <w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 6" /> <w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 6" /> <w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 6" /> <w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 6" /> <w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 6" /> <w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 6" /> <w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 6" /> <w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 6" /> <w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 6" /> <w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 6" /> <w:LsdException Locked="false" Priority="19" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Subtle Emphasis" /> <w:LsdException Locked="false" Priority="21" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis" /> <w:LsdException Locked="false" Priority="31" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Subtle Reference" /> <w:LsdException Locked="false" Priority="32" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Intense Reference" /> <w:LsdException Locked="false" Priority="33" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Book Title" /> <w:LsdException Locked="false" Priority="37" Name="Bibliography" /> <w:LsdException Locked="false" Priority="39" QFormat="true" Name="TOC Heading" /> </w:LatentStyles> </xml><![endif]--><!--[if gte mso 10]> <style> /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} </style> <![endif]--><p> </p>
APA, Harvard, Vancouver, ISO, and other styles
13

Feisst, Debbie. "The Long, Long Line by T. Ohmura." Deakin Review of Children's Literature 3, no. 4 (April 25, 2014). http://dx.doi.org/10.20361/g2sg78.

Full text
Abstract:
Ohmura, Tomoko. The Long, Long Line. Toronto, ON: OwlKids Books, 2013. Print."Thank you for waiting, and welcome aboard! One at a time, please!" mentions the bird, who is the ride guide on this mysterious ride for which 50 different animals have patiently lined up. As they wait, the bird flies amongst them, offering reassuring words as they guess as to what they may be in line for and play word games to pass the time. The anticipation builds, and finally they start boarding the ride, which turns out to be a very large whale on which the animals ride while the whale performs somersaults, dives and sprays. Children will be delighted by all 50 animals represented on the large gatefold spread in the center of the book, from the smallest frog to the largest elephant.Children will love the small details such as the tail of the next animal in line ‘peeking’ around the corner of the page and the size of the animals increasing as they get closer to the ride giving perspective of size. A list of all 50 animals is included at the back for easy reference when young readers get stumped by a species. While this is indeed a picture book aimed at young children it is no quick read – children will want to hear every word of the animals’ conversations as they wait and will want to count as they go, and likely once all the animals are aboard the whale they will want to confirm there are indeed 50 animals present, perhaps multiple times.The colourful illustrations by the author are cute and engaging and show a wide range of expressions and interplay between the animals. The language felt slightly unnatural but this may be a result of this edition being a translation of the original Japanese work Nanno Gyoretsu? A fun book for public and elementary schools as well as a nice addition to science or math based storytime in lower elementary grades.The Long, Long Line was selected as one of the best children’s books of 2013 by Kirkus Reviews.Recommended: 3 out of 4 stars Reviewer: Debbie FeisstDebbie is a Public Services Librarian at the H.T. Coutts Education Library at the University of Alberta. When not renovating, she enjoys travel, fitness and young adult fiction.
APA, Harvard, Vancouver, ISO, and other styles
14

Chen, Kuang-hua, and Bi-Shin Hsueh. "Exploring Regional Development of Digital Humanities Research: A Case Study for Taiwan." Journal of Data Mining & Digital Humanities 2014 (June 24, 2014). http://dx.doi.org/10.46298/jdmdh.6.

Full text
Abstract:
This study analyzed references and source papers of the Proceedings of 2009-2012 International Conference of Digital Archives and Digital Humanities (DADH), which was held annually in Taiwan. A total of 59 sources and 1,104 references were investigated, based on descriptive analysis and subject analysis of library practices on cataloguing. Preliminary results showed historical materials, events, bureaucracies, and people of Taiwan and China in the Qing Dynasty were the major subjects in the tempo-spatial dimensions. The subject-date figure depicted a long-low head and short-high tail curve, which demonstrated both characteristics of research of humanities and application of technology in digital humanities. The dates of publication of the references spanned over 360 years, which shows a long time span in research materials. A majority of the papers (61.41%) were single-authored, which is in line with the common research practice in the humanities. Books published by general publishers were the major type of references, and this was the same as that of established humanities research. The next step of this study will focus on the comparison of characteristics of both sources and references of international journals with those reported in this article. Comment: 25 pages, 10 tables, 5 figures
APA, Harvard, Vancouver, ISO, and other styles
15

Sudharsan, R., and V. Saravanabavan. "Availability and Utilization of Primary Healthcare Centre in Thanjavur District, Tamilnadu." International Journal of Scientific Research in Science and Technology, August 5, 2019, 288–97. http://dx.doi.org/10.32628/ijsrst196451.

Full text
Abstract:
Health is a common theme in most cultures. Among the definitions still used, probably the oldest is that health is not the absence of disease. Contemporary developments in social sciences reveal that health is not only a biomedical phenomenon, but one which is influenced by social, psychological, cultural, economic and political factors of the people concerned. Thanjavur District lies on the east of Tamil Nadu. It is situated between 90 50’and 110 25’ of the northern latitude and between 780 45’and 790 25’ of the eastern longitude. It extends to an area of 3411 sq. kms. Our sample in Thanjavur, we found more people depending upon the public health facilities than on the private health facilities. Almost 74% people went to public health facilities and only 26% went to the private health facilities. The health status of various blocks of the district in relation to other blocks with reference to socio-economic living, environment, family structure and health care utilization but also emphasized the intra regional variation that exists among different bocks in the health status of the population.
APA, Harvard, Vancouver, ISO, and other styles
16

Wessell, Adele. "Cookbooks for Making History: As Sources for Historians and as Records of the Past." M/C Journal 16, no. 3 (August 23, 2013). http://dx.doi.org/10.5204/mcj.717.

Full text
Abstract:
Historians have often been compared with detectives; searching for clues as evidence of a mystery they are seeking to solve. I would prefer an association with food, making history like a trained cook who blends particular ingredients, some fresh, some traditional, using specific methods to create an object that is consumed. There are primary sources, fresh and raw ingredients that you often have to go to great lengths to procure, and secondary sources, prepared initially by someone else. The same recipe may yield different meals, the same meal may provoke different responses. On a continuum of approaches to history and food, there are those who approach both as a scientific endeavour and, at the other end of the spectrum, those who make history and food as art. Brought together, it is possible to see cookbooks as history in at least two important ways; they give meaning to the past by representing culinary heritage and they are in themselves sources of history as documents and blueprints for experiences that can be interpreted to represent the past. Many people read cookbooks and histories with no intention of preparing the meal or becoming a historian. I do a little of both. I enjoy reading history and cookbooks for pleasure but, as a historian, I also read them interchangeably; histories to understand cookbooks and cookbooks to find out more about the past. History and the past are different of course, despite their use in the English language. It is not possible to relive the past, we can only interpret it through the traces that remain. Even if a reader had an exact recipe and an antique stove, vegetables grown from heritage seeds in similar conditions, eggs and grains from the same region and employed the techniques his or her grandparents used, they could not replicate their experience of a meal. Undertaking those activities though would give a reader a sense of that experience. Active examination of the past is possible through the processes of research and writing, but it will always be an interpretation and not a reproduction of the past itself. Nevertheless, like other histories, cookbooks can convey a sense of what was important in a culture, and what contemporaries might draw on that can resonate a cultural past and make the food palatable. The way people eat relates to how they apply ideas and influences to the material resources and knowledge they have. Used in this way, cookbooks provide a rich and valuable way to look at the past. Histories, like cookbooks, are written in the present, inspired and conditioned by contemporary issues and attitudes and values. Major shifts in interpretation or new directions in historical studies have more often arisen from changes in political or theoretical preoccupations, generated by contemporary social events, rather than the recovery of new information. Likewise, the introduction of new ingredients or methods rely on contemporary acceptance, as well as familiarity. How particular versions of history and new recipes promote both the past and present is the concern of this paper. My focus below will be on the nineteenth century, although a much larger study would reveal the circumstances that separated that period from the changes that followed. Until the late nineteenth century Australians largely relied on cookbooks that were brought with them from England and on their own private recipe collection, and that influenced to a large extent the sort of food that they ate, although of course they had to improvise by supplementing with local ingredients. In the first book of recipes that was published in Australia, The English and Australian Cookery Book that appeared in 1864, Edward Abbott evoked the ‘roast beef of old England Oh’ (Bannerman, Dictionary). The use of such a potent symbol of English identity in the nineteenth century may seem inevitable, and colonists who could afford them tended to use their English cookbooks and the ingredients for many years, even after Abbott’s publication. New ingredients, however, were often adapted to fit in with familiar culinary expectations in the new setting. Abbott often drew on native and exotic ingredients to produce very familiar dishes that used English methods and principles: things like kangaroo stuffed with beef suet, breadcrumbs, parsley, shallots, marjoram, thyme, nutmeg, pepper, salt, cayenne, and egg. It was not until the 1890s that a much larger body of Australian cookbooks became available, but by this time the food supply was widely held to be secure and abundant and the cultivation of exotic foods in Australia like wheat and sheep and cattle had established a long and familiar food supply for English colonists. Abbott’s cookbook provides a record of the culinary heritage settlers brought with them to Australia and the contemporary circumstances they had to adapt to. Mrs Beeton’s Cookery Book and Household Guide is an example of the popularity of British cookbooks in Australia. Beeton’s Kangaroo Tail Curry was included in the Australian cooking section of her household management (2860). In terms of structure it is important for historians as one of the first times, because Beeton started writing in the 1860s, that ingredients were clearly distinguished from the method. This actually still presents considerable problems for publishers. There is debate about whether that should necessarily be the case, because it takes up so much space on the page. Kangaroo Tail CurryIngredients:1 tail2 oz. Butter1 tablespoon of flour1 tablespoon of curry2 onions sliced1 sour apple cut into dice1 desert spoon of lemon juice3/4 pint of stocksaltMethod:Wash, blanch and dry the tail thoroughly and divide it at the joints. Fry the tail in hot butter, take it up, put it in the sliced onions, and fry them for 3 or 4 minutes without browning. Sprinkle in the flour and curry powder, and cook gently for at least 20 minutes, stirring frequently. Add the stock, apple, salt to taste, bring to the boil, stirring meanwhile, and replace the tail in the stew pan. Cover closely, and cook gently until tender, then add the lemon juice and more seasoning if necessary. Arrange the pieces of tail on a hot dish, strain the sauce over, and serve with boiled rice.Time: 2-3 hoursSufficient for 1 large dish. Although the steps are not clearly distinguished from each other the method is more systematic than earlier recipes. Within the one sentence, however, there are still two or three different sorts of tasks. The recipe also requires to some extent a degree of discretion, knowledge and experience of cooking. Beeton suggests adding things to taste, cooking something until it is tender, so experience or knowledge is necessary to fulfil the recipe. The meal also takes between two and three hours, which would be quite prohibitive for a lot of contemporary cooks. New recipes, like those produced in Delicious have recipes that you can do in ten minutes or half an hour. Historically, that is a new development that reveals a lot about contemporary conditions. By 1900, Australian interest in native food had pretty much dissolved from the record of cookbooks, although this would remain a feature of books for the English public who did not need to distinguish themselves from Indigenous people. Mrs Beeton’s Cookery Book and Household Guide gave a selection of Australian recipes but they were primarily for the British public rather than the assumption that they were being cooked in Australia: kangaroo tail soup was cooked in the same way as ox tail soup; roast wallaby was compared to hare. The ingredients were wallaby, veal, milk and butter; and parrot pie was said to be not unlike one made of pigeons. The novelty value of such ingredients may have been of interest, rather than their practical use. However, they are all prepared in ways that would make them fairly familiar to European tastes. Introducing something new with the same sorts of ingredients could therefore proliferate the spread of other foods. The means by which ingredients were introduced to different regions reflects cultural exchanges, historical processes and the local environment. The adaptation of recipes to incorporate local ingredients likewise provides information about local traditions and contemporary conditions. Starting to see those ingredients as a two-way movement between looking at what might have been familiar to people and what might have been something that they had to do make do with because of what was necessarily available to them at that time tells us about their past as well as the times they are living in. Differences in the level of practical cooking knowledge also have a vital role to play in cookbook literature. Colin Bannerman has suggested that the shortage of domestic labour in Australia an important factor in supporting the growth of the cookbook industry in the late nineteenth century. The poor quality of Australian cooking was also an occasional theme in the press during the same time. The message was generally the same: bad food affected Australians’ physical, domestic, social and moral well-being and impeded progress towards civilisation and higher culture. The idea was really that Australians had to learn how to cook. Colin Bannerman (Acquired Tastes 19) explains the rise of domestic science in Australia as a product of growing interest in Australian cultural development and the curse of bad cookery, which encouraged support for teaching girls and women how to cook. Domestic Economy was integrated into the Victorian and New South Wales curriculum by the end of the nineteenth century. Australian women have faced constant criticism of their cooking skills but the decision to teach cooking shouldn’t necessarily be used to support that judgement. Placed in a broader framework is possible to see the support for a modern, scientific approach to food preparation as part of both the elevation of science and systematic knowledge in society more generally, and a transnational movement to raise the status of women’s role in society. It would also be misleading not to consider the transnational context. Australia’s first cookery teachers were from Britain. The domestic-science movement there can be traced to the congress on domestic economy held in Manchester in 1878, at roughly the same time as the movement was gaining strength in Australia. By the 1890s domestic economy was widely taught in both British and Australian schools, without British women facing the same denigration of their cooking skills. Other comparisons with Britain also resulted from Australia’s colonial heritage. People often commented on the quality of the ingredients in Australia and said they were more widely available than they were in England but much poorer in quality. Cookbooks emerged as a way of teaching people. Among the first to teach cookery skills was Mina Rawson, author of The Antipodean Cookery Book and the Kitchen Companion first published in 1885. The book was a compilation of her own recipes and remedies, and it organised and simplified food preparation for the ordinary housewife. But the book also included directions and guidance on things like household tasks and how to cure diseases. Cookbooks therefore were not completely distinct from other aspects of everyday life. They offered much more than culinary advice on how to cook a particular meal and can similarly be used by historians to comment on more than food. Mrs Rawson also knew that people had to make do. She included a lot of bush foods that you still do not get in a lot of Australian meals, ingredients that people could substitute for the English ones they were used to like pig weed. By the end of the nineteenth century cooking had become a recognised classroom subject, providing early training in domestic service, and textbooks teaching Australians how to cook also flourished. Measurements became much more uniform, the layout of cookbooks became more standardised and the procedure was clearly spelled out. This allowed companies to be able to sell their foods because it also meant that you could duplicate the recipes and they could potentially taste the same. It made cookbooks easier to use. The audience for these cookbooks were mostly young women directed to cooking as a way of encouraging social harmony. Cooking was elevated in lots of ways at this stage as a social responsibility. Cookbooks can also be seen as a representation of domestic life, and historically this prescribed the activities of men and women as being distinct The dominance of women in cookbooks in the nineteenth and early twentieth centuries attested to the strength of that idea of separate spheres. The consequences of this though has been debated by historians: whether having that particular kind of market and the identification that women were making with each other also provided a forum for women’s voices and so became quite significant in women’s politics at a later date. Cookbooks have been a strategic marketing device for products and appliances. By the beginning of the twentieth century food companies began to print recipes on their packets and to release their own cookbooks to promote their products. Davis Gelatine produced its first free booklet in 1904 and other companies followed suit (1937). The largest gelatine factory was in New South Wales and according to Davis: ‘It bathed in sunshine and freshened with the light breezes of Botany all year round.’ These were the first lavishly illustrated Australian cookbooks. Such books were an attempt to promote new foods and also to sell local foods, many of which were overproduced – such as milk, and dried fruits – which provides insights into the supply chain. Cookbooks in some ways reflected the changing tastes of the public, their ideas, what they were doing and their own lifestyle. But they also helped to promote some of those sorts of changes too. Explaining the reason for cooking, Isabella Beeton put forward an historical account of the shift towards increasing enjoyment of it. She wrote: "In the past, only to live has been the greatest object of mankind, but by and by comforts are multiplied and accumulating riches create new wants. The object then is to not only live but to live economically, agreeably, tastefully and well. Accordingly the art of cookery commences and although the fruits of the earth, the fowls of the air, the beasts of the field and the fish of the sea are still the only food of mankind, yet these are so prepared, improved and dressed by skill and ingenuity that they are the means of immeasurably extending the boundaries of human enjoyment. Everything that is edible and passes under the hands of cooks is more or less changed and assumes new forms, hence the influence of that functionary is immense upon the happiness of the household" (1249). Beeton anticipates a growing trend not just towards cooking and eating but an interest in what sustains cooking as a form of recreation. The history of cookbook publishing provides a glimpse into some of those things. The points that I have raised provide a means for historians to use cookbooks. Cookbooks can be considered in terms of what was eaten, by whom and how: who prepared the food, so to whom the books were actually directed? Clever books like Isabella Beeton’s were directed at both domestic servants and at wives, which gave them quite a big market. There are also changes in the inclusion of themes. Economy and frugality becomes quite significant, as do organisation and management at different times. Changes in the extent of detail, changes in authorship, whether it is women, men, doctors, health professionals, home economists and so on all reflect contemporary concerns. Many books had particular purposes as well, used to fund raise or promote a particular perspective, relate food reform and civic life which gives them a political agenda. Promotional literature produced by food and kitchen equipment companies were a form of advertising and quite significant to the history of cookbook publishing in Australia. Other themes include the influence of cookery school and home economics movements; advice on etiquette and entertaining; the influence of immigration and travel; the creation of culinary stars and authors of which we are all fairly familiar. Further themes include changes in ingredients, changes in advice about health and domestic medicine, and the impact of changes in social consciousness. It is necessary to place those changes in a more general historical context, but for a long time cookbooks have been ignored as a source of information in their own right about the period in which they were published and the kinds of social and political changes that we can see coming through. More than this active process of cooking with the books as well becomes a way of imagining the past in quite different ways than historians are often used to. Cookbooks are not just sources for historians, they are histories in themselves. The privileging of written and visual texts in postcolonial studies has meant other senses, taste and smell, are frequently neglected; and yet the cooking from historical cookbooks can provide an embodied, sensorial image of the past. From nineteenth century cookbooks it is possible to see that British foods were central to the colonial identity project in Australia, but the fact that “British” culinary culture was locally produced, challenges the idea of an “authentic” British cuisine which the colonies tried to replicate. By the time Abbot was advocating rabbit curry as an Australian family meal, back “at home” in England, it was not authentic Indian food but the British invention of curry power that was being incorporated into English cuisine culture. More than cooks, cookbook authors told a narrative that forged connections and disconnections with the past. They reflected the contemporary period and resonated with the culinary heritage of their readers. Cookbooks make history in multiple ways; by producing change, as the raw materials for making history and as historical narratives. References Abbott, Edward. The English and Australian Cookery Book: Cookery for the Many, as well as the Upper Ten Thousand. London: Sampson Low, Son & Marston, 1864. Bannerman, Colin. Acquired Tastes: Celebrating Australia’s Culinary History. Canberra: National Library of Australia, 1998. Bannerman, Colin. "Abbott, Edward (1801–1869)." Australian Dictionary of Biography. National Centre of Biography, Australian National University. 21 May 2013. . Beeton, Isabella. Mrs Beeton’s Book of Household Management. New Ed. London and Melbourne: Ward, Lock and Co. Ltd., n.d. (c. 1909). Davis Gelatine. Davis Dainty Dishes. Rev ed. Sydney: Davis Gelatine Organization, 1937. Rawson, Lance Mrs. The Antipodean Cookery Book and Kitchen Companion. Melbourne: George Robertson & Co., 1897.
APA, Harvard, Vancouver, ISO, and other styles
17

Barry, S. "The year of jubilee: a hermeneutic for social and moral transformation in South Africa." In die Skriflig/In Luce Verbi 45, no. 4 (July 26, 2011). http://dx.doi.org/10.4102/ids.v45i4.206.

Full text
Abstract:
This article aims to show that the Old Testament concept of the year of jubilee is neither an anachronistic, nor a peripheral de- tail of Scripture. It is an integral part of it and indeed one her- meneutical tool for interpreting and applying it to social and mo- ral transformation in South Africa. Israel, liberated from slavery and returning to God, became a paradigm for the liberated slave to return to his inheritance in the year of jubilee celebrated every 50th year. Its underlying concerns are: justice, freedom, human dignity and rights. Jesus clearly understood his mission in terms of the proclama- tion of “the year of the Lord’s favour” (Luke 4:14-21), and de- monstrated this by preaching good news to the poor, freeing the prisoners, restoring sight to the blind, and releasing the op- pressed. He linked the mission of his followers with his own and with the promise and gift of the Holy Spirit. Pentecost, seen as fulfilment and announcement of God’s promise, demonstrates that the kingdom of God is already here and still to come. The Book of Revelation gathers together this scriptural theme and presents the jubilee as good news for now and the future. Indeed, God’s future is presented as the ultimate jubilee. Although these institutions cannot be imposed on a secular democracy, there are implications here for holistic evangelism and mission as well as for social and moral transformation in South Africa. These implications, it is argued, should include a reference to the ‘missio Dei’ as Jesus expressed it: holistic evangelism; a commitment to the values and practices of restorative justice; restoration, healing and hope; economic justice and land re- form; ecological responsibility; and moral restoration.
APA, Harvard, Vancouver, ISO, and other styles
18

Brien, Donna Lee. "The Real Filth in American Psycho." M/C Journal 9, no. 5 (November 1, 2006). http://dx.doi.org/10.5204/mcj.2657.

Full text
Abstract:
1991 An afternoon in late 1991 found me on a Sydney bus reading Brett Easton Ellis’ American Psycho (1991). A disembarking passenger paused at my side and, as I glanced up, hissed, ‘I don’t know how you can read that filth’. As she continued to make her way to the front of the vehicle, I was as stunned as if she had struck me physically. There was real vehemence in both her words and how they were delivered, and I can still see her eyes squeezing into slits as she hesitated while curling her mouth around that final angry word: ‘filth’. Now, almost fifteen years later, the memory is remarkably vivid. As the event is also still remarkable; this comment remaining the only remark ever made to me by a stranger about anything I have been reading during three decades of travelling on public transport. That inflamed commuter summed up much of the furore that greeted the publication of American Psycho. More than this, and unusually, condemnation of the work both actually preceded, and affected, its publication. Although Ellis had been paid a substantial U.S. $300,000 advance by Simon & Schuster, pre-publication stories based on circulating galley proofs were so negative—offering assessments of the book as: ‘moronic … pointless … themeless … worthless (Rosenblatt 3), ‘superficial’, ‘a tapeworm narrative’ (Sheppard 100) and ‘vile … pornography, not literature … immoral, but also artless’ (Miner 43)—that the publisher cancelled the contract (forfeiting the advance) only months before the scheduled release date. CEO of Simon & Schuster, Richard E. Snyder, explained: ‘it was an error of judgement to put our name on a book of such questionable taste’ (quoted in McDowell, “Vintage” 13). American Psycho was, instead, published by Random House/Knopf in March 1991 under its prestige paperback imprint, Vintage Contemporary (Zaller; Freccero 48) – Sonny Mehta having signed the book to Random House some two days after Simon & Schuster withdrew from its agreement with Ellis. While many commented on the fact that Ellis was paid two substantial advances, it was rarely noted that Random House was a more prestigious publisher than Simon & Schuster (Iannone 52). After its release, American Psycho was almost universally vilified and denigrated by the American critical establishment. The work was criticised on both moral and aesthetic/literary/artistic grounds; that is, in terms of both what Ellis wrote and how he wrote it. Critics found it ‘meaningless’ (Lehmann-Haupt C18), ‘abysmally written … schlock’ (Kennedy 427), ‘repulsive, a bloodbath serving no purpose save that of morbidity, titillation and sensation … pure trash, as scummy and mean as anything it depicts, a dirty book by a dirty writer’ (Yardley B1) and ‘garbage’ (Gurley Brown 21). Mark Archer found that ‘the attempt to confuse style with content is callow’ (31), while Naomi Wolf wrote that: ‘overall, reading American Psycho holds the same fascination as watching a maladjusted 11-year-old draw on his desk’ (34). John Leo’s assessment sums up the passionate intensity of those critical of the work: ‘totally hateful … violent junk … no discernible plot, no believable characterization, no sensibility at work that comes anywhere close to making art out of all the blood and torture … Ellis displays little feel for narration, words, grammar or the rhythm of language’ (23). These reviews, as those printed pre-publication, were titled in similarly unequivocal language: ‘A Revolting Development’ (Sheppard 100), ‘Marketing Cynicism and Vulgarity’ (Leo 23), ‘Designer Porn’ (Manguel 46) and ‘Essence of Trash’ (Yardley B1). Perhaps the most unambiguous in its message was Roger Rosenblatt’s ‘Snuff this Book!’ (3). Of all works published in the U.S.A. at that time, including those clearly carrying X ratings, the Los Angeles chapter of the National Organization for Women (NOW) selected American Psycho for special notice, stating that the book ‘legitimizes inhuman and savage violence masquerading as sexuality’ (NOW 114). Judging the book ‘the most misogynistic communication’ the organisation had ever encountered (NOW L.A. chapter president, Tammy Bruce, quoted in Kennedy 427) and, on the grounds that ‘violence against women in any form is no longer socially acceptable’ (McDowell, “NOW” C17), NOW called for a boycott of the entire Random House catalogue for the remainder of 1991. Naomi Wolf agreed, calling the novel ‘a violation not of obscenity standards, but of women’s civil rights, insofar as it results in conditioning male sexual response to female suffering or degradation’ (34). Later, the boycott was narrowed to Knopf and Vintage titles (Love 46), but also extended to all of the many products, companies, corporations, firms and brand names that are a feature of Ellis’s novel (Kauffman, “American” 41). There were other unexpected responses such as the Walt Disney Corporation barring Ellis from the opening of Euro Disney (Tyrnauer 101), although Ellis had already been driven from public view after receiving a number of death threats and did not undertake a book tour (Kennedy 427). Despite this, the book received significant publicity courtesy of the controversy and, although several national bookstore chains and numerous booksellers around the world refused to sell the book, more than 100,000 copies were sold in the U.S.A. in the fortnight after publication (Dwyer 55). Even this success had an unprecedented effect: when American Psycho became a bestseller, The New York Times announced that it would be removing the title from its bestseller lists because of the book’s content. In the days following publication in the U.S.A., Canadian customs announced that it was considering whether to allow the local arm of Random House to, first, import American Psycho for sale in Canada and, then, publish it in Canada (Kirchhoff, “Psycho” C1). Two weeks later, when the book was passed for sale (Kirchhoff, “Customs” C1), demonstrators protested the entrance of a shipment of the book. In May, the Canadian Defence Force made headlines when it withdrew copies of the book from the library shelves of a navy base in Halifax (Canadian Press C1). Also in May 1991, the Australian Office of Film and Literature Classification (OFLC), the federal agency that administers the classification scheme for all films, computer games and ‘submittable’ publications (including books) that are sold, hired or exhibited in Australia, announced that it had classified American Psycho as ‘Category 1 Restricted’ (W. Fraser, “Book” 5), to be sold sealed, to only those over 18 years of age. This was the first such classification of a mainstream literary work since the rating scheme was introduced (Graham), and the first time a work of literature had been restricted for sale since Philip Roth’s Portnoy’s Complaint in 1969. The chief censor, John Dickie, said the OFLC could not justify refusing the book classification (and essentially banning the work), and while ‘as a satire on yuppies it has a lot going for it’, personally he found the book ‘distasteful’ (quoted in W. Fraser, “Sensitive” 5). Moreover, while this ‘R’ classification was, and remains, a national classification, Australian States and Territories have their own sale and distribution regulation systems. Under this regime, American Psycho remains banned from sale in Queensland, as are all other books in this classification category (Vnuk). These various reactions led to a flood of articles published in the U.S.A., Canada, Australia and the U.K., voicing passionate opinions on a range of issues including free speech and censorship, the corporate control of artistic thought and practice, and cynicism on the part of authors and their publishers about what works might attract publicity and (therefore) sell in large numbers (see, for instance, Hitchens 7; Irving 1). The relationship between violence in society and its representation in the media was a common theme, with only a few commentators (including Norman Mailer in a high profile Vanity Fair article) suggesting that, instead of inciting violence, the media largely reflected, and commented upon, societal violence. Elayne Rapping, an academic in the field of Communications, proposed that the media did actively glorify violence, but only because there was a market for such representations: ‘We, as a society love violence, thrive on violence as the very basis of our social stability, our ideological belief system … The problem, after all, is not media violence but real violence’ (36, 38). Many more commentators, however, agreed with NOW, Wolf and others and charged Ellis’s work with encouraging, and even instigating, violent acts, and especially those against women, calling American Psycho ‘a kind of advertising for violence against women’ (anthropologist Elliot Leyton quoted in Dwyer 55) and, even, a ‘how-to manual on the torture and dismemberment of women’ (Leo 23). Support for the book was difficult to find in the flood of vitriol directed against it, but a small number wrote in Ellis’s defence. Sonny Mehta, himself the target of death threats for acquiring the book for Random House, stood by this assessment, and was widely quoted in his belief that American Psycho was ‘a serious book by a serious writer’ and that Ellis was ‘remarkably talented’ (Knight-Ridder L10). Publishing director of Pan Macmillan Australia, James Fraser, defended his decision to release American Psycho on the grounds that the book told important truths about society, arguing: ‘A publisher’s office is a clearing house for ideas … the real issue for community debate [is] – to what extent does it want to hear the truth about itself, about individuals within the community and about the governments the community elects. If we care about the preservation of standards, there is none higher than this. Gore Vidal was among the very few who stated outright that he liked the book, finding it ‘really rather inspired … a wonderfully comic novel’ (quoted in Tyrnauer 73). Fay Weldon agreed, judging the book as ‘brilliant’, and focusing on the importance of Ellis’s message: ‘Bret Easton Ellis is a very good writer. He gets us to a ‘T’. And we can’t stand it. It’s our problem, not his. American Psycho is a beautifully controlled, careful, important novel that revolves around its own nasty bits’ (C1). Since 1991 As unlikely as this now seems, I first read American Psycho without any awareness of the controversy raging around its publication. I had read Ellis’s earlier works, Less than Zero (1985) and The Rules of Attraction (1987) and, with my energies fully engaged elsewhere, cannot now even remember how I acquired the book. Since that angry remark on the bus, however, I have followed American Psycho’s infamy and how it has remained in the public eye over the last decade and a half. Australian OFLC decisions can be reviewed and reversed – as when Pasolini’s final film Salo (1975), which was banned in Australia from the time of its release in 1975 until it was un-banned in 1993, was then banned again in 1998 – however, American Psycho’s initial classification has remained unchanged. In July 2006, I purchased a new paperback copy in rural New South Wales. It was shrink-wrapped in plastic and labelled: ‘R. Category One. Not available to persons under 18 years. Restricted’. While exact sales figures are difficult to ascertain, by working with U.S.A., U.K. and Australian figures, this copy was, I estimate, one of some 1.5 to 1.6 million sold since publication. In the U.S.A., backlist sales remain very strong, with some 22,000 copies sold annually (Holt and Abbott), while lifetime sales in the U.K. are just under 720,000 over five paperback editions. Sales in Australia are currently estimated by Pan MacMillan to total some 100,000, with a new printing of 5,000 copies recently ordered in Australia on the strength of the book being featured on the inaugural Australian Broadcasting Commission’s First Tuesday Book Club national television program (2006). Predictably, the controversy around the publication of American Psycho is regularly revisited by those reviewing Ellis’s subsequent works. A major article in Vanity Fair on Ellis’s next book, The Informers (1994), opened with a graphic description of the death threats Ellis received upon the publication of American Psycho (Tyrnauer 70) and then outlined the controversy in detail (70-71). Those writing about Ellis’s two most recent novels, Glamorama (1999) and Lunar Park (2005), have shared this narrative strategy, which also forms at least part of the frame of every interview article. American Psycho also, again predictably, became a major topic of discussion in relation to the contracting, making and then release of the eponymous film in 2000 as, for example, in Linda S. Kauffman’s extensive and considered review of the film, which spent the first third discussing the history of the book’s publication (“American” 41-45). Playing with this interest, Ellis continues his practice of reusing characters in subsequent works. Thus, American Psycho’s Patrick Bateman, who first appeared in The Rules of Attraction as the elder brother of the main character, Sean – who, in turn, makes a brief appearance in American Psycho – also turns up in Glamorama with ‘strange stains’ on his Armani suit lapels, and again in Lunar Park. The book also continues to be regularly cited in discussions of censorship (see, for example, Dubin; Freccero) and has been included in a number of university-level courses about banned books. In these varied contexts, literary, cultural and other critics have also continued to disagree about the book’s impact upon readers, with some persisting in reading the novel as a pornographic incitement to violence. When Wade Frankum killed seven people in Sydney, many suggested a link between these murders and his consumption of X-rated videos, pornographic magazines and American Psycho (see, for example, Manne 11), although others argued against this (Wark 11). Prosecutors in the trial of Canadian murderer Paul Bernardo argued that American Psycho provided a ‘blueprint’ for Bernardo’s crimes (Canadian Press A5). Others have read Ellis’s work more positively, as for instance when Sonia Baelo Allué compares American Psycho favourably with Thomas Harris’s The Silence of the Lambs (1988) – arguing that Harris not only depicts more degrading treatment of women, but also makes Hannibal Lecter, his antihero monster, sexily attractive (7-24). Linda S. Kauffman posits that American Psycho is part of an ‘anti-aesthetic’ movement in art, whereby works that are revoltingly ugly and/or grotesque function to confront the repressed fears and desires of the audience and explore issues of identity and subjectivity (Bad Girls), while Patrick W. Shaw includes American Psycho in his work, The Modern American Novel of Violence because, in his opinion, the violence Ellis depicts is not gratuitous. Lost, however, in much of this often-impassioned debate and dialogue is the book itself – and what Ellis actually wrote. 21-years-old when Less than Zero was published, Ellis was still only 26 when American Psycho was released and his youth presented an obvious target. In 1991, Terry Teachout found ‘no moment in American Psycho where Bret Easton Ellis, who claims to be a serious artist, exhibits the workings of an adult moral imagination’ (45, 46), Brad Miner that it was ‘puerile – the very antithesis of good writing’ (43) and Carol Iannone that ‘the inclusion of the now famous offensive scenes reveals a staggering aesthetic and moral immaturity’ (54). Pagan Kennedy also ‘blamed’ the entire work on this immaturity, suggesting that instead of possessing a developed artistic sensibility, Ellis was reacting to (and, ironically, writing for the approval of) critics who had lauded the documentary realism of his violent and nihilistic teenage characters in Less than Zero, but then panned his less sensational story of campus life in The Rules of Attraction (427-428). Yet, in my opinion, there is not only a clear and coherent aesthetic vision driving Ellis’s oeuvre but, moreover, a profoundly moral imagination at work as well. This was my view upon first reading American Psycho, and part of the reason I was so shocked by that charge of filth on the bus. Once familiar with the controversy, I found this view shared by only a minority of commentators. Writing in the New Statesman & Society, Elizabeth J. Young asked: ‘Where have these people been? … Books of pornographic violence are nothing new … American Psycho outrages no contemporary taboos. Psychotic killers are everywhere’ (24). I was similarly aware that such murderers not only existed in reality, but also in many widely accessed works of literature and film – to the point where a few years later Joyce Carol Oates could suggest that the serial killer was an icon of popular culture (233). While a popular topic for writers of crime fiction and true crime narratives in both print and on film, a number of ‘serious’ literary writers – including Truman Capote, Norman Mailer, Kate Millet, Margaret Atwood and Oates herself – have also written about serial killers, and even crossed over into the widely acknowledged as ‘low-brow’ true crime genre. Many of these works (both popular or more literary) are vivid and powerful and have, as American Psycho, taken a strong moral position towards their subject matter. Moreover, many books and films have far more disturbing content than American Psycho, yet have caused no such uproar (Young and Caveney 120). By now, the plot of American Psycho is well known, although the structure of the book, noted by Weldon above (C1), is rarely analysed or even commented upon. First person narrator, Patrick Bateman, a young, handsome stockbroker and stereotypical 1980s yuppie, is also a serial killer. The book is largely, and innovatively, structured around this seeming incompatibility – challenging readers’ expectations that such a depraved criminal can be a wealthy white professional – while vividly contrasting the banal, and meticulously detailed, emptiness of Bateman’s life as a New York über-consumer with the scenes where he humiliates, rapes, tortures, murders, mutilates, dismembers and cannibalises his victims. Although only comprising some 16 out of 399 pages in my Picador edition, these violent scenes are extreme and certainly make the work as a whole disgustingly confronting. But that is the entire point of Ellis’s work. Bateman’s violence is rendered so explicitly because its principal role in the novel is to be inescapably horrific. As noted by Baelo Allué, there is no shift in tone between the most banally described detail and the description of violence (17): ‘I’ve situated the body in front of the new Toshiba television set and in the VCR is an old tape and appearing on the screen is the last girl I filmed. I’m wearing a Joseph Abboud suit, a tie by Paul Stuart, shoes by J. Crew, a vest by someone Italian and I’m kneeling on the floor beside a corpse, eating the girl’s brain, gobbling it down, spreading Grey Poupon over hunks of the pink, fleshy meat’ (Ellis 328). In complete opposition to how pornography functions, Ellis leaves no room for the possible enjoyment of such a scene. Instead of revelling in the ‘spine chilling’ pleasures of classic horror narratives, there is only the real horror of imagining such an act. The effect, as Kauffman has observed is, rather than arousing, often so disgusting as to be emetic (Bad Girls 249). Ellis was surprised that his detractors did not understand that he was trying to be shocking, not offensive (Love 49), or that his overall aim was to symbolise ‘how desensitised our culture has become towards violence’ (quoted in Dwyer 55). Ellis was also understandably frustrated with readings that conflated not only the contents of the book and their meaning, but also the narrator and author: ‘The acts described in the book are truly, indisputably vile. The book itself is not. Patrick Bateman is a monster. I am not’ (quoted in Love 49). Like Fay Weldon, Norman Mailer understood that American Psycho posited ‘that the eighties were spiritually disgusting and the author’s presentation is the crystallization of such horror’ (129). Unlike Weldon, however, Mailer shied away from defending the novel by judging Ellis not accomplished enough a writer to achieve his ‘monstrous’ aims (182), failing because he did not situate Bateman within a moral universe, that is, ‘by having a murderer with enough inner life for us to comprehend him’ (182). Yet, the morality of Ellis’s project is evident. By viewing the world through the lens of a psychotic killer who, in many ways, personifies the American Dream – wealthy, powerful, intelligent, handsome, energetic and successful – and, yet, who gains no pleasure, satisfaction, coherent identity or sense of life’s meaning from his endless, selfish consumption, Ellis exposes the emptiness of both that world and that dream. As Bateman himself explains: ‘Surface, surface, surface was all that anyone found meaning in. This was civilisation as I saw it, colossal and jagged’ (Ellis 375). Ellis thus situates the responsibility for Bateman’s violence not in his individual moral vacuity, but in the barren values of the society that has shaped him – a selfish society that, in Ellis’s opinion, refused to address the most important issues of the day: corporate greed, mindless consumerism, poverty, homelessness and the prevalence of violent crime. Instead of pornographic, therefore, American Psycho is a profoundly political text: Ellis was never attempting to glorify or incite violence against anyone, but rather to expose the effects of apathy to these broad social problems, including the very kinds of violence the most vocal critics feared the book would engender. Fifteen years after the publication of American Psycho, although our societies are apparently growing in overall prosperity, the gap between rich and poor also continues to grow, more are permanently homeless, violence – whether domestic, random or institutionally-sanctioned – escalates, and yet general apathy has intensified to the point where even the ‘ethics’ of torture as government policy can be posited as a subject for rational debate. The real filth of the saga of American Psycho is, thus, how Ellis’s message was wilfully ignored. While critics and public intellectuals discussed the work at length in almost every prominent publication available, few attempted to think in any depth about what Ellis actually wrote about, or to use their powerful positions to raise any serious debate about the concerns he voiced. Some recent critical reappraisals have begun to appreciate how American Psycho is an ‘ethical denunciation, where the reader cannot but face the real horror behind the serial killer phenomenon’ (Baelo Allué 8), but Ellis, I believe, goes further, exposing the truly filthy causes that underlie the existence of such seemingly ‘senseless’ murder. But, Wait, There’s More It is ironic that American Psycho has, itself, generated a mini-industry of products. A decade after publication, a Canadian team – filmmaker Mary Harron, director of I Shot Andy Warhol (1996), working with scriptwriter, Guinevere Turner, and Vancouver-based Lions Gate Entertainment – adapted the book for a major film (Johnson). Starring Christian Bale, Chloë Sevigny, Willem Dafoe and Reese Witherspoon and, with an estimated budget of U.S.$8 million, the film made U.S.$15 million at the American box office. The soundtrack was released for the film’s opening, with video and DVDs to follow and the ‘Killer Collector’s Edition’ DVD – closed-captioned, in widescreen with surround sound – released in June 2005. Amazon.com lists four movie posters (including a Japanese language version) and, most unexpected of all, a series of film tie-in action dolls. The two most popular of these, judging by E-Bay, are the ‘Cult Classics Series 1: Patrick Bateman’ figure which, attired in a smart suit, comes with essential accoutrements of walkman with headphones, briefcase, Wall Street Journal, video tape and recorder, knife, cleaver, axe, nail gun, severed hand and a display base; and the 18” tall ‘motion activated sound’ edition – a larger version of the same doll with fewer accessories, but which plays sound bites from the movie. Thanks to Stephen Harris and Suzie Gibson (UNE) for stimulating conversations about this book, Stephen Harris for information about the recent Australian reprint of American Psycho and Mark Seebeck (Pan Macmillan) for sales information. References Archer, Mark. “The Funeral Baked Meats.” The Spectator 27 April 1991: 31. Australian Broadcasting Corporation. First Tuesday Book Club. First broadcast 1 August 2006. Baelo Allué, Sonia. “The Aesthetics of Serial Killing: Working against Ethics in The Silence of the Lambs (1988) and American Psycho (1991).” Atlantis 24.2 (Dec. 2002): 7-24. Canadian Press. “Navy Yanks American Psycho.” The Globe and Mail 17 May 1991: C1. Canadian Press. “Gruesome Novel Was Bedside Reading.” Kitchener-Waterloo Record 1 Sep. 1995: A5. Dubin, Steven C. “Art’s Enemies: Censors to the Right of Me, Censors to the Left of Me.” Journal of Aesthetic Education 28.4 (Winter 1994): 44-54. Dwyer, Victor. “Literary Firestorm: Canada Customs Scrutinizes a Brutal Novel.” Maclean’s April 1991: 55. Ellis, Bret Easton. American Psycho. London: Macmillan-Picador, 1991. ———. Glamorama. New York: Knopf, 1999. ———. The Informers. New York: Knopf, 1994. ———. Less than Zero. New York: Simon & Schuster, 1985. ———. Lunar Park. New York: Knopf, 2005. ———. The Rules of Attraction. New York: Simon & Schuster, 1987. Fraser, James. :The Case for Publishing.” The Bulletin 18 June 1991. Fraser, William. “Book May Go under Wraps.” The Sydney Morning Herald 23 May 1991: 5. ———. “The Sensitive Censor and the Psycho.” The Sydney Morning Herald 24 May 1991: 5. Freccero, Carla. “Historical Violence, Censorship, and the Serial Killer: The Case of American Psycho.” Diacritics: A Review of Contemporary Criticism 27.2 (Summer 1997): 44-58. Graham, I. “Australian Censorship History.” Libertus.net 9 Dec. 2001. 17 May 2006 http://libertus.net/censor/hist20on.html>. Gurley Brown, Helen. Commentary in “Editorial Judgement or Censorship?: The Case of American Psycho.” The Writer May 1991: 20-23. Harris, Thomas. The Silence of the Lambs. New York: St Martins Press, 1988. Harron, Mary (dir.). American Psycho [film]. Edward R. Pressman Film Corporation, Lions Gate Films, Muse Productions, P.P.S. Films, Quadra Entertainment, Universal Pictures, 2004. Hitchens, Christopher. “Minority Report.” The Nation 7-14 January 1991: 7. Holt, Karen, and Charlotte Abbott. “Lunar Park: The Novel.” Publishers Weekly 11 July 2005. 13 Aug. 2006 http://www.publishersweekly.com/article/CA624404.html? pubdate=7%2F11%2F2005&display=archive>. Iannone, Carol. “PC & the Ellis Affair.” Commentary Magazine July 1991: 52-4. Irving, John. “Pornography and the New Puritans.” The New York Times Book Review 29 March 1992: Section 7, 1. 13 Aug. 2006 http://www.nytimes.com/books/97/06/15/lifetimes/25665.html>. Johnson, Brian D. “Canadian Cool Meets American Psycho.” Maclean’s 10 April 2000. 13 Aug. 2006 http://www.macleans.ca/culture/films/article.jsp?content=33146>. Kauffman, Linda S. “American Psycho [film review].” Film Quarterly 54.2 (Winter 2000-2001): 41-45. ———. Bad Girls and Sick Boys: Fantasies in Contemporary Art and Culture. Berkeley: University of California Press, 1998. Kennedy, Pagan. “Generation Gaffe: American Psycho.” The Nation 1 April 1991: 426-8. Kirchhoff, H. J. “Customs Clears Psycho: Booksellers’ Reaction Mixed.” The Globe and Mail 26 March 1991: C1. ———. “Psycho Sits in Limbo: Publisher Awaits Customs Ruling.” The Globe and Mail 14 March 1991: C1. Knight-Ridder News Service. “Vintage Picks up Ellis’ American Psycho.” Los Angeles Daily News 17 November 1990: L10. Lehmann-Haupt, Christopher. “Psycho: Wither Death without Life?” The New York Times 11 March 1991: C18. Leo, John. “Marketing Cynicism and Vulgarity.” U.S. News & World Report 3 Dec. 1990: 23. Love, Robert. “Psycho Analysis: Interview with Bret Easton Ellis.” Rolling Stone 4 April 1991: 45-46, 49-51. Mailer, Norman. “Children of the Pied Piper: Mailer on American Psycho.” Vanity Fair March 1991: 124-9, 182-3. Manguel, Alberto. “Designer Porn.” Saturday Night 106.6 (July 1991): 46-8. Manne, Robert. “Liberals Deny the Video Link.” The Australian 6 Jan. 1997: 11. McDowell, Edwin. “NOW Chapter Seeks Boycott of ‘Psycho’ Novel.” The New York Times 6 Dec. 1990: C17. ———. “Vintage Buys Violent Book Dropped by Simon & Schuster.” The New York Times 17 Nov. 1990: 13. Miner, Brad. “Random Notes.” National Review 31 Dec. 1990: 43. National Organization for Women. Library Journal 2.91 (1991): 114. Oates, Joyce Carol. “Three American Gothics.” Where I’ve Been, and Where I’m Going: Essays, Reviews and Prose. New York: Plume, 1999. 232-43. Rapping, Elayne. “The Uses of Violence.” Progressive 55 (1991): 36-8. Rosenblatt, Roger. “Snuff this Book!: Will Brett Easton Ellis Get Away with Murder?” New York Times Book Review 16 Dec. 1990: 3, 16. Roth, Philip. Portnoy’s Complaint. New York: Random House, 1969. Shaw, Patrick W. The Modern American Novel of Violence. Troy, NY: Whitson, 2000. Sheppard, R. Z. “A Revolting Development.” Time 29 Oct. 1990: 100. Teachout, Terry. “Applied Deconstruction.” National Review 24 June 1991: 45-6. Tyrnauer, Matthew. “Who’s Afraid of Bret Easton Ellis?” Vanity Fair 57.8 (Aug. 1994): 70-3, 100-1. Vnuk, Helen. “X-rated? Outdated.” The Age 21 Sep. 2003. 17 May 2006 http://www.theage.com.au/articles/2003/09/19/1063625202157.html>. Wark, McKenzie. “Video Link Is a Distorted View.” The Australian 8 Jan. 1997: 11. Weldon, Fay. “Now You’re Squeamish?: In a World as Sick as Ours, It’s Silly to Target American Psycho.” The Washington Post 28 April 1991: C1. Wolf, Naomi. “The Animals Speak.” New Statesman & Society 12 April 1991: 33-4. Yardley, Jonathan. “American Psycho: Essence of Trash.” The Washington Post 27 Feb. 1991: B1. Young, Elizabeth J. “Psycho Killers. Last Lines: How to Shock the English.” New Statesman & Society 5 April 1991: 24. Young, Elizabeth J., and Graham Caveney. Shopping in Space: Essays on American ‘Blank Generation’ Fiction. London: Serpent’s Tail, 1992. Zaller, Robert “American Psycho, American Censorship and the Dahmer Case.” Revue Francaise d’Etudes Americaines 16.56 (1993): 317-25. Citation reference for this article MLA Style Brien, Donna Lee. "The Real Filth in : A Critical Reassessment." M/C Journal 9.5 (2006). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0610/01-brien.php>. APA Style Brien, D. (Nov. 2006) "The Real Filth in American Psycho: A Critical Reassessment," M/C Journal, 9(5). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0610/01-brien.php>.
APA, Harvard, Vancouver, ISO, and other styles
19

Lee, Tom McInnes. "The Lists of W. G. Sebald." M/C Journal 15, no. 5 (October 12, 2012). http://dx.doi.org/10.5204/mcj.552.

Full text
Abstract:
Since the late 1990s, W. G. Sebald’s innovative contribution to the genre of prose fiction has been the source of much academic scrutiny. His books Vertigo, The Rings of Saturn, The Emigrants and Austerlitz have provoked interest from diverse fields of inquiry: visual communication (Kilbourn; Patt; Zadokerski), trauma studies (Denham and McCulloh; Schmitz), and travel writing (Blackler; Zisselsberger). His work is also claimed to be a bastion for both modernist and postmodernist approaches to literature and history writing (Bere; Fuchs and Long; Long). This is in addition to numerous “guide to” type books, such as Mark McCulloh’s Understanding Sebald, Long and Whitehead’s W. G. Sebald—A Critical Companion, and the comprehensive Saturn’s Moons: A W. G. Sebald Handbook. Here I have only mentioned works available in English. I should point out that Sebald wrote in German, the country of his birth, and as one would expect much scholarship dealing with his work is confined to this language. In this article I focus on what is perhaps Sebald’s prototypical work, The Rings of Saturn. Of all Sebald’s prose fictional works The Rings of Saturn seems the example that best exhibits his innovative literary forms, including the use of lists. This book is the work of an author who is purposefully and imaginatively concerned with the nature of his vocation: what is it to be a writer? Crucially, he addresses this question not only from the perspective of a subject facing an existential crisis, but from the perspective of the documents created by writers. His works demonstrate a concern with the enabling role documents play in the thinking and writing process; how, for example, pen and paper are looped in with our capacity to reason in certain ways. Despite taking the form of fictional narratives, his books are as much motivated by a historical interest in how ideas and forms of organisation are transmitted, and how they evolve as part of an ecology; how humans become articulate within their surrounds, according to the contingencies of specific epochs and places. The Sebald critic J. J. Long accounts for this in some part in his description “archival consciousness,” which recommends that conscious experience is not simply located in the mind of a knowing, human subject, but is rather distributed between the subject and different technologies (among which writing and archives are exemplary).The most notable peculiarity of Sebald’s books lies in their abundant use of “non-syntactical” kinds of writing or inscription. My use of the term “non-syntactical” has its origins in the anthropological work of Jack Goody, who emphasises the importance of list making and tabulation in pre-literate or barely literate cultures. In Sebald’s texts, kinds of non-syntactical writing include lists, photographic images, tables, signatures, diagrams, maps, stamps, dockets and sketches. As I stress throughout this article, Sebald’s shifts between syntactical and non-syntactical forms of writing allows him to build up highly complex schemes of internal reference. Massimo Leone identifies something similar, when he notes that Sebald “orchestrates a multiplicity of voices and text-types in order to produce his own coherent discourse” (91). The play between multiplicity and coherence is at once a thematic and poetic concern for Sebald. This is to say, his texts are formal experiments with these contrasting tendencies, in addition to discussing specific historical situations in which they feature. The list is perhaps Sebald’s most widely used and variable form of non-syntactical writing, a key part of his formal and stylistic peculiarity. His lengthy sentences frequently spill over into catalogues and inventories, and the entire structure of his narratives is list-like. Discrete episodes accumulate alongside each other, rather than following a narrative arc where episodes of suspenseful gravity overshadow the significance of minor events. The Rings of Saturn details the travels of Sebald’s trademark, nameless, first person narrator, who recounts his trek along the Suffolk coastline, from Lowestoft to Ditchingham, about two years after the event. From the beginning, the narrative is framed as an effort to organise a period of time that lacks a coherent and durable form, a period of time that is in pieces, fading from the narrator’s memory. However, the movement from the chaos of forgetting to the comparatively distinct and stable details of the remembered present does not follow a continuum. Rather, the past and present are both constituted by the force of memory, which is continually crystallising and dissolving. Each event operates according to its own specific arrangement of emphasis and forgetting. Our experience of memory in the present, or recollective memory, is only one kind of memory. Sebald is concerned with a more pervasive kind of remembering, which includes the vectorial existence of non-conscious, non-human perceptual events; memory as expressed by crystals, tree roots, glaciers, and the nested relationship of fuel, fire, smoke, and ash. The Rings of Saturn is composed of ten chapters, each of which is outlined in table form at the book’s beginning. The first chapter appears as: “In hospital—Obituary—Odyssey of Thomas Browne’s skull—Anatomy lecture—Levitation—Quincunx—Fabled creatures—Urn burial.” The Rings of Saturn is of course hardly exceptional in its use of this device. Rather, it is exemplary concerning the repeated emphasis on the tension between syntactical and non-syntactical forms of writing, among which this chapter breakdown is included. Sebald continually uses the conventions of bookmaking in subtle though innovative ways. Each of these horizontally linked and divided indices might put the reader in mind of Thomas Browne’s urns, time capsules from the past, the unearthing of which is discussed in the book’s first chapter (25). The chapter outlines (and the urns) are containers that preserve a fragmentary and suggestive history. Each is a perspective on the narrator’s travels that abstracts, arranges, and uniquely refers to the narrative elaborations to come.As I have already stressed, Sebald is a writer concerned with forms of organisation. His works account for a diverse range of organisational forms, some of which instance an overt, chronological, geometric, or metrical manipulation of space and time, such as grids, star shapes, and Greenwich Mean Time. This contrasts with comparatively suggestive, insubstantial, mutable forms, including various meteorological phenomena such as cloudbanks and fog, dust and sand, and as exemplified in narrative form by the haphazard, distracted assemblage of events featured in dreams or dream logic. The relationship between these supposedly opposing tendencies is, however, more complex and paradoxical than might at first glance appear. As Sebald warily reminds us in his essay “A Little Excursion to Ajaccio,” despite our wishes to inhabit periods of complete freedom, where we follow our distractions to the fullest possible extent, we nonetheless “must all have some more or less significant design in view” (Sebald, Campo 4). It is not so much that we must choose, absolutely, between form and formlessness. Rather, the point is to understand that some seemingly inevitable forms are in fact subject to contingencies, which certain uses deliberately or ignorantly mask, and that simplicity and intricacy are often co-dependent. Richard T. Gray is a Sebald critic who has picked up on the element in Sebald’s work that suggests a tension between different forms of organisation. In his article “Writing at the Roche Limit,” Gray notes that Sebald’s tendency to emphasise the decadent aspects of human and natural history “is continually counterbalanced by an insistence on order and by often extremely subtle forms of organization” (40). Rather than advancing the thesis that Sebald is exclusively against the idea of systematisation or order, Gray argues that The Rings of Saturn models in its own textual make-up an alternative approach to the cognitive order(ing) of things, one that seeks to counter the natural tendency toward entropic decline and a fall into chaos by introducing constructive forces that inject a modicum of balance and equilibrium into the system as a whole. (Gray 41)Sebald’s concern with the contrasting energies exemplified by different forms extends to his play with syntactical and non-syntactical forms of writing. He uses lists to add contrast to his flowing, syntactically intricate sentences. The achievement of his work is not the exclusive privileging of either the list form or the well-composed sentence, but in providing contexts whereby the reader can appreciate subtle modulations between the two, thus experiencing a more dynamic and complex kind of narrative time. His works exhibit an astute awareness of the fact that different textual devices command different experiences of temporality, and our experience of temporality in good part determines our metaphysics. Here I consider two lists featured in The Rings of Saturn, one from the first chapter, and one from the last. Each shows contrasting tendencies concerning systems of organisation. Both are attributable to the work of Thomas Browne, “who practiced as a doctor in Norwich in the seventeenth century and had left a number of writings that defy all comparison” (Sebald, Rings 9). The Rings of Saturn is in part a dialogue across epochs with the sentiments expressed in Browne’s works, which, according to Bianca Theisen, preserve a kind of reasoning that is lost in “the rationalist and scientific embrace of a devalued world of facts” (Theisen 563).The first list names the varied “animate and inanimate matter” in which Browne identifies the quincuncial structure, a lattice like arrangement of five points and intersecting lines. The following phenomena are enumerated in the text:certain crystalline forms, in starfish and sea urchins, in the vertebrae of mammals and the backbones of birds and fish, in the skins of various species of snake, in the crosswise prints left by quadrupeds, in the physical shapes of caterpillars, butterflies, silkworms and moths, in the root of the water fern, in the seed husks of the sunflower and the Caledonian pine, within young oak shoots or the stem of the horse tail; and in the creations of mankind, in the pyramids of Egypt and the mausoleum of Augustus as in the garden of King Solomon, which was planted with mathematical precision with pomegranate trees and white lilies. (Sebald, Rings 20-21)Ostensibly quoting from Browne, Sebald begins the next sentence, “Examples might be multiplied without end” (21). The compulsion to list, or the compulsiveness expressed by listing, is expressed here in a relationship of dual utility with another, dominant or overt, kind of organisational form: the quincunx. It is not the utility or expressiveness of the list itself that is at issue—at least in the version of Browne’s work preserved here by Sebald. In W. G. Sebald: Image, Archive, Modernity, Long notes the historical correspondences and divergences between Sebald and Michel Foucault (2007). Long interprets Browne’s quincunx as exemplifying a “hermeneutics of resemblance,” whereby similarities among diverse phenomena are seen as providing proof of “the universal oneness of all things” (33). This contrasts with the idea of a “pathological nature, autonomous from God,” which, according to Long, informs Sebald’s transformation of Browne into “an avatar of distinctly modern epistemology” (38). Long follows Foucault in noting the distinction between Renaissance and modern epistemology, a distinction in good part due to the experimental, inductive method, the availability of statistical data, and probabilistic reasoning championed in the latter epoch (Whitehead; Hacking). In the book’s final chapter, Sebald includes a list from Browne’s imaginary library, the “Musæum Clausium.” In contrast to the above list, here Sebald seems to deliberately problematise any efforts to suggest an abstract uniting principle. There is no evident reason for the togetherness of the discrete things, beyond the mere fact that they happen to be gathered, hypothetically, in the text (Sebald, Rings 271-273). Among the library’s supposed contents are:an account by the ancient traveller Pytheas of Marseilles, referred to in Strabo, according to which all the air beyond thule is thick, condensed and gellied, looking just like sea lungs […] a dream image showing a prairie or sea meadow at the bottom of the Mediterranean, off the coat of Provence […] and a glass of spirits made of æthereal salt, hermetically sealed up, of so volatile a nature that it will not endure by daylight, and therefore shown only in winter or by the light of a carbuncle or Bononian stone. (Sebald, Rings 272-73)Unlike the previous example attributed to Browne, here the list coheres according to the tensions of its own coincidences. Sebald uses the list to create spontaneous organisations in which history is exhibited as a complex mix of fact and fantasy. More important than the distinction between the imaginary and the real is the effort to account for the way things uniquely incorporate aspects of the world in order to be what they are. Human knowledge is a perspective that is implicated in, rather than excluded from, this process.Lists move us to puzzle over the criteria that their togetherness implies. They might be used inthe service of a specific paradigm, or they might suggest an imaginable but as yet unknown kind of systematisation; a specific kind of relationship, or simply the possibility of a relationship. Take, for example, the list-like accumulation of architectural details in the following description of the decadent Sommerleyton Hall, featured in chapter II: There were drawing rooms and winter gardens, spacious halls and verandas. A corridor might end in a ferny grotto where fountains ceaselessly plashed, and bowered passages criss-crossed beneath the dome of a fantastic mosque. Windows could be lowered to open the interior onto the outside, and inside the landscape was replicated on the mirror walls. Palm houses and orangeries, the lawn like green velvet, the baize on the billiard tables, the bouquets of flowers in the morning and retiring rooms and in the majolica vases on the terrace, the birds of paradise and the golden peasants on the silken tapestries, the goldfinches in the aviaries and the nightingales in the garden, the arabesques in the carpets and the box-edged flower beds—all of it interacted in such a way that one had the illusion of complete harmony between the natural and the manufactured. (Sebald, Rings 33-34)This list shifts emphasis away from preconceived distinctions between the natural and the manufactured through the creation of its own unlikely harmony. It tells us something important about the way perception and knowledge is ordered in Sebald’s prose. Each encounter, or historically specific situation, is considered as though it were its own microworld, its own discrete, synecdochic realisation of history. Rather than starting from the universal or the meta-level and scaling down to the local, Sebald arranges historically peculiar examples that suggest a variable, contrasting and dynamic metaphysics, a motley arrangement of ordering systems that each aspire to but do not command universal applicability. In a comparable sense, Browne’s sepulchral urns of his 1658 work Urn Burial, which feature in chapter I, are time capsules that seem to create their own internally specific kind of organisation:The cremated remains in the urns are examined closely: the ash, the loose teeth, some long roots of quitch, or dog’s grass wreathed about the bones, and the coin intended for the Elysian ferryman. Browne records other objects known to have been placed with the dead, whether as ornament or utensil. His catalogue includes a variety of curiosities: the circumcision knives of Joshua, the ring which belonged to the mistress of Propertius, an ape of agate, a grasshopper, three-hundred golden bees, a blue opal, silver belt buckles and clasps, combs, iron pins, brass plates and brazen nippers to pull away hair, and a brass Jews harp that last sounded on the crossing over black water. (Sebald, Rings 25-26)Regardless of our beliefs concerning the afterlife, these items, preserved across epochs, solicit a sense of wonder as we consider what we might choose for company on our “last journey” (25). In death, the human body is reduced to a condition of an object or thing, while the objects that accompany the corpse seem to acquire a degree of potency as remnants that transcend living time. Life is no longer the paradigm through which to understand purpose. In their very difference from living things these objects command our fascination. Eric Santner coins the term “undeadness” to name the significance of this non-living agency in Sebald’s prose (Santner xx). Santner’s study places Sebald in a linage of German-Jewish writers, including Walter Benjamin, Franz Kafka, and Paul Celan, whose understanding of “the human” depends crucially on the concept of “the creature” or “creatureliness” (Santner 38-41). Like the list of items contained within Sommerleyton Hall, the above list accounts for a context in which ornament and utensil, nature and culture, are read according to their differentiated togetherness, rather than opposition. Death, it seems, is a universal leveller, or at least a different dimension in which symbol and function appear to coincide. Perhaps it is the unassuming and convenient nature of lists that make them enduring objects of historical interest. Lists are a form of writing to which we appeal for immediate mnemonic assistance. They lack the artifice of a sentence. While perhaps not as interesting in the present that is contemporary with their usefulness (a trip to the supermarket), with time lists acquire credibility due to the intimacy they share with mundane, diurnal concerns—due to the fact that they were, once upon a time, so useful. The significance of lists arrives anachronistically, when we look back and wonder what people were really up to, or what our own concerns were, relatively free from fanciful, stylistic adornment. Sebald’s democratic approach to different forms of writing means that lists sit alongside the esteemed poetic and literary efforts of Joseph Conrad, Algernon Swinburne, Edward Fitzgerald, and François René de Chateaubriand, all of whom feature in The Rings of Saturn. His books make the exclusive differences between literary and non-literary kinds of writing less important than the sense of dynamism that is elicited through a play of contrasting kinds of syntactical and non-syntactical writing. The book’s closing chapter includes a revealing example that expresses these sentiments. After tracing over a natural history of silk, with a particular focus on human greed and naivety, the narrative arrives at a “pattern book” that features strips of colourful silk kept in “the small museum of Strangers Hall” (Sebald, Rings 283). The narrator notes that the silks arranged in this book “were of a truly fabulous variety, and of an iridescent, quite indescribable beauty as if they had been produced by Nature itself, like the plumage of birds” (283). This effervescent declamation continues after a double page photograph of the pattern book, which is described as a “catalogue of samples” and “leaves from the only true book which none of our textual and pictorial works can even begin to rival” (286). Here we witness Sebald’s inclusive and variable understanding as to the kinds of thing a book, and writing, can be. The fraying strips of silk featured in the photograph are arranged one below the other, in the form of a list. They are surrounded by ornate handwriting that, like the strips of silk, seems to fray at the edges, suggesting the specific gestural event that occasioned the moment of their inscription—something which tends to be excluded in printed prose. Sebald’s remarks here are not without a characteristic irony (“the only true book”). However, in the greatercontext of the narrative, this comment suggests an important inclination. Namely, that there is much scope yet for innovative literary forms that capture the nuances and complexity of collective and individual histories. And that writing always includes, though to varying degrees obscures, contrasting tensions shared among syntactical and non-syntactical elements, including material and gestural contingencies. Sebald’s works remind us of what potentials might lay ahead for books if the question of what writing can be is asked continually as part of a writer’s enterprise.ReferencesBere, Carol. “The Book of Memory: W. G. Sebald’s The Emigrants and Austerlitz.” Literary Review, 46.1 (2002): 184-92.Blackler, Deane. Reading W. G. Sebald: Adventure and Disobedience. Rochester, New York: Camden House, 2007. Catling Jo, and Richard Hibbitt, eds. Saturn’s Moons: A W. G. Sebald Handbook. Oxford: Legenda, 2011.Denham, Scott and Mark McCulloh, eds. W. G. Sebald: History, Memory, Trauma. Berlin: Walter de Gruyter, 2006. Fuchs, Anne and J. J. Long, eds. W. G. Sebald and the Writing of History. Würzburg: Königshausen & Neumann, 2007. Goody, Jack. The Logic of Writing and the Organization of Society. Cambridge: Cambridge UP, 1986. Gray, Richard T. “Writing at the Roche Limit: Order and Entropy in W. G. Sebald’s The Rings of Saturn.” The German Quarterly 83.1 (2010): 38-57. Hacking, Ian. The Emergence of Probability: A Philosophical Study of Early Ideas about Probability, Induction and Statistical Inference. London: Cambridge UP, 1977.Kilbourn, Russell J. A. “Architecture and Cinema: The Representation of Memory in W. G. Sebald’s Austerlitz.” W. G. Sebald—A Critical Companion. Ed. J. J. Long and Anne Whitehead. Edinburgh: Edinburgh UP, 2004.Leone, Massimo. “Textual Wanderings: A Vertiginous Reading of W. G. Sebald.” W. G. Sebald—A Critical Companion. Ed. J. J. Long and A. Whitehead. Edinburgh: Edinburgh UP, 2004.Long, J. J. W. G. Sebald: Image, Archive, Modernity. New York: Columbia UP, 2007.Long, J. J., and Anne Whitehead, eds. W. G. Sebald—A Critical Companion. Edinburgh: Edinburgh U P, 2004. McCulloh, Mark. Understanding W. G. Sebald. Columbia, S. C.: U of South Carolina P, 2003.Patt, Lise, ed. Searching for Sebald: Photography After W. G. Sebald. Los Angeles: The Institute of Critical Inquiry and ICI Press, 2007. Sadokierski, Zoe. “Visual Writing: A Critique of Graphic Devices in Hybrid Novels from a Visual Communication Design Perspective.” Diss. University of Technology Sydney, 2010. Santner, Eric. On Creaturely Life: Rilke, Benjamin, Sebald. Chicago: U of Chicago P, 2006. Schmitz, Helmut. “Catastrophic History, Trauma and Mourning in W. G. Sebald and Jörg Friedrich.” The German Monitor 72 (2010): 27-50.Sebald, W. G. The Rings of Saturn. Trans. Michael Hulse. London: Harvill Press, 1998.---. Vertigo. Trans. Michael Hulse. London: Harvill Press, 1999.---. Campo Santo. Trans. Anthea Bell. London: Penguin Books, 2005. Print. Theisen, Bianca. “A Natural History of Destruction: W. G. Sebald’s The Rings of Saturn.” MLN, 121. The John Hopkins U P (2006): 563-81.Whitehead, Alfred North. Science and The Modern World. Cambridge: Cambridge UP, 1932.Zisselsberger, Markus. The Undiscover’d Country: W. G. Sebald and the Poetics of Travel. Rochester, NY: Camden House, 2010.
APA, Harvard, Vancouver, ISO, and other styles
20

Brien, Donna Lee. "“Porky Times”: A Brief Gastrobiography of New York’s The Spotted Pig." M/C Journal 13, no. 5 (October 18, 2010). http://dx.doi.org/10.5204/mcj.290.

Full text
Abstract:
Introduction With a deluge of mouthwatering pre-publicity, the opening of The Spotted Pig, the USA’s first self-identified British-styled gastropub, in Manhattan in February 2004 was much anticipated. The late Australian chef, food writer and restauranteur Mietta O’Donnell has noted how “taking over a building or business which has a long established reputation can be a mixed blessing” because of the way that memories “can enrich the experience of being in a place or they can just make people nostalgic”. Bistro Le Zoo, the previous eatery on the site, had been very popular when it opened almost a decade earlier, and its closure was mourned by some diners (Young; Kaminsky “Feeding Time”; Steinhauer & McGinty). This regret did not, however, appear to affect The Spotted Pig’s success. As esteemed New York Times reviewer Frank Bruni noted in his 2006 review: “Almost immediately after it opened […] the throngs started to descend, and they have never stopped”. The following year, The Spotted Pig was awarded a Michelin star—the first year that Michelin ranked New York—and has kept this star in the subsequent annual rankings. Writing Restaurant Biography Detailed studies have been published of almost every type of contemporary organisation including public institutions such as schools, hospitals, museums and universities, as well as non-profit organisations such as charities and professional associations. These are often written to mark a major milestone, or some significant change, development or the demise of the organisation under consideration (Brien). Detailed studies have also recently been published of businesses as diverse as general stores (Woody), art galleries (Fossi), fashion labels (Koda et al.), record stores (Southern & Branson), airlines (Byrnes; Jones), confectionary companies (Chinn) and builders (Garden). In terms of attracting mainstream readerships, however, few such studies seem able to capture popular reader interest as those about eating establishments including restaurants and cafés. This form of restaurant life history is, moreover, not restricted to ‘quality’ establishments. Fast food restaurant chains have attracted their share of studies (see, for example Love; Jakle & Sculle), ranging from business-economic analyses (Liu), socio-cultural political analyses (Watson), and memoirs (Kroc & Anderson), to criticism around their conduct and effects (Striffler). Eric Schlosser’s Fast Food Nation: The Dark Side of the All-American Meal is the most well-known published critique of the fast food industry and its effects with, famously, the Rolling Stone article on which it was based generating more reader mail than any other piece run in the 1990s. The book itself (researched narrative creative nonfiction), moreover, made a fascinating transition to the screen, transformed into a fictionalised drama (co-written by Schlosser) that narrates the content of the book from the point of view of a series of fictional/composite characters involved in the industry, rather than in a documentary format. Akin to the range of studies of fast food restaurants, there are also a variety of studies of eateries in US motels, caravan parks, diners and service station restaurants (see, for example, Baeder). Although there has been little study of this sub-genre of food and drink publishing, their popularity can be explained, at least in part, because such volumes cater to the significant readership for writing about food related topics of all kinds, with food writing recently identified as mainstream literary fare in the USA and UK (Hughes) and an entire “publishing subculture” in Australia (Dunstan & Chaitman). Although no exact tally exists, an informed estimate by the founder of the Gourmand World Cookbook Awards and president of the Paris Cookbook Fair, Edouard Cointreau, has more than 26,000 volumes on food and wine related topics currently published around the world annually (ctd. in Andriani “Gourmand Awards”). The readership for publications about restaurants can also perhaps be attributed to the wide range of information that can be included a single study. My study of a selection of these texts from the UK, USA and Australia indicates that this can include narratives of place and architecture dealing with the restaurant’s location, locale and design; narratives of directly food-related subject matter such as menus, recipes and dining trends; and narratives of people, in the stories of its proprietors, staff and patrons. Detailed studies of contemporary individual establishments commonly take the form of authorised narratives either written by the owners, chefs or other staff with the help of a food journalist, historian or other professional writer, or produced largely by that writer with the assistance of the premise’s staff. These studies are often extensively illustrated with photographs and, sometimes, drawings or reproductions of other artworks, and almost always include recipes. Two examples of these from my own collection include a centennial history of a famous New Orleans eatery that survived Hurricane Katrina, Galatoire’s Cookbook. Written by employees—the chief operating officer/general manager (Melvin Rodrigue) and publicist (Jyl Benson)—this incorporates reminiscences from both other staff and patrons. The second is another study of a New Orleans’ restaurant, this one by the late broadcaster and celebrity local historian Mel Leavitt. The Court of Two Sisters Cookbook: With a History of the French Quarter and the Restaurant, compiled with the assistance of the Two Sisters’ proprietor, Joseph Fein Joseph III, was first published in 1992 and has been so enduringly popular that it is in its eighth printing. These texts, in common with many others of this type, trace a triumph-over-adversity company history that incorporates a series of mildly scintillating anecdotes, lists of famous chefs and diners, and signature recipes. Although obviously focused on an external readership, they can also be characterised as an instance of what David M. Boje calls an organisation’s “story performance” (106) as the process of creating these narratives mobilises an organisation’s (in these cases, a commercial enterprise’s) internal information processing and narrative building activities. Studies of contemporary restaurants are much more rarely written without any involvement from the eatery’s personnel. When these are, the results tend to have much in common with more critical studies such as Fast Food Nation, as well as so-called architectural ‘building biographies’ which attempt to narrate the historical and social forces that “explain the shapes and uses” (Ellis, Chao & Parrish 70) of the physical structures we create. Examples of this would include Harding’s study of the importance of the Boeuf sur le Toit in Parisian life in the 1920s and Middlebrook’s social history of London’s Strand Corner House. Such work agrees with Kopytoff’s assertion—following Appadurai’s proposal that objects possess their own ‘biographies’ which need to be researched and expressed—that such inquiry can reveal not only information about the objects under consideration, but also about readers as we examine our “cultural […] aesthetic, historical, and even political” responses to these narratives (67). The life story of a restaurant will necessarily be entangled with those of the figures who have been involved in its establishment and development, as well as the narratives they create around the business. This following brief study of The Spotted Pig, however, written without the assistance of the establishment’s personnel, aims to outline a life story for this eatery in order to reflect upon the pig’s place in contemporary dining practice in New York as raw foodstuff, fashionable comestible, product, brand, symbol and marketing tool, as well as, at times, purely as an animal identity. The Spotted Pig Widely profiled before it even opened, The Spotted Pig is reportedly one of the city’s “most popular” restaurants (Michelin 349). It is profiled in all the city guidebooks I could locate in print and online, featuring in some of these as a key stop on recommended itineraries (see, for instance, Otis 39). A number of these proclaim it to be the USA’s first ‘gastropub’—the term first used in 1991 in the UK to describe a casual hotel/bar with good food and reasonable prices (Farley). The Spotted Pig is thus styled on a shabby-chic version of a traditional British hotel, featuring a cluttered-but-well arranged use of pig-themed objects and illustrations that is described by latest Michelin Green Guide of New York City as “a country-cute décor that still manages to be hip” (Michelin 349). From the three-dimensional carved pig hanging above the entrance in a homage to the shingles of traditional British hotels, to the use of its image on the menu, website and souvenir tee-shirts, the pig as motif proceeds its use as a foodstuff menu item. So much so, that the restaurant is often (affectionately) referred to by patrons and reviewers simply as ‘The Pig’. The restaurant has become so well known in New York in the relatively brief time it has been operating that it has not only featured in a number of novels and memoirs, but, moreover, little or no explanation has been deemed necessary as the signifier of “The Spotted Pig” appears to convey everything that needs to be said about an eatery of quality and fashion. In the thriller Lethal Experiment: A Donovan Creed Novel, when John Locke’s hero has to leave the restaurant and becomes involved in a series of dangerous escapades, he wants nothing more but to get back to his dinner (107, 115). The restaurant is also mentioned a number of times in Sex and the City author Candace Bushnell’s Lipstick Jungle in relation to a (fictional) new movie of the same name. The joke in the book is that the character doesn’t know of the restaurant (26). In David Goodwillie’s American Subversive, the story of a journalist-turned-blogger and a homegrown terrorist set in New York, the narrator refers to “Scarlett Johansson, for instance, and the hostess at the Spotted Pig” (203-4) as the epitome of attractiveness. The Spotted Pig is also mentioned in Suzanne Guillette’s memoir, Much to Your Chagrin, when the narrator is on a dinner date but fears running into her ex-boyfriend: ‘Jack lives somewhere in this vicinity […] Vaguely, you recall him telling you he was not too far from the Spotted Pig on Greenwich—now, was it Greenwich Avenue or Greenwich Street?’ (361). The author presumes readers know the right answer in order to build tension in this scene. Although this success is usually credited to the joint efforts of backer, music executive turned restaurateur Ken Friedman, his partner, well-known chef, restaurateur, author and television personality Mario Batali, and their UK-born and trained chef, April Bloomfield (see, for instance, Batali), a significant part has been built on Bloomfield’s pork cookery. The very idea of a “spotted pig” itself raises a central tenet of Bloomfield’s pork/food philosophy which is sustainable and organic. That is, not the mass produced, industrially farmed pig which produces a leaner meat, but the fatty, tastier varieties of pig such as the heritage six-spotted Berkshire which is “darker, more heavily marbled with fat, juicier and richer-tasting than most pork” (Fabricant). Bloomfield has, indeed, made pig’s ears—long a Chinese restaurant staple in the city and a key ingredient of Southern US soul food as well as some traditional Japanese and Spanish dishes—fashionable fare in the city, and her current incarnation, a crispy pig’s ear salad with lemon caper dressing (TSP 2010) is much acclaimed by reviewers. This approach to ingredients—using the ‘whole beast’, local whenever possible, and the concentration on pork—has been underlined and enhanced by a continuing relationship with UK chef Fergus Henderson. In his series of London restaurants under the banner of “St. John”, Henderson is famed for the approach to pork cookery outlined in his two books Nose to Tail Eating: A Kind of British Cooking, published in 1999 (re-published both in the UK and the US as The Whole Beast: Nose to Tail Eating), and Beyond Nose to Tail: A Kind of British Cooking: Part II (coauthored with Justin Piers Gellatly in 2007). Henderson has indeed been identified as starting a trend in dining and food publishing, focusing on sustainably using as food the entirety of any animal killed for this purpose, but which mostly focuses on using all parts of pigs. In publishing, this includes Hugh Fearnley-Whittingstall’s The River Cottage Meat Book, Peter Kaminsky’s Pig Perfect, subtitled Encounters with Some Remarkable Swine and Some Great Ways to Cook Them, John Barlow’s Everything but the Squeal: Eating the Whole Hog in Northern Spain and Jennifer McLagan’s Fat: An Appreciation of a Misunderstood Ingredient, with Recipes (2008). In restaurants, it certainly includes The Spotted Pig. So pervasive has embrace of whole beast pork consumption been in New York that, by 2007, Bruni could write that these are: “porky times, fatty times, which is to say very good times indeed. Any new logo for the city could justifiably place the Big Apple in the mouth of a spit-roasted pig” (Bruni). This demand set the stage perfectly for, in October 2007, Henderson to travel to New York to cook pork-rich menus at The Spotted Pig in tandem with Bloomfield (Royer). He followed this again in 2008 and, by 2009, this annual event had become known as “FergusStock” and was covered by local as well as UK media, and a range of US food weblogs. By 2009, it had grown to become a dinner at the Spotted Pig with half the dishes on the menu by Henderson and half by Bloomfield, and a dinner the next night at David Chang’s acclaimed Michelin-starred Momofuku Noodle Bar, which is famed for its Cantonese-style steamed pork belly buns. A third dinner (and then breakfast/brunch) followed at Friedman/Bloomfield’s Breslin Bar and Dining Room (discussed below) (Rose). The Spotted Pig dinners have become famed for Henderson’s pig’s head and pork trotter dishes with the chef himself recognising that although his wasn’t “the most obvious food to cook for America”, it was the case that “at St John, if a couple share a pig’s head, they tend to be American” (qtd. in Rose). In 2009, the pigs’ head were presented in pies which Henderson has described as “puff pastry casing, with layers of chopped, cooked pig’s head and potato, so all the lovely, bubbly pig’s head juices go into the potato” (qtd. in Rose). Bloomfield was aged only 28 when, in 2003, with a recommendation from Jamie Oliver, she interviewed for, and won, the position of executive chef of The Spotted Pig (Fabricant; Q&A). Following this introduction to the US, her reputation as a chef has grown based on the strength of her pork expertise. Among a host of awards, she was named one of US Food & Wine magazine’s ten annual Best New Chefs in 2007. In 2009, she was a featured solo session titled “Pig, Pig, Pig” at the fourth Annual International Chefs Congress, a prestigious New York City based event where “the world’s most influential and innovative chefs, pastry chefs, mixologists, and sommeliers present the latest techniques and culinary concepts to their peers” (Starchefs.com). Bloomfield demonstrated breaking down a whole suckling St. Canut milk raised piglet, after which she butterflied, rolled and slow-poached the belly, and fried the ears. As well as such demonstrations of expertise, she is also often called upon to provide expert comment on pork-related news stories, with The Spotted Pig regularly the subject of that food news. For example, when a rare, heritage Hungarian pig was profiled as a “new” New York pork source in 2009, this story arose because Bloomfield had served a Mangalitsa/Berkshire crossbreed pig belly and trotter dish with Agen prunes (Sanders) at The Spotted Pig. Bloomfield was quoted as the authority on the breed’s flavour and heritage authenticity: “it took me back to my grandmother’s kitchen on a Sunday afternoon, windows steaming from the roasting pork in the oven […] This pork has that same authentic taste” (qtd. in Sanders). Bloomfield has also used this expert profile to support a series of pork-related causes. These include the Thanksgiving Farm in the Catskill area, which produces free range pork for its resident special needs children and adults, and helps them gain meaningful work-related skills in working with these pigs. Bloomfield not only cooks for the project’s fundraisers, but also purchases any excess pigs for The Spotted Pig (Estrine 103). This strong focus on pork is not, however, exclusive. The Spotted Pig is also one of a number of American restaurants involved in the Meatless Monday campaign, whereby at least one vegetarian option is included on menus in order to draw attention to the benefits of a plant-based diet. When, in 2008, Bloomfield beat the Iron Chef in the sixth season of the US version of the eponymous television program, the central ingredient was nothing to do with pork—it was olives. Diversifying from this focus on ‘pig’ can, however, be dangerous. Friedman and Bloomfield’s next enterprise after The Spotted Pig was The John Dory seafood restaurant at the corner of 10th Avenue and 16th Street. This opened in November 2008 to reviews that its food was “uncomplicated and nearly perfect” (Andrews 22), won Bloomfield Time Out New York’s 2009 “Best New Hand at Seafood” award, but was not a success. The John Dory was a more formal, but smaller, restaurant that was more expensive at a time when the financial crisis was just biting, and was closed the following August. Friedman blamed the layout, size and neighbourhood (Stein) and its reservation system, which limited walk-in diners (ctd. in Vallis), but did not mention its non-pork, seafood orientation. When, almost immediately, another Friedman/Bloomfield project was announced, the Breslin Bar & Dining Room (which opened in October 2009 in the Ace Hotel at 20 West 29th Street and Broadway), the enterprise was closely modeled on the The Spotted Pig. In preparation, its senior management—Bloomfield, Friedman and sous-chefs, Nate Smith and Peter Cho (who was to become the Breslin’s head chef)—undertook a tasting tour of the UK that included Henderson’s St. John Bread & Wine Bar (Leventhal). Following this, the Breslin’s menu highlighted a series of pork dishes such as terrines, sausages, ham and potted styles (Rosenberg & McCarthy), with even Bloomfield’s pork scratchings (crispy pork rinds) bar snacks garnering glowing reviews (see, for example, Severson; Ghorbani). Reviewers, moreover, waxed lyrically about the menu’s pig-based dishes, the New York Times reviewer identifying this focus as catering to New York diners’ “fetish for pork fat” (Sifton). This representative review details not only “an entree of gently smoked pork belly that’s been roasted to tender goo, for instance, over a drift of buttery mashed potatoes, with cabbage and bacon on the side” but also a pig’s foot “in gravy made of reduced braising liquid, thick with pillowy shallots and green flecks of deconstructed brussels sprouts” (Sifton). Sifton concluded with the proclamation that this style of pork was “very good: meat that is fat; fat that is meat”. Concluding remarks Bloomfield has listed Michael Ruhlman’s Charcuterie as among her favourite food books. Publishers Weekly reviewer called Ruhlman “a food poet, and the pig is his muse” (Q&A). In August 2009, it was reported that Bloomfield had always wanted to write a cookbook (Marx) and, in July 2010, HarperCollins imprint Ecco publisher and foodbook editor Dan Halpern announced that he was planning a book with her, tentatively titled, A Girl and Her Pig (Andriani “Ecco Expands”). As a “cookbook with memoir running throughout” (Maurer), this will discuss the influence of the pig on her life as well as how to cook pork. This text will obviously also add to the data known about The Spotted Pig, but until then, this brief gastrobiography has attempted to outline some of the human, and in this case, animal, stories that lie behind all businesses. References Andrews, Colman. “Its Up To You, New York, New York.” Gourmet Apr. (2009): 18-22, 111. Andriani, Lynn. “Ecco Expands Cookbook Program: HC Imprint Signs Up Seven New Titles.” Publishers Weekly 12 Jul. (2010) 3 Sep. 2010 http://www.publishersweekly.com/pw/by-topic/book-news/cooking/article/43803-ecco-expands-cookbook-program.html Andriani, Lynn. “Gourmand Awards Receive Record Number of Cookbook Entries.” Publishers Weekly 27 Sep. 2010 http://www.publishersweekly.com/pw/by-topic/book-news/cooking/article/44573-gourmand-awards-receive-record-number-of-cookbook-entries.html Appadurai, Arjun. The Social Life of Things: Commodities in Cultural Perspectives. Cambridge (UK): Cambridge University Press, 2003. First pub. 1986. Baeder, John. Gas, Food, and Lodging. New York: Abbeville Press, 1982. Barlow, John. Everything But the Squeal: Eating the Whole Hog in Northern Spain. New York: Farrar, Straus and Giroux, 2008. Batali, Mario. “The Spotted Pig.” Mario Batali 2010. 3 Sep. 2010 http://www.mariobatali.com/restaurants_spottedpig.cfm Boje, David M. “The Storytelling Organization: A Study of Story Performance in an Office-Supply Firm.” Administrative Science Quarterly 36.1 (1991): 106-126. Brien, Donna Lee. “Writing to Understand Ourselves: An Organisational History of the Australian Association of Writing Programs 1996–2010.” TEXT: Journal of Writing and Writing Courses Apr. 2010 http://www.textjournal.com.au/april10/brien.htm Bruni, Frank. “Fat, Glorious Fat, Moves to the Center of the Plate.” New York Times 13 Jun. 2007. 3 Sep. 2010 http://www.nytimes.com/2007/06/13/dining/13glut.html Bruni, Frank. “Stuffed Pork.” New York Times 25 Jan. 2006. 4 Sep. 2010 http://events.nytimes.com/2006/01/25/dining/reviews/25rest.html Bushnell, Candace. Lipstick Jungle. New York: Hyperion Books, 2008. Byrnes, Paul. Qantas by George!: The Remarkable Story of George Roberts. Sydney: Watermark, 2000. Chinn, Carl. The Cadbury Story: A Short History. Studley, Warwickshire: Brewin Books, 1998. Dunstan, David and Chaitman, Annette. “Food and Drink: The Appearance of a Publishing Subculture.” Ed. David Carter and Anne Galligan. Making Books: Contemporary Australian Publishing. St Lucia: U of Queensland P, 2007: 333-351. Ellis, W. Russell, Tonia Chao and Janet Parrish. “Levi’s Place: A Building Biography.” Places 2.1 (1985): 57-70. Estrine, Darryl. Harvest to Heat: Cooking with America’s Best Chefs, Farmers, and Artisans. Newton CT: The Taunton Press, 2010 Fabricant, Florence. “Food stuff: Off the Menu.” New York Times 26 Nov. 2003. 3 Sep. 2010 http://www.nytimes.com/2003/11/26/dining/food-stuff-off-the-menu.html?ref=april_bloomfield Fabricant, Florence. “Food Stuff: Fit for an Emperor, Now Raised in America.” New York Times 23 Jun. 2004. 2 Sep. 2010 http://www.nytimes.com/2004/06/23/dining/food-stuff-fit-for-an-emperor-now-raised-in-america.html Farley, David. “In N.Y., An Appetite for Gastropubs.” The Washington Post 24 May 2009. 1 Sep. 2010 http://www.washingtonpost.com/wp-dyn/content/article/2009/05/22/AR2009052201105.html Fearnley-Whittingstall, Hugh. The River Cottage Meat Book. London: Hodder & Stoughton, 2004. Food & Wine Magazine. “Food & Wine Magazine Names 19th Annual Best New Chefs.” Food & Wine 4 Apr. 2007. 3 Sep. 2010 http://www.foodandwine.com/articles/2007-best-new-chefs Fossi, Gloria. Uffizi Gallery: Art, History, Collections. 4th ed. Florence Italy: Giunti Editore, 2001. Garden, Don. Builders to the Nation: The A.V. Jennings Story. Carlton: Melbourne U P, 1992. Ghorbani, Liza. “Boîte: In NoMad, a Bar With a Pub Vibe.” New York Times 26 Mar. 2010. 3 Sep. 2010 http://www.nytimes.com/2010/03/28/fashion/28Boite.html Goodwillie, David. American Subversive. New York: Scribner, 2010. Guillette, Suzanne. Much to Your Chagrin: A Memoir of Embarrassment. New York, Atria Books, 2009. Henderson, Fergus. Nose to Tail Eating: A Kind of British Cooking. London: Pan Macmillan, 1999 Henderson, Fergus and Justin Piers Gellatly. Beyond Nose to Tail: A Kind of British Cooking: Part I1. London: Bloomsbury Publishing, 2007. Hughes, Kathryn. “Food Writing Moves from Kitchen to bookshelf.” The Guardian 19 Jun. 2010. 1 Sep. 2010 http://www.guardian.co.uk/books/2010/jun/19/anthony-bourdain-food-writing Jakle, John A. and Keith A. Sculle. Fast Food: Roadside Restaurants in the Automobile Age. Baltimore: Johns Hopkins U P, 1999. Jones, Lois. EasyJet: The Story of Britain's Biggest Low-cost Airline. London: Aurum, 2005. Kaminsky, Peter. “Feeding Time at Le Zoo.” New York Magazine 12 Jun. 1995: 65. Kaminsky, Peter. Pig Perfect: Encounters with Some Remarkable Swine and Some Great Ways To Cook Them. New York: Hyperion 2005. Koda, Harold, Andrew Bolton and Rhonda K. Garelick. Chanel. New York: Metropolitan Museum of Art, 2005. Kopytoff, Igor. “The Cultural Biography of Things: Commoditization as Process.” The Social Life of things: Commodities in Cultural Perspectives. Ed. Arjun Appadurai. Cambridge (UK): Cambridge U P, 2003. 64-94. (First pub. 1986). Kroc, Ray and Robert Anderson. Grinding It Out: The Making of McDonald’s, Chicago: H. Regnery, 1977 Leavitt, Mel. The Court of Two Sisters Cookbook: With a History of the French Quarter and the Restaurant. Gretna, LA: Pelican Publishing, 2005. Pub. 1992, 1994, 1996, 1998, 2000, 2001, 2003. Leventhal, Ben. “April Bloomfield & Co. Take U.K. Field Trip to Prep for Ace Debut.” Grub Street 14 Apr. 2009. 3 Sep. 2010 http://newyork.grubstreet.com/2009/04/april_bloomfield_co_take_uk_field_trip_to_prep_for_ace_debut.html Fast Food Nation. R. Linklater (Dir.). Fox Searchlight Pictures, 2006. Liu, Warren K. KFC in China: Secret Recipe for Success. Singapore & Hoboken, NJ: John Wiley (Asia), 2008. Locke, John. Lethal Experiment: A Donovan Creed Novel. Bloomington: iUniverse, 2009. Love, John F. McDonald’s: Behind the Arches. Toronto & New York: Bantam, 1986. Marx, Rebecca. “Beyond the Breslin: April Bloomfield is Thinking Tea, Bakeries, Cookbook.” 28 Aug. 2009. 3 Sep. 2010 http://blogs.villagevoice.com/forkintheroad/archives/2009/08/beyond_the_bres.php Maurer, Daniel. “Meatball Shop, April Bloomfield Plan Cookbooks.” Grub Street 12 Jul. 2010. 3 Sep. 2010 http://newyork.grubstreet.com/2010/07/meatball_shop_april_bloomfield.html McLagan, Jennifer. Fat: An Appreciation of a Misunderstood Ingredient, with Recipes. Berkeley: Ten Speed Press, 2008. Michelin. Michelin Green Guide New York City. Michelin Travel Publications, 2010. O’Donnell, Mietta. “Burying and Celebrating Ghosts.” Herald Sun 1 Dec. 1998. 3 Sep. 2010 http://www.miettas.com.au/restaurants/rest_96-00/buryingghosts.html Otis, Ginger Adams. New York Encounter. Melbourne: Lonely Planet, 2007. “Q and A: April Bloomfield.” New York Times 18 Apr. 2008. 3 Sep. 2010 http://dinersjournal.blogs.nytimes.com/2008/04/18/q-and-a-april-bloomfield Rodrigue, Melvin and Jyl Benson. Galatoire’s Cookbook: Recipes and Family History from the Time-Honored New Orleans Restaurant. New York: Clarkson Potter, 2005. Rose, Hilary. “Fergus Henderson in New York.” The Times (London) Online, 5 Dec. 2009. 23 Aug. 2010 http://www.timesonline.co.uk/tol/life_and_style/food_and_drink/recipes/article6937550.ece Rosenberg, Sarah & Tom McCarthy. “Platelist: The Breslin’s April Bloomfield.” ABC News/Nightline 4 Dec. 2009. 23 Aug. 2010 http://abcnews.go.com/Nightline/april-bloomfield-spotted-pig-interview/story?id=9242079 Royer, Blake. “Table for Two: Fergus Henderson at The Spotted Pig.” The Paupered Chef 11 Oct. 2007. 23 Aug. 2010 http://thepauperedchef.com/2007/10/table-for-two-f.html Ruhlman, Michael and Brian Polcyn. Charcuterie: The Craft of Salting, Smoking, and Curing. New York: W. Norton, 2005. Sanders, Michael S. “An Old Breed of Hungarian Pig Is Back in Favor.” New York Times 26 Mar. 2009. 23 Aug. 2010 http://www.nytimes.com/2009/04/01/dining/01pigs.html?ref=april_bloomfield Schlosser, Eric. “Fast Food Nation: The True History of the America’s Diet.” Rolling Stone Magazine 794 3 Sep. 1998: 58-72. Schlosser, Eric. Fast Food Nation: The Dark Side of the All-American Meal. Boston: Houghton Mifflin, 2001. Severson, Kim. “From the Pig Directly to the Fish.” New York Times 2 Sep. 2008. 23 Aug. 2010 http://www.nytimes.com/2008/09/03/dining/03bloom.html Severson, Kim. “For the Big Game? Why, Pigskins.” New York Times 3 Feb. 2010. 23 Aug. 2010 http://query.nytimes.com/gst/fullpage.html?res=9502E2DB143DF930A35751C0A9669D8B63&ref=april_bloomfield Sifton, Sam. “The Breslin Bar and Dining Room.” New York Times 12 Jan. 2010. 3 Sep. 2010 http://events.nytimes.com/2010/01/13/dining/reviews/13rest.htm Southern, Terry & Richard Branson. Virgin: A History of Virgin Records. London: A. Publishing, 1996. Starchefs.com. 4th Annual StarChefs.com International Chefs Congress. 2009. 1 Sep. 2010 http://www.starchefs.com/cook/icc-2009 Stein, Joshua David. “Exit Interview: Ken Friedman on the Demise of the John Dory.” Grub Street 15 Sep. 2009. 1 Sep. 2010 http://newyork.grubstreet.com/2009/09/exit_interview_ken_friedman_on.html Steinhauer, Jennifer & Jo Craven McGinty. “Yesterday’s Special: Good, Cheap Dining.” New York Times 26 Jun. 2005. 1 Sep. 2010 http://www.nytimes.com/2005/06/26/nyregion/26restaurant.html Striffler, Steve. Chicken: The Dangerous Transformation of America’s Favorite Food. New Haven: Yale University Press, 2005. The Spotted Pig (TSP) 2010 The Spotted Pig website http://www.thespottedpig.com Time Out New York. “Eat Out Awards 2009. Best New Hand at Seafood: April Bloomfield, the John Dory”. Time Out New York 706, 9-15 Apr. 2009. 10 Sep. 2010 http://newyork.timeout.com/articles/eat-out-awards/73170/eat-out-awards-2009-best-new-hand-at-seafood-a-april-bloomfield-the-john-dory Vallis, Alexandra. “Ken Friedman on the Virtues of No Reservations.” Grub Street 27 Aug. 2009. 10 Sep. 2010 http://newyork.grubstreet.com/2009/08/ken_friedman_on_the_virtues_of.html Watson, James L. Ed. Golden Arches East: McDonald’s in East Asia. Stanford: Stanford U P, 1997.Woody, Londa L. All in a Day's Work: Historic General Stores of Macon and Surrounding North Carolina Counties. Boone, North Carolina: Parkway Publishers, 2001. Young, Daniel. “Bon Appetit! It’s Feeding Time at Le Zoo.” New York Daily News 28 May 1995. 2 Sep. 2010 http://www.nydailynews.com/archives/lifestyle/1995/05/28/1995-05-28_bon_appetit__it_s_feeding_ti.html
APA, Harvard, Vancouver, ISO, and other styles
21

Ware, Ianto. "Andrew Keen Vs the Emos: Youth, Publishing, and Transliteracy." M/C Journal 11, no. 4 (July 1, 2008). http://dx.doi.org/10.5204/mcj.41.

Full text
Abstract:
This article is a comparison of two remarkably different takes on a single subject, namely the shifting meaning of the word ‘publishing’ brought about by the changes in literacy habits related to Web 2.0. One the one hand, we have Andrew Keen’s much lambasted 2007 book The Cult of the Amateur, which is essentially an attempt to defend traditional gatekeeper models of cultural production by denigrating online, user-generated content. The second is Spin journalist Andy Greenwald’s Nothing Feels Good, focusing on the Emo subculture of the early 2000s and its reliance on Web 2.0 as an integral medium for communication and the accumulation of subcultural capital. What I want to suggest in this article is that these two books, with their contrasting readings of Web 2.0, both tell us something specific about what the word “publishing” means and how it is currently undergoing a significant change brought about by a radical adaptation of literacy practices. What I think both books also do is give us an insight into how those changes are being interpreted, to be rejected on the one hand and applauded on the other. Both books have their faults. Keen’s work can fairly easily be passed off as a sort of cantankerous reminiscence for the legitimacy of an earlier era of publishing, and Greenwald’s Emos have, like all teen subcultures, changed somewhat. Yet what both books portray is an attempt to digest how Web 2.0 has altered perceptions of what constitutes legitimate speaking positions and how that is reflected in the literacy practices that shape the relationships among authors, readers, and the channels through which they interact. Their primary difference is a disparity in the value they place on Web 2.0’s amplification of the Internet’s use as a social and communicative medium. Greenwald embraces it as the facilitator of an open-access dialogue, whereas Keen sees it as a direct threat to other, more traditional, gatekeeper genres. Accordingly, Keen begins his book with a lament that Web 2.0’s “democratization” of media is “undermining truth, souring civic discourse and belittling expertise, experience, and talent … it is threatening the very future of our cultural institutions” (15). He continues, Today’s editors, technicians, and cultural gatekeepers—the experts across an array of fields—are necessary to help us to sift through what’s important and what’s not, what is credible from what is unreliable, what is worth spending our time on as opposed to the white noise that can be safely ignored. (45) As examples of the “white noise,” he lists some of the core features of Web 2.0—blogs, MySpace, YouTube and Facebook. The notable similarity between all of these is that their content is user generated and, accordingly, comes from the position of the personal, rather than from a gatekeeper. In terms of their readership, this presents a fundamental shift in an understanding of authenticated speaking positions, one which Keen suggests underwrites reliability by removing the presence of certifiable expertise. He looks at Web 2.0 and sees a mass of low grade, personal content overwhelming traditional benchmarks of quality and accountability. His definition of “publishing” is essentially one in which a few, carefully groomed producers express work seen as relevant to the wider community. The relationship between reader and writer is primarily one sided, mediated by a gatekeeper and rests on the assumption by all involved that the producer has the legitimacy to speak to a large, and largely silent, readership. Greenwald, by contrast, looks at the same genres and comes to a remarkably different and far more positive conclusion. He focuses heavily on the lively message boards of the social networking site Makeoutclub, the shift to a long tail marketing style by key Emo record labels such as Vagrant and Drive-Thru Records and, in particular, the widespread use of LiveJournal (www.livejournal.com) by suburban, Emo fixated teenagers. Of this he writes: The language is inflated, coded as ‘adult’ and ‘poetic’, which often translates into affected, stilted and forced. But if one can accept that, there’s a sweet vulnerability to it. The world of LiveJournal is an enclosed circuit where everyone has agreed to check their cynicism at the sign on screen; it’s a pulsing, swoony realm of inflated emotions, expectations and dialogue. (287) He specifically notes that one cannot read mediums like LiveJournal in the same style as their more traditional counterparts. There is a necessity to adopt a reading style conducive to a dialogue devoid of conventional quality controls. It is also, he notes, a heavily interconnected, inherently social medium: LiveJournals represent the truest and easiest realization of the essential teenage (and artistic) tenet of the importance of a ‘room of one’s own’, and yet the framework of the website is enough to make each individual room interconnected into a mosaic of richly felt lives. (288) Where Keen sees Web 2.0 as a shift way from established cultural forums, Greenwald sees it as an interconnected conversation. His definition of publishing is more fluid, founded on a belief not in the authenticity of a single, validated voice but on the legitimacy of interaction and communication entirely devoid of any gatekeepers. Central to understanding the difference between Greenwald and Keen is the issue or whether or not we accept the legitimacy of personal voices and how we evaluate the kind of reading practices involved in interpreting them. In this respect, Greenwald’s reference to “a room of one’s own” is telling. When Virginia Woolf wrote A Room of One’s Own in 1929, Web 2.0 wasn’t even a consideration, but her work dealt with a similar subject matter, detailing the key role the novel genre played in legitimising women’s voices precisely because it was “young enough to be soft in [their] hands” (74). What would eventually emerge from Woolf’s work was the field of feminist literary criticism, which hit its stride in the mid-eighties. In terms of its understanding of the power relations inherent to cultural production, particularly as they relate to gatekeeping, it’s a rich academic tradition notably lacking in the writing on Web 2.0. For example, Celia Lury’s essay “Reading the Self,” written more than ten years before the popularisation of the internet, looks specifically at the way in which authoritative speaking positions gain their legitimacy not just through the words on the page but through the entire relationships among author, genre, channels of distribution, and readership. She argues that, “to write is to enter into a relationship with a community of readers, and various forms of writing are seen to involve and imply, at any particular time, various forms of relationship” (102). She continues, so far as text is clearly written/read within a particular genre, it can be seen to rest upon a more or less specific set of social relations. It also means that ‘textual relations’—that is, formal techniques, reading strategies and so on—are not held separate from ‘non-textual relations’—such as methods of cultural production and modes of distribution—and that the latter can be seen to help construct ‘literary value.’ (102) The implication is that an appropriation of legitimised speaking positions isn’t done purely by overthrowing or contesting an established system of ‘quality’ but by developing a unique relationship between author, genre, and readership. Textual and non-textual practices blur together to create literary environments and cultural space. The term “publishing” is at the heart of these relationships, describing the literacies required to interpret particular voices and forms of communication. Yet, as Lury writes, literacy habits can vary. Participation in dialogue-driven, user-generated mediums is utterly different from conventional, gatekeeper-driven ones, yet the two can easily co-exist. For instance, reading last year’s Man Booker prize-winner doesn’t stop one from reading, or even writing, blogs. One can enact numerous literacy practices, move between discourses and inhabit varied relationships between genre, reader, and writer. However, with the rise of Web 2.0 a whole range of literacies that used to be defined as “private sphere” or “everyday literacies,” everything from personal conversations and correspondence to book clubs and fanzines, have become far, far more public. In the past these dialogue-based channels of communication have never been in a position where they could be defined as “publishing.” Web 2.0 changes that, moving previously private sphere communication into online public space in a very obvious way. Keen dismisses this shift as a wall of white noise, but Greenwald does something equally interesting. To a large extent, his positive treatment of Web 2.0’s “affected, stilted and forced” user-generated content is validated by his focus on a “Youth” subculture, namely Emo. Indeed, he heavily links the impact of youthful subcultural practices with the internet, writing that Teenage life has always been about self-creation, and its inflated emotions and high stakes have always existed in a grossly accelerated bubble of hypertime. The internet is the most teenage of media because it too exists in this hypertime of limitless limited moments and constant reinvention. If emo is the soundtrack to hypertime, then the web is its greatest vehicle, the secret tunnel out of the locked bedroom and dead-eyed judgmental scenes of youth. (277) In this light, we accept the voices of his Emo subjects because, underneath their low-quality writing, they produce a “sweet vulnerability” and a “dialogue,” which provides them with a “secret tunnel” out of the loneliness of their bedrooms or unsupportive geographical communities. It’s a theme that hints at the degree to which discussions of Web 2.0 are often heavily connected to arguments about generationalism, framed by the field of youth studies and accordingly end up being mined for what Tara Brabazon calls “spectacular youth subcultures” (23). We see some core examples of this in some of the quasi-academic writing on the subject of “Youth.” For example, in his 2005 book XYZ: The New Rules of Generational Warfare, Michael Grose declares Generation Y as “post-literate”: Like their baby boomer parents and generation X before them, generation Ys get their information from a range of sources that include the written and spoken word. Magazines and books are in, but visual communication is more important for this cohort than their parents. They live in a globalised, visual world where images rather than words are universal communication media. The Internet has heightened the use of symbols as a direct communicator. (95) Given the Internet is overwhelmingly a textual medium, it’s hard to tell exactly what Grose’s point is other than to express his confusion over new literacy practices. In a similar vein and in a similar style, Rebecca Huntley writes in her book The World According to Y, In the Y world, a mobile phone is not merely a phone. It is, as described by demographer Bernard Salt, “a personal accessory, a personal communications device and a personal entertainment centre.” It’s a device for work and play, flirtation and sex, friendship and family. For Yers, their phone symbolizes freedom and flexibility. More than that, your mobile phone symbolizes you. (16) Like Keen, Grose and Huntley are trying to understand a shift in publishing and media that has produced new literacy practices. Unlike Keen, Grose and Huntley pin the change on young people and, like Greenwald, they turn a series of new literacy practices into something akin to what Dick Hebdige called “conspicuous consumption” (103). It’s a term he linked to his definition of bricolage as the production of “implicitly coherent, though explicitly bewildering, systems of connection between things which perfectly equip their users to ‘think’ their own world” (103). Thus, young people are differentiated from the rest of the population by their supposedly unique consumption of “symbols” and mobile phones, into which they read their own cryptic meanings and develop their own generational language. Greenwald shows this methodology in action, with the Emo use of things like LiveJournal, Makeoutclub and other bastions of Web 2.0 joining their record collections, ubiquitous sweeping fringes and penchant for accessorised outfits as part of the conspicuous consumption inherent to understandings of youth subculture. The same theme is reflected in Michel de Certeau’s term “tactics” or, more common amongst those studying Web 2.0, Henry Jenkins’s notion of “poaching”. The idea is that people, specifically young people, appropriate particular forms of cultural literacy to redefine themselves and add a sense of value to their voices. De Certeau’s definition of tactics, as a method of resistance “which cannot count on a ‘proper’ (a spatial or institutional localization), nor thus on a borderline distinguishing the other as a visible totality” (489), is a prime example of how Web 2.0 is being understood. Young people, Emo or not, engage in a consumption of the Internet, poaching the tools of production to redefine the value of their voices in a style completely acceptable to the neo-Marxist, Birmingham school understanding of youth and subculture as a combination producing a sense of resistance. It’s a narrative highly compatible within the fields of cultural and media studies, which, despite major shifts brought about by people like Ken Gelder, Sarah Thornton, Keith Kahn-Harris and the aforementioned Tara Brabazon, still look heavily for patterns of politicised consumption. The problem, as I think Keen inadvertently suggests, is that the Internet isn’t just about young people and their habits as consumers. It’s about what the word “publishing” actually means and how we think about the interaction among writers, readers, and the avenues through which they interact. The idea that we can pass off the redefinition of literacy practices brought about by Web 2.0 as a subcultural youth phenomena is an easy way of bypassing wider cultural shifts onto a token demographic. It presents Web 2.0 as an issue of “Youth” resisting the hegemony of traditional gatekeepers, which is effectively what Greenwald does. Yet such an approach has a very short shelf life. It’s a little like claiming the telephone or the television set were “youth genres.” The uptake of new technologies will inadvertently impact differently on those who grew up with them as compared to those who grew up without them. Yet ultimately changes in literacy habits are much larger than a generationalist framework can really express, particularly given the first generation of “digital natives” are now in their thirties. There’s a lot of things wrong with Andrew Keen’s book but one thing he does do well is ground the debate about Web 2.0 back to issues of legitimate speaking positions and publishing. That said, he also significantly simplifies those issues when he claims the problem is purely about the decline of traditional gatekeeper models. Responding to Keen’s criticism of him, Creative Commons founder Lawrence Lessig writes, I think it is a great thing when amateurs create, even if the thing they create is not as great as what the professional creates. I want my kids to write. But that doesn’t mean that I’ll stop reading Hemingway and read only what they write. What Keen misses is the value to a culture that comes from developing the capacity to create—independent of the quality created. That doesn’t mean we should not criticize works created badly (such as, for example, Keen’s book…). But it does mean you’re missing the point if you simply compare the average blog to the NY times (Lessig). What Lessig expresses here is the different, but not mutually exclusive, literacy practices involved in the word “publishing.” Publishing a blog is very different to publishing a newspaper and the way readers react to both will change as they move in and out the differing discursive spaces each occupies. In a recent collaborative paper by Sue Thomas, Chris Joseph, Jess Laccetti, Bruce Mason, Simon Mills, Simon Perril, and Kate Pullinger, they describe this capacity to move across different reading and writing styles as “transliteracy.” They define the term as “the ability to read, write and interact across a range of platforms, tools and media from signing and orality through handwriting, print, TV, radio and film, to digital social networks” (Thomas et al.). It’s a term that perfectly describes the capacity to move fluidly across discursive environments. Here we return to Greenwald’s use of a framework of youth and subculture. While I have criticised the Birminghamesque fixation on a homogeneous “Youth” demographic enacting resistance through conspicuous consumption, there is good reason to use existing subculture studies methodology as a means of understanding how transliteracies play out in everyday life. David Chaney remarks, the idea of subculture is redundant because the type of investment that the notion of subculture labelled is becoming more general, and therefore the varieties of modes of symbolization and involvement are more common in everyday life. (37) I think the increasing commonality of subcultural practices in everyday life actually makes the idea more relevant, not less. It does, however, make it much harder to pin things on “spectacular youth subcultures.” Yet the focus on “everyday life” is important here, shifting our understanding of “subculture” to the types of literacies played out within localised, personal networks and experiences. As de Certeau has argued, the practice of everyday life is an issue of “a way of thinking invested in a way of acting, an art of combination which cannot be dissociated from an art of using” (Certeau 486). This is as true for our literacy practices as anything else. Whether we choose to label those practices subcultural or not, our ability to interpret, take part in and react to different communicative forums is clearly fundamental to our understanding of the world around us, regardless of our age. Sarah Thornton suggests a useful alternate definition of subculture when she talks about subcultural capital: Subcultural capital is the linchpin of an alternative hierarchy in which the aces of age, gender, sexuality and race are all employed in order to keep the determinations of class, income and occupation at bay (105). This is an understanding that avoids easy narratives of young people and their consumption of Web 2.0 by recognising the complexity with which people’s literacy habits, in the cultural sense, connect to their active participation in the production of meaning. Subcultural capital implies that the framework through which individuals read, interpret, and shift between discursive environments, personalising and building links across the strata of cultural production, is acted out at the local and personal level, rather than purely through the relationship between a producing gatekeeper and a passive, consuming readership. If we recognise the ability for readers to connect multiple mediums, to shift between reading and writing practices, and to seamlessly interpret and digest markedly different assumptions about legitimate speaking voices across genres, our understanding of what it means to “publish” ceases to be an issue of generationalism or conventional mediums being washed away by the digital era. The issue we see in both Keen and Greenwald is an attempt to digest the way Web 2.0 has forced the concept of “publishing” to take on a multiplicity of meanings, played out by individual readers, and imbued with their own unique and interwoven textual and cultural literacy habits. It’s not only Emos who publish livejournals, and it’s incredibly naive to assume gatekeepers have ever really held a monopoly on all aspects of cultural production. What the rise of Web 2.0 has done is simply to bring everyday, private sphere dialogue driven literacies into the public sphere in a very obvious way. The kind of discourses once passed off as resistant youth subcultures are now being shown as common place. Keen is right to suggest that this will continue to impact, sometimes negatively, on traditional gatekeepers. Yet the change is inevitable. As our reading and writing practices alter around new genres, our understandings of what constitutes legitimate fields of publishing will also change. References Brabazon, Tara. From Revolution to Revelation. Aldershot: Ashgate, 2005. de Certeau, Michel. “Practice of Every Day Life.” Cultural Theory and Popular Culture. Ed. John Story. London: Prentice Hall, 1998. 483–94. Chaney, David. “Fragmented Culture and Subcultures.” After Subculture. Ed. Andy Bennett and Keith Kahn-Harris. Houndsmill: Palgrave McMillian, 2004. 36–48. Greenwald, Andy. Nothing Feels Good: Punk Rock, Teenagers and Emo. New York: St Martin’s Griffin, 2003. Grose, Michael. XYZ: The New Rules of Generational Warfare. Sydney: Random House, 2005. Hebdige, Dick. Subculture: The Meaning of Style. London: Methuen and Co Ltd, 1979. Huntley, Rebecca. The World According to Y. Crows Nest: Allen and Unwin, 2006. Keen, Andrew. The Cult of the Amateur. London: Nicholas Brealey Publishing, 2007. Lessig, Lawrence. “Keen’s ‘The Cult of the Amateur’: BRILLIANT!” Lessig May 31, 2007. Aug. 19 2008 ‹http://www.lessig.org/blog/2007/05/keens_the_cult_of_the_amateur.html>. Lury, Celia. “Reading the Self: Autobiography, Gender and the Institution of the Literary.” Off-Centre: Feminism and Cultural Studies. Ed. Sarah. Franklin, Celia Lury, and Jackie Stacey. Hammersmith: HarperCollinsAcademic, 1991. 97–108. Thomas, Sue, Chris Joseph, Jess Laccetti, Bruce Mason, Simon Mills, Simon Perril, and Kate Pullinger. “Transliteracy: Crossing Divides.” First Monday 12.12. (2007). Apr. 1 2008 ‹http://www.uic.edu/htbin/cgiwrap/bin/ojs/index.php/fm/article/view/2060/1908>. Thornton, Sarah. Club Cultures: Music, Media and Subcultural Capital. Oxford: Polity Press, 1995. Woolf, Virginia. A Room of One’s Own. Frogmore: Triad/Panther Press, 1977.
APA, Harvard, Vancouver, ISO, and other styles
22

Turner, Bethaney. "Information-Age Guerrillas." M/C Journal 8, no. 2 (June 1, 2005). http://dx.doi.org/10.5204/mcj.2331.

Full text
Abstract:
After balaclava-clad Zapatistas seized control of a handful of southern Mexican towns on New Year’s Eve, 1993, and soon after became implicated in the first wide-scale use of the Internet in a warlike scenario, it was thought that the age of postmodern Internet warfare had arrived. However, while the centrality of the Internet to the movement’s relative success evokes romantic images of Zapatista rebels uploading communiqués onto the World Wide Web from remote mountain hideaways, these myths are dispelled when the impoverished living conditions of its indigenous Maya constituents are taken into account. Instead, the Zapatistas’ presence on the Internet is mediated by NGOs and other support groups who electronically publish hand-written Zapatista communiqués. While this paper demonstrates the political utility of information-age communication strategies for localised struggles for cultural autonomy, it is shown that, for the Zapatistas, these strategies work with, rather than against, traditional print culture. The Zapatistas, NGOs and the Internet Soon after the Zapatista uprising began, the New York Times, prompted by the movement’s rapid acquirement of an Internet presence, declared that the world’s first “postmodern revolutionary movement” had appeared in the unlikely location of the southern Mexican state of Chiapas (Burbach 116). Other analyses that investigate the significance of the Internet in the uprising define the EZLN as the world’s “first informational guerrilla movement” (Castells 79), and the “first social netwar” (Ronfeldt et al. 1). After such descriptions were assigned to the EZLN, an image of Zapatista rebels typing e-mails on laptops in remote mountain hideaways featured in many initial media reports. These ideas were still dominating much of the media a year after the uprising when the Mexican President ordered a raid on suspected EZLN hideouts in an attempt to capture the movement’s mestizo spokesperson, Subcomandante Marcos. Media reports at the time claimed that in some of the raids “they found as many computer disks as bullets”. There were also claims that “if Marcos is equipped with a telephone modem and a cellular phone [he could] hook into the Internet [directly] even while on the run, as he is now” (Knudson 509). However, while the Internet contributed significantly to the advance of the EZLN struggle, this romanticised and mythologised imagery is far removed from the material impoverishment that led to the movement’s uprising and which still characterises the lives of its constituents. Indeed, the Marcos that I saw addressing a crowd in the Mexican city of Puebla during the EZLN’s 2001 March for Indigenous Dignity read his speech from an old-tattered notebook—the old-fashioned printed kind, not one from the Toshiba range. He stumbled over some sections, telling the crowd that it had been smudged by the rain earlier in the day. This may have been a move calculated to enhance the charismatic appeal of the pipe-smoking, poet-guerrilla, but it is also consistent with the impoverished circumstances from which the Zapatistas emanated and within which they continue to struggle. There is a glaring anomaly between descriptions of the Zapatistas as postmodern or as the initiators of informational guerrilla warfare, or netwar, and the movement’s location in the most remote regions of an impoverished state, which has Internet hubs in only two of its towns and “no telephone or electricity at all in most of the rural areas” (Froehling 291). Indeed, the Zapatistas’ relationship with the Internet is mediated via a support network that, most significantly, includes NGOs. For the Zapatista word to reach a national and international audience the movement had to firstly rely on hand-written documents and old-fashioned means of covert communication whereby messages were passed secretly from hand to hand, galloped inside a saddle satchel, hidden in a cyclist’s bag, slipped into a backpack, or perhaps thrust inside a sack of beans, then propped in the back of an open truck, crammed with indigenous villagers who make the hours-long journey to the closest market, or doctor, and our messenger to a contact person with Internet access. (Ponce de León xxiii) The journey of the EZLN’s communiqués from the remote Chiapan highlands to a world-wide audience via its Internet-connected support network has created what Cleaver calls a “Zapatista effect” (1998). This effect demonstrates that by establishing an international electronic web of support, particularly between marginalised groups and NGOs, dominant political, economic and social policies can be effectively opposed and alternatives articulated. The Zapatista uprising marks the first time that the electronic media have been used as a strategy in their own right, producing “an electronic fabric of opposition to much wider policies”, rather than simply facilitating the “traditional work of solidarity” (Cleaver 622). Cleaver claims that this “Zapatista effect” has the potential to permeate and inform social struggles throughout the world and reweave “the fabric of politics” by demonstrating the ability of grassroots movements to form national and international collectives to challenge the power of the nation-state (637). Investigation into the usefulness of new communication technologies in times of war and struggle has also been the focus of studies conducted for the US army, leading to the development of the concept of “netwar” (Ronfeldt et al. iii). Ronfeldt et al. contend that, as a result of what they claim is the increasing dependency of contemporary society on information, “more than ever before, conflicts are about ‘knowledge’—about who knows (or can be kept from knowing) what, when, where, and why” (7-8). The study concludes that the EZLN’s development of an NGO support network that could rapidly disseminate reports on human rights abuses, information about the intolerable living conditions endured by indigenous Chiapans, and the EZLN’s communiqués has been crucial to developing the movement’s support base. However, the movement’s establishment of an electronically wired NGO support network able to circulate information about the EZLN, its struggle and its aims relies on the movement’s ability to convey information to them, the “what, when, where, and why”, before it can appear on the Internet and in other media forms. It is not simply the publication and distribution of figures relating to disease, impoverishment and human rights violations that have contributed to people’s interest in, and support for, the Zapatistas. Rather, the intriguing content and style of their discourse, which is heavily indebted to the charismatic figure of Subcomandante Marcos, has also played a crucial role. The writings of Marcos are rich with poetic imagery, humour, symbols of Mayan mythology and references to Latin American and Spanish literary figures and styles, particularly magic realism. Zapatista Narratives Marcos’ innovative and engaging discursive style is particularly evident in the stories he tells of Don Durito, a beetle named Nebuchadnezzar who has assumed the nom de guerre of Durito, which literally means the little strong or hard one, a reference to his shell, fighting spirit and his status as a ladies’ man (Subcomandante Marcos 9). Don Durito has made the floor of the Southern Mexican Lacandón jungle his home, but in Marcos’s stories he often travels the world as a knight-errant, reminiscent of Cervantes’s delusional do-gooder Don Quijote. Durito also intermittently assumes the role of a detective and that of a political analyst, and it is in this guise that he first meets Marcos. This occurs when Marcos, unable to find tobacco to fill the pipe he is never seen without, notices a trail of the dried black leaves weaving away from his hammock. After following the trail for a few metres Marcos sees, behind a stone, a bespectacled beetle clenching a tiny pipe, sitting at a tiny desk studying, as we soon discover, neoliberalism “and its strategy of domination for Latin America” (Subcomandante Marcos 12). Marcos, unfazed by the discovery of a literate, smoking beetle is taken aback by his investigation of neoliberalism. Durito explains that his scholarly interest is quite pragmatic for it stems from a desire to know how long and how successful the Zapatista struggle will be so as to ascertain “how long us beetles are going to have to be careful that you [Marcos and the other members of the Zapatista army who are based in the jungle] aren’t going to squash us with your big boots” (Subcomandante Marcos 12). In these encounters with Durito the political analyst, Marcos is given lessons in politics and economics from an inhabitant of the jungle floor, from a beetle who recognises that the danger of being squashed by “big boots” in his small patch of land is intimately linked to the global issue of neoliberalism and its much bigger boots. Through these stories, Marcos highlights the detrimental impact that global economic policies have had on the Maya of Chiapas. The character of Durito also enables him to demonstrate the potential for small, seemingly insignificant individuals or groups to radically challenge these policies and articulate alternatives. Conclusion Such entertaining and lyrical prose enables the EZLN to present itself as a new style of social revolutionary movement, far removed from traditional Latin American revolutionary struggles. This has, arguably, broadened the movement’s international support network, a situation facilitated by the circulation and publication of these writings and communiqués on the Internet by the movement’s NGO support network. However, while the use of information-age technology to stimulate the creation of collective transnational support networks presents as a useful strategy for contemporary social struggles, it does not guarantee the procurement of significant political, economic and social change. Indeed, after more than a decade of struggle, the Zapatistas have not precipitated the radical reconstruction of the Mexican political system that they had hoped for. References Burbach, Roger. Globalization and Postmodern Politics: From Zapatistas to High-Tech Robber Barons. London: Pluto Press, 2001. Castells, Manuel. The Information Age: Economy, Society and Culture Volume II: The Power of Identity. Malden, Ma.: Blackwell Publishers, 1997. Cleaver, Harry M. Jr. “The Zapatista Effect: The Internet and the Rise of an Alternative Political Fabric.” Journal of International Affairs 51.2 (1998): 621-40. Froehling, Oliver. “The Cyberspace ‘War of Ink and Internet’ in Chiapas, Mexico.” The Geographical Review 87.2 (1997): 291-307. Knudson, Jerry W. “Rebellion in Chiapas: Insurrection by Internet and Public Relations.” Media, Culture and Society 20.3 (1998): 507-18. Ponce de León, Juana. “Editor’s Note: Travelling Back for Tomorrow.” Our Word Is Our Weapon. Ed. Juana Ponce de León. London: Serpent’s Tail, 2001. xxiii-xxxi. Ronfeldt, David, et al. The Zapatista Social Netwar in Mexico. Santa Monica, California: RAND, 1998. Subcomandante Marcos. Don Durito de La Lacandona. San Cristóbal de Las Casas Chiapas: Centro de Información y Análisis de Chiapas, 1999. Citation reference for this article MLA Style Turner, Bethaney. "Information-Age Guerrillas: The Communication Strategies of the Zapatistas." M/C Journal 8.2 (2005). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0506/01-turner.php>. APA Style Turner, B. (Jun. 2005) "Information-Age Guerrillas: The Communication Strategies of the Zapatistas," M/C Journal, 8(2). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0506/01-turner.php>.
APA, Harvard, Vancouver, ISO, and other styles
23

Moore, Christopher Luke. "Digital Games Distribution: The Presence of the Past and the Future of Obsolescence." M/C Journal 12, no. 3 (July 15, 2009). http://dx.doi.org/10.5204/mcj.166.

Full text
Abstract:
A common criticism of the rhythm video games genre — including series like Guitar Hero and Rock Band, is that playing musical simulation games is a waste of time when you could be playing an actual guitar and learning a real skill. A more serious criticism of games cultures draws attention to the degree of e-waste they produce. E-waste or electronic waste includes mobiles phones, computers, televisions and other electronic devices, containing toxic chemicals and metals whose landfill, recycling and salvaging all produce distinct environmental and social problems. The e-waste produced by games like Guitar Hero is obvious in the regular flow of merchandise transforming computer and video games stores into simulation music stores, filled with replica guitars, drum kits, microphones and other products whose half-lives are short and whose obsolescence is anticipated in the annual cycles of consumption and disposal. This paper explores the connection between e-waste and obsolescence in the games industry, and argues for the further consideration of consumers as part of the solution to the problem of e-waste. It uses a case study of the PC digital distribution software platform, Steam, to suggest that the digital distribution of games may offer an alternative model to market driven software and hardware obsolescence, and more generally, that such software platforms might be a place to support cultures of consumption that delay rather than promote hardware obsolescence and its inevitability as e-waste. The question is whether there exists a potential for digital distribution to be a means of not only eliminating the need to physically transport commodities (its current 'green' benefit), but also for supporting consumer practices that further reduce e-waste. The games industry relies on a rapid production and innovation cycle, one that actively enforces hardware obsolescence. Current video game consoles, including the PlayStation 3, the Xbox 360 and Nintendo Wii, are the seventh generation of home gaming consoles to appear within forty years, and each generation is accompanied by an immense international transportation of games hardware, software (in various storage formats) and peripherals. Obsolescence also occurs at the software or content level and is significant because the games industry as a creative industry is dependent on the extensive management of multiple intellectual properties. The computing and video games software industry operates a close partnership with the hardware industry, and as such, software obsolescence directly contributes to hardware obsolescence. The obsolescence of content and the redundancy of the methods of policing its scarcity in the marketplace has been accelerated and altered by the processes of disintermediation with a range of outcomes (Flew). The music industry is perhaps the most advanced in terms of disintermediation with digital distribution at the center of the conflict between the legitimate and unauthorised access to intellectual property. This points to one issue with the hypothesis that digital distribution can lead to a reduction in hardware obsolescence, as the marketplace leader and key online distributor of music, Apple, is also the major producer of new media technologies and devices that are the paragon of stylistic obsolescence. Stylistic obsolescence, in which fashion changes products across seasons of consumption, has long been observed as the dominant form of scaled industrial innovation (Slade). Stylistic obsolescence is differentiated from mechanical or technological obsolescence as the deliberate supersedence of products by more advanced designs, better production techniques and other minor innovations. The line between the stylistic and technological obsolescence is not always clear, especially as reduced durability has become a powerful market strategy (Fitzpatrick). This occurs where the design of technologies is subsumed within the discourses of manufacturing, consumption and the logic of planned obsolescence in which the product or parts are intended to fail, degrade or under perform over time. It is especially the case with signature new media technologies such as laptop computers, mobile phones and portable games devices. Gamers are as guilty as other consumer groups in contributing to e-waste as participants in the industry's cycles of planned obsolescence, but some of them complicate discussions over the future of obsolescence and e-waste. Many gamers actively work to forestall the obsolescence of their games: they invest time in the play of older games (“retrogaming”) they donate labor and creative energy to the production of user-generated content as a means of sustaining involvement in gaming communities; and they produce entirely new game experiences for other users, based on existing software and hardware modifications known as 'mods'. With Guitar Hero and other 'rhythm' games it would be easy to argue that the hardware components of this genre have only one future: as waste. Alternatively, we could consider the actual lifespan of these objects (including their impact as e-waste) and the roles they play in the performances and practices of communities of gamers. For example, the Elmo Guitar Hero controller mod, the Tesla coil Guitar Hero controller interface, the Rock Band Speak n' Spellbinder mashup, the multiple and almost sacrilegious Fender guitar hero mods, the Guitar Hero Portable Turntable Mod and MAKE magazine's Trumpet Hero all indicate a significant diversity of user innovation, community formation and individual investment in the post-retail life of computer and video game hardware. Obsolescence is not just a problem for the games industry but for the computing and electronics industries more broadly as direct contributors to the social and environmental cost of electrical waste and obsolete electrical equipment. Planned obsolescence has long been the experience of gamers and computer users, as the basis of a utopian mythology of upgrades (Dovey and Kennedy). For PC users the upgrade pathway is traversed by the consumption of further hardware and software post initial purchase in a cycle of endless consumption, acquisition and waste (as older parts are replaced and eventually discarded). The accumulation and disposal of these cultural artefacts does not devalue or accrue in space or time at the same rate (Straw) and many users will persist for years, gradually upgrading and delaying obsolescence and even perpetuate the circulation of older cultural commodities. Flea markets and secondhand fairs are popular sites for the purchase of new, recent, old, and recycled computer hardware, and peripherals. Such practices and parallel markets support the strategies of 'making do' described by De Certeau, but they also continue the cycle of upgrade and obsolescence, and they are still consumed as part of the promise of the 'new', and the desire of a purchase that will finally 'fix' the users' computer in a state of completion (29). The planned obsolescence of new media technologies is common, but its success is mixed; for example, support for Microsoft's operating system Windows XP was officially withdrawn in April 2009 (Robinson), but due to the popularity in low cost PC 'netbooks' outfitted with an optimised XP operating system and a less than enthusiastic response to the 'next generation' Windows Vista, XP continues to be popular. Digital Distribution: A Solution? Gamers may be able to reduce the accumulation of e-waste by supporting the disintermediation of the games retail sector by means of online distribution. Disintermediation is the establishment of a direct relationship between the creators of content and their consumers through products and services offered by content producers (Flew 201). The move to digital distribution has already begun to reduce the need to physically handle commodities, but this currently signals only further support of planned, stylistic and technological obsolescence, increasing the rate at which the commodities for recording, storing, distributing and exhibiting digital content become e-waste. Digital distribution is sometimes overlooked as a potential means for promoting communities of user practice dedicated to e-waste reduction, at the same time it is actively employed to reduce the potential for the unregulated appropriation of content and restrict post-purchase sales through Digital Rights Management (DRM) technologies. Distributors like Amazon.com continue to pursue commercial opportunities in linking the user to digital distribution of content via exclusive hardware and software technologies. The Amazon e-book reader, the Kindle, operates via a proprietary mobile network using a commercially run version of the wireless 3G protocols. The e-book reader is heavily encrypted with Digital Rights Management (DRM) technologies and exclusive digital book formats designed to enforce current copyright restrictions and eliminate second-hand sales, lending, and further post-purchase distribution. The success of this mode of distribution is connected to Amazon's ability to tap both the mainstream market and the consumer demand for the less-than-popular; those books, movies, music and television series that may not have been 'hits' at the time of release. The desire to revisit forgotten niches, such as B-sides, comics, books, and older video games, suggests Chris Anderson, linked with so-called “long tail” economics. Recently Webb has queried the economic impact of the Long Tail as a business strategy, but does not deny the underlying dynamics, which suggest that content does not obsolesce in any straightforward way. Niche markets for older content are nourished by participatory cultures and Web 2.0 style online services. A good example of the Long Tail phenomenon is the recent case of the 1971 book A Lion Called Christian, by Anthony Burke and John Rendall, republished after the author's film of a visit to a resettled Christian in Africa was popularised on YouTube in 2008. Anderson's Long Tail theory suggests that over time a large number of items, each with unique rather than mass histories, will be subsumed as part of a larger community of consumers, including fans, collectors and everyday users with a long term interest in their use and preservation. If digital distribution platforms can reduce e-waste, they can perhaps be fostered by to ensuring digital consumers have access to morally and ethically aware consumer decisions, but also that they enjoy traditional consumer freedoms, such as the right to sell on and change or modify their property. For it is not only the fixation on the 'next generation' that contributes to obsolescence, but also technologies like DRM systems that discourage second hand sales and restrict modification. The legislative upgrades, patches and amendments to copyright law that have attempted to maintain the law's effectiveness in competing with peer-to-peer networks have supported DRM and other intellectual property enforcement technologies, despite the difficulties that owners of intellectual property have encountered with the effectiveness of DRM systems (Moore, Creative). The games industry continues to experiment with DRM, however, this industry also stands out as one of the few to have significantly incorporated the user within the official modes of production (Moore, Commonising). Is the games industry capable (or willing) of supporting a digital delivery system that attempts to minimise or even reverse software and hardware obsolescence? We can try to answer this question by looking in detail at the biggest digital distributor of PC games, Steam. Steam Figure 1: The Steam Application user interface retail section Steam is a digital distribution system designed for the Microsoft Windows operating system and operated by American video game development company and publisher, Valve Corporation. Steam combines online games retail, DRM technologies and internet-based distribution services with social networking and multiplayer features (in-game voice and text chat, user profiles, etc) and direct support for major games publishers, independent producers, and communities of user-contributors (modders). Steam, like the iTunes games store, Xbox Live and other digital distributors, provides consumers with direct digital downloads of new, recent and classic titles that can be accessed remotely by the user from any (internet equipped) location. Steam was first packaged with the physical distribution of Half Life 2 in 2004, and the platform's eventual popularity is tied to the success of that game franchise. Steam was not an optional component of the game's installation and many gamers protested in various online forums, while the platform was treated with suspicion by the global PC games press. It did not help that Steam was at launch everything that gamers take objection to: a persistent and initially 'buggy' piece of software that sits in the PC's operating system and occupies limited memory resources at the cost of hardware performance. Regular updates to the Steam software platform introduced social network features just as mainstream sites like MySpace and Facebook were emerging, and its popularity has undergone rapid subsequent growth. Steam now eclipses competitors with more than 20 million user accounts (Leahy) and Valve Corporation makes it publicly known that Steam collects large amounts of data about its users. This information is available via the public player profile in the community section of the Steam application. It includes the average number of hours the user plays per week, and can even indicate the difficulty the user has in navigating game obstacles. Valve reports on the number of users on Steam every two hours via its web site, with a population on average between one and two million simultaneous users (Valve, Steam). We know these users’ hardware profiles because Valve Corporation makes the results of its surveillance public knowledge via the Steam Hardware Survey. Valve’s hardware survey itself conceptualises obsolescence in two ways. First, it uses the results to define the 'cutting edge' of PC technologies and publishing the standards of its own high end production hardware on the companies blog. Second, the effect of the Survey is to subsequently define obsolescent hardware: for example, in the Survey results for April 2009, we can see that the slight majority of users maintain computers with two central processing units while a significant proportion (almost one third) of users still maintained much older PCs with a single CPU. Both effects of the Survey appear to be well understood by Valve: the Steam Hardware Survey automatically collects information about the community's computer hardware configurations and presents an aggregate picture of the stats on our web site. The survey helps us make better engineering and gameplay decisions, because it makes sure we're targeting machines our customers actually use, rather than measuring only against the hardware we've got in the office. We often get asked about the configuration of the machines we build around the office to do both game and Steam development. We also tend to turn over machines in the office pretty rapidly, at roughly every 18 months. (Valve, Team Fortress) Valve’s support of older hardware might counter perceptions that older PCs have no use and begins to reverse decades of opinion regarding planned and stylistic obsolescence in the PC hardware and software industries. Equally significant to the extension of the lives of older PCs is Steam's support for mods and its promotion of user generated content. By providing software for mod creation and distribution, Steam maximises what Postigo calls the development potential of fan-programmers. One of the 'payoffs' in the information/access exchange for the user with Steam is the degree to which Valve's End-User Licence Agreement (EULA) permits individuals and communities of 'modders' to appropriate its proprietary game content for use in the creation of new games and games materials for redistribution via Steam. These mods extend the play of the older games, by requiring their purchase via Steam in order for the individual user to participate in the modded experience. If Steam is able to encourage this kind of appropriation and community support for older content, then the potential exists for it to support cultures of consumption and practice of use that collaboratively maintain, extend, and prolong the life and use of games. Further, Steam incorporates the insights of “long tail” economics in a purely digital distribution model, in which the obsolescence of 'non-hit' game titles can be dramatically overturned. Published in November 2007, Unreal Tournament 3 (UT3) by Epic Games, was unappreciated in a market saturated with games in the first-person shooter genre. Epic republished UT3 on Steam 18 months later, making the game available to play for free for one weekend, followed by discounted access to new content. The 2000 per cent increase in players over the game's 'free' trial weekend, has translated into enough sales of the game for Epic to no longer consider the release a commercial failure: It’s an incredible precedent to set: making a game a success almost 18 months after a poor launch. It’s something that could only have happened now, and with a system like Steam...Something that silently updates a purchase with patches and extra content automatically, so you don’t have to make the decision to seek out some exciting new feature: it’s just there anyway. Something that, if you don’t already own it, advertises that game to you at an agreeably reduced price whenever it loads. Something that enjoys a vast community who are in turn plugged into a sea of smaller relevant communities. It’s incredibly sinister. It’s also incredibly exciting... (Meer) Clearly concerns exist about Steam's user privacy policy, but this also invites us to the think about the economic relationship between gamers and games companies as it is reconfigured through the private contractual relationship established by the EULA which accompanies the digital distribution model. The games industry has established contractual and licensing arrangements with its consumer base in order to support and reincorporate emerging trends in user generated cultures and other cultural formations within its official modes of production (Moore, "Commonising"). When we consider that Valve gets to tax sales of its virtual goods and can further sell the information farmed from its users to hardware manufacturers, it is reasonable to consider the relationship between the corporation and its gamers as exploitative. Gabe Newell, the Valve co-founder and managing director, conversely believes that people are willing to give up personal information if they feel it is being used to get better services (Leahy). If that sentiment is correct then consumers may be willing to further trade for services that can reduce obsolescence and begin to address the problems of e-waste from the ground up. Conclusion Clearly, there is a potential for digital distribution to be a means of not only eliminating the need to physically transport commodities but also supporting consumer practices that further reduce e-waste. For an industry where only a small proportion of the games made break even, the successful relaunch of older games content indicates Steam's capacity to ameliorate software obsolescence. Digital distribution extends the use of commercially released games by providing disintermediated access to older and user-generated content. For Valve, this occurs within a network of exchange as access to user-generated content, social networking services, and support for the organisation and coordination of communities of gamers is traded for user-information and repeat business. Evidence for whether this will actively translate to an equivalent decrease in the obsolescence of game hardware might be observed with indicators like the Steam Hardware Survey in the future. The degree of potential offered by digital distribution is disrupted by a range of technical, commercial and legal hurdles, primary of which is the deployment of DRM, as part of a range of techniques designed to limit consumer behaviour post purchase. While intervention in the form of legislation and radical change to the insidious nature of electronics production is crucial in order to achieve long term reduction in e-waste, the user is currently considered only in terms of 'ethical' consumption and ultimately divested of responsibility through participation in corporate, state and civil recycling and e-waste management operations. The message is either 'careful what you purchase' or 'careful how you throw it away' and, like DRM, ignores the connections between product, producer and user and the consumer support for environmentally, ethically and socially positive production, distribrution, disposal and recycling. This article, has adopted a different strategy, one that sees digital distribution platforms like Steam, as capable, if not currently active, in supporting community practices that should be seriously considered in conjunction with a range of approaches to the challenge of obsolescence and e-waste. References Anderson, Chris. "The Long Tail." Wired Magazine 12. 10 (2004). 20 Apr. 2009 ‹http://www.wired.com/wired/archive/12.10/tail.html›. De Certeau, Michel. The Practice of Everyday Life. Berkeley: U of California P, 1984. Dovey, Jon, and Helen Kennedy. Game Cultures: Computer Games as New Media. London: Open University Press,2006. Fitzpatrick, Kathleen. The Anxiety of Obsolescence. Nashville: Vanderbilt UP, 2008. Flew, Terry. New Media: An Introduction. South Melbourne: Oxford UP, 2008. Leahy, Brian. "Live Blog: DICE 2009 Keynote - Gabe Newell, Valve Software." The Feed. G4TV 18 Feb. 2009. 16 Apr. 2009 ‹http://g4tv.com/thefeed/blog/post/693342/Live-Blog-DICE-2009-Keynote-–-Gabe-Newell-Valve-Software.html›. Meer, Alec. "Unreal Tournament 3 and the New Lazarus Effect." Rock, Paper, Shotgun 16 Mar. 2009. 24 Apr. 2009 ‹http://www.rockpapershotgun.com/2009/03/16/unreal-tournament-3-and-the-new-lazarus-effect/›.Moore, Christopher. "Commonising the Enclosure: Online Games and Reforming Intellectual Property Regimes." Australian Journal of Emerging Technologies and Society 3. 2, (2005). 12 Apr. 2009 ‹http://www.swin.edu.au/sbs/ajets/journal/issue5-V3N2/abstract_moore.htm›. Moore, Christopher. "Creative Choices: Changes to Australian Copyright Law and the Future of the Public Domain." Media International Australia 114 (Feb. 2005): 71–83. Postigo, Hector. "Of Mods and Modders: Chasing Down the Value of Fan-Based Digital Game Modification." Games and Culture 2 (2007): 300-13. Robinson, Daniel. "Windows XP Support Runs Out Next Week." PC Business Authority 8 Apr. 2009. 16 Apr. 2009 ‹http://www.pcauthority.com.au/News/142013,windows-xp-support-runs-out-next-week.aspx›. Straw, Will. "Exhausted Commodities: The Material Culture of Music." Canadian Journal of Communication 25.1 (2000): 175. Slade, Giles. Made to Break: Technology and Obsolescence in America. Cambridge: Harvard UP, 2006. Valve. "Steam and Game Stats." 26 Apr. 2009 ‹http://store.steampowered.com/stats/›. Valve. "Team Fortress 2: The Scout Update." Steam Marketing Message 20 Feb. 2009. 12 Apr. 2009 ‹http://storefront.steampowered.com/Steam/Marketing/message/2269/›. Webb, Richard. "Online Shopping and the Harry Potter Effect." New Scientist 2687 (2008): 52-55. 16 Apr. 2009 ‹http://www.newscientist.com/article/mg20026873.300-online-shopping-and-the-harry-potter-effect.html?page=2›. With thanks to Dr Nicola Evans and Dr Frances Steel for their feedback and comments on drafts of this paper.
APA, Harvard, Vancouver, ISO, and other styles
24

Scannell, John. "Becoming-City." M/C Journal 5, no. 2 (May 1, 2002). http://dx.doi.org/10.5204/mcj.1951.

Full text
Abstract:
Graffiti remains a particularly resilient aspect of the contemporary urban landscape and as a pillar of Hip-Hop culture enjoys an enduring popularity as a subject of academic inquiry.1 As the practice of graffiti is so historically broad it is within the context of Hip-Hop culture that I will limit my observations. In this tradition, graffiti is often rationalised as either a rebellious attempt at territorial reclamation by an alienated subculture or reduced to a practice of elaborate attention seeking. This type of account is offered in titles such as Nelson George's Hip-Hop America (George 1998, 14-15) and David Toop's Rap Attack series (Toop 2000, 11-14). Whilst I am in accord with their respective analyses of graffiti's role as a territorial practice, these discussions concentrate on graffiti's social significance and neglect the immanent logistical processes that precede artistic practice. A Deleuze-Guattarian approach would emphasise the process over the final product, as they believe, '[w]riting has nothing to do with signifying. It has to do with surveying, mapping, even realms that are yet to come' (Deleuze and Guattari 1987, 4-5).2 This undermines the self-contained approach to graffiti as artistic signification and offers a more encompassing approach to investigating the graffiti writers' desire to physically connect with the architecture of the city. It was William Upski Wimsatt's 'underground bestseller' Bomb the Suburbs that inspired my Deleuze-Guattarian perspective on the processes behind graffiti. After reading the testimonies of the author and his peers about the niceties of underground graffiti writing, I was struck by the profound affective relations to technology they described. Many discussions of graffiti, academic or otherwise, relegate the artists' exploration of the urban environment and its technologies to be of secondary importance to the production of the artwork itself. Wimsatt's affectionate account of a city discovered via graffiti writing appeared to have resonance with the Deleuze-Guattarian concept of 'becoming'. For Deleuze (both alone and in conjunction with Felix Guattari), the concept of 'becoming' was a complex redefinition, or perhaps destruction, of the traditional dichotomy between 'subject' and 'object'. Baring in mind that this concept was developed across the breadth of his work, here I offer a concise, and perhaps more readily accessible definition of 'becoming' from Claire Colebrook's Gilles Deleuze: 'The human becomes more than itself - by becoming-hybrid with what is not itself. This creates 'lines of flight'; from life itself we imagine all the becomings of life, using the human power of imagination to overcome the human' (Colebrook 2001, 129). Using 'becoming' as a conceptual approach provides a rather more productive consideration of the graffiti writers' endeavours rather than simply reducing their status to simple archetypes such as 'criminal', 'rebel' or even 'visual artist'. In this way we could look at their ongoing and active engagement with the city's architecture as an ongoing 'becoming' with urban technologies. This is manifest in the graffiti writers' willingness to break the law and even risk physical danger in order to find new ways of moving about the city. Bomb the Suburbs outlines the trials and tribulations of Chicago based, 'old school' graffiti artist Wimsatt who writes about his first-hand observations on the decaying urban environment within major US cities. Bomb the Suburbs is both a handbook of Hip-Hop culture, as well as an astute piece of social analysis. Wimsatt's approach is self-consciously provocative, and shining through all the revolutionary rhetoric is essentially a love affair with the city and its technologies. 'As a writer, there is nothing I love better, nowhere in the city I love more, than the CTA (Chicago Transit Authority). Whether it's climbing on the tracks, playing in the tunnels, or just chillin' in between cars, I think of the CTA as my personal jungle gym. The fact is, we graffiti writers have a very close relationship with the train lines. Yet it is our goal to fuck them up' (Wimsatt 1994, 143). Such an extraordinary physical relationship with the city's technology obviously surpasses the general public's more mundane interactions. The amount of dedication required by the graffiti writers to scale buildings, trains and bridges, obviously goes beyond a mere desire of exposure for their art. Hence I regard the writers as having perhaps the strongest affective bond with the city of any resident, as their pioneering of unorthodox navigational feats requires a level of commitment that far exceeds the rest of the population. Thus the artistry justifies the means of the exploratory process and the graffiti merely serves as a premise to interact with the city's architecture. Wimsatt's enthusiastic account of the CTA infers the desire to realise new interactions that surpass the rather more average ambition of getting on and off at the right stops. An inordinate amount of attention to potential vehicles of exposure, such as the city's rail system becomes a requirement of any self-respecting graffiti writer. Hence they acquire an intricate knowledge of the logistical processes that keep the city's transportation system ticking over. Detailed knowledge of platforms, schedules, right up to employee shift changes are necessary and each of these aspects in turn open out into a variety of assemblages that offer insight into the inner workings of the city. Unfortunately for these urban explorers, their unorthodox interactions with the city architecture are invariably considered 'illegal', and reminiscent of the Foucauldian assertion, the transgression of law only adds to affective investment. This transgression of 'the law', also offers potential for new becomings, and the graffiti writers, in turn, acquire a 'virtual' nature as 'becoming-criminal' or 'becoming-hero', even perhaps perpetuating the struggle for an alternative 'becoming-law'. Hence the dour reflection at the end of Wimsatt's quote which highlights his exasperation over the underlying political tensions that conspire toward his beloved rail system's destruction. It is perhaps the barriers, both physical and legal that are placed between the writers and their beloved lines, which fosters the type of emotional displacement that incites such revenge. To prove that the law can't contain their desire, the writers ironically destroy the city's property so that the technology will forever bear the mark of their challenge. Wimsatt doesn't advocate this destruction, but rather he is trying to implore other writers to see the error of their ways, 'If we love trains, then bombing the CTA is biting the hand that feeds us' (Wimsatt 1994, 143). His idealistic alternative is to 'bomb the suburbs' (for the uninitiated the bombing they refer to is of the acrylic as opposed to the explosive kind) to symbolically deflect attention from the rail yards and into the homes of the indifferent. 'Bomb The Suburbs means let's celebrate the city. Let's celebrate the ghetto and the few people who aren't running away from it. Let's stop fucking up the city. Let's stop fucking up the ghetto. Let's start defending it and making it work for us' (11). Emphasising the division between the urban and suburban way of life, Wimsatt beckons graffiti writers to 'bomb the suburbs' in what I perceive, as an unorthodox means of inclusion. This call to violate suburban property is purely a scare tactic, an avenue that Wimsatt admits he is not keen to explore (143). This contempt for the suburbs is directed at what is perceived as its residents' collective escape from an inclusive dialogue. The graffiti artists are frustrated over the suburban residents' economic control of their inner city space and they have no accessible political vehicle to voice this complaint. In the minds of the graffiti writers, the suburban population is ungrateful, as the technology such as the CTA is taken for granted, or not even used at all. Wimsatt hates the insular culture of the car owning commuters that symbolise the suburban condition. They are deemed to pollute the city and will subsequently be the first to retreat from any adversity as their collective goal has been to acquire the means to take an out of sight, out of mind approach to urban life. Thus, Wimsatt blames the suburban population for the continuing malaise suffered by inner city residents. Their collective exodus to the suburbs has negatively impacted on city funding and continues to erode the quality of life of its inhabitants. Wimsatt's admonition of the suburban condition begins in the introduction on the front cover of the book stating, 'The suburbs is more than just an unfortunate geographical location, it is an unfortunate state-of-mind. It's the American state-of-mind, founded on fear, conformity, shallowness of character, and dullness of imagination.' Yet Wimsatt would have difficulty convincing his posse of writers to 'bomb the suburbs' for a solely political purpose as the attributes of the city that make it so accessible conversely makes the suburbs logistically difficult to conquer. By his own admission the pleasure of graffiti writing lies in the thrill of exploring the city's architecture as this process in its entirety forms an affective assemblage. For Deleuze and Guattari these 'affects are becomings' (Deleuze and Guattari 1987, 256), perhaps simply understood as the affective intensities that influence our movement through the world, and this is how the graffiti writers integrate themselves into the matrix of the city assemblage. Furthermore, Deleuze and Guattari offer that art consists of blocs of affects and percepts and that its role is to draw attention to these processes (Deleuze and Guattari 1994, 163-199), '[a]ffects are sensible experiences in their singularity, liberated from organising systems of representation' (Colebrook 2001, 22). Thus graffiti operates on a purely affective level and the works of its anonymous authors, whose collective texts are often indecipherable, appear to have little cultural relevance to the general public. This is demonstrative of a Deleuze-Guattarian reading where graffiti's significance as 'writing' is actually negligible. The pragmatic significance of graffiti in terms of territorial marking is its role as a refrain, providing infinite transference of signification. The refrains create relations of corresponding affective assemblages and in this way the graffiti is able to generate a range of audience positions. Whilst it may indicate signify a hostile environment for some, it similarly provides information to others or is perhaps merely treated with indifference. To this extent the recollections of Wimsatt and his peers recall Deleuzean empiricism and its 'commitment to experience,' as '[o]ne way of thinking empiricism is to see all life as a flow and connection of interacting bodies, or 'desiring machines'. These connections form regularities, which can then be organised through 'social machines' (Colebrook 2001, 89). Graffiti consciously draws attention to its procedure thus creating corresponding affective assemblages, and the ensuing relations inform audience opinions. Many would contend that graffiti is inherently destructive and would necessarily disagree with my claim that it derives from a love of the city. Dissenting opinion is invariably based on relative aesthetic merits and as a result will always be inconclusive. The only thing that can be tangibly measured is the ownership of capital and in this context graffiti will always remain the visual sign of a losing battle. Graffiti is the evidence of its writers' respective status as 'ghosts in the machine'. Presented in terms of information theory, we could view graffiti as feedback, either signal or noise depending on how you are positioned. As a permanent fixture of the urban environment it is indicative of a city that is all but running smoothly. The nature of this underlying antagonism is elaborated in Houston A Baker jr's Black Studies, Rap and the Academy where graffiti is 'perceived as the ethnic pollution of public space' by the 'other' (Baker 1993, 43). Baker then proceeds to the heart of the matter, questioning the values inherent in the regulation of public space, 'the contest was urbanely proprietorial: Who owns the public spaces? What constitutes information and what constitutes noise? Just what is visually and audibly pure and what precisely is noise pollution or graffiti?'. He contends that community opinion over such aesthetic maintenance of the public space will continue to be dominated by corporate capital. 'Urban public spaces of the late twentieth century are spaces of audiovisual contest. It's something like this: My billboards and neon and handbills and high-decibel-level television advertising are purely for the public good. Your boom boxes and graffiti are evil pollutants. Erase them, shut them down! (43)' Graffiti writers are fully aware that any attempt for consensus over aesthetics is futile as the urban subcultures have little political clout. Their ongoing battle is a vain attempt at seeking alternate ways to access this public space and will continue to sustain casualties both architectural and human. Thus the visibility of graffiti on a train line provides an affective assemblage that is as intrinsic to the network as the tracks themselves. As public property3 the railway is installed to serve the collective population and graffiti writers, it can be argued, just seek to use it in an unorthodox manner. Their work is undoubtedly just as creative and perhaps less objectionable than most billboard ads. Advertising on the other hand, represents the collusion of private property ownership that informs public opinion. This view perpetuates the 'reasonable' assumption that advertisements are an acceptable use of the public space based on the 'logic' that they are spatially contained and regulated by capital. Alienated from that sphere of capital ownership, graffiti impinges on this private stranglehold of public aesthetics. In this capacity graffiti artists invite a momentary existential awakening, drawing attention to our internalised self-regulation. It is such conditioning that in turn may provoke us to mouth an obligatory 'tut tut'. Yet, running into this visual 'other' requires self-reflection, caught up in our daily routine we are oblivious to our physical surroundings and only realise what we are missing when it has been tampered with. The writers' unorthodox interaction with city architecture questions our fetishizing of blank walls, and our instilled lack of practical interaction with our surrounds. Nevertheless, the reality is that graffiti signifies to a large percentage of the population a sense of danger, a side effect that Wimsatt is indeed aware and is trying to discourage. Bomb the Suburbs is concerned with mapping out relations within the city's delicate ecosystem and how the mere act of graffiti affects a feedback loop that ends up in the pockets of the corporates: 'Every time we fat cap an outside, or even scratch-bomb a window, we've got guys with last names like Ford, Toyota, and Isuzu with us all the way, cheering us on - we're helping them fuck up public transportation for free' (Wimsatt 1994, 142). So the more graffiti, the fewer people ride the subway and will instead continue to buy cars and perpetuate the urban/suburban divide. Wimsatt and his peers are embittered that those who actually own most of the city care so little about it that they leave for the suburbs every night, to retreat from the 'urban noise' epitomised by graffiti culture to one of secluded suburban silence. Hence Wimsatt's enthusiasm for a communal project of graffiti led urban renewal believing it will liven up neglected and plain forgotten parts of the city (104). He goes out of his way to visit the more ravaged and neglected cities in the US, dreaming of how graffiti could help promote reinvestment, both emotional and financial, back into the heart of the city. Wimsatt also realises this can only be achieved with the grass roots support of the graffiti writing community themselves. 'I'm not even going to talk about the train yards. Yes, they're easy, but you're not allowed to bomb them as a personal favor to me. Cleveland is struggling not to become another Detroit and scare all its capital off to the suburbs. If you're going to do graffiti in Cleveland, do it to help Cleveland back up, not to kick it while it's down' (43). Yet his vision of urban renewal is one that scorns permission for legal designs (113) as the impetus for this project must derive organically from the graffiti writers' collective process of observation via urban exploration. For them, legal design defeats the purpose of this empirical process, and for this reason the artists believe there is no challenge in doing 'pieces' in the easy spots as a necessary part of the process requires the 'becoming' with the urban environment. The graffiti writers' lifestyle is itself an experimental project intended as a direct challenge on the 'conventional' epitomised by suburban existence. The graffiti markings operate as Deleuze-Guattarian 'lines of flight' that indicate that there are alternate ways of moving about the city, replete with a set of refrains to indicate the existence of a suitably alternative culture. We are aware that the smooth running of the urban capitalist machine requires the striations that demarcate no-go areas and territories forbidden to pubic access. To paraphrase Deleuze and Guattari, that in order to run smoothly, you have to striate, and there is a lot of wasted space created in the process. The graffiti writers merely seek to claw back these neglected territories. Notes 1. The following list is provided as a guide, and is by no means considered exhaustive, of some of the key texts employed in my research: Castleman, Craig. Getting Up: Subway Graffiti in New York. New York: MIT Press, 1984; Chalfant, Henry, and James Prigoff. Spraycan Art. New York, N.Y.: Thames and Hudson, 1987; Baker, Houston A. Black Studies, Rap, and the Academy. Black Literature and Culture. Chicago: University of Chicago Press, 1993; Wimsatt, William 'Upski'. Bomb the Suburbs. New York: Soft Skull Press, 1994; George, Nelson. Hip Hop America. London: Penguin, 1998; Poschardt, Ulf. DJ Culture. Trans. Shaun Whiteside. London: Quartet Books, 1998; Light, Alan. The Vibe History of Hip Hop. Three Rivers Press, New York, 1999; Ogg, Alex, and David Upshal. The Hip-Hop Years: A History of Rap. London: Channel 4 Books, 1999; Toop, David. Rap Attack # 3: African Rap to Global Hip Hop. London: Serpent's Tail, 2000; Gonzales, Michael A. 'Hip-Hop Nation: From Rockin' the House to Planet Rock' in Crossroads. Seattle, Marquand Books, 2000. 2. Note: The relation of this quote to the practice of graffiti writing was previously outlined in Richard Higgins article 'Machines, Big and Little' available at http://www.arts.monash.edu.au/gsandss/sl... My discovery of this essay occurred during my research and whilst my own analysis takes a different approach I am obviously compelled to acknowledge my familiarity with this excellent piece of work. 3. Although this situation is rapidly changing as railway's status as public property is being slowly compromised as its running is increasingly handled by the private sector. References Baker, Houston A. jr. (1993) Black Studies, Rap, and the Academy. Black Literature and Culture. Chicago: University of Chicago Press. Castleman, Craig. (1984) Getting Up: Subway Graffiti in New York. New York: MIT Press. Chalfant, Henry, and James Prigoff. (1987) Spraycan Art. New York, N.Y.: Thames and Hudson. Colebrook, Claire. (2001) Gilles Deleuze. London: Routledge. Deleuze, Gilles, and Félix Guattari. (1987) A Thousand Plateaus: Capitalism and Schizophrenia. Trans. Brian Massumi. London: Athlone Press. Deleuze, Gilles and Félix Guattari. (1994) What Is Philosophy? Trans. Hugh Tomlinson and Graham Burchill. New York: Columbia University Press. George, Nelson. (1998) Hip Hop America. London: Penguin. Gonzales, Michael A. (2000) 'Hip-Hop Nation: From Rockin' the House to Planet Rock.' Crossroads. Seattle: Marquand Books. Light, Alan. (1999) The Vibe History of Hip Hop. Three Rivers Press, New York. Ogg, Alex, and David Upshal. (1999) The Hip-Hop Years: A History of Rap. London: Channel 4 Books. Poschardt, Ulf. (1998) DJ Culture. Trans. Shaun Whiteside. London: Quartet Books. Toop, David. (2000) Rap Attack # 3: African Rap to Global Hip Hop. London: Serpent's Tail. Wimsatt, William. (1994) 'Upski'. Bomb the Suburbs. New York: Soft Skull Press. Links http://www.arts.monash.edu.au/gsandss/slavic/papers/rhizome.html. Citation reference for this article MLA Style Scannell, John. "Becoming-City" M/C: A Journal of Media and Culture 5.2 (2002). [your date of access] < http://www.media-culture.org.au/0205/becoming.php>. Chicago Style Scannell, John, "Becoming-City" M/C: A Journal of Media and Culture 5, no. 2 (2002), < http://www.media-culture.org.au/0205/becoming.php> ([your date of access]). APA Style Bennett, Simon A.. (2002) A City Divided. M/C: A Journal of Media and Culture 5(2). < http://www.media-culture.org.au/0205/divided.php> ([your date of access]).
APA, Harvard, Vancouver, ISO, and other styles
25

Hutcheon, Linda. "In Defence of Literary Adaptation as Cultural Production." M/C Journal 10, no. 2 (May 1, 2007). http://dx.doi.org/10.5204/mcj.2620.

Full text
Abstract:
Biology teaches us that organisms adapt—or don’t; sociology claims that people adapt—or don’t. We know that ideas can adapt; sometimes even institutions can adapt. Or not. Various papers in this issue attest in exciting ways to precisely such adaptations and maladaptations. (See, for example, the articles in this issue by Lelia Green, Leesa Bonniface, and Tami McMahon, by Lexey A. Bartlett, and by Debra Ferreday.) Adaptation is a part of nature and culture, but it’s the latter alone that interests me here. (However, see the article by Hutcheon and Bortolotti for a discussion of nature and culture together.) It’s no news to anyone that not only adaptations, but all art is bred of other art, though sometimes artists seem to get carried away. My favourite example of excess of association or attribution can be found in the acknowledgements page to a verse drama called Beatrice Chancy by the self-defined “maximalist” (not minimalist) poet, novelist, librettist, and critic, George Elliot Clarke. His selected list of the incarnations of the story of Beatrice Cenci, a sixteenth-century Italian noblewoman put to death for the murder of her father, includes dramas, romances, chronicles, screenplays, parodies, sculptures, photographs, and operas: dramas by Vincenzo Pieracci (1816), Percy Bysshe Shelley (1819), Juliusz Slowacki (1843), Waldter Landor (1851), Antonin Artaud (1935) and Alberto Moravia (1958); the romances by Francesco Guerrazi (1854), Henri Pierangeli (1933), Philip Lindsay (1940), Frederic Prokosch (1955) and Susanne Kircher (1976); the chronicles by Stendhal (1839), Mary Shelley (1839), Alexandre Dumas, père (1939-40), Robert Browning (1864), Charles Swinburne (1883), Corrado Ricci (1923), Sir Lionel Cust (1929), Kurt Pfister (1946) and Irene Mitchell (1991); the film/screenplay by Bertrand Tavernier and Colo O’Hagan (1988); the parody by Kathy Acker (1993); the sculpture by Harriet Hosmer (1857); the photograph by Julia Ward Cameron (1866); and the operas by Guido Pannain (1942), Berthold Goldschmidt (1951, 1995) and Havergal Brian (1962). (Beatrice Chancy, 152) He concludes the list with: “These creators have dallied with Beatrice Cenci, but I have committed indiscretions” (152). An “intertextual feast”, by Clarke’s own admission, this rewriting of Beatrice’s story—especially Percy Bysshe Shelley’s own verse play, The Cenci—illustrates brilliantly what Northrop Frye offered as the first principle of the production of literature: “literature can only derive its form from itself” (15). But in the last several decades, what has come to be called intertextuality theory has shifted thinking away from looking at this phenomenon from the point of view of authorial influences on the writing of literature (and works like Harold Bloom’s famous study of the Anxiety of Influence) and toward considering our readerly associations with literature, the connections we (not the author) make—as we read. We, the readers, have become “empowered”, as we say, and we’ve become the object of academic study in our own right. Among the many associations we inevitably make, as readers, is with adaptations of the literature we read, be it of Jane Austin novels or Beowulf. Some of us may have seen the 2006 rock opera of Beowulf done by the Irish Repertory Theatre; others await the new Neil Gaiman animated film. Some may have played the Beowulf videogame. I personally plan to miss the upcoming updated version that makes Beowulf into the son of an African explorer. But I did see Sturla Gunnarsson’s Beowulf and Grendel film, and yearned to see the comic opera at the Lincoln Centre Festival in 2006 called Grendel, the Transcendence of the Great Big Bad. I am not really interested in whether these adaptations—all in the last year or so—signify Hollywood’s need for a new “monster of the week” or are just the sign of a desire to cash in on the success of The Lord of the Rings. For all I know they might well act as an ethical reminder of the human in the alien in a time of global strife (see McGee, A4). What interests me is the impact these multiple adaptations can have on the reader of literature as well as on the production of literature. Literature, like painting, is usually thought of as what Nelson Goodman (114) calls a one-stage art form: what we read (like what we see on a canvas) is what is put there by the originating artist. Several major consequences follow from this view. First, the implication is that the work is thus an original and new creation by that artist. However, even the most original of novelists—like Salman Rushdie—are the first to tell you that stories get told and retold over and over. Indeed his controversial novel, The Satanic Verses, takes this as a major theme. Works like the Thousand and One Nights are crucial references in all of his work. As he writes in Haroun and the Sea of Stories: “no story comes from nowhere; new stories are born of old” (86). But illusion of originality is only one of the implications of seeing literature as a one-stage art form. Another is the assumption that what the writer put on paper is what we read. But entire doctoral programs in literary production and book history have been set up to study how this is not the case, in fact. Editors influence, even change, what authors want to write. Designers control how we literally see the work of literature. Beatrice Chancy’s bookend maps of historical Acadia literally frame how we read the historical story of the title’s mixed-race offspring of an African slave and a white slave owner in colonial Nova Scotia in 1801. Media interest or fashion or academic ideological focus may provoke a publisher to foreground in the physical presentation different elements of a text like this—its stress on race, or gender, or sexuality. The fact that its author won Canada’s Governor General’s Award for poetry might mean that the fact that this is a verse play is emphasised. If the book goes into a second edition, will a new preface get added, changing the framework for the reader once again? As Katherine Larson has convincingly shown, the paratextual elements that surround a work of literature like this one become a major site of meaning generation. What if literature were not a one-stage an art form at all? What if it were, rather, what Goodman calls “two-stage” (114)? What if we accept that other artists, other creators, are needed to bring it to life—editors, publishers, and indeed readers? In a very real and literal sense, from our (audience) point of view, there may be no such thing as a one-stage art work. Just as the experience of literature is made possible for readers by the writer, in conjunction with a team of professional and creative people, so, arguably all art needs its audience to be art; the un-interpreted, un-experienced art work is not worth calling art. Goodman resists this move to considering literature a two-stage art, not at all sure that readings are end products the way that performance works are (114). Plays, films, television shows, or operas would be his prime examples of two-stage arts. In each of these, a text (a playtext, a screenplay, a score, a libretto) is moved from page to stage or screen and given life, by an entire team of creative individuals: directors, actors, designers, musicians, and so on. Literary adaptations to the screen or stage are usually considered as yet another form of this kind of transcription or transposition of a written text to a performance medium. But the verbal move from the “book” to the diminutive “libretto” (in Italian, little book or booklet) is indicative of a view that sees adaptation as a step downward, a move away from a primary literary “source”. In fact, an entire negative rhetoric of “infidelity” has developed in both journalistic reviewing and academic discourse about adaptations, and it is a morally loaded rhetoric that I find surprising in its intensity. Here is the wonderfully critical description of that rhetoric by the king of film adaptation critics, Robert Stam: Terms like “infidelity,” “betrayal,” “deformation,” “violation,” “bastardisation,” “vulgarisation,” and “desecration” proliferate in adaptation discourse, each word carrying its specific charge of opprobrium. “Infidelity” carries overtones of Victorian prudishness; “betrayal” evokes ethical perfidy; “bastardisation” connotes illegitimacy; “deformation” implies aesthetic disgust and monstrosity; “violation” calls to mind sexual violence; “vulgarisation” conjures up class degradation; and “desecration” intimates religious sacrilege and blasphemy. (3) I join many others today, like Stam, in challenging the persistence of this fidelity discourse in adaptation studies, thereby providing yet another example of what, in his article here called “The Persistence of Fidelity: Adaptation Theory Today,” John Connor has called the “fidelity reflex”—the call to end an obsession with fidelity as the sole criterion for judging the success of an adaptation. But here I want to come at this same issue of the relation of adaptation to the adapted text from another angle. When considering an adaptation of a literary work, there are other reasons why the literary “source” text might be privileged. Literature has historical priority as an art form, Stam claims, and so in some people’s eyes will always be superior to other forms. But does it actually have priority? What about even earlier performative forms like ritual and song? Or to look forward, instead of back, as Tim Barker urges us to do in his article here, what about the new media’s additions to our repertoire with the advent of electronic technology? How can we retain this hierarchy of artistic forms—with literature inevitably on top—in a world like ours today? How can both the Romantic ideology of original genius and the capitalist notion of individual authorship hold up in the face of the complex reality of the production of literature today (as well as in the past)? (In “Amen to That: Sampling and Adapting the Past”, Steve Collins shows how digital technology has changed the possibilities of musical creativity in adapting/sampling.) Like many other ages before our own, adaptation is rampant today, as director Spike Jonze and screenwriter Charlie Kaufman clearly realised in creating Adaptation, their meta-cinematic illustration-as-send-up film about adaptation. But rarely has a culture denigrated the adapter as a secondary and derivative creator as much as we do the screenwriter today—as Jonze explores with great irony. Michelle McMerrin and Sergio Rizzo helpfully explain in their pieces here that one of the reasons for this is the strength of auteur theory in film criticism. But we live in a world in which works of literature have been turned into more than films. We now have literary adaptations in the forms of interactive new media works and videogames; we have theme parks; and of course, we have the more common television series, radio and stage plays, musicals, dance works, and operas. And, of course, we now have novelisations of films—and they are not given the respect that originary novels are given: it is the adaptation as adaptation that is denigrated, as Deborah Allison shows in “Film/Print: Novelisations and Capricorn One”. Adaptations across media are inevitably fraught, and for complex and multiple reasons. The financing and distribution issues of these widely different media alone inevitably challenge older capitalist models. The need or desire to appeal to a global market has consequences for adaptations of literature, especially with regard to its regional and historical specificities. These particularities are what usually get adapted or “indigenised” for new audiences—be they the particularities of the Spanish gypsy Carmen (see Ioana Furnica, “Subverting the ‘Good, Old Tune’”), those of the Japanese samurai genre (see Kevin P. Eubanks, “Becoming-Samurai: Samurai [Films], Kung-Fu [Flicks] and Hip-Hop [Soundtracks]”), of American hip hop graffiti (see Kara-Jane Lombard, “‘To Us Writers, the Differences Are Obvious’: The Adaptation of Hip Hop Graffiti to an Australian Context”) or of Jane Austen’s fiction (see Suchitra Mathur, “From British ‘Pride’ to Indian ‘Bride’: Mapping the Contours of a Globalised (Post?)Colonialism”). What happens to the literary text that is being adapted, often multiple times? Rather than being displaced by the adaptation (as is often feared), it most frequently gets a new life: new editions of the book appear, with stills from the movie adaptation on its cover. But if I buy and read the book after seeing the movie, I read it differently than I would have before I had seen the film: in effect, the book, not the adaptation, has become the second and even secondary text for me. And as I read, I can only “see” characters as imagined by the director of the film; the cinematic version has taken over, has even colonised, my reader’s imagination. The literary “source” text, in my readerly, experiential terms, becomes the secondary work. It exists on an experiential continuum, in other words, with its adaptations. It may have been created before, but I only came to know it after. What if I have read the literary work first, and then see the movie? In my imagination, I have already cast the characters: I know what Gabriel and Gretta Conroy of James Joyce’s story, “The Dead,” look and sound like—in my imagination, at least. Then along comes John Huston’s lush period piece cinematic adaptation and the director superimposes his vision upon mine; his forcibly replaces mine. But, in this particular case, Huston still arguably needs my imagination, or at least my memory—though he may not have realised it fully in making the film. When, in a central scene in the narrative, Gabriel watches his wife listening, moved, to the singing of the Irish song, “The Lass of Aughrim,” what we see on screen is a concerned, intrigued, but in the end rather blank face: Gabriel doesn’t alter his expression as he listens and watches. His expression may not change—but I know exactly what he is thinking. Huston does not tell us; indeed, without the use of voice-over, he cannot. And since the song itself is important, voice-over is impossible. But I know exactly what he is thinking: I’ve read the book. I fill in the blank, so to speak. Gabriel looks at Gretta and thinks: There was grace and mystery in her attitude as if she were a symbol of something. He asked himself what is a woman standing on the stairs in the shadow, listening to distant music, a symbol of. If he were a painter he would paint her in that attitude. … Distant Music he would call the picture if he were a painter. (210) A few pages later the narrator will tell us: At last she turned towards them and Gabriel saw that there was colour on her cheeks and that her eyes were shining. A sudden tide of joy went leaping out of his heart. (212) This joy, of course, puts him in a very different—disastrously different—state of mind than his wife, who (we later learn) is remembering a young man who sang that song to her when she was a girl—and who died, for love of her. I know this—because I’ve read the book. Watching the movie, I interpret Gabriel’s blank expression in this knowledge. Just as the director’s vision can colonise my visual and aural imagination, so too can I, as reader, supplement the film’s silence with the literary text’s inner knowledge. The question, of course, is: should I have to do so? Because I have read the book, I will. But what if I haven’t read the book? Will I substitute my own ideas, from what I’ve seen in the rest of the film, or from what I’ve experienced in my own life? Filmmakers always have to deal with this problem, of course, since the camera is resolutely externalising, and actors must reveal their inner worlds through bodily gesture or facial expression for the camera to record and for the spectator to witness and comprehend. But film is not only a visual medium: it uses music and sound, and it also uses words—spoken words within the dramatic situation, words overheard on the street, on television, but also voice-over words, spoken by a narrating figure. Stephen Dedalus escapes from Ireland at the end of Joseph Strick’s 1978 adaptation of Joyce’s A Portrait of the Artist as a Young Man with the same words as he does in the novel, where they appear as Stephen’s diary entry: Amen. So be it. Welcome, O life! I go to encounter for the millionth time the reality of experience and to forge in the smithy of my soul the uncreated conscience of my race. … Old father, old artificer, stand me now and ever in good stead. (253) The words from the novel also belong to the film as film, with its very different story, less about an artist than about a young Irishman finally able to escape his family, his religion and his country. What’s deliberately NOT in the movie is the irony of Joyce’s final, benign-looking textual signal to his reader: Dublin, 1904 Trieste, 1914 The first date is the time of Stephen’s leaving Dublin—and the time of his return, as we know from the novel Ulysses, the sequel, if you like, to this novel. The escape was short-lived! Portrait of the Artist as a Young Man has an ironic structure that has primed its readers to expect not escape and triumph but something else. Each chapter of the novel has ended on this kind of personal triumphant high; the next has ironically opened with Stephen mired in the mundane and in failure. Stephen’s final words in both film and novel remind us that he really is an Icarus figure, following his “Old father, old artificer”, his namesake, Daedalus. And Icarus, we recall, takes a tumble. In the novel version, we are reminded that this is the portrait of the artist “as a young man”—later, in 1914, from the distance of Trieste (to which he has escaped) Joyce, writing this story, could take some ironic distance from his earlier persona. There is no such distance in the film version. However, it stands alone, on its own; Joyce’s irony is not appropriate in Strick’s vision. His is a different work, with its own message and its own, considerably more romantic and less ironic power. Literary adaptations are their own things—inspired by, based on an adapted text but something different, something other. I want to argue that these works adapted from literature are now part of our readerly experience of that literature, and for that reason deserve the same attention we give to the literary, and not only the same attention, but also the same respect. I am a literarily trained person. People like me who love words, already love plays, but shouldn’t we also love films—and operas, and musicals, and even videogames? There is no need to denigrate words that are heard (and visualised) in order to privilege words that are read. Works of literature can have afterlives in their adaptations and translations, just as they have pre-lives, in terms of influences and models, as George Eliot Clarke openly allows in those acknowledgements to Beatrice Chancy. I want to return to that Canadian work, because it raises for me many of the issues about adaptation and language that I see at the core of our literary distrust of the move away from the written, printed text. I ended my recent book on adaptation with a brief examination of this work, but I didn’t deal with this particular issue of language. So I want to return to it, as to unfinished business. Clarke is, by the way, clear in the verse drama as well as in articles and interviews that among the many intertexts to Beatrice Chancy, the most important are slave narratives, especially one called Celia, a Slave, and Shelley’s play, The Cenci. Both are stories of mistreated and subordinated women who fight back. Since Clarke himself has written at length about the slave narratives, I’m going to concentrate here on Shelley’s The Cenci. The distance from Shelley’s verse play to Clarke’s verse play is a temporal one, but it is also geographic and ideological one: from the old to the new world, and from a European to what Clarke calls an “Africadian” (African Canadian/African Acadian) perspective. Yet both poets were writing political protest plays against unjust authority and despotic power. And they have both become plays that are more read than performed—a sad fate, according to Clarke, for two works that are so concerned with voice. We know that Shelley sought to calibrate the stylistic registers of his work with various dramatic characters and effects to create a modern “mixed” style that was both a return to the ancients and offered a new drama of great range and flexibility where the expression fits what is being expressed (see Bruhn). His polemic against eighteenth-century European dramatic conventions has been seen as leading the way for realist drama later in the nineteenth century, with what has been called its “mixed style mimesis” (Bruhn) Clarke’s adaptation does not aim for Shelley’s perfect linguistic decorum. It mixes the elevated and the biblical with the idiomatic and the sensual—even the vulgar—the lushly poetic with the coarsely powerful. But perhaps Shelley’s idea of appropriate language fits, after all: Beatrice Chancy is a woman of mixed blood—the child of a slave woman and her slave owner; she has been educated by her white father in a convent school. Sometimes that educated, elevated discourse is heard; at other times, she uses the variety of discourses operative within slave society—from religious to colloquial. But all the time, words count—as in all printed and oral literature. Clarke’s verse drama was given a staged reading in Toronto in 1997, but the story’s, if not the book’s, real second life came when it was used as the basis for an opera libretto. Actually the libretto commission came first (from Queen of Puddings Theatre in Toronto), and Clarke started writing what was to be his first of many opera texts. Constantly frustrated by the art form’s demands for concision, he found himself writing two texts at once—a short libretto and a longer, five-act tragic verse play to be published separately. Since it takes considerably longer to sing than to speak (or read) a line of text, the composer James Rolfe keep asking for cuts—in the name of economy (too many singers), because of clarity of action for audience comprehension, or because of sheer length. Opera audiences have to sit in a theatre for a fixed length of time, unlike readers who can put a book down and return to it later. However, what was never sacrificed to length or to the demands of the music was the language. In fact, the double impact of the powerful mixed language and the equally potent music, increases the impact of the literary text when performed in its operatic adaptation. Here is the verse play version of the scene after Beatrice’s rape by her own father, Francis Chancey: I was black but comely. Don’t glance Upon me. This flesh is crumbling Like proved lies. I’m perfumed, ruddied Carrion. Assassinated. Screams of mucking juncos scrawled Over the chapel and my nerves, A stickiness, as when he finished Maculating my thighs and dress. My eyes seep pus; I can’t walk: the floors Are tizzy, dented by stout mauling. Suddenly I would like poison. The flesh limps from my spine. My inlets crimp. Vultures flutter, ghastly, without meaning. I can see lice swarming the air. … His scythe went shick shick shick and slashed My flowers; they lay, murdered, in heaps. (90) The biblical and the violent meet in the texture of the language. And none of that power gets lost in the opera adaptation, despite cuts and alterations for easier aural comprehension. I was black but comely. Don’t look Upon me: this flesh is dying. I’m perfumed, bleeding carrion, My eyes weep pus, my womb’s sopping With tears; I can hardly walk: the floors Are tizzy, the sick walls tumbling, Crumbling like proved lies. His scythe went shick shick shick and cut My flowers; they lay in heaps, murdered. (95) Clarke has said that he feels the libretto is less “literary” in his words than the verse play, for it removes the lines of French, Latin, Spanish and Italian that pepper the play as part of the author’s critique of the highly educated planter class in Nova Scotia: their education did not guarantee ethical behaviour (“Adaptation” 14). I have not concentrated on the music of the opera, because I wanted to keep the focus on the language. But I should say that the Rolfe’s score is as historically grounded as Clarke’s libretto: it is rooted in African Canadian music (from ring shouts to spirituals to blues) and in Scottish fiddle music and local reels of the time, not to mention bel canto Italian opera. However, the music consciously links black and white traditions in a way that Clarke’s words and story refuse: they remain stubbornly separate, set in deliberate tension with the music’s resolution. Beatrice will murder her father, and, at the very moment that Nova Scotia slaves are liberated, she and her co-conspirators will be hanged for that murder. Unlike the printed verse drama, the shorter opera libretto functions like a screenplay, if you will. It is not so much an autonomous work unto itself, but it points toward a potential enactment or embodiment in performance. Yet, even there, Clarke cannot resist the lure of words—even though they are words that no audience will ever hear. The stage directions for Act 3, scene 2 of the opera read: “The garden. Slaves, sunflowers, stars, sparks” (98). The printed verse play is full of these poetic associative stage directions, suggesting that despite his protestations to the contrary, Clarke may have thought of that version as one meant to be read by the eye. After Beatrice’s rape, the stage directions read: “A violin mopes. Invisible shovelsful of dirt thud upon the scene—as if those present were being buried alive—like ourselves” (91). Our imaginations—and emotions—go to work, assisted by the poet’s associations. There are many such textual helpers—epigraphs, photographs, notes—that we do not have when we watch and listen to the opera. We do have the music, the staged drama, the colours and sounds as well as the words of the text. As Clarke puts the difference: “as a chamber opera, Beatrice Chancy has ascended to television broadcast. But as a closet drama, it play only within the reader’s head” (“Adaptation” 14). Clarke’s work of literature, his verse drama, is a “situated utterance, produced in one medium and in one historical and social context,” to use Robert Stam’s terms. In the opera version, it was transformed into another “equally situated utterance, produced in a different context and relayed through a different medium” (45-6). I want to argue that both are worthy of study and respect by wordsmiths, by people like me. I realise I’ve loaded the dice: here neither the verse play nor the libretto is primary; neither is really the “source” text, for they were written at the same time and by the same person. But for readers and audiences (my focus and interest here), they exist on a continuum—depending on which we happen to experience first. As Ilana Shiloh explores here, the same is true about the short story and film of Memento. I am not alone in wanting to mount a defence of adaptations. Julie Sanders ends her new book called Adaptation and Appropriation with these words: “Adaptation and appropriation … are, endlessly and wonderfully, about seeing things come back to us in as many forms as possible” (160). The storytelling imagination is an adaptive mechanism—whether manifesting itself in print or on stage or on screen. The study of the production of literature should, I would like to argue, include those other forms taken by that storytelling drive. If I can be forgiven a move to the amusing—but still serious—in concluding, Terry Pratchett puts it beautifully in his fantasy story, Witches Abroad: “Stories, great flapping ribbons of shaped space-time, have been blowing and uncoiling around the universe since the beginning of time. And they have evolved. The weakest have died and the strongest have survived and they have grown fat on the retelling.” In biology as in culture, adaptations reign. References Bloom, Harold. The Anxiety of Influence. New York: Oxford University Press, 1975. Bruhn, Mark J. “’Prodigious Mixtures and Confusions Strange’: The Self-Subverting Mixed Style of The Cenci.” Poetics Today 22.4 (2001). Clarke, George Elliott. “Beatrice Chancy: A Libretto in Four Acts.” Canadian Theatre Review 96 (1998): 62-79. ———. Beatrice Chancy. Victoria, BC: Polestar, 1999. ———. “Adaptation: Love or Cannibalism? Some Personal Observations”, unpublished manuscript of article. Frye, Northrop. The Educated Imagination. Toronto: CBC, 1963. Goodman, Nelson. Languages of Art: An Approach to a Theory of Symbols. Indianapolis: Bobbs-Merrill, 1968. Hutcheon, Linda, and Gary R. Bortolotti. “On the Origin of Adaptations: Rethinking Fidelity Discourse and “Success”—Biologically.” New Literary History. Forthcoming. Joyce, James. Dubliners. 1916. New York: Viking, 1967. ———. A Portrait of the Artist as a Young Man. 1916. Penguin: Harmondsworth, 1960. Larson, Katherine. “Resistance from the Margins in George Elliott Clarke’s Beatrice Chancy.” Canadian Literature 189 (2006): 103-118. McGee, Celia. “Beowulf on Demand.” New York Times, Arts and Leisure. 30 April 2006. A4. Rushdie, Salman. The Satanic Verses. New York: Viking, 1988. ———. Haroun and the Sea of Stories. London: Granta/Penguin, 1990. Sanders, Julie. Adaptation and Appropriation. London and New York: Routledge, 160. Shelley, Percy Bysshe. The Cenci. Ed. George Edward Woodberry. Boston and London: Heath, 1909. Stam, Robert. “Introduction: The Theory and Practice of Adaptation.” Literature and Film: A Guide to the Theory and Practice of Film Adaptation. Oxford: Blackwell, 2005. 1-52. Citation reference for this article MLA Style Hutcheon, Linda. "In Defence of Literary Adaptation as Cultural Production." M/C Journal 10.2 (2007). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0705/01-hutcheon.php>. APA Style Hutcheon, L. (May 2007) "In Defence of Literary Adaptation as Cultural Production," M/C Journal, 10(2). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0705/01-hutcheon.php>.
APA, Harvard, Vancouver, ISO, and other styles
26

Redden, Guy. "Packaging the Gifts of Nation." M/C Journal 2, no. 7 (October 1, 1999). http://dx.doi.org/10.5204/mcj.1800.

Full text
Abstract:
The contemporary supermarket is a work of classification and cataloguing as marvellous as any museum. Barcodes are hallmarks by which its computer systems could know, in their own electronic language, every possible product of a certain kind afoot in the nation. It is a rather special institution in this respect -- a huge fund of contemporary synchronic cultural memory, a database and storehouse of collected human tastes to which individuals turn to seek out their own. However, this means that just as Wittgenstein demonstrated the impossibility of a purely private language, there can be no such thing as a purely private taste. Taste is demonstrated by choosing from a range of public items, that is, products. Therefore let's bracket the liberal concept of sovereign personal taste for now and beat a different track: the supermarket is the site of aggregation of multiple discourses by which the individual is sewn into and sews the fabric of collective life. Techniques used to sell food today, such as freebies (like plastic toys), free offers, forms of gambling, and images of healthiness, convenience, celebrity and enhanced relationships, appeal to -- must appeal to for commercial reasons -- shared values. It is inviting to view the supermarket as an emblem of a postmodern condition. The gaggle of images and words that line its aisles defy unity, play fast and loose with reality, create a simulacral space of copied quotes and sight bites that is coterminous with radically decentred selves. It conforms to the Jamesonian topography of a culture that has lost it -- that sense of real placed history that identity used to be tied up with. But my aim in this essay is to critique such a rhetoric of loss. Discourse remains the province of the self-imaginings of social groups in spite of the diversity of images in circulation. And although the media through which group solidarity is transmitted change with technological developments, the fact of such transmission does not. Hence, by looking at the imagery used on food packets, I will analyse the way that one rhetorical strategy used to sell the food we find on supermarket shelves -- nationalism -- is part of a longstanding cultural trajectory by which citizens of a nation imagine their relationship with their land. This, however, involves the equation of 'the nation' with the ethnic imagery of the group that dominates its political apparatus and territory, a process of circumscription that I shall ultimately suggest has political ramifications, especially in the context of nations like Australia which were formed by largely European settler colonisation of the land. Nationalism, then, is a strand of marketing rhetoric used most often, but not exclusively, for the promotion of products in the country of their origin. As such it grafts a tradition of art commemorating place and ethnic identity into the seemingly unlikely genre of the product label. Indeed, for Benedict Anderson the sociopolitical sentiment of nationalism requires forums and images through which to articulate itself, or more accurately, to imaginatively create its auratic object of adoration -- as nationalism is itself innovative (Anderson 15). It also depends upon technologies that can produce a sense of simultaneity between dispersed people who will never meet each other. The distribution of the packaged 'gifts' of a land to 'its people' provides one such opportunity for the transmission of sacralised images of land and the solidarity of its inhabitants. So the genre of the label that comes with a specific distribution and selling system provides the technical medium, and the land, its produce, its people and their relationships in ecosocial community, form the imagery. A limit case example of pride in the gifts of the land can be found on the label of New Zealand's Steinlager: "New Zealand's Finest ... World's Best Lager ... Brewed with the finest New Zealand Hops, Yeast, Barley and Pure Water ... Since 1854". It embodies a series of associations found in other examples: the products of the land are associated with firstly, high quality, and secondly, natural purity. New Zealand seems to be repeated with two slightly different senses. In its juxtaposition with "the world", the two places centre on the finished product of lager, which is presented as a literally world-beating national product. The last line of the label reads "Brewed and Bottled by New Zealand Breweries Limited", the company name both emphasising the agency of New Zealand people in processing ingredients taken from their land's soil, and the legally New Zealandian status of their enterprise. The second sense implies the physical basis for all this: the giftedness of the land which subtends an economy and a culture. "Since 1854" brings these components together on the axis of continuity, making the origination of national production temporal as well as spatial. In other words this benign relationship of production becomes part of national heritage. A certain double sense is in play. Land is both a nation comprising citizens and physical resource; the word that perfectly fuses the sense of the former's political proprietary relationship with the latter into a working unity. Accordingly many packets transfigure the legal requirement to mention the place of production into an attention-grabbing declaration of country of origin whilst also referring to the physical land. The latter may be parsed into two general categories: imagery of animals, plants, landscapes, the elements, etc, and rustic images of human management of the land. So Bulla ice cream advertises its Australianness to a pastoral backdrop; Saxa salt, which has been "Australia's own ... Since 1911", is being hauled by a hat-wearing Aussie man and loyal horse; Bundaberg caster sugar is both "pure Australian" and "Australian made" thanks to the blessing of the (Australian) sun. And other products, such as Australian Natural Foods Non Dairy Soy Mango Smoothie and Pureland Organic Tofu make links between nation and nature through 'land-based' company names similarly buttressed by images of Australian agricultural landscape and the Australian made hallmark respectively. The three conceptual categories often found in correlation with the concrete particulars of 'the land' -- healthiness, purity and naturalness -- are well represented in the packets analysed here. A series of metonymic implications is set up between the terms. They are all potential qualities of the land that are realised in the products it yields. Pureland and Australian Natural Foods juxtapose nation and healthiness closely and the pastoral visions of Bürgen and Dairy Vale have the approval of the National Heart Foundation. Bundaberg and Pureland make the most direct appeals to purity, but concepts such as Bulla's "Australian made real dairy" and Devondale's "choice grade" and "premium Australian" also convey a certain sense of uncorrupted pedigree in their products' provenance. Most products seem to evoke naturalness pictorially, with green rolling landscapes and cows feeding on the verdure featuring particularly highly. Thus at this point a critique of capitalist industrial culture is possible. The missing links are the contemporary factory and office: the places of the processing and assembly of the product physically and discursively; the places where the fruits of the land meet their packaging and are primed for the marketplace. The gifts of nature become commodities but are inscribed as the gifts of nature still, such that the point of sale obfuscates the point of production: profit. The whole enterprise seems to be based on a principle of distantiation. Because of urbanisation, the vast majority of people live away from farm land, and because most food is not consumed by the local communities that produce it, but is produced for larger markets, it is packed and written upon for transport to strangers who will buy it and perhaps also an idealisation of the land. Yet they aren't strangers. This mediation of group solidarity by food-as-commodity does not tear social bonds apart, it forms them. It forms ecosocial community just as it provides a projection of one. And the very invocation of group loyalty as the reason for buying means we should question, as John Frow has done, whether the commodity is always simply a token of abstraction in conceptual opposition to 'the gift' (Frow, "Gift and Commodity"). It is not simply the case that capitalists dupe consumers into thinking of commodities in gift-like terms. Indeed, the discourses of the land we find on supermarket shelves go back a long way in Western culture. As Raymond Williams says: "in English, 'country' is both a nation and a part of a 'land'; 'the country' can be the whole society or its rural area. In the long history of human settlements, this connection between the land from which directly or indirectly we all get our living and the achievements of human society has been deeply known" (1). The majority of the packets analysed extend the pastoral tradition of European art, a tradition which determines the "innate bounty" (33) of the land as the province of benign, 'total' social relations as reflected in the "timeless rhythm" of the authentic agrarian life (10). But the pastoral tradition is itself a media technical one. Williams points out that "a working country is hardly ever a landscape. The very idea of landscape implies separation and observation" (120). The same is true of pastoral in its nationalistic guise. It is transmitted by books, paintings and packets, is predicated on such a 'separation and observation'. The idealisation of the common land that subtends 'us' may be an attempt to bridge that distance, yet it is, ironically, transmitted through inscribed objects that create bonds between spatially and temporally dispersed people. It achieves what Anderson calls "unisonance", "a special kind of contemporaneous community which language alone suggests -- above all in the form of poetry and songs" (132). So, if the supermarket turns inner desire outward to the realm of public items that provides its possibilities, nationalistic desire moves in the same way, both inside and outside the supermarket context. There is no purely internal or purely external nation, just as there is no private language. Rather cultural memory, whether transmitted by a food packet or a poem is a thread transmitted through selves, language, technological milieux, and groups of people. Thus as Thongchai Winichakul succinctly states, "a nation is not a given reality. Rather it is the effect of imagining about it" (14). "We can know about it as long as we employ certain technologies to inscribe the possible sphere. In turn, such technologies create the knowledge of it, create a fact of it, and the entity comes into existence." (15). The contemporary food packet is one such media technology as certainly as a book or a song, and all media inscriptions of the possible sphere of 'the land' are lived ecosocial experience of the land. They make the land a unity by fusing its first physical sense with its second sociopolitical one. Invocation of the land as a prior given that subtends and provides the continuity of a sociopolitical group that has power over its resources, nests the historical contingency of that power relationship into a secure vision of the provenance of nation with the self-origination of 'its' land. That natural element, free, pure and healthy, is the one in which the group's ownership rights are rooted and legitimated. However, in fact, any nation is itself an historical innovation, an inherently unstable ideological product of strategy, technique, rhetorical and material. Nation-states are not naturally correlative with the land, nor are the ethnic groups that politically dominate the nation. They arise where other socio-economic political organisations existed before; they emerge. In The City and the Country Williams's main concern was to point out an alternative class-based history of the real and largely exploitative management of the land, a history that is actively occluded by idealised renderings of the countryside. Here in a parallel way but without room for explication, I want to suggest an alternative history of the management of the land that is indissociable from the emergence of the modern Australian nation -- a race-based history. Thus, here's the rub: the totems of pastoral that are equated with Australianness in the packets I have referred to, are European. The 'food packet' pastoral idealises group totems such as to transform historically contingent relationships of certain ethnic groups with the land into naturalised ones. The cows of Bulla and Devondale, the pastures of Dairy Vale, Bürgen's wheat, the agricultural infrastructure, the men imaged and their modes of management of the land, are European in lineage, and so is most of the food they sacralise as 'Australian'. These things are not natural to the land but were introduced, as was a related political and economic infrastructure that created 'Australia'. And there is a whole history to this appropriation of the land that is not active in the rhetorical force field of the European Australian pastoral, just as the living cultural memories of Aboriginal peoples disposed by the creation of the Australian nation-state are not. ... In "Australia Day at the Aboriginal Tent Embassy", Felicia Fletcher and John Leonard mention how representatives of Aboriginal countries in Australia assembled at Parliament House eat food to sustain themselves in their bid to right this dispossession: "vegetables are cooked in the coals, bread is toasted over the fire, endless cups of tea are poured, pots of three dozen eggs are boiled again and again to keep up the strengths and spirits of the people" (16). However, they add, quoting the group rather than a specific individual: "'It's nice, but at home we'd have a nice bit of kangaroo tail in the fire -- you've got to know how to do it properly -- and damper'": a different memory of and relationship with 'the land' (in both its senses). To conclude, the memories of the land create it at the time of commemoration. How we commemorate it is a present-day matter of great communal and political significance. Plates 1 Ducks Nuts 7 Bürgen High-Bake Heritage White bread 2 Steinlager Beer 8 Devondale Extra Soft margarine 3 Bulla Real Dairy Ice Cream 9 Bundaberg Caster Sugar 4 Saxa Table Salt 10 Dairy Vale Skim Milk 5 Pureland Organic Tofu 11 Devondale Cheese 6 So Natural Mango Smoothie 12 Edgell References Anderson, Benedict. Imagined Communities: Reflections on the Origin and Spread of Nationalism. London: Verso, 1983. Fletcher, Felicia, and John Leonard. "Australia Day at the Aboriginal Tent Embassy." Meanjin 58.1 (1999): 10-17. Frow, John. "Gift and Commodity." Time and Commodity Culture: Essays in Cultural Theory and Postmodernity. Oxford: Oxford UP, 1997. ---. "Toute la Mémoire du Monde: Repetition and Forgetting." Time and Commodity Culture: Essays in Cultural Theory and Postmodernity. Oxford: Oxford UP, 1997. Williams, Raymond. The Country and the City. London: Chatto & Windus, 1973. Winichakul, Thongchai. Siam Mapped: A History of the Geo-Body of a Nation. Chiang Mai: Silkworm Books, 1994. Citation reference for this article MLA style: Guy Redden. "Packaging the Gifts of Nation." M/C: A Journal of Media and Culture 2.7 (1999). [your date of access] <http://www.uq.edu.au/mc/9910/gifts.php>. Chicago style: Guy Redden, "Packaging the Gifts of Nation," M/C: A Journal of Media and Culture 2, no. 7 (1999), <http://www.uq.edu.au/mc/9910/gifts.php> ([your date of access]). APA style: Guy Redden. (1999) Packaging the gifts of nation. M/C: A Journal of Media and Culture 2(7). <http://www.uq.edu.au/mc/9910/gifts.php> ([your date of access]).
APA, Harvard, Vancouver, ISO, and other styles
27

White, Jessica. "Body Language." M/C Journal 13, no. 3 (June 30, 2010). http://dx.doi.org/10.5204/mcj.256.

Full text
Abstract:
Jessica craned her head to take in the imposing, stone building, then lowered her gaze to the gold-plated sign at the base of the steps. “Institute of Methodology”, it read. Inside the heavy iron doors, a woman sat at a desk, her face devoid of expression. “Subject area?” asked the woman. “Uhmm, feminism ... and fiction, I think.” “Turn right.” “Do you have a map?” “No.” “How am I meant to find things?” “Each has their own method; it’s not up to us to prescribe that.” Jessica sighed, readjusted her handbag and turned right. A corridor stretched out before her. She set off, her stiletto boots echoing on the hard wooden floor. The first door she arrived at had the words “Deleuze and Guattari” positioned squarely in the middle. She hesitated, then turned the doorknob. The room was white and empty. A male voice issued from somewhere but she couldn’t tell the direction from which it came. It droned on, with some inflection, but there was no way of knowing where the sentences started and finished. She picked out a few words: a thousand plateaus, becoming, burrowing, but couldn’t piece them into anything meaningful. She backed out of the room, frowning, and asked me, How am I going to learn anything if they only have these voices? I can’t lipread them. And how can I produce something factual if I haven’t heard it all? I might make stuff up. You always make things up anyway. After the barrier of disembodied sound, the silence of the corridor was soothing. Jessica always had difficulty with hearing men’s voices, for their registers were lower. Sometimes, she wondered if this was the reason she’d become interested in feminism: women were simply easier to understand. The next door was labelled “Facets of Phenomenology.” After that was “Post-It Notes and Poststructuralism”, “Interpretation of Geometric Design”, “Knitting Class” and “Cyberspace and Geography.” None of these were very helpful. She wanted something on bodies and writing. She walked on. It was, she soon realised, so terribly easy to lose one’s way. The corridors continued. She turned right most of the time, and occasionally left. Her arches began to ache. After a while she came to the conclusion that she had no idea of where she was. Immediately, a bird appeared and dived down her throat. Trapped, it thudded against her ribs. Breathe, I told her. Breathe. She put a hand out to the wall. Outside another door she heard, a voice with a distinct Australian accent. She checked the label on the door. “Fictocriticism,” it read. The door opened. The bird climbed out of her chest and flew away. A young woman stood before her, wearing bright red lipstick. “We saw your shadow beneath the door.” She pointed to Jessica’s feet. “We don’t like barriers, so come in.” The room was airy and brilliantly lit, with a high ceiling patterned with pressed metal vines and flowers. A man and a handful of women sat at a table covered with papers, bottles of wine, brie, sundried tomatoes and crackers. “Wine?” asked the woman, a bottle in her hand. “It’s from Margaret River.” “Oh yes, please.” Jessica pulled out a chair from the table. The people’s faces looked friendly. “What brings you here?” The woman with red lipstick asked, handing her a glass. “I’m trying to find a writing style that’s comfortable for me to use. I just can’t relate to abstract texts, like those by Deleuze and Guattari.” Jessica eyed the cheese platter on the table. She was hungry. “Help yourself,” said the man. Jessica picked up the cheese knife and a cracker. “You’d like my essay, then, ‘Me and My Shadow.’” It was an older woman speaking, with soft grey hair and luminous eyes. “In it I assert that Guattari’s Molecular Revolution is distancing and, she pushed the pile of paper napkins towards Jessica, ‘totally abstract and impersonal. Though the author uses the first person (‘The distinction I am proposing’, ‘I want therefore to make it clear’), it quickly became clear to me that he had no interest whatsoever in the personal, or in concrete situations as I understand them – a specific person, a specific machine, somewhere in time and space, with something on his/her mind, real noises, smells, aches and pains” (131). Jessica thought about the first room, where Deleuze’s and Guattari’s voices had seemed to issue from nowhere. “Of course,” she said. “If my comprehension comes from reading faces and bodies, it follows that those writers who evince themselves in the text will be the ones that appeal to me.” The rest of the table was silent. “I’m deaf,” Jessica explained. “I’ve no hearing in my left ear and half in my right, but people don’t know until I tell them.” “I’d never have guessed,” said the woman with red lipstick. “I’m good at faking it,” Jessica replied wryly. “It seems to me that, if I only hear some things and make the rest up, then my writing should reflect that.” “We might be able to help you — we write about, and in the style of, fictocriticism.” Two women were talking at once. It was difficult to tell who was saying what. “But what is it?” Jessica asked. “That’s a problematic question. It resists definition, you see, for the form it takes varies according to the writer.” She glanced from one woman to the other. It was hard to keep up. They went on, “Fictocriticism might most usefully be defined as hybridised writing that moves between the poles of fiction (‘invention’/‘speculation’) and criticism (‘deduction’/‘explication’), of subjectivity (‘interiority’) and objectivity (‘exteriority’). It is writing that brings the ‘creative’ and the ‘critical’ together – not simply in the sense of placing them side by side, but in the sense of mutating both, of bringing a spotlight to bear upon the known forms in order to make them ‘say’ something else” (Kerr and Nettlebeck 3). “It began to incorporate narratives and styles that wrote against omniscience in favour of fragmentary, personal perspectives.” Concentrating on cutting and spreading her brie, Jessica couldn’t see who had said this. She looked up, trying to see who had spoken. “In addition,” said a young, slim woman, “The use of autobiographical elements in ficto-criticism that include the body and personal details … realises a subjectivity that is quite different from the controlling academic critical subject with their voice from on high” (Flavell 77). Jessica bit into her cracker. The brie was creamy, but rather too strong. She piled sundried tomatoes onto it. “It is of course, a capacious category,” the man added, “as it must be if it is inspired by the materials and situation at hand. One might urge the interested writer not to feel that their practice has to conform to one or another model, but to have the confidence that the problem characterising the situation before them will surprise them into changing their practices. Like all literature, fictocriticism experiments with ways of being in the world, with forms of subjectivity if you like” (Muecke 15). Jessica nodded, her mouth full of biscuit and brie. Oil dripped from the tomatoes down her fingers. “Yes,” it was the two women in their duet, “in fictocritical writings the ‘distance’ of the theorist/critic collides with the ‘interiority’ of the author. In other words, the identity of the author is very much at issue. This is not to say that an ‘identity’ declares itself strictly in terms of the lived experience of the individual, but it does declare itself as a politic to be viewed, reviewed, contested, and above all engaged with” (Kerr and Nettlebeck 3). “That makes sense,” Jessica thought aloud. “Everything I write is an amalgam of fact and fiction, because I hear some things and make the rest up. Deafness influences the way I process and write about the world, so it seems I can’t avoid my body when I write.” She lifted a napkin from the pile and wiped her oily fingers. “Yet, to use a language of the body, or écriture féminine, is also to run the risk of essentialism, of assuming that, for example when we write long, silky sentences, we are saying that this is how every woman would write. It’s also true that, when writing, we don’t have to be limited to our own bodies – we can go beyond them.” She paused, thinking. “It’s been said that sign language is a form of écriture féminine, for a person who signs literally writes with their hands. Where are my notes?” She ferreted through her handbag, pushing aside tubes of lip gloss and hand cream, a bus pass and mirror, and extracted some folded pieces of paper. “Here, H-Dirksen L. Bauman comments on the possibilites of écriture féminine for the disabled, writing that, The project of recognizing Deaf identity bears similarities to the feminist project of re-gaining a ‘body of one’s own’ through linguistic and literary practices. Sign, in a more graphic way, perhaps, than l’écriture féminine is a ‘writing of/on the body.’ The relation between Sign and l’écriture féminine raises questions that could have interesting implications for feminist performance. Does the antiphonocetric nature of Sign offer a means of averting these essentializing tendency of l’écriture féminine? Does the four-dimensional space of performance offer ways of deconstructing phallogocentric linear discourse? (359) “As Sign is a writing by the body, it could be argued that each body produces an original language. I think it’s this, rather than antiphonocentrism — that is, refusing to privilege speech over writing, as has been the tradition — that represents the destabilising effects of Sign.” “Here’s Jamming the Machinery.” The slim woman pushed a book towards Jessica. “It’s about contemporary Australian écriture féminine.” Jessica opened the covers and began reading: As a counter-strategy, écriture féminine, it is argued, is theoretically sourced in the bodies of women. Here, the body represents one aspect of what it ‘means’ to be a woman, but of course our bodies are infinitely variable as are our socio-historical relations and the way that we live through and make meaning of our particular bodies. Texts, however, are produced through the lived practices of being socially positioned as (among other things) women, so those effects will be inscribed in actively inventing ways for women to speak and write about ourselves as women, rather than through the narrative machinery of patriarchy (Bartlett 1-2). I agree with that, Jessica mused to herself. Even if, on paper, écriture féminine does run the risk of essentialism, it’s still a useful strategy, so long as one remains attentive to the specificity of each individual body. She looked up. The conversation was becoming loud, joyful and boisterous. It was turning into a party. Sadly, she stood. “I’d like to stay, but I have to keep thinking.” She pushed in her chair. “Thank you for your ideas.” “Goodbye and good luck!” they chorused, and replenished their wine glasses. Outside, it was getting dark. She trailed her fingers along the wall for balance. Her sight orientated her; without it, she was liable to fall over, particularly in stilettos. Seeing a movement near the ceiling, Jessica stopped and peered upwards. Dragons! she cried. Sitting in the rafters were three small, pearly white dragons, their scaly hides gleaming in the darkness. Here, she called, stretching out a hand. One dropped, swooping, and landed on her wrist, its talons gripping her arm. Ouch! It looked at her curiously with its small gold eyes, then stretched its wings proudly. Dark blue veins ran across the soft membrane. You’re not very cuddly, she told it, but you are exquisite. Tell me, are you real? For an answer, it leaned over and gently nipped her thumb, drawing blood. Its tail swished like a cat’s in a frisky mood. Stop making things up, I scolded her. This is supposed to be serious. Abruptly, the dragon sprang from her wrist, winging gracefully back to the ceiling. Jessica rubbed her arm and continued, feeling ripples of unevenly applied paint beneath her fingertips. Let me pose a question, I suggested: if a fairy godmother offered you your hearing, would you take it? Well, deafness has made me who I am— You mean, an opinionated, obnoxious, feminist thinker and writer? Yes, exactly. So perhaps I wouldn’t take it. And where would you be without silence, which has given you the space in which to think, and which has shaped you as a writer? Without silence, you wouldn’t have turned to words. Hmmm, yes. She slowed. It’s awfully dark in here now. And quiet. For deaf people, silence has often been yoked together with negative connotations – it’s a cave, a prison, a tomb. Sometimes it can feel like this, but, as you know, at other times it’s liberating. You don’t have to listen to someone yakking on their mobile phone on the bus, nor overhear your flatmate having loud sex in the room above; you can simply switch off your hearing aid and keep reading your book, or thinking your thoughts. In a somewhat similar situation, Stephen Hawking, the theoretical physicist, has said that ‘his disability has given him the advantage of having more time to think,’ although Susan Wendell points out that he is only able to do this ‘because of the help of his family, three nurses, a graduate student who travels with him to maintain his computer-communications systems’ – resources which are unavailable to many disabled people” (109). Thus although disability has been largely theorised as lack, it would seem that the contrary is the case: disability brings with it a wealth of possibility. Jessica slowed, feeling vibrations in the wall and beneath our feet. Her heartbeat quickened. Maybe it’s music. It’s not. It’s irregular. Then we heard the sound, like distant thunder. Get back against the wall, I ordered her. Seconds later a crowd of creatures ran past, rattling the floorboards. They were so black we couldn’t see them. What was that? she asked. They smelled like horses. Musky, but sharp too. Let’s get moving. And I told you to stop making things up. I didn’t make that up! she protested. Her pulse was still rapid, so I kept talking to distract her. The difficulty is to avoid referring to the disabled person as having lost something. Of course, you can lose your hearing, but you gain infinitely more in other ways – your senses of touch, taste, smell and sight are augmented. In the current climate of thinking, this is easier said than done. Lennard Davis indicates with distaste that discussions of disability stop theorists in their tracks. Disability, as it has been formulated, is a construct that is defined by lack. Rather than face this ragged imaged [of the disabled individual], the critic turns to the fluids of sexuality, the gloss of lubrication, the glossary of the body as text, the heteroglossia of the intertext, the glossolalia of the schizophrenic. But almost never the body of the differently abled (5). Theorists of disability consistently point out that, if more effort and energy were directed towards the philosophical implications of the disabled body, a wealth of new material and ideas would emerge that would shatter existing presumptions about the corporeal. For example, there are still immense possibilities thrown up by theorising a jouissance, or pleasure, in the disabled body. As Susan Wendell points out, “paraplegics and quadriplegics have revolutionary things to teach us about the possibilities of sexuality which contradict patriarchal culture’s obsessions with the genitals” (120). Thus if there were more of a focus on the positive aspects of disability and on promoting the understanding that disability is not about lack, people could see how it fosters creativity and imagination. Jessica saw with relief that there was a large bay window at the end of a corridor, looking out onto the Institute’s grounds. She collapsed onto the bench beneath it, which was layered with cushions. The last of the sun was fading and the grass refracted a golden sheen. She unzipped her boots and swung her legs onto the bench. Leaning her head back against the wall, she remembered a day at primary school when she was eleven. She sat on the blue seat beneath the Jacaranda tree, a book open in her lap. It was lunchtime, the sun was warm and purple Jacaranda blossoms lay scattered at her feet, some squidged wetly into the cement. She looked up from the book to watch her classmates playing soccer on the field, shouting and calling. She would have joined them, except that of late she had felt awkwardness, where before she had been blithe. She, who was so used to scrambling over the delightful hardness of wool bales in the shearing shed, who ran up and down the banks of creeks and crawled into ti trees, flakes of bark sticking to her jumper, had gradually, insidiously, learnt a consciousness of her body. She was not like them. We were silent. The electric lights on the walls of the building came on, illuminating sections of the stonework. At the time, she hated being isolated, but it forced to look at the world differently. Spending so much time on her own also taught her to listen to me, her imagination, and because of that her writing flourished. There was a flutter in the hallway. The tiny dragon had returned. It braked in the air, circled, and floated gently onto her skirt. Was this your doing? She asked me suspiciously. Maybe. She held out her palm. The dragon jumped into it, squeaking, its tail whipping lazily. Jessica smiled. References Bartlett, Alison. Jamming the Machinery: Contemporary Australian Women’s Writing. Toowoomba: Association for the Study of Australian Literature, 1998. Bauman, H-Dirksen L. “Toward a Poetics of Vision, Space and the Body.” The Disability Studies Reader. Ed. Lennard J. Davis. Hoboken: Routledge, 2006. 355-366. Davis, Lennard J. Enforcing Normalcy: Disability, Deafness, and the Body. London: Verso, 1995. Flavell, Helen. Writing-Between: Australian and Canadian Ficto-Criticism. Ph.D. Thesis. Murdoch University, 2004. Gibbs, Anna. “Writing and the Flesh of Others.” Australian Feminist Studies 18 (2003): 309–319. Kerr, Heather, and Amanda Nettlebeck. “Notes Towards an Introduction.” The Space Between: Australian Women Writing Fictocriticism. Ed. Heather Kerr and Amanda Nettlebeck. Nedlands: U of Western Australia P, 1998. 1-18. Muecke, Stephen. Joe in the Andamans: And Other Fictocritical Stories. Erskineville: Local Consumption Publications, 2008. Tompkins, Jane. “Me and My Shadow.” Gender and Theory: Dialogues on Feminist Criticism. Ed. Linda Kauffman. Oxford: Basil Blackwell, 1989. 121-139. Wendell, Susan. “Towards a Feminist Theory of Disability.” Hypatia 4 (1989): 104–124.
APA, Harvard, Vancouver, ISO, and other styles
28

Flowers, Arhlene Ann. "Swine Semantics in U.S. Politics: Who Put Lipstick on the Pig?" M/C Journal 13, no. 5 (October 17, 2010). http://dx.doi.org/10.5204/mcj.278.

Full text
Abstract:
Swine semantics erupted into a linguistic battle between the two U.S. presidential candidates in the 2008 campaign over a lesser-known colloquialism “lipstick on a pig” reference in a speech by then Democratic presidential candidate, Barack Obama. This resulted in the Republicans sparring with the Democrats over the identification of the “swine” in question, claiming “sexism” and demanding an apology on behalf of then Governor Sarah Palin, the first female Republican vice presidential candidate. The Republican Party, fearful of being criticised for its own sexist and racist views (Kuhn par. 1), seized the opportunity to attack the Democrats with a proactive media campaign that made the lipstick comment a lead story in the media during a critical time less than two months before the election, derailing more serious campaign issues and focusing attention on Palin, who had just made her national political debut and whose level of experience was widely debated. Leskovec, Backstrom, and Kleinberg conducted a meme-tracking study for analysing news-cycle phrases in approximately 90 million stories from 1.6 million online sites spanning mainstream news to blogs during the final three months of the U.S. presidential election (1). They discovered that “lipstick on a pig” was “stickier” than other phrases and received “unexpectedly high popularity” (4). A simple Google search of “lipstick on a pig” resulted in 244,000 results, with more than half originating in 2008. Obama’s “Lipstick on a Pig” Reference During the final rounds of the 2008 U.S. presidential campaign, Democratic presidential candidate Barack Obama’s words at a widely televised campaign stop in Lebanon, Virginia, on 9 September, sparked a linguistic debate between the two major American political parties 56 days before Election Day. Obama attempted to debunk McCain’s strategy about change in the following statement:John McCain says he’s about change, too. [...] And so I guess his whole angle is, watch out, George Bush. Except for economic policy, healthcare policy, tax policy, education policy, foreign policy, and Karl Rove-style politics [...] That’s not change. That’s just calling some—the same thing, something different. But you know [...] you can put [...] lipstick on a pig. It’s still a pig (“Obama’s Take”).A reporter from The New York Times commented that it was clear to the audience that Obama’s “lipstick” phrase was a direct reference to McCain’s policies (Zeleny par. 5). Known as a well-educated, articulate speaker, perhaps one considered too professorial for mainstream America, Obama attempted to inject more folksy language and humour into his dialogue with the public. However, the Republicans interpreted the metaphor quite differently. Republicans Claim “Sexism” from a “Male Chauvinist Pig” The Republican contender John McCain and his entourage immediately took offence, claiming that the “pig” in question was a sexist comment referring to Palin, who was introduced on 29 August as the first female vice presidential candidate on the Republican ticket (“VP Pick”). A Republican National Committee spokeswoman quickly told the media, “Sarah Palin’s maverick record of reform doesn’t need any ‘dressing up,’ but the Obama campaign’s condescending commentary deserves some dressing down” (Chozick par. 8). McCain’s camp formed the Palin Truth Squad with 54 Republican women, primarily lawyers and politicians, on the same day as the metaphor was used, to counter negative media and Internet commentary about Palin (Harper A13). Almost immediately after Obama’s “lipstick” comment, McCain’s camp conducted a conference call with journalists and former Massachusetts Governor Jane Swift, a Republican and chair of the Palin Truth Squad, who stated the lipstick comment referred to Palin, “the only one of the four—the presidential and vice presidential candidates—who wears lipstick” (Kornblut and Shear par. 12). Another member of the Squad, Thelma Drake, then a Republican Representative from Virginia, said that “it’s hard for Barack Obama to paint himself as the agent of change if he harbors the same mindset that Palin and millions of women just like her, have been fighting against their whole lives” (Applegate par. 8). Swift and others also claimed Obama was referring to Palin since she had herself used a lipstick metaphor during her Republican National Convention speech, 3 Sepember: “I love those hockey moms. You know, they say the difference between a hockey mom and a pit bull? Lipstick” (“Palin’s Speech” par. 26). The Republicans also created an anti-Obama Web ad with the theme, “Ready to Lead? No. Ready to Smear? Yes,“ (Weisman and Slevin A01) with a compilation of video clips of Palin’s “lipstick” joke, followed by the latter part of Obama's “lipstick” speech, and CBS News anchorwoman, Katie Couric, talking about “sexism” in politics, that latter of which referred to an older clip referring to Hillary Clinton’s campaign for the White House. Both clips on Obama and Couric were taken out of context. CBS retaliated and released a statement that the network “does not endorse any candidate” and that “any use of CBS personnel in political advertising that suggests the contrary is misleading” (Silva par. 8). YouTube pulled the Republican Web ads stating that the cause was “due to a copyright claim” (Silva par. 7). Another porcine phrase became linked to Obama—“male chauvinist pig”—an expression that evolved as an outgrowth of the feminist movement in the 1960s and first appeared with the third word, “pig,” in the media in 1970 (Mansbridge and Flaster 261). BlogHer, a blog for women, posted “Liberal Chauvinist Pigs,” on the same day as Obama's speech, asking: “Does the expression male chauvinist pig come to mind?” (Leary par. 5) Other conservative blogs also reflected on this question, painting Obama as a male chauvinist pig, and chastising both the liberal media and the Democrats for questioning Palin’s credentials as a viable vice presidential candidate. Obama “Sexist Pig Gear” protest tee-shirts, buttons, and bumper stickers were sold online by Zazzle.com. Democratic Response to “Controversy” During a campaign stop in Norfolk, Virginia, the day after his “lipstick” comment, Obama called the Republican backlash the “latest made-up controversy by the John McCain campaign” and appealed for a return to more serious topics with “enough” of “foolish diversions” (“Obama Hits”). He stated that the Republicans “seize on an innocent remark, try to take it out of context, throw up an outrageous ad, because they know it’s catnip for the news media” (“Obama Hits”). Obama also referred to the situation as the “silly season of politics” in media interviews (James par. 8). Obama’s spokespeople rallied claiming that McCain played the “gender card about the use of a common analogy” (Kornblut and Shear par. 6). An Obama campaign spokesman distributed to the media copies of articles from a Chicago Tribune story in 2007 in which McCain applied the lipstick analogy about the healthcare strategy of Hillary Clinton, a previous female Democratic presidential contender (Chozick 11). Another Obama spokeswoman said that the porcine expression “was older than my grandfather’s grandfather,” (Zimmer par. 1) which also inspired the media and linguists to further investigate this claim. Evolution of “Lipstick on a Pig” This particular colloquial use of a “pig” evolved from a long history of porcine expressions in American politics. American political discourse has been rich with cultural references to porcine idioms with negative connotations. Pork barrels were common 19th-century household items used to store salt pork, and some plantation owners doled out the large barrels as rewards to slaves who then had to compete with each other to grab a portion (Maxey 693). In post-Civil War America, “pork barrel” became a political term for legislative bills “loaded with special projects for Members of Congress to distribute to their constituents back home as an act of largesse, courtesy of the federal taxpayer” (“Pork Barrel Legislation”). Today, “pork barrel” is widely used in the U.S., Australia, New Zealand, the United Kingdom, and other countries (“Definition Pork Barrel”) to refer to “government projects or appropriations yielding rich patronage benefits” (“Pork Barrel”). Conservative radio personality Rush Limbaugh coined the term, “porkulus,” as another expression for “pork barrel” by merging the words “pork and “stimulus,” while discussing President Obama’s economic stimulus package in January 2009 (Kuntz par. 1). Ben Zimmer, an American lexicologist, explained that “many porcine proverbs describe vain attempts at converting something from ugly to pretty, or from useless to useful” (par. 2). Zimmer and other writers investigated the heritage of “lipstick on a pig” over the past 500 years from “you can't make a silk purse from a sow’s ear,” “a hog in armour is still a hog,” and “a hog in a silk waistcoat is still a hog.” Zimmer connected the dots between the words “lipstick,” a 19th-century invention, and “pig” to a Los Angeles Times editor in 1926 who wrote: “Most of us know as much of history as a pig does of lipsticks” (par. 3). American Politicians Who Have Smeared “Lipstick on a Pig” Which American politicians had used “lipstick on a pig” before Obama? Both Democrats and Republicans have coloured their speech with this colloquialism to refer to specific issues, not specific people. In 2008, Elizabeth Edwards, wife of presidential hopeful John Edwards, used the porcine expression about McCain’s healthcare proposals at a Democratic campaign event and House Minority Leader John Boehner, a Republican, about weak Republican fundraising efforts during the same month (Covington and Curry par. 7-8). McCain ironically used the term twice to criticise Hillary Clinton’s healthcare proposals as “lipstick on a pig,” while they were both campaigning in 2007 (Covington and Curry par. 6). His statement received limited attention at the time. During a telephone interview in 2007, Obama also had used the pig analogy when referring to an “impossible assignment” George W. Bush gave to General Petraeus, who was then serving as the Multinational Forces Iraq Commander (Tapper par. 15). In 2004, Republican Vice President Richard Cheney applied a regional slant: “As we like to say in Wyoming, you can put all the lipstick you want on a pig, but at the end of the day it's still a pig,” about the national defence record of John Kerry, then a Democratic presidential nominee (Covington and Curry par. 4). A few months earlier that year, John Edwards, Democratic vice presidential candidate, scolded the Bush administration for putting “lipstick on a pig” on “lackluster job-creation numbers” (Covington and Curry par. 3). Representative Charles Rangel, a Democrat, identified the “pig” as a tax bill the same year (Siegel par. 15-16). In 1992, the late Governor of Texas, Ann Richards, a Democrat, who was known for colourful phrases, gave the pig a name when she said: “You can put lipstick on a hog and call it Monique, but it is still a pig,” referring to the Republican administration for deploying warships to protect oil tankers in the Middle East, effectively subsidizing foreign oil (Zimmer par. 4). A year earlier, when she introduced her first budget for Texas, she said: “This is not another one of those deals where you put lipstick on a hog and call it a princess” (Zimmer par. 4). The earliest reputed recorded use of an American politician using the phrase was Texas Democrat Jim Hightower, who applied it to depict the reorganisation of Ronald Reagan's Cabinet in 1986 (Macintyre 16). Time magazine reporters (Covington and Curry par. 2) and Zimmer (par. 3) claimed that a San Francisco radio personality, Ron Lyons, was one of the earliest quoted in print with “lipstick on a pig” about renovation plans for a local park in November 1985 in the Washington Post. Author of the Double-Tongued Dictionary, Grant Barrett, uncovered a 1980 article from a small Washington state newspaper as the earliest written record with an article that stated: “You can clean up a pig, put a ribbon on it’s [sic] tail, spray it with perfume, but it is still a pig” (Guzman par. 7). A book on communication also adopted the pig metaphor in its title in 2006, Lipstick on a Pig: Winning in the No-Spin Era by Someone Who Knows the Game, by Torie Clarke, who previously served as Assistant Secretary of Defense for Public Affairs under Donald Rumsfield during the early years of the G.W. Bush Administration. Media Commentary According to The New York Times (Leibovich and Barrett), “lipstick on a pig” was one of the most popular political buzzwords and phrases of 2008, along with others directly referring to Palin, “Caribou Barbie” and “Hockey Mom,” as well as “Maverick,” a popular term used by both McCain and Palin. Many journalists played on the metaphor to express disdain for negative political campaigns. A Wall Street Journal article asked: “What's the difference between a more hopeful kind of politics and old-fashioned attacks? Lipstick” (Chozick par. 1). International media also covered the Obama-McCain lipstick wars. The Economist, for example, wrote that the “descent of American politics into pig wrestling has dismayed America’s best friends abroad” (“Endless Culture War” par. 6). Bloggers claimed that Obama’s “lipstick” speech was influenced by copy and imagery from two leading American cartoonists. The Free Republic, self-acclaimed to be “the premier online gathering place for independent, grass-roots conservatism” (Freerepublic.com), claimed that Obama plagiarized almost verbatim the language leading into the “pig” comment from a Tom Toles cartoon that ran in the Washington Post on 5 Sepember (see fig. 1).Fig. 1. Toles, Tom. Cartoon. Washington Post. 5 Sep. 2008. 30 July 2010 Another cartoon by R. J. Matson appeared in the St. Louis Post Dispatch (see fig. 2) four days before Obama’s speech that depicted Palin not just as a pig wearing lipstick, but as one using pork barrel funding. The cartoon’s caption provides an interpretation of Palin's lipstick analogy: “Question: What’s the Difference Between a Hockey Mom Reformer and a Business-As-Usual Pork Barrel-Spending Politician? Answer: Lipstick.” Newsbusters.org blogger stated: “It’s not too far-fetched to say Team Obama is cribbing his stump speech laugh lines from the liberal funnies” (Shepherd par. 3). Fig 2. Matson, R. J. Cartoon. St. Louis Post Dispatch. 5 Sep. 2008. 30 July 2010 . A porcine American character known for heavy makeup and a starring role as one of the Muppets created by puppeteer Jim Henson in the 1970s, Miss Piggy still remains an American icon. She commented on the situation during an interview on the set of “Today,” an American television program. When the interviewer asked, “Were you surprised by all the hubbub this election season over your lipstick practices?,” Miss Piggy’s response was “Moi will not dignify that with a response” (Raphael par. 6-7). Concluding Comments The 2008 U.S. presidential election presented new players in the arena: the first African-American in a leading party and the first female Republican. During a major election, words used by candidates are widely scrutinised and, in this case, the “lipstick on a pig” phrase was misconstrued by the opposing party, known for conservative values, that latched onto the opportunity to level a charge of sexism against the more liberal party. Vocabulary about gender, like language about race, can become a “minefield” (Givhan M01). With today’s 24/7 news cycle and the blogosphere, the perceived significance of a political comment, whether innocent or not, is magnified through repeated analysis and commentary. The meme-tracking study by Leskovec, Backstrom, and Kleinberg observed that 2.5 hours was the typical time lag between stories originating in mainstream media and reaching the blogosphere (8); whereas only 3.5 percent of the stories began in blogs and later permeated into traditional media (9). An English author of the history of clichés and language, Julia Cresswell, stated that the “lipstick” term “seems to be another candidate for clichéhood” (61). Although usage of clichés can prove to cause complications as in the case of Obama’s lipstick reference, Obama was able to diffuse the Republican backlash quickly and make a plea to return to serious issues affecting voters. David Greenberg analysed Obama’s presidential win and explained: And although other factors, especially the tanking economy, obviously contributed more directly to his November victory, it would be a mistake to overlook the importance of his skill at mastering the politics of negative attacks. When Obama went negative against others, he carefully singled out aspects of his opponents’ characters that, he argued, American politics itself had to transcend; he associated his foes with the worst of the old politics and himself with the best of the new. When others fired at him, in contrast, he was almost always able to turn the criticisms back upon them—through feigned outrage, among other tactics—as perpetuating those selfsame blights on our politics (70). References Applegate, Aaron. “Rep. Drake Criticizes Obama for ‘Lipstick on a Pig’ Remark.” Virginia Pilot 10 Sep. 2008. 28 Jul. 2010. Chozick, Amy. “Obama Puts Different Twist on Lipstick.” Wall Street Journal 9 Sep. 2008. 30 Jul. 2010. Covington, Marti, and Maya Curry. “A Brief History of: ‘Putting Lipstick on a Pig.’” Time 11 Sep. 2008. 17 May 2010. Cresswell, Julia. “Let’s Hear it for the Cliché.” British Journalism Review 19.57 (2008): 57-61. “Endless Culture War.” The Economist 4 Oct. 2008: ABI/INFORM Global, ProQuest. 30 Jul. 2010. “Definition Pork Barrel.” Webster’s Online Dictionary. 30 Jul. 2010. freerepublic.com. “Welcome to Free Republic.” Free Republic 2009. 30 Jul. 2010. Givhan, Robin. “On the Subject of Race, Words Get in the Way.” Washington Post 20 Jan. 2008: M01. Greenberg, David. “Accentuating the Negative.” Dissent 56.2 (2009): 70-75. Guzman, Monica. “‘Lipstick on a Pig’ Finds Origin in Tiny State Newspaper.” Seattlepi.com 10 Sep. 2008. 17 May 2010. Harper, Jennifer. “Obama Comment Offends GOP Women; ‘Palin Truth Squad’ Sent Out to Counter ‘Lipstick on a Pig’ Remark.” Washington Times 10 Sep. 2008: A13. Huston, Warner Todd. “Did Obama Steal His Lip Stick on a Pig From a Political Cartoon?” Newsbusters.org 10 Sep. 2008. 15 Jul. 2010 . James, Frank. “Barack Obama on David Letterman.” Chicago Tribune 11 Sep. 2008. 15 Jul. 2010 http://www.swamppolitics.com/news/politics/blog/2008/09/barack_obama_on_david_letterma.html>. Kornblut, Anne E., and Michael D. Shear. “McCain Camp Sees an Insult in a Saying.” Washington Post 10 Sep. 2008. 30 Jul. 2010 AR2008090903531.html>. Kuhn, David P. “GOP Fears Charges of Racism, Sexism.” Politico.com 23 Feb. 2008. 4 Oct. 2010. Kuntz, Tom. “Porkulus.” NYTimes.com 8 Feb. 2009. 30 Jul. 2010. Leary, Anne. “Liberal Chauvinist Pigs.” BlogHer 9 Sep. 2008. 2 Oct. 2010. Leibovich, Mark, and Grant Barrett. “The Buzzwords of 2008.” New York Times 21 Dec. 2008. 29 Jul. 2010 http://www.nytimes.com/ref/weekinreview/buzzwords2008.html>. Leskovec, Jure, Lars Backstrom, and Jon Kleinberg. “Meme-tracking and the Dynamics of the News Cycle.” ACM SIGKDD International Conference on Knowledge Discovery and Data Mining, Paris, 28 Jun. 2009. 30 Jul. 2010 . Macintyre, Ben. “US Politics is Littered with Dawgs, Crawdaddys and Pigs in Lipstick.” The Times [London] 27 Sep. 2008: 16. Mansbridge, Jane, and Katherine Flaster. “Male Chauvinist, Feminist, Sexist, and Sexual Harassment: Different Trajectories in Feminist Linguistic Innovation.” American Speech 80.3 (Fall 2005): 256-279. Maxey, Chester Collins. “A Little History of Pork.” National Municipal Review, Volume VIII. Concord: Rumford Press, 1919. Google Books. 30 Jul. 2010. “Obama Hits Back Against McCain Campaign.” MSNBC 10 Sep. 2008. Televised Speech. 18 May 2010. “Obama’s Take on McCain's Version of Change.” CNN 9 Sep. 2009. YouTube.com. 17 May 2010. “Palin’s Speech at the Republican National Convention.” New York Times 3 Sep. 2008. 17 May 2010. “Pork Barrel.” Merriam-Webster Online Dictionary 2010. 30 Jul. 2010. “Pork Barrel Legislation.” C-SPAN Congressional Glossary. c-span.org. 17 May 2010. Raphael, Rina. “Miss Piggy: Obama Should Make Poodle First Pet” Today 13 Nov. 2008. MSNBC.com. 29 Jul. 2010. Shepherd, Ken. “Palin Shown As Lipsticked Pig in Cartoon Days Before Obama Remark.” NewsBusters.org 11 Sep. 2008. 30 Jul. 2010 . Siegel, Robert. “Putting Lipstick on a Pig.” National Public Radio 10 Sep. 2008. 16 Jul. 2010. Silva, Mark. “Katie Couric's 'Lipstick' Rescue: CBS.” Chicago Tribune 11 Sep. 2008. 30 Jul. 2010. Tapper, Jack. “A Piggish Debate: Power, Pop, and Probings from ABC News Senior White House Correspondent Jake Tapper.” ABC News 9 Sep. 2008. 29 Jul. 2010. “VP Pick Palin Makes Appeal to Women Voters.” NBC News, msnbc.com, and Associated Press 28 Aug. 2008. 30 Jul. 2010. Weisman, Jonathan, and Peter Slevin. “McCain Camp Hits Obama on More Than One Front.” Washington Post 11 Sep. 2008: A04. Zeleny, Jeff. “Feeling a Challenge, Obama Sharpens His Silver Tongue.” New York Times 10 Sep. 2008. 27 Jul. 2010. Zimmer, Ben. “Who First Put ‘Lipstick on a Pig’?” The Slate 10 Sep. 2008. 17 May 2010.
APA, Harvard, Vancouver, ISO, and other styles
29

Risson, Toni. "Sugar Pigs: Children’s Consumption of Confectionery." M/C Journal 13, no. 5 (October 17, 2010). http://dx.doi.org/10.5204/mcj.294.

Full text
Abstract:
Sugar pigs are traditional confections shaped like sugar mice with little legs and no tail. One might, therefore, nibble the trotters of a sugar pig or suck delicately upon the nose of a sugar pig, but one must never eat one’s sugary treats like a pig. As an imagined border between the private world inside the body and the public world outside, the mouth is an unstable limit of selfhood. Food can easily cause disgust as it passes through this hazardous terrain, and this disgust is produced less by the thought of incorporation than by socially constructed boundaries such as the division between human and animal. In order to guard against disgust and the moral judgement it incurs about the eater, the mouth is governed by myriad rules and, in the case of the juvenile mouth, subject to adult surveillance. This paper investigates children’s consumption of confectionery in relation to the mouth as a liminal border space. Children are “sugar pigs” in as much as they disregard the conventions of civilised eating that govern the mouth, preferring instead to slubber, gnaw, lick, and chew like animals, to reveal the contents of their mouths and examine the contents of others, to put lollies in and out of their mouths with dirty hands, and to share single lollies. Children’s lolly rituals resist civilised eating norms, but they hold important cultural meanings that parallel and subvert those of the adult world. Children’s mouths are communal spaces and the rituals that take place in them are acts of friendship, intimacy, and power. Eating norms instituted over thousands of years ensure that people do not eat like animals, and the pig, in particular, stands in opposition to civilised eating. In On Good Manners for Boys (1530), Erasmus of Rotterdam advises that a general guide to eating like a human being is to eat inconspicuously and self-consciously—to “lick a plate or dish to which some sugar or sweet substance has adhered is for cats, not people,” he explains, and to “gnaw bones is for a dog”—and he compares ill-mannered eating with that of pigs, observing how some people “slubber up their meat like swine” (qtd. in Kass 145). Unrefined table manners and uncontrolled appetite continue to elicit such expressions of disgust as “dirty pig” and “greedy pig.” Pigs grunt. Pigs snuffle among refuse. Pigs, as Bob Ashley et al. note, represent all that is uncivilised and exist only as a signifier of appetite (2). The pig and civilisation, however, do not exist simply in opposition. Cookery writer Jane Grigson argues that European civilisation has been founded upon the pig (qtd. in Ashley et al. 2). Also, because the pig’s body is pinkish, soft, and flabby like a human body and because pigs were usually housed near or even inside human dwellings, the pig confounds the human/animal binary: it is “a threshold animal” (Stallybrass and White qtd. in Ashley et al. 7). Furthermore, the steady evolution of eating practices suggests that humans would eat like animals if left in their natural state. Food rules are part of the “attempt to exclude piggishness” from human civilisation, which, according to Ashley et al., demonstrates “precisely the proximity of human and pig” (7). As physician Leon Kass observes, eating conventions “show us both how much we have taken instruction and how much we needed it” (139). Humans aspire to purity and perfection, but William Ian Miller explains that “fuelling no small part of those aspirations is disgust with what we are or with what we are likely to slide back into” (Anatomy xiv). Eating norms, therefore, do not emphasise the difference between human and the pig as much as they express the underlying anxiety that the human mouth and the act of eating are utterly animal. ‘Lollies’ is the Australian term for the confectionery that children mostly buy, and while the child with a lolly pouched in its cheek is such a familiar, even iconic, image that it features on the covers of two recent books about confectionery (Richardson, Whittaker), licking, gnawing, and slubbering—Erasmus’ wonderfully evocative and piggish word—aptly describe the consumption of lollies. Many lollies are large and hard, and eating them requires time, effort, concentration, and conspicuous mouth activity: the cheek bulges and speaking is difficult; a great deal of saliva is produced and the area around the mouth becomes smeared with coloured drool; and there is always the possibility of the lolly falling out. The smaller the child’s mouth, or the larger the lolly, the more impossible it is to eat inconspicuously and self-consciously. Endless chewing is similarly animal-like, and “the bovine look” of teenagers featured in public complaints when chewing gum was mass-produced in the twentieth century (Hendrickson 7). Humans must not eat like animals, but overly-stuffed cheeks, sucking and slubbering mouths, licking tongues, gnawing teeth, and mindlessly ruminating jaws are unashamedly animal-like. Other rules guard against disgust arising from the sight of half-chewed food. When food is in the process of becoming part of the body, it quickly acquires the quality of things with which disgust is more readily associated, things that are, according to Miller, moist rather than dry, viscid rather than free-flowing, pliable rather than hard, things that are “oozy, mucky, gooey, slimy, clammy, sticky, tacky, dank, squishy, or filmy” (“Darwin’s Disgust” 338). Soft lollies with their vividly-coloured and glossy or sugar-encrusted surfaces look magical, but once they go into the mouth are “magically transformed into the disgusting” (Anatomy Miller 96). Food in the process of “becoming” must, therefore, never be seen again. The process of transformation takes place in the private interior of the body, but, if the mouth is open, half-transformed food is visible, and chewed food, according to Miller, “has the capacity to be even more disgusting than feces [sic]” (Anatomy 96). Sometimes, the sight of half-consumed lollies inside children’s mouths is deliberate because children poke out their tongues and look into each other’s mouths to monitor the progress of lollies that change colour as they break down. Miller explains that the rules of disgust are suspended in sexual and non-sexual love: “Disgust marks the boundaries of the self; the relaxing of them marks privilege, intimacy, duty, and caring” (Anatomy xi). This principle applies to children’s lolly rituals. If children forget to note the colour of a Clinker as they bite it, or if they want to note the progress of a Cloud or gobstopper, they open their mouths and even poke out their tongues so a friend can inspect the colour of the lolly, or their tongue. Such acts are marks of friendship. It is not something children do with everyone. The mouth is a threshold of self that children relax as a marker of privilege. The clean/unclean binary exerts a powerful influence on food because, in addition to the way in which food is eaten, it determines the kind of food that is eaten. The mouth is a border between the self (the eater) and the other (the eaten), so what is eaten (the other) eventually becomes the eater (the self). Paradoxically, the reverse is also true; the eater becomes what is eaten—hence, “we are what we eat.” Little wonder then that food is a site of anxiety, surveillance, and control. The pig eats anything, but children’s consumption is strictly monitored. The clean food imperative means that food must be uncontaminated by the world outside the body, and lollies violate the clean food category in this regard. Large, hard lollies can fall out of the mouth, or children may be obliged to violently expel them if they are danger of choking. The young protagonists in Saturdee, Norman Lindsay’s bildungsroman set in country Victoria after WWI, arrange a secret tryst with some girls, and when their plan is discovered a horde of spectators assembles to watch the proceedings: [Snowey Critchet] had provided himself with a bull’s-eye; a comestible about the size of a cricket ball, which he stowed away in one cheek, as a monkey pouches an orange, where it distended his face in a most obnoxious manner. He was prepared, it seemed, to spend the entire afternoon inspecting a scandal, while sucking his bull’s-eye down to edible proportions. (147) Amid a subsequent volley of taunts and cow dung, Snowey lands in the gutter, a reprisal that “was like to be Snowey’s end through causing him to bolt his bull’s-eye whole. It was too large to swallow but large enough to block up his gullet and choke him. Frenziedly he fought his way out of the gutter and ran off black in the face to eject his windpipe obstruction” (147-8). Choking episodes are further aspects of children’s consumption that adults would deem dangerous as well as disgusting. If a child picks up a lolly from the ground, an adult is likely to slap it away and spit out the word “Dirty!” The child’s hands are potentially part of the contaminated outside world, hence, wash your hands before you eat, don’t eat with your fingers, don’t lick your fingers, don’t put your fingers into your mouth, don’t handle food if you aren’t going to eat it, don’t eat food that others have touched. Lolly-consumption breaches the clean/unclean divide when children put fingers into mouths to hook tacky lollies like Minties off the back teeth, remove lollies in order to observe their changing shape or colour, pull chewing gum from the mouth, or push bubble gum back in. The mouth is part of the clean world inside the body; adult disgust stems from concern about contamination through contact with the world outside the body, including the face and hands. The hands are also involved in playground rituals. Children often remove lollies from their mouths, play with them, and put them back in. Such invented rituals include sharpening musk sticks by twisting them in the mouth before jabbing friends with them and returning them to the mouth. Teenagers also bite the heads off jelly babies and rearrange the bodies in multicoloured versions before eating them. These rituals expose half-consumed lollies, and allow lollies to be contaminated by the outside world, but they are markers of friendship and ways of belonging to particular groups as well as sources of entertainment. The ultimate cause for disgust, apart from sharing with a pig perhaps, arises when children violate the boundary between one mouth and another by sharing a single lolly. “Can I have a lick o’ your lollipop?” is an expression that belongs to a time when germs were yet to consume the public imagination, and it demonstrates that children have long been disposed to sharing confectionery in this way. Allowing someone to share an all-day sucker indicates friendship because it involves sacrifice as well as intimacy. How many times the friend licks it indicates how important a friend they are. Chewing gum and hard lollies such as bull’s-eyes and all-day suckers are ideal for sharing because they last a long time. Snowey’s choking episode is punishment both for having such a lolly while others did not, and for not sharing it. When friends share a single lolly in Markus Zusak’s The Book Thief it is a sign of their growing intimacy. Rudy and Liesel had only enough money for one lolly: “they unwrapped it and tried biting it in half, but the sugar was like glass. Far too tough, even for Rudy’s animal-like choppers. Instead, they had to trade sucks on it until it was finished. Ten sucks for Rudy. Ten for Liesel. Back and forth” (168). Rudy asks Liesel to kiss him on many occasions, but she never does. She regrets this after he is killed, so here the shared lolly stands in lieu of intimacy rather than friendship. Lollies are still shared in this way in Australian playgrounds, but often it is only hard lollies, and only with close friends. A hard lolly has a clearly defined boundary that can easily be washed, but even unwashed the only portion that is contaminated, and contaminable, is the visible surface of the lolly. This is not the case with a stick of chewing gum. In response to Tom Sawyer’s enquiry as to whether or not she likes rats, Becky Thatcher replies,“What I like, is chewing gum.” “O, I should say so! I wish I had some now.” “Do you? I’ve got some. I’ll let you chew it a while, but you must give it back to me.” That was agreeable, so they chewed it turn about, and dangled their legs against the bench in excess of contentment.” (58) Unlike the clearly defined boundary of a gobstopper, the boundary of chewing gum continually shifts and folds in on itself. The entire confection is contaminated through contact with the mouth of the other. The definition of clean food also includes that which is deemed appropriate for eating, and part of the appeal of lollies is their junk status. Some lollies are sugar versions of “good” foodstuffs: strawberries and cream, wildberries, milk bottles, pineapples, and bananas. Even more ironic, especially in light of the amount of junk food in many adult diets, others are sugar versions of junk food: fries, coke bottles, Pizzas, Hot Dogs, and Hamburgers, all of which are packaged like miniatures of actual products. Lollies, like their British equivalent, kets (which means rubbish), are absolutely distinct from the confectionery adults eat, and British sociologist Allison James shows that this is because they “stand in contrast to conventional adult sweets and adult eating generally” (298). Children use terms like junk and ket intentionally because there is a “power inherent in the conceptual gulf between the worlds of the adult and the child” (James, “Confections” 297). Parents place limits on children’s consumption because lollies are seen to interfere with the consumption of good food, but, as James explains, for children, “it is meals which disrupt the eating of sweets” (“Confections” 296). Some lollies metaphorically violate a different kind of food taboo by taking the form of “unclean” animals like rats, pythons, worms, cats, dinosaurs, blowflies, cane toads, and geckos. This highlights the arbitrary nature of food categories: snakes, lizards, and witchetty grubs do not feature on European menus, but indigenous Australians eat them. Neither do white Australians eat horses, frogs, cats, dogs, and insects, which are considered delicacies in other cultures, some even in other European cultures. Eating human beings is widely-considered taboo, but children enjoy eating lollies shaped like parts of the human body. A fundraiser at a Queensland school fete in 2009 epitomised the contemporary fascination with consuming body parts. Traditionally, the Guess-The-Number fundraiser involves guessing the number of jelly beans in a glass jar, but in this instance the jar held teeth, lips, noses, eyeballs, ears, hearts, and feet. Similarly, when children eat Tongue Pops—tangy tongue-shaped lollies on a stick—the irony of having two tongues, of licking your own tongue, is not lost on children. Other lollies represent tiny people, and even babies. In the ordinary world, children are small and powerless, but the magic of lollies enables them to be the man-eating giant, while Chicos and jelly babies represent the powerless child. Children welcome the opportunity to “bite someone else’s head off” for a change. These lollies are anonymous people, but Freddo Frog and Caramello Koala have names as well as bodies and facial features, while others, like Cadbury’s seven Magical Elves, even have personalities. One of these, Aquamarine, is depicted as a winking character dressed in blue, and described on the wrapper as “a talented musician who plays music to inspire the Elves to enjoy themselves and work harder, but is a bit of a farty pants.” Advertisements also commonly personify lollies by giving them faces, voices, and limbs, so that even something as un-humanlike as a red ball, in the case of the Jaffa, is represented as a cheeky character in the act of running away. And children happily eat them all. Cannibalism rates highly in the world of children’s confectionery (James 298). If lollies are “metaphoric rubbish,” as James explains, they can also be understood as metaphorically breaking food taboos (299). Not only do children’s rituals create a sense of friendship, belonging, even intimacy, but engaging in them is also an act of power because children know that these practices disgust adults. Lollies give children permission to transgress the rules of civilised eating and this carnivalesque subversion is part of the pleasure of eating lollies. James suggests that confectionery is neither raw nor cooked, but belongs to a third food category that helps to define “the disorderly and inverted world of children” (“Confections” 301). In James’ analysis, children and adults inhabit separate worlds, and she views children’s sweets as part of the “alternative system of meanings through which [children] can establish their own integrity” (“Confections” 301, 305). In the sense that they exist outside of officialdom, children have inherited the carnivalesque tradition of the festive life, which Bakhtin theorises as “a second world” organised on the basis of laughter (6, 8). In this topsy-turvy, carnivalesque realm, with its emphasis on the grotesque body, laughter, fun, exuberance, comic rituals, and other non-official values, children escape adult rule. Lollies may be rubbish in the adult world, but, like the carnival fool, they are “king” in the child’s second and festive life, where bodies bulge, feasting is a public and often grotesque event, and children are masters of their own destiny. Eating lollies, then, represents a “metaphoric chewing up of adult order” and a means of the child assuming control over at least one of its orifices (James 305-6). In this sense, the pig is not a symbol of the uncivilised but the un-adult. Children are pigs with sugar—slubbering around hard lollies, licking other children’s lollies, metaphorically cannibalising jelly babies—and if they disgust adults it is because they challenge the eating norms that guard against the ever-present reminder that eating is an animal act. Eating practices “civilize the human animal” (Kass 131), but eating is inherently an untidy experience, and any semblance of order, as anthropologist Mary Douglas explains, is only created by exaggerating difference (qtd. in Ashley et al. 3). The pig is commonly understood to be the antithesis of civilisation and, therefore, the means by which we understand ourselves as civilised beings. The child with a lolly, however, is evidence that the line between human and animal is a tenuous divide. References Ashley, Bob, Joanne Hollows, Steve Jones and Ben Taylor. Food and Cultural Studies. London: Routledge, 2004. Bakhtin, Mikhail. Rabelais and His World. Trans.Helene Iswolsky. Cambridge: M.I.T. P, Massachusetts Institute of Technology, 1968. Hendrickson, Robertson. The Great American Chewing Gum Book. Radnor, Pennsylvania: Chilton, 1976. James, Allison. “Confections, Concoctions and Conceptions.” Popular Culture: Past and Present. Eds Bernard Waites, Tony Bennett and Graham Martin. London: Routledge, 1986. 294-307. James, Allison. “The Good, the Bad and the Delicious: The Role of Confectionery in British Society.” Sociological Review 38, 1990: 666-88. Kass, Leon R. The Hungry Soul: Eating and the Perfecting of Our Nature. New York: Free Press, 1994. Lindsay, Norman. Saturdee. London: Angus & Robertson, 1981. Miller, William Ian. “Darwin’s Disgust.” Empire of the Senses: The Sensual Culture Reader. Ed. David Howes. Oxford: Berg, 2005. Miller, William Ian. The Anatomy of Disgust. Cambridge: Harvard U P, 1997. Mason, Laura. Sugar Plums and Sherbet: The Pre-history of Sweets. Devon: Prospect, 1998. Richardson, Tim. Sweets: A History of Temptation. London: Bantam Books, 2003. Twain, Mark. The Adventures of Tom Sawyer. New York: Collier, 1962. Whittaker, Nicholas. Sweet Talk: The Secret History of Confectionery. London: Phoenix, 1999. Zusak, Markus. The Book Thief. Sydney: Picador, 2005.
APA, Harvard, Vancouver, ISO, and other styles
30

Graf, Shenja van der. "Blogging Business." M/C Journal 7, no. 4 (October 1, 2004). http://dx.doi.org/10.5204/mcj.2395.

Full text
Abstract:
SuicideGirls.com In September 2001 two entrepreneurs Missy (coal-black Betty Page bangs and numerous tattoos) and Sean launched SuicideGirls.com. With their backgrounds in graphic design, programming and photography, they came up with the idea of launching an alternative adult site that started out as “a kind of an art project” — it grew out of an interest in Bunny Yeager’s pinup photos, where the control and attitude of the sexy women were emphasized, only now it was about pierced and tattooed females. Missy describes the portrayal of women on the site in the following words: The site is about the girls being in control and being in charge of how they’re portrayed. It’s also proof that sexuality and beauty aren’t mutually exclusive of intelligence, and we wanted to showcase all of the girls, but leave people guessing a little bit. There’s no need to go full-blown porno. SuicideGirls.com is an adult community that offers a mix of eroticism, creativity, personality and intelligence. SuicideGirls is about so-called empowered eroticism; it provides a site where girls outside of mainstream culture can express their individual style through soft erotic images, and web logs. Every week the site introduces new SuicideGirls, every day new pictures are added; a full national calendar of events is frequently updated and is searchable by location, date or keyword — members can be looked up by name, age, location or keywords; the site also features a magazine section with original fiction, articles and interviews with celebrities. What makes this site especially interesting is that each SuicideGirl has her own page featuring a pertinent profile with personal information such as age, stats, body mods, favorite books, music, sex positions, and current crushes. She can also put up pictures and video materials — including a web cam — of herself, express her thoughts and share her daily experiences in a blog, comment on other blogs and message boards, chat in designated chat rooms, and organize online and offline events. Kate78, Texan-born, is a regular blogger. She writes about her studies in Kansas City, a city she has come to hate after she learned that her car insurance could only be renewed in Texas. She describes herself as a “punk rock chick” — illustrated by pictures that show her with long spiky hair; she has got her nose pierced and her many tattoos — and a “suicidegirl”. There are plenty of blogs — e.g. LiveJournal, Blogspot, Punklog — where girls write about wanting to become a SuicideGirl. The girls are mainly motivated by a wish to share their bodily art paralleled by a sense of being in control over their image and admirers (they keep control over the photo sets and shoots). SuicideGirls.com is foremost an online community and therefore girls from all over the world can potentially become a SuicideGirl, as long as they have access to the Internet in order to publish to their personal page. These girls are in charge of their own online presentation, supported by a lively community where both women and men interact by reading and posting to the girls and each other’s blogs. In addition, members of the site can also post local events to the SuicideGirl calendar or the message boards, comment on pictures, and even hook up with one another. With the ability for members to create their own page, with their own profile picture and personal information, members can search for one another based on location, age, sex and personal preferences. Indeed, not only the SuicideGirls themselves have online pages to fill: subscribers to SuicideGirls.com have similar ‘privileges’, with the exception that they have to pay a small fee of $4 per month — though they can never refer to themselves as SuicideGirl: anyone entering the site has to log in as either ‘SuicideGirl’ or ‘Member’. Thus, SuicideGirls.com mixes a DIY attitude with alternative culture — especially Gothic, Punk and Emo — resulting in an appealing grassroots approach to sexuality that is of interest to both women and men. At the same time, the public identity of a SuicideGirl is constructed within a particular textual context dependent on commercial drivers. Through attracting fans on the basis of her “autonomous” self-representation — Goth fans, for instance — she brings in customers, raising questions about the tensions between “grassroots” self-representation and corporate branding. Collaborative Eroticism as Business Model We should document the interactions that occur among media consumers, between media consumers and media texts and between media consumers and media producers. The new participatory culture is taking shape at the intersection between three trends: 1) new tools and technologies enable consumers to archive, annotate, appropriate and re-circulate media content; 2) a range of subcultures promote do-it-yourself (DIY) media production, a discourse that shapes how consumers have deployed those technologies; and 3) economic trends favoring the horizontally integrated media conglomerates encourage the flow of images, ideas and narratives across multiple media channels and demand more active modes of spectatorship” (Jenkins 157). Traditionally the organization of economic production is based on the idea that individuals order their productive activities either on managerial hierarchies, or on production that is based on market prices (Benkler). Peer production represents a new mode of organizing that is not based on relations of dependence (managerial hierarchies) nor relations of independence (markets) rather peer production involves relations of interdependence. Peer production is a heterarchy characterized by relations of minimal hierarchy and by organizational heterogeneity (Stark). While traditionally structured organizations attempt to maximize internal order and control by enforcing a hierarchical system and establishing standards and clear lines of authority (Powell), heterarchies exist through permitting and even fostering a diversity of organizational logics and minimizing conformity (Chan). With the introduction of Mosaic and the Pentium chip in the mid-1990s the notion of the organization of production profoundly changed. The Internet could be used for more than looking up information or sending email. Instead, it offers a structure where participants are not organized by managerial hierarchies nor governed by price signals rather where people formed networks to collaborate in open source software projects or effectively constructing ‘user-created search engines’ for the exchange of e.g., music files, games (KaZaA, Gnutella), news and chat. While the present moment is marked by a legal standoff between robust communities of users (cultural co-producers) and the established media industry (particularly the music and film industry), some elements of the corporate media world have taken a different approach, embracing the new technological use rather than attempting to outlaw it. These corporations have found their way to online participatory networks and are attempting to use them for their own good. For instance, companies like Coca-Cola, BMW, and Apple offer online spaces – often in the form of thinly veiled advertisements (‘advertainment’) – where people can play games, watch movies, share files and the like in order to create or promote a company’s product, service or brand. They crucially rely upon blurring the boundaries between production, distribution and consumption, encouraging the target audience to work for them. Whether by playing games with embedded advertising, or inadvertently sending marketing information back to advertisers, or simply by passing advertising texts within one’s circle of friends, the target audience and the larger dynamic of participatory networks are ‘used’ by corporations to achieve their ends. SuicideGirls.com is a good example example of this emerging mode of (commons-based) peer production in a digitally networked environment – i.e. groups of individuals who participate in online shared spaces driven by diverse motivations, and serving corporate as well as community needs. The SuicideGirls’ blogs are the shared currency that binds SuicideGirls.com and its erotic consumers together as a “community”: SuicideGirls.com taps into online communities by enabling collaborative eroticism. Moving beyond adult entertainment, this trend of using blogs for commercial purposes raises interesting questions regarding, on the one hand, the cultural status of online blogging from a commercial perspective, e.g., how should we consider the cultural status of artifacts such as blogs that have commerce at the core of their identity: Can we speak of a displacement of aesthetic experience by the branding experience, or might these two experiences be seen as part of a continuum?; and, on the other hand, regarding participatory culture in a commercially mediated environment: e.g., What is the status of b2c, c2c, and p2p in a commercially structured network; What are the implications for user appropriation? The answers to these questions among others studied by various academic disciplines may contribute to the building of a framework for examining the consequences of this strategic shift towards relating to, reaching out to and linking online customers in a commercial web (b)log. Acknowledgement Anja Rau, thank you for your feedback. References Banerjee, A. “A Simple Model of Herd Behavior.” Quarterly Journal of Economics 1992: 797-817. Barabási, A. L. Linked: The New Science of Networks. Cambridge, MA: Perseus Publishing, 2002. Benkler, Y. “Coase’s Penguin, or, Linux and The Nature of the Firm.” Yale Law Journal, Winter v.04.3 2002-03. http://personal.uncc.edu/alblanch/SOVC.pdf. http://www.dcs.napier.ac.uk/~mm/socbytes/feb2002_i/9.html Castells, M. The Rise of the Network Society. Oxford: Blackwell, 2000. Castells, M. The Internet Galaxy: Reflections on the Internet, Business and Society. Oxford: Oxford University Press, 2001. Chan, A. Collaborative News Networks: Distributed Editing, Collective Action, and the Construction of Online News on Slashdot.org. Thesis M.Sc. at MIT’s Comparative Media Studies, 2002). http://www.marketing.unsw.edu.au/HTML/mktresearch/workingpapers/Cowley_Rossiter02_6.pdf http://www.xdreze.org/vitae1.pfd Du Gay, P.& Pryke, M. Cultural Economy. London: Sage Publications, 2002. Dyer, R., Stars (Revised). London: British Film Institute, 1998. Hagel, J. & Armstrong, A. Net Gain: Expanding Markets Through Virtual Communities. USA: McKinsey & Company, Inc., 1997.; Hebditch, D. and Anning, N. Porn Gold: Inside the Pornography Business. London: Faber & Faber, 1988. Jenkins, H. “Interactive audiences?” In Harries, D., ed. The New Media Book. London: British Film Institute, 2002. Kottler, P. Marketing Management: The Millennium Edition. Upper Saddle River, NJ: Prentice Hall, 2000. Mayzlin, D. Promotional Chat on the Internet. PhD dissertation, MIT, Sloan School of Management, 2001. Oram, A. Peer-To-Peer: Harnessing the Power of Disruptive Technologies. Sebastopol: O’Reilly & Associates, 2001. O’Toole, L. Pornocopia: Porn, Sex, Technology and Desire. London: Serpent’s Tail, 1998. Pine, J. and Gilmore, J. The Experience Economy: Work is Theatre & Every Business a Stage. Boston: Harvard Business School Press, 1999. Powell, W. “Neither Market nor Hierarchy: Network Forms of Organization.” Research in Organizational Behavior, 12, 1990: 295-336. Schmitt, B. & Simonson, A. Marketing Aesthetics: The Strategic Management of Brands, Identity, and Image. New York: The Free Press, 1997. Slater, D. Consumer Culture and Modernity. Cambridge: Polity Press, 1997.Slater, D. and Tonkiss, F. Market Society: Markets and Modern Social Theory. Cambridge: Polity Press, 2001. http://www.stanford.edu/~woodyp/papers/capitalist_firm.pdf Stone, A. R. The War of Desire and Technology at the Close of the Mechanical Age. Cambridge, MA: MIT Press, 1996. Sunstein C. Behavioral Law and Economics. Cambridge University Press, 2000. Thompson, J.B. The Media and Modernity: A Social Theory of the Media. Cambridge: Polity Press, 1995. Watts, D. and Strogatz, S. “Collective Dynamics of ‘Small-World’ Networks.” Nature, 393, 1998: 440-442. Williams, L. Hard Core: Power, Pleasure and the ‘Frenzy of the Visible’. London: Pandora Press, 1990. MLA Style Van der Graf, Shenja. "Blogging Business: SuicideGirls.com." M/C Journal 7.4 (2004). 10 October 2004 <http://www.media-culture.org.au/0410/07_suicide.php>. APA Style Van der Graf, S. (2004 Oct 11). Blogging Business: SuicideGirls.com, M/C Journal, 7(4). Retrieved Oct 10 2004 from <http://www.media-culture.org.au/0410/07_suicide.php>
APA, Harvard, Vancouver, ISO, and other styles
31

Wessell, Adele. "Making a Pig of the Humanities: Re-centering the Historical Narrative." M/C Journal 13, no. 5 (October 18, 2010). http://dx.doi.org/10.5204/mcj.289.

Full text
Abstract:
As the name suggests, the humanities is largely a study of the human condition, in which history sits as a discipline concerned with the past. Environmental history is a new field that brings together scholars from a range of disciplines to consider the changing relationships between humans and the environment over time. Critiques of anthropocentrism that place humans at the centre of the universe or make assessments through an exclusive human perspective provide a challenge to scholars to rethink our traditional biases against the nonhuman world. The movement towards nonhumanism or posthumanism, however, does not seem to have had much of an impression on history as a discipline. What would a nonhumanist history look like if we re-centred the historical narrative around pigs? There are histories of pigs as food (see for example, The Cambridge History of Food which has a chapter on “Hogs”). There are food histories that feature pork in terms of its relationship to multiethnic identity (such as Donna Gabaccia’s We Are What We Eat) and examples made of pigs to promote ethical eating (Singer). Pigs are central to arguments about dietary rules and what motivates them (Soler; Dolander). Ancient pig DNA has also been employed in studies on human migration and colonisation (Larson et al.; Durham University). Pigs are also widely used in a range of products that would surprise many of us. In 2008, Christien Meindertsma spent three years researching the products made from a single pig. Among some of the more unexpected results were: ammunition, medicine, photographic paper, heart valves, brakes, chewing gum, porcelain, cosmetics, cigarettes, hair conditioner and even bio diesel. Likewise, Fergus Henderson, who coined the term ‘nose to tail eating’, uses a pig on the front cover of the book of that name to suggest the extraordinary and numerous potential of pigs’ bodies. However, my intention here is not to pursue a discussion of how parts of their bodies are used, rather to consider a reorientation of the historical narrative to place pigs at the centre of stories of our co-evolution, in order to see what their history might say about humans and our relationships with them. This is underpinned by recognition of the inter-relationality of humans and animals. The relationships between wild boar and pigs with humans has been long and diverse. In a book exploring 10,000 years of interaction, Anton Ervynck and Peter Rowley-Conwy argue that pigs have been central to complex cultural developments in human societies and they played an important role in human migration patterns. The book is firmly grounded within the disciplines of zoology, anthropology and archaeology and contributes to an understanding of the complex and changing relationship humans have historically shared with wild boar and domestic pigs. Naturalist Lyall Watson also explores human/pig relationships in The Whole Hog. The insights these approaches offer for the discipline of history are valuable (although overlooked) but, more importantly, such scholarship also challenges a humanist perspective that credits humans exclusively with historical change and suggests, moreover, that we did it alone. Pigs occupy a special place in this history because of their likeness to humans, revealed in their use in transplant technology, as well as because of the iconic and paradoxical status they occupy in our lives. As Ervynck and Rowley-Conwy explain, “On the one hand, they are praised for their fecundity, their intelligence, and their ability to eat almost anything, but on the other hand, they are unfairly derided for their apparent slovenliness, unclean ways, and gluttonous behaviour” (1). Scientist Niamh O’Connell was struck by the human parallels in the complex social structures which rule the lives of pigs and people when she began a research project on pig behaviour at the Agricultural Research Institute at Hillsborough in County Down (Cassidy). According to O’Connell, pigs adopt different philosophies and lifestyle strategies to get the most out of their life. “What is interesting from a human perspective is that low-ranking animals tend to adopt one of two strategies,” she says. “You have got the animals who accept their station in life and then you have got the other ones that are continually trying to climb, and as a consequence, their life is very stressed” (qtd. in Cassidy). The closeness of pigs to humans is the justification for their use in numerous experiments. In the so-called ‘pig test’, code named ‘Priscilla’, for instance, over 700 pigs dressed in military uniforms were used to study the effects of nuclear testing at the Nevada (USA) test site in the 1950s. In When Species Meet, Donna Haraway draws attention to the ambiguities and contradictions promoted by the divide between animals and humans, and between nature and culture. There is an ethical and critical dimension to this critique of human exceptionalism—the view that “humanity alone is not [connected to the] spatial and temporal web of interspecies dependencies” (11). There is also that danger that any examination of our interdependencies may just satisfy a humanist preoccupation with self-reflection and self-reproduction. Given that pigs cannot speak, will they just become the raw material to reproduce the world in human’s own image? As Haraway explains: “Productionism is about man the tool-maker and -user, whose highest technical production is himself […] Blinded by the sun, in thrall to the father, reproduced in the sacred image of the same, his rewards is that he is self-born, an auto telic copy. That is the mythos of enlightenment and transcendence” (67). Jared Diamond acknowledges the mutualistic relationship between pigs and humans in Guns, Germs and Steel and the complex co-evolutionary path between humans and domesticated animals but his account is human-centric. Human’s relationships with pigs helped to shape human history and power relations and they spread across the world with human expansion. But questioning their utility as food and their enslavement to this cause was not part of the account. Pigs have no voice in the histories we write of them and so they can appear as passive objects in their own pasts. Traces of their pasts are available in humanity’s use of them in, for example, the sties built for them and the cooking implements used to prepare meals from them. Relics include bones and viruses, DNA sequences and land use patterns. Historians are used to dealing with subjects that cannot speak back, but they have usually left ample evidence of what they have said. In the process of writing, historians attempt to perform the miracle, as Curthoys and Docker have suggested, of restoration; bringing the people and places that existed in the past back to life (7). Writing about pigs should also attempt to bring the animal to life, to understand not just their past but also our own culture. In putting forward the idea of an alternative history that starts with pigs, I am aware of both the limits to such a proposal, and that most people’s only contact with pigs is through the meat they buy at the supermarket. Calls for a ban on intensive pig farming (RSPCA, ABC, AACT) might indeed have shocked people who imagine their dinner comes from the type of family farm featured in the movie Babe. Baby pigs in factory farms would have been killed a long time before the film’s sheep dog show (usually at 3 to 4 months of age). In fact, because baby pigs do grow so fast, 48 different pigs were used to film the role of the central character in Babe. While Babe himself may not have been aware of the relationship pigs generally have to humans, the other animals were very cognisant of their function. People eat pigs, even if they change the name of the form it takes in order to do so:Cat: You know, I probably shouldn’t say this, but I’m not sure if you realize how much the other animals are laughing at you for this sheep dog business. Babe: Why would they do that? Cat: Well, they say that you’ve forgotten that you’re a pig. Isn't that silly? Babe: What do you mean? Cat: You know, why pigs are here. Babe: Why are any of us here? Cat: Well, the cow’s here to be milked, the dogs are here to help the Boss's husband with the sheep, and I’m here to be beautiful and affectionate to the boss. Babe: Yes? Cat: [sighs softly] The fact is that pigs don’t have a purpose, just like ducks don’t have a purpose. Babe: [confused] Uh, I—I don’t, uh ... Cat: Alright, for your own sake, I’ll be blunt. Why do the Bosses keep ducks? To eat them. So why do the Bosses keep a pig? The fact is that animals don’t seem to have a purpose really do have a purpose. The Bosses have to eat. It’s probably the most noble purpose of all, when you come to think about it. Babe: They eat pigs? Cat: Pork, they call it—or bacon. They only call them pigs when they’re alive (Noonan). Babe’s transformation into a working pig to round up the sheep makes him more useful. Ferdinand the duck tried to do the same thing by crowing but was replaced by an alarm clock. This is a common theme in children’s stories, recalling Charlotte’s campaign to praise Wilbur the pig in order to persuade the farmer to let him live in E. B. White’s much loved children’s novel, Charlotte’s Web. Wilbur is “some pig”, “terrific”, “radiant” and “humble”. In 1948, four years before Charlotte’s Web, White had published an essay “Death of a Pig”, in which he fails to save a sick pig that he had bought in order to fatten up and butcher. Babe tried to present an alternative reality from a pig’s perspective, but the little pig was only spared because he was more useful alive than dead. We could all ask the question why are any of us here, but humans do not have to contemplate being eaten to justify their existence. The reputation pigs have for being filthy animals encourages distaste. In another movie, Pulp Fiction, Vincent opts for flavour, but Jules’ denial of pig’s personalities condemns them to insignificance:Vincent: Want some bacon? Jules: No man, I don’t eat pork. Vincent: Are you Jewish? Jules: Nah, I ain’t Jewish, I just don’t dig on swine, that’s all. Vincent: Why not? Jules: Pigs are filthy animals. I don’t eat filthy animals. Vincent: Bacon tastes gooood. Pork chops taste gooood. Jules: Hey, sewer rat may taste like pumpkin pie, but I’d never know ’cause I wouldn’t eat the filthy motherfucker. Pigs sleep and root in shit. That’s a filthy animal. I ain’t eat nothin’ that ain’t got sense enough to disregard its own feces [sic]. Vincent: How about a dog? Dogs eats its own feces. Jules: I don’t eat dog either. Vincent: Yeah, but do you consider a dog to be a filthy animal? Jules: I wouldn’t go so far as to call a dog filthy but they’re definitely dirty. But, a dog’s got personality. Personality goes a long way. Vincent: Ah, so by that rationale, if a pig had a better personality, he would cease to be a filthy animal. Is that true? Jules: Well we’d have to be talkin’ about one charming motherfuckin’ pig. I mean he’d have to be ten times more charmin’ than that Arnold on Green Acres, you know what I’m sayin’? In the 1960s television show Green Acres, Arnold was an exceptional pig who was allowed to do whatever he wanted. He was talented enough to write his own name and play the piano and his attempts at painting earned him the nickname “Porky Picasso”. These talents reflected values that are appreciated, and so he was. The term “pig” is, however, chiefly used a term of abuse, however, embodying traits we abhor—gluttony, obstinence, squealing, foraging, rooting, wallowing. Making a pig of yourself is rarely honoured. Making a pig of the humanities, however, could be a different story. As a historian I love to forage, although I use white gloves rather than a snout. I have rubbed my face and body on tree trunks in the service of forestry history and when the temperature rises I also enjoy wallowing, rolling from side to side rather than drawing a conclusion. More than this, however, pigs provide a valid means of understanding key historical transitions that define modern society. Significant themes in modern history—production, religion, the body, science, power, the national state, colonialism, gender, consumption, migration, memory—can all be understood through a history of our relationships with pigs. Pigs play an important role in everyday life, but their relationship to the economic, social, political and cultural matters discussed in general history texts—industrialisation, the growth of nation states, colonialism, feminism and so on—are generally ignored. However “natural” this place of pigs may seem, culture and tradition profoundly shape their history and their own contribution to those forces has been largely absent in history. What, then, would the contours of such a history that considered the intermeshing of humans and pigs look like? The intermeshing of pigs in early human history Agricultural economies based on domestic animals began independently in different parts of the world, facilitating increases in population and migration. Evidence for long-term genetic continuity between modern and ancient Chinese domestic pigs has been established by DNA sequences. Larson et al. have made an argument for five additional independent domestications of indigenous wild boar populations: in India, South East Asia and Taiwan, which they use to develop a picture of both pig evolution and the development and spread of early farmers in the Far East. Domestication itself involves transformation into something useful to animals. In the process, humans became transformed. The importance of the Fertile Crescent in human history has been well established. The area is attributed as the site for a series of developments that have defined human history—urbanisation, writing, empires, and civilisation. Those developments have been supported by innovations in food production and animal husbandry. Pig, goats, sheep and cows were all domesticated very early in the Fertile Crescent and remain four of the world’s most important domesticated mammals (Diamond 141). Another study of ancient pig DNA has concluded that the earliest domesticated pigs in Europe, believed to be descended from European wild boar, were introduced from the Middle East. The research, by archaeologists at Durham University, sheds new light on the colonisation of Europe by early farmers, who brought their animals with them. Keith Dobney explains:Many archaeologists believe that farming spread through the diffusion of ideas and cultural exchange, not with the direct migration of people. However, the discovery and analysis of ancient Middle Eastern pig remains across Europe reveals that although cultural exchange did happen, Europe was definitely colonised by Middle Eastern farmers. A combination of rising population and possible climate change in the ‘fertile crescent’, which put pressure on land and resources, made them look for new places to settle, plant their crops and breed their animals and so they rapidly spread west into Europe (ctd in ScienceDaily). Middle Eastern farmers colonised Europe with pigs and in the process transformed human history. Identity as a porcine theme Religious restrictions on the consumption of pigs come from the same area. Such restrictions exist in Jewish dietary laws (Kashrut) and in Muslim dietary laws (Halal). The basis of dietary laws has been the subject of much scholarship (Soler). Economic and health and hygiene factors have been used to explain the development of dietary laws historically. The significance of dietary laws, however, and the importance attached to them can be related to other purposes in defining and expressing religious and cultural identity. Dietary laws and their observance may have been an important factor in sustaining Jewish identity despite the dispersal of Jews in foreign lands since biblical times. In those situations, where a person eats in the home of someone who does not keep kosher, the lack of knowledge about your host’s ingredients and the food preparation techniques make it very difficult to keep kosher. Dietary laws require a certain amount of discipline and self-control, and the ability to make distinctions between right and wrong, good and evil, pure and defiled, the sacred and the profane, in everyday life, thus elevating eating into a religious act. Alternatively, people who eat anything are often subject to moral judgments that may also lead to social stigmatisation and discrimination. One of the most powerful and persuasive discourses influencing current thinking about health and bodies is the construction of an ‘obesity epidemic’, critiqued by a range of authors (see for example, Wright & Harwood). As omnivores who appear indiscriminate when it comes to food, pigs provide an image of uncontrolled eating, made visible by the body as a “virtual confessor”, to use Elizabeth Grosz’s term. In Fat Pig, a production by the Sydney Theatre Company in 2006, women are reduced to being either fat pigs or shrieking shallow women. Fatuosity, a blog by PhD student Jackie Wykes drawing on her research on fat and sexual subjectivity, provides a review of the play to describe the misogyny involved: “It leaves no options for women—you can either be a lovely person but a fat pig who will end up alone; or you can be a shrill bitch but beautiful, and end up with an equally obnoxious and shallow male counterpart”. The elision of the divide between women and pigs enacted by such imagery also creates openings for new modes of analysis and new practices of intervention that further challenge humanist histories. Such interventions need to make visible other power relations embedded in assumptions about identity politics. Following the lead of feminists and postcolonial theorists who have challenged the binary oppositions central to western ideology and hierarchical power relations, critical animal theorists have also called into question the essentialist and dualist assumptions underpinning our views of animals (Best). A pig history of the humanities might restore the central role that pigs have played in human history and evolution, beyond their exploitation as food. Humans have constructed their story of the nature of pigs to suit themselves in terms that are specieist, racist, patriarchal and colonialist, and failed to grasp the connections between the oppression of humans and other animals. The past and the ways it is constructed through history reflect and shape contemporary conditions. In this sense, the past has a powerful impact on the present, and the way this is re-told, therefore, also needs to be situated, historicised and problematicised. The examination of history and society from the standpoint of (nonhuman) animals offers new insights on our relationships in the past, but it might also provide an alternative history that restores their agency and contributes to a different kind of future. As the editor of Critical Animals Studies, Steve Best describes it: “This approach, as I define it, considers the interaction between human and nonhuman animals—past, present, and future—and the need for profound changes in the way humans define themselves and relate to other sentient species and to the natural world as a whole.” References ABC. “Changes to Pig Farming Proposed.” ABC News Online 22 May 2010. 10 Aug. 2010 http://www.abc.net.au/news/stories/2010/05/22/2906519.htm Against Animal Cruelty Tasmania. “Australia’s Intensive Pig Industry: The Intensive Pig Industry in Australia Has Much to Hide.” 10 Sep. 2010 http://www.aact.org.au/pig_industry.htm Babe. Dir. Chris Noonan. Universal Pictures, 1995. Best, Steven. “The Rise of Critical Animal Studies: Putting Theory into Action and Animal Liberation into Higher Education.” Journal for Critical Animal Studies 7.1 (2009): 9-53. Cassidy, Martin. “How Close are Pushy Pigs to Humans?”. BBC News Online 2005. 10 Sep. 2010 http://news.bbc.co.uk/2/hi/uk_news/northern_ireland/4482674.stmCurthoys, A., and Docker, J. “Time Eternity, Truth, and Death: History as Allegory.” Humanities Research 1 (1999) 10 Sep. 2010 http://www.anu.edu.au/hrc/publications/hr/hr_1_1999.phpDiamond, Jared. Guns, Germs and Steel: The Fates of Human Societies. New York: W. W. Norton, 1999. Dolader, Miguel-Àngel Motis. “Mediterranean Jewish Diet and Traditions in the Middle Ages”. Food: A Culinary History. Eds. Jean-Louis Flandrin and Massimo Montanari. Trans. Clarissa Botsford, Arthus Golhammer, Charles Lambert, Frances M. López-Morillas and Sylvia Stevens. New York: Columbia UP, 1999. 224-44. Durham University. “Chinese Pigs ‘Direct Descendants’ of First Domesticated Breeds.” ScienceDaily 20 Apr. 2010. 29 Aug. 2010 http://www.sciencedaily.com/releases/2010/04/100419150947.htm Gabaccia, Donna R. We Are What We Eat: Ethnic Food and the Making of Americans. Cambridge: Harvard University Press, 1998. Grosz, Elizabeth. Volatile Bodies: Toward a Corporeal Feminism. St Leonards: Allen & Unwin, 1994. Haraway, D. “The Promises of Monsters: A Regenerative Politics for Inappropriate/d Others.” The Haraway Reader. New York: Routledge, 2005. 63-124. Haraway, D. When Species Meet: Posthumanities. 3rd ed. London: University of Minnesota Press, 2008. Henderson, Fergus. Nose to Tail Eating: A Kind of British Cooking. London: Bloomsbury, 2004. Kiple, Kenneth F., Kriemhild Coneè Ornelas. Cambridge History of Food. Cambridge: Cambridge University Press, 2000. Larson, G., Ranran Liu, Xingbo Zhao, Jing Yuan, Dorian Fuller, Loukas Barton, Keith Dobney, Qipeng Fan, Zhiliang Gu, Xiao-Hui Liu, Yunbing Luo, Peng Lv, Leif Andersson, and Ning Li. “Patterns of East Asian Pig Domestication, Migration, and Turnover Revealed by Modern and Ancient DNA.” Proceedings of the National Academy of Sciences, United States 19 Apr. 2010. 10 Sep. 2010 http://www.pnas.org/cgi/content/full/0912264107/DCSupplemental Meindertsma, Christien. “PIG 05049. Kunsthal in Rotterdam.” 2008. 10 Sep. 2010 http://www.christienmeindertsma.com/index.php?/books/pig-05049Naess, A. “The Shallow and the Deep, Long-Range Ecology Movement.” Inquiry 16 (1973): 95-100. Needman, T. Fat Pig. Sydney Theatre Company. Oct. 2006. Noonan, Chris [director]. “Babe (1995) Memorable Quotes”. 10 Sep. 2010 http://www.imdb.com/title/tt0112431/quotes Plumwood, V. Feminism and the Mastery of Nature. London: Routledge, 1993. Pulp Fiction. Dir. Quentin Tarantino. Miramax, 1994. RSPCA Tasmania. “RSPCA Calls for Ban on Intensive Pig Farming.” 10 Sep. 2010 http://www.rspcatas.org.au/press-centre/rspca-calls-for-a-ban-on-intensive-pig-farming ScienceDaily. “Ancient Pig DNA Study Sheds New Light on Colonization of Europe by Early Farmers” 4 Sep. 2007. 10 Sep. 2010 http://www.sciencedaily.com/releases/2007/09/070903204822.htm Singer, Peter. “Down on the Family Farm ... or What Happened to Your Dinner When it was Still an Animal.” Animal Liberation 2nd ed. London: Jonathan Cape, 1990. 95-158. Soler, Jean. “Biblical Reasons: The Dietary Rules of the Ancient Hebrews.” Food: A Culinary History. Eds. Jean-Louis Flandrin and Massimo Montanari. Trans. Clarissa Botsford, Arthus Golhammer, Charles Lambert, Frances M. López-Morillas and Sylvia Stevens. New York: Columbia University Press, 1999. 46-54. Watson, Lyall. The Whole Hog: Exploring the Extraordinary Potential of Pigs. London: Profile, 2004. White, E. B. Essays of E. B. White. London: HarperCollins, 1979. White, E. B. Charlotte’s Web. London: HarperCollins, 2004. Wright, J., and V. Harwood. Eds. Biopolitics and the ‘Obesity Epidemic’. New York: Routledge, 2009. Wykes, J. Fatuosity 2010. 29 Aug. 2010 http://www.fatuosity.net
APA, Harvard, Vancouver, ISO, and other styles
32

Green, Lelia, Leesa Bonniface, and Tami McMahon. "Adapting to a New Identity." M/C Journal 10, no. 2 (May 1, 2007). http://dx.doi.org/10.5204/mcj.2647.

Full text
Abstract:
Apart from its negative literary connotations, the notion of adaptation generally carries an optimistic connotation in the sense that it is most often associated with an improved outcome in the face of challenging circumstances. However, this is not an inevitable response to an adaptive imperative: there are often indicators of significant failure to adapt. In short, there is often evidence of maladaption. Examples include the spiralling rates of heart disease, obesity and adult-onset diabetes that have characterised richer western populations over the past half-century. Arguably, the West as a whole has failed to adapt to the health opportunities provided by plentiful food supplies. Instead, a growing dietary emphasis upon refined carbohydrates (including simple sugars) and animal-sourced protein (including dairy foods) is harming these populations. This paper applies the metaphors of adaptation and maladaptation to the development of a new sense of self following a diagnosis of heart disease. There is a range of evidence to suggest that newly-diagnosed heart patients resist accepting the implications of lifestyle-related heart disease. Such a lack of acceptance can impact upon short-term health, exercise and diet priorities, as well as upon long-term life expectancy. While this paper does not describe a medical, but a cultural approach to the well-adapted self as heart patient, it is also important to stress that there is a significant range of heart conditions that are not lifestyle related. Counterproductively, the links increasingly made between lifestyle choices and heart disease mean that many heart patients feel “punished” by people with healthy hearts who seem to assume that the patient is to “blame”. Nonetheless, there are few heart patients who cannot positively impact their health and recovery prospects by improving lifestyle choices. Ladwig and his research team argue that the challenge lies in getting heart patients to take their illness seriously without precipitating a traumatically negative view of the experience of illness. Such a negative view may, in itself, facilitate poor outcomes. These perspectives indicate that issues of communication and identity—that is, cultural imperatives—are important determinants of a healthy recovery. This paper records and analyses recent research relating to heart patients who are members of an online support community, HeartNET. HeartNET is an experimental Website funded by two Australian Research Council Linkage Grants (2004-10), with the National Heart Foundation (WA Division) as the industry partner. The authors/researchers speculate that engagement in the HeartNET online community enables the positive adaptation of an individual’s sense of self (rather than the fostering of a maladaptive identity, including a denial of the implications of heart disease that can lead to behaviours which promote morbidity). Early indications are that supportive online interactions can foster the development of a positive persona of a “heart patient“. At the optimistic end of the response-spectrum, a positive heart patient is a person who is keenly motivated to maximise their health and—if possible—halt or reverse (see, for example, Esselstyn) the progress of their disease. Such a response can be constituted and enhanced via supportive online interactions. Insofar as medical commentators theorise about reactions to a life-changing health diagnosis, this tends to be in terms of self-image (see, for example, Petrie et al.) and sometimes includes Kubler-Ross’s stages of grief: Denial, Anger, Bargaining, Depression and Acceptance. The results reported here look instead at issues of adapting to a new identity as “heart patient” that potentially involves positive commitment to improved health, partly as a result of giving and receiving social support. The rationale behind this perspective is influenced by significant evidence that compliance with the therapeutic regimes recommended and prescribed by physicians is lacking. It is speculated that patients are enacting a denial of the importance of the health challenges confronting them. For example, Hugtenburg et al. found that “of 232 first-time chronic medicine prescriptions [repeats], 132 were not collected at all (46.1%) or too late (11%).” Noting that 46% of the 232 prescriptions studied were for cardiovascular drugs (353), Hugtenburg et al. conclude that “This kind of non-compliance may result in an increased health risk as well as constituting a waste of a large amount of money” (352). Clearly, more emphasis needs to be placed on communicating constructively with patients and supporting the evolution and reconstitution of an identity that includes positive constructions of self-as-heart-patient and that works to facilitate recovery. The Website that enables the HeartNET community was developed by the National Heart Foundation (WA Branch: NHFWA) and Edith Cowan University (ECU) as part of an ARC-Linkage grant, 2004-6 “Evaluating the effectiveness of online support in building community, promoting healthy behaviours and supporting philanthropy”. The first three months of the Website’s operation (when the tiny number of postings trickled away and then dried up completely) are reported in Bonniface et al. (“Affect”) and graphed below (see Figure 1). They followed on from a careful process of recruitment via databases of existing heart patients that were held by the NHFWA and supportive cardiologists. Participants were approached to gain ethical consent, and would-be Website participants were matched with people who had equivalent heart illness, but who weren’t invited to join the HeartNET community, thus acting as comparisons. Baseline data was collected to compare “before” the HeartNET intervention with the yet-to-be collected “after” data. The idea was to see if there were differences between the online and offline groups that could be attributed to Website activity. Instead, the first version of the supposed-community remained stillborn, and it wasn’t until the Website was thrown open to all comers that it began to thrive. This was a preliminary indication that an invitation to participate in a therapeutic community was not effective, by itself, in encouraging communication with people who shared important health-related experiences. While Website engagement might have fitted comparatively well into a (Kubler-Ross) Bargaining approach to heart patients’ illnesses (“I’ll help others, and they’ll help me”) the default position appeared to be non-engagement, possibly an indication of the patients having become “stuck“ in the first stage of grief, Denial. Even though the initial HeartNET participants were well established as heart patients, and had all been diagnosed some time earlier, it is possible that they preferred to ignore the implications of this for their health. Figure 1 records the patterns of postings made by the 68 people who agreed to join the HeartNET Web community and who signed and returned the ethical consent forms. Of the 68 people recruited, only 53 logged on (despite phone calls to every individual) and of the 53 who logged into the site, only 22 posted (Bonniface et al. “Affect”). The heaviest week’s traffic was 40 postings in Week 4. By Week 12, activity had ceased entirely. The decision to relaunch had been taken a fortnight earlier and the first iteration of the Website was closed down. Figure 1, reprinted from Bonniface et al (“Affect”) The relaunch of the Website made it available for anyone interested in participating, and membership and traffic both grew exponentially. Amongst other innovations were “newbie” icons (to indicate new members to be welcomed and nurtured), guest status (to “try before you buy”), and symbols to indicate whether the member was a heart patient, a family member or supporter, or an administrator. In due course a “ratings system“ was added to indicate the total number of member-postings to date, so that people could gauge an individual’s commitment and contribution to the community. People contributing up to 150 posts to discussion boards were allotted from one to five stars, while Superstar status indicated 1000-plus posts. One of the major differences between the group of heart patients invited to participate in the site’s first iteration, and the group that ultimately launched the Website as a viable and vibrant community, is that the second-stage members were generally recently diagnosed. The research team speculate that they were actively reconstituting their identities as heart patients, and they and their families consequently had many matters and issues they wanted to discuss. In effect, the people who joined the relaunched site were “learning“ to be heart patients. Weis et al., investigating a pharmaceutically-sponsored Website for MS sufferers, argued that “users are diverse” and “communication needs change over time [as the disease progresses]” (146). They found that, of the 943 users who responded to their online survey, indications were that participants used “the website the most during early stages of the disease” (135). However, one area the HeartNET research is investigating is whether a community-member whose persona includes “care and support for my Web community“ will continue to participate even after the first information-seeking phase of their illness is over. Support offered for new heart patients by cardiologists, hospital staff, other specialists and general practitioners is an important part of the enculturation of the self-as-heart-patient, but it leaves unexplored the more personal work of reconstituting the individual’s identity as a person with heart disease (or as a supporter of such a person). It also leaves unaddressed the sense of “aloneness“ that HeartNET members say they feel until they are able to talk regularly with people who understand exactly what they are going through, as a result of having already “been there“ themselves. Although health professionals, family and friends are supportive, that support is only occasionally able to cut through the isolation. Extracts from two (separate) interviews are typical of the kinds of comments made: Murphy: I mean the support from Sandra and the family was all great but—to actually talk to other people who know what you’re feeling and … Yes, nothing against family and friends but they’re [other patients are] going through the same thing, they know what you’re feeling and … you know. Margo: I found friends were pains. It was like “well, okay, but you’re better now, they fixed you.” Well I looked at her and I said, ‘“You’re never fixed, but [it’s] something you live with for the rest of your life that doesn’t go away. …’ The implication is that heart patients have a differential need to communicate with others about their experience of heart disease, and that the communicative imperative is greatest in the first stages of being a heart patient, soon after diagnosis. For the well-established patients invited to contribute to the original HeartNET Website, their status as people-with-heart-disease was no longer problematic. Consequently, they had little to say and very few incentives to revisit the adaptive processes of personal identity construction. People who are used to their status as a heart patient may be theorised as having very different information needs and behaviours compared with the newly diagnosed. There is evidence that at least some of these well established patients were prompted to engage when new patients who needed support joined the site in the second iteration. However, those who are never given the opportunity to interact and learn from others may take longer to reach a level of adaptation. Even worse, they may adopt maladaptive behaviours encompassing issues of denial or self-sabotage—such as rejecting medications or increasing behaviours which progress morbidity, such as smoking and excessive alcohol consumption. Patients’ denial of the implications of heart disease is recognised as a major medical problem. Cooper et al. (234) cite evidence from Petrie et al. that “only a third of eligible patients under 65 years old attended cardiac rehabilitation” while noting that “Ades et al. showed uptake as low as 21% in eligible patients over 62 years”. In another study of patients who did/did not adhere to their pharmacological treatment regime, Horwitz et al. found that “Compared with patients with good adherence, patients with poor adherence were twice as likely to have died within a year of follow-up.” They argue that “adherence may need to be viewed more broadly as encompassing a cluster of health-related behaviours that may influence the outcome of treatment.” The argument advanced in our paper is that such a broader view should also encompass necessary adaptation strategies which introduce positive influences to the formation of patient identity. Compliance with therapeutic and medical regimes has been linked to increased self esteem (Burkhart and Rayens), and the combination of compliance with a positive patient identity may well multiply beneficial health outcomes. Whereas currently a majority of recovering heart patients may be inferred as resisting a revised self-identity that takes their diagnosis and health challenges seriously, the HeartNET Website may offer an effective enticement to positive behavioural change. Bonniface et al. (“Shuffling buddies”) have demonstrated that engagement with HeartNET can influence attitudes to (and involvement in) exercise. The hypothesis regarding identity adaptation is that active HeartNET members, through Website engagement, consistently indicate a willingness to acknowledge their changed health status and work to develop a reconstituted identity as a person with a heart condition who is proactively maximising positive outcomes (and helping others to do so at the same time). This is particularly the case where the online engagement feeds into the offline world: where “shuffling buddies“ have developed mutually supportive walking and exercise regimes, involving social events, consistent with their commitment to health-enhancing activity. Adaptation strategies delivered online offer new ways to counter the maladaptive processes which can follow diagnosis. By using the raw materials of social support and Website engagement, patients can chart new and positive ways in which they progress from denial and bargaining to health-promoting acceptance. For those established patients, online engagement may progress the stages of grief beyond the level of acceptance to the end goal of “support” as they pass on their knowledge, empathy and understanding of illness to the newly diagnosed. References Ades, Philip, M. L. Waldman, W. J. McCann, and S. O. Weaver. “Predictors of Cardiac Rehabilitation Participation in Older Coronary Patients.” Archives of Internal Medicine 152.2 (1992): 1033-5. Bonniface, Leesa, Lelia Green, and Maurice Swanson. “Affect and an Effective Online Therapeutic Community.” M/C Journal 8.6 (2005). 22 Apr. 2007 . Bonniface, Leesa, Arshad Omari, and Maurice Swanson. “Shuffling Buddies—How an Online Community Supports Healthier Lifestyle Choices: An Early Indication of Physical Activity and Exercise Outcomes from the HeartNET Intervention.” Proceedings of the Fifth International Conference on Cultural Attitudes towards Technology and Communication. Eds. F Sudweeks, H Hrachovec and C Ess. Estonia, Tartu: School of Information Technology, Murdoch University, 2006. 90-101. Burkhart, Patricia, and Mary Rayens. “Self-Concept and Health Locus of Control: Factors Related to Children’s Adherence to Recommended Asthma Regimen.” Pediatric Nursing 31.5 (2005): 404-9. Campbell, Colin, and Thomas Campbell. The China Study: Startling Implications for Diet, Weight Loss and Long-Term Health. Dallas, TX: Benbella Books, 2004. Cooper, A., G., Lloyd, J. Weinman, and G. Jackson. “Why Patients Do Not Attend Cardiac Rehabilitation: Role of Intentions and Illness Beliefs.” Heart 82.2 (1999): 234-6. Horwitz, Ralph, Catherine Viscoli, Lisa Berkman, Robert Donaldson, Sarah Horwitz, Carolyn Murray, David Ransohoff, and Jody Sindelar. “Treatment Adherence and Risk of Death after a Myocardial Infarction.” The Lancet 336 (1990): 542-5. Hugtenburg, J. G., A. T. G. Blom, and S. U. Kisoensingh. “Initial Phase of Chronic Medication Use; Patients’ Reasons for Discontinuation.” British Journal of Clinical Pharmacology 61.3 (2005): 352-4. Kubler-Ross, Elisabeth. On Death and Dying: What the Dying Have to Teach Doctors, Nurses, Clergy, and Their Own Families. New York: Macmillan, 1969. Ladwig, Karl-Heinz, Andreas Schoefinius, Gerhard Dammann, Reinhold Danner, Rolf Gurtler, and Robert Hermann. “Long-Acting Psychotraumatic Properties of a Cardiac Arrest Experience.” American Journal of Psychiatry 156.6 (1999): 912-9. Esselstyn, C.B. Jr. Prevent and Reverse Heart Disease. New York: Penguin Group, 2007. Petrie, Keith, John Weinman, Sharpe Norman, and Judith Buckley. “Role of Patients’ View of Their Illness in Predicting Return to Work and Functioning after Myocardial Infarction: Longitudinal Study.” British Medical Journal 312 (1996): 1191-4. Weis, Robert, Keith Stamm, Craig Smith, Michael Nilan, Fiona Clark, Joan Weis, and Kate Kennedy. “Communities of Care and Caring: The Case of Mswatch.Com.” Journal of Health Psychology 8.1 (2003): 135-48. Citation reference for this article MLA Style Green, Lelia, Leesa Bonniface, and Tami McMahon. "Adapting to a New Identity: Reconstituting the Self as a Heart Patient." M/C Journal 10.2 (2007). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0705/13-bonnifacegreenmcmahon.php>. APA Style Green, L., L. Bonniface, and T. McMahon. (May 2007) "Adapting to a New Identity: Reconstituting the Self as a Heart Patient," M/C Journal, 10(2). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0705/13-bonnifacegreenmcmahon.php>.
APA, Harvard, Vancouver, ISO, and other styles
33

Wilson, Jason Anthony, and Jason Jacobs. "Obsolete." M/C Journal 12, no. 3 (July 15, 2009). http://dx.doi.org/10.5204/mcj.170.

Full text
Abstract:
Obsolescence is most frequently talked about in relation to the history of technology. A still-common way of understanding modernity is as a linear succession of emerging technologies which supersede existing ones, and which are themselves, in time, made redundant. The cycle of novelty and obsolescence underpins a narrative including episodes of human invention, mastery and eventual technological failure. Nevertheless, it makes technologies themselves the subjects of history, rather than the human beings whose choices frame their contingent births, shapings, adoptions and uses. Many have pointed out the extent to which this simplifies history, but this has made precious little impact, if the way in which many writers treat digital communications technologies is any guide. Professional new media evangelists, including media and cultural theorists who subscribe to what Turner describes as an entrenched “digital orthodoxy”, are nowadays wont to describing mass media – including all broadcast and print media – as “heritage” media. This neat rhetorical trick confirms all remaining manifestations and uses of such media as remnants of the past in the present, as curiosities, even perhaps as impediments to the “imaginary futures” (Barbrook) regularly projected onto new technologies. On the other hand, similar assumptions underlie narratives of decline and decay which attach themselves to new media technologies. Thus we can understand laments for the lost qualities (and quality) of old media from writers such as Andrew Keen, which themselves shape self-interested pronouncements about the decadence of the new communications environment from the highest echelons of established media (Hartigan). A history of scholarship from media historians has worked to try to nuance the contours of this oldest of modern stories, and to complicate the relationship between modernity, technological obsolescence, and social reality. Brian Winston’s work has shown how messy the business of invention and adoption is. Caroline Marvyn’s book When Old Technologies Were New showed how durable are the terms in which we are invited to link new technologies with progress. Lisa Gitelman’s Always Already New shows how complexly interweaved our understanding of media history is with our own media use. Collections like New Media, 1740-1915 and Residual Media have offered a number of theoretical critiques and case-studies which show the contemporary persistence of old media, and the recurrence of simplifying, totalising rhetorics of media history. More specifically, work like Sterne’s shows how contemplating obsolescence can give us a way of thinking about the downside of media change in terms of the problem of ecological damage in the form of e-waste. Most importantly for us, though, are those who use the category of obsolescence as a way of understanding that in the forward march of modernity, there are losers as well as winners. Watkins links technological obsolescence with the production of certain people, certain segments of the population as obsolescent. For him, obsolescent people can be understood as engaged in a “useless survival”, and are linked with obsolete technologies. David Simon, the creator of the television series The Wire, which richly depicted the “useless survival” of the city of Baltimore and its civic institutions, recently put this same position bluntly, linking obsolescence with class and race in contemporary America: these really are the excess people in America, we – our economy doesn't need them. We don't need ten or 15 percent of our population. And certainly the ones that are undereducated, that have been ill served by the inner city school system, that have been unprepared for the technocracy of the modern economy... The people most affected by this are black and brown and poor. It's the abandoned inner cores of our urban areas. And we don't, as we said before, economically, we don't need those people. The American economy doesn't need them. So, as long as they stay in their ghettos, and they only kill each other, we're willing to pay a police presence to keep them out of our America. (Moyers) Five series of The Wire showed the incapacity of police, labour unions, the school system, civic government and newspapers in serving those people who Zygmunt Bauman calls “human waste”, those who are “redundant” in the new economy. The decline of manufacturing industries, rapid advances in the capacity of communication technologies, and the troubled business models of “old media” have advantaged those with the skills and capacity to become “network capitalists” (Bradwell & Reeves) in the information era, but they have turned whole cities into what Bauman calls “waste yards”, wherein industries, social infrastructures and entire neighbourhoods are antiquated, surplus to requirements. In The Wire, those who are shown to benefit most readily from the collapse of these economic and social forces, from the improvements in networked communications, and the globalisation of trade are those who sell the drugs which have turned Baltimore’s inner city into a free-fire zone. Obsolescence, then, is a category which allows us to think about the destruction, or “useless persistence”, of the people, patterns of life and territories which are imbricated with those technologies which are seen as being past their prime. It allows us to think about the power that accrues to “early adopters” as against those who are forced to “make do” with older technologies, and how that power is often implicated in already-existing patterns of social disadvantage – how it maps onto existing class structures, or the horizontal inequalities of geography. But we can also think of the ways in which obsolete technologies are recuperated and celebrated, whether by resistant consumers or “fans” of a particular technology, or by the process whereby yesterday's trash is historicised and aestheticisied by collectors, curators and scholars. We also might reflect on our own practice as academics. To what extent are our traditional patterns of work lubricated and enhanced by digital processes, or are they themselves artefacts of the past. This issue of M/C Journal offers some specific meditations on the theme of obsolescence. The first three pieces think reflexively about the processes by which academics are credentialised and published. In our first feature, John Hartley wonders whether the passing of the traditional, paper scholarly journal as the main means for academic publication and community-building might not irrevocably change and even damage collegiality, and the way in which we understand our fields. Kate Bowles replies to Hartley in a piece which originated as a peer review of his paper, and which is published here at the request of both authors. For Bowles, Hartley’s focus on e-publishing and the obsolescence of paper journals is potentially a distraction – the real concern is the way in which bureaucratic rationality threatens to push organic forms of collegial behaviour into the dustbin of history. Donna Lee Brien argues that the traditional PhD may be obsolete, and it must change to reflect the needs of students, new models of learning, and the employment marketplace. The second group of articles asks questions about the inevitability of obsolescence, and case-studies of users pushing back against the obsolescence of favoured machines. In our second feature, Greg Shapley offers an expansive critique of the most fundamental recent narrative of obsolescence, which relies on the dichotomy of the analogue and the digital, and the supplanting of one by the other. Shapley complicates our history by relating the odd story of the fax machine. Peter Thomas shows how Super 8 cannot be approached simply, lazily as a fetishised object of nostalgia. He shows how Super 8 continues in use as a specialised filmmaking stock, but that its most crucial textural characteristics have been lost in the transition from widespread amateur use to professional applications. Huh and Ackerman discuss the determined resistance by users of the HP200LX PDA device to the discontinuation of the device. Our third set of articles rethink approaches to a technological field in which cycles of novelty and obsolescent are notoriously swift and prominent – computer games. James Newman unleashes an impassioned polemic regarding the need to preserve and archive “obsolete” games as an element of Britain’s and the world’s cultural heritage. Thompson, McAllister and Ruggill use their own efforts at curation and preservation as the starting point for a theoretical meditation on the relationships between nostalgia, collection and obsolescence. Chris Moore asks whether new methods of digital distribution might ameliorate one of the more pernicious side-effects of the games industry’s relentless focus on novelty – e-waste. He looks at the online distribution platform Steam as a venue where both hardware and software obsolescence may be countered and complicated by weightless distribution and the “long tail” effect. While acknowledging continuing concerns with Steam – for example concerns about user privacy – Moore wonders whether online distribution might make the more wasteful aspects of structured obsolescence, well, obsolete. Together, these articles make a contribution to a reorientation that’s already underway in media and cultural studies. It’s arguable that cultural and media studies perennial fetishisation of “youth”, subcultural and the new have been intensified by the shift to a focus on new media technologies. Perhaps this has been at the expense of a focus on the old, the ordinary, and what happened the day before yesterday. (Driscoll and Gregg) A focus on obsolescence allows us to count the complex costs of our perennial impulse to novelty. It allows us to think through the series of revaluations that technologies typically undergo as they pass from being the newest thing, to junk, to collectable. It helps us to think about the relationships between technology use and the social position of users. We present this as the first step in our own effort to bring a greater focus to the issues thrown up when we think about the obsolete. We hope you will enjoy this issue when it’s new, and not discard it lightly when the next one comes along. References Acland, Charles, ed. Residual Media. Minneapolis: University of Minnesota Press, 2007. Barbrook, Richard. Imaginary Futures: From Thinking Machines to the Global Village. London: Pluto, 2007. Bauman, Zygmunt. Wasted Lives: Modernity and its Outcasts. London: John Wiley and Sons, 2003. Bradwell, Peter, and Richard Reeves. Network Citizens: Power and Responsibility at Work. London: Demos, 2009. Driscoll, Catherine, and Melissa Gregg. “The YouTube Generation: Moral Panic, Youth Culture and Internet Studies” in Usha Rodrigues (ed) Youth and Media in the Asia-Pacific Region. Cambridge: Cambridge Scholars Press. 2008. Gitelman, Lisa. Always Already New: Media, History and the Data of Culture. Boston: MIT Press. Hartigan, John. “John Hartigan address to the National Press Club.” news.com.au. 9 July 2009 ‹http://www.news.com.au/heraldsun/story/0,21985,25718006-661,00.html›. Keen, Andrew. The Cult of the Amateur: How Today's Internet is Killing Our Culture. New York: Doubleday, 2007. Marvin, Carolyn. When Old Technologies Were New: Rethinking Electric Communication in the Nineteenth Century. Oxford: OUP, 1990. Moyers, Bill. “David Simon: Transcript.” Bill Moyers Journal. 9 July 2009 ‹http://www.pbs.org/cove-media/http/PBS_CP_Bill_Moyers/58/1000/transcript1.html›. Sterne, Jonathan. “Out With the Trash: On the Future of New Media.” Residual Media. Ed Charles Acland. Minneapolis: University of Minnesota Press, 2007. Turner, Graeme. “Television and the Nation: Does This Matter Anymore?” Television Studies After TV. Ed Graeme Turner and Jinna Tay. London and New York: Routledge, 2009. Watkins, Evan. Throwaways: Work, Culture and Consumer Education. Stanford: Stanford University Press, 1993. Winston, Brian. Media, Technology and Society: A History: From the Telegraph to the Internet. New York and London: Routledge, 1998.
APA, Harvard, Vancouver, ISO, and other styles
34

Kaden, Hamish. "The Interminable Son." M/C Journal 2, no. 3 (May 1, 1999). http://dx.doi.org/10.5204/mcj.1756.

Full text
Abstract:
Today, tomorrow, the dead, the unborn, the sick and dying. And me, can you see me? The thirty-five-year-old man, cross-legged in the large white tent where we speak of the dead? Another face in the hundred other faces. The walls are thick with thankas, pastel pinks and icy hells, skulls cups and lotus flowers. Mothers are rocking babies, fathers creak like old bones. We all inch forward to hear the large monk in yellow robes who says how forty-nine days after death we seek material form, see a range of lights, a chimera of colours. We drift to where our parents are making love and take form in the womb. To be reborn a human, he reminds us, is very, very rare. Breath in, breath out. Meaning of life through a contemplation on death. He says we need to remember to remember, but right now I wish I could forget. Me, on a midwinter night, in Christchurch. Twelve years old, naked and deep in the bath as a yellow cloud of piss bleeds out around my white and skinny knees. Downstairs, there are noises, milk bottles chinking, a coal shovel scraping, Pink Floyd and a maunder of women's voices. Back from a conference, they laugh and fret. Cars arrive, the door bell rings, and someone is met with cajoling welcome. Tonight it is busy, when for the last three days the house had been dead of life; just my brother in his room, my stepfather, Earl, fixing shelves in the bathroom, and me continually thinking about the conference, all those women, overseas speakers, delegates and workshops. Three thousand. To me it may as well have been the world. Everyone had gone. My mother, her friends, my sister. Even my gran had managed an afternoon on Sunday. "Yes darling," she said, mightily impressed, "all those girls rah-rah-rahing. Your mother up on stage. It was all quite a show." When they came in, I was sitting on the bench, picking a scab on my elbow. I remember, my mother, searching in her pockets for cigarettes and wrestling off her jacket. Her face had been tired and her eyes were sullen. Smoke eddied past her forehead as she reached up and unfastened her long tail of hair. Berwyn Sallychurch, six foot, pale and bony, was boasting about her workshop, 'Women and Guilt'. She was hunched over her hands, fixing herself a cracker and cheese when Earl came in from outside. He had his cotton work hat on, baggy corduroys and his hands looked cold and were splattered with paint. He stood in the middle of the room of women, cardboard roll, several brushes and a scrunched up sheet of paper in his hand. He bid them all a sheepish hello, to which my mother quickly smiled back, I examined my shoe, before he moved to the fire, tossed the rubbish into the red mouth of the fire and stabbed it with the poker. Berwyn was explaining how a woman broke down in the middle of her workshop. "The bit where I had them all writing down their childhoods, she starts up, wailing like an siren." "What did you do?" My mother rid her cigarette of ash with a quick flick of her finger. "Do!" Berwyn raised her hand. "What can you do? I said to her, 'Darling, you've got a lifetime of patriarchal conditioning to live down. It's gunna take a while.'" Berwyn went on saying how she asked the crying woman if she masturbated and how well the woman had responded to her question. Heads nodded, tea was poured, Earl skulked out the door. Another winter night, how I remember, all those noises, my mother's tired face, me in bath later on, trying to figure out this thing about asking someone if they masturbated, and really, who on earth would want to know? Footsteps up the stairs, then back down again, the door opening to myriad of sounds, cut through by my mother's indelible voice, just before the door slams. "Fuckin' silly bitch. When will she learn?" Who is the silly bitch? I lie back and consider. Patricia Hickey, the smut protector? She always gets a hiss and spit when she comes on the tellie. Or Lady Drayton, ex-mayoress, who has a thing for councillors and other women's husbands? One of the pro-life Spuckies, rabbit-breeding Catholic. It is hard to tell. There are so many silly bitches to choose from. The wall is tiled and chipped. It is peppered with splash marks and finger prints. On the shelf a tube of toothpaste is uncapped and oozing. Tooth brushes are scattered like pick-up sticks. There are two pictures tacked to the tiles. One is of a chart of all the kings and queens of England. The other picture, a real picture, is torn out of a magazine and its edges are frayed and have turned a shade of yellow. This is the one I look at. It isn't like the other pictures downstairs though, the ones in the hippy guides to mud huts and home births. There are no doctors with masks on, mothers grunting, hands being held, babies being squeezed out the lady's hole. I wouldn't show my friends. It's no fun. No fun at all. She is dead and flat on her face, arms out with her dress around her large, white buttocks. Blood is running out between her legs and at the bottom, beneath a twist of plastic tube, black letters say 'ABORTION -- A WOMAN'S RIGHT TO CHOOSE. KEEP IT OFF THE STREETS'. Everyday I see her, brushing my teeth, wiping my face, sitting on the loo. She is a reminder of how lucky I am, that she could be my mum or my sister, the lady who sent us a turkey at Christmas because she was religious and there was nothing else she could do; or maybe the one from last night when I answered the phone and she said 'Is your mum there darling?' distant and weepy. 'Please! Please! Can I speak to your mother?' From my wet, white toes to her grim, grainy print and world of lonely silence, my eyes and imagination move. How could they? The boyfriend, the husband, the doctors, Patricia Hickey, the stupid Catholics? How could they let her die? The tent flukes in the afternoon breeze. I can hear the sound of the waves and the occasional car. Figures pass by, feet on the sandy soil as I sit here aware that it has taken me three days; three days up the grassy slope, past the brazier wafting juniper and incense, past this shrine for the dead, three days looking down at my bare feet, their pale weave of bones, their callused heels upon the litter of green blades, the oak needles, ants and earth? Before me is a box containing many names, a masonite board and many different photos. The monk said he would give prayers for the unborn as well as the dead, and now the box is full and I must wedge my paper in. It contains a small offering, my mother's name, date of birth, date of death and a reason. As if we need a reason. My mother had her reasons. They were wrapped around her life like a shawl. At the National Archive that day, they were all that was left of a forty-seven-year-old life. In scribbles and scraps, cutouts and clippings, she was 'a notorious pioneer in New Zealand women's health, a fighter for justice, a heroine of reform', neatly assembled into two concertina folders. I sat at a neat desk in a large room with a head full of questions and a book full of scribbles. Proud? Of course I was proud. But when certain words fell off certain people's tongues, my skin crept and toes cramped. No. That woman they chorussed, the 'wonderful' 'strong' and 'gutsy' mother of mine, wasn't mine at all. She was theirs, sewn into their political imagination with the thread of nostalgia, traces of jealousy and fear. Hundred of pages attesting to her work: the back-breaking tedium of abortion politics, accounts, tax files, divvying up of funds, the 1977 Women's Conference, speakers to attend, registrations, flight details for women going to Australia, hotels booked, operating doctors. Q tried to get into Christchurch Women's Hospital. Refused. Found back street abortionist. Used catheter. Told to leave it in for a week -- bled badly. Emergency case Ch'ch Women's. Nearly died. Mrs M is a 44-year-old Maori woman, solo mother of 9. Husband left after service and never returned. She said herself that her children were a 'bit out of hand'. Just suffered a disc protrusion in her last pregnancy and spent six months in hospital severely depressed. In all the woman saw 7 doctors in order to obtain termination. The delays in appointments resulted in her being 16 weeks pregnant at the time of operation. Done for $250. I looked out the window at a seagull battling in the Wellington wind and could imagine my mother, labouring over a pad of paper and ashtray late at night. I wanted to hold her hand, share the load, tell her not to cry. I removed the file marked 'Personal' and was pulled out of my lament. It was brimming with letters, cringeful, naïve, mock militant letters that were bleedingly written and poorly spelt out. For me, they signalled a journey from boy to man along a fraught and fractured path. Letters from my mother's best friend to my mother, around the time they met, drunk in adoration, political vision and parochial feminist forecasts of 'Sisterhood' and 'Herstory'. From the halcyon high to inimical low, deceipt, and brokenheartedness, I could pin-point the letter written to my mother at the time of my seduction. "Dear Elizabeth," my new lover wrote. "You unmitigated bitch." Dozens of letters I stuffed in my sock, sick at the thought, feeling the camera in the corner, as if it were the eye of the world, laughing, goading and snickering at me, the feminist's son. 'Mine! Mine!' I want to shout. 'These letters are mine. No-one else's. Ya hear me. Got it!' And though I wanted it, no librarian's hand appeared on my shoulder, no one tried to stop me stealing. It was just me in that large room, and a small camera no one was even watching. From out of my shirt pocket I remove the photo and pin it to the masonite board. My mother, beside all the other photos of the dead, the polaroids and black and whites, has her hand on her chin and looks towards the early night sky. She wanted to see the Kauri trees before she died and her boyfriend drove them north. Her hand supports her chin and her face is alabaster in a red silhouette of sunset and trees. She wears a light-blue jumper and her black hair has not yet fallen out. That hair, once raven black and key to her bold symetry and audacious manner, dropped out in feathery lumps and left her like a small girl with frail shoulders and yellow skin. So many dead to ponder. My mother haunted by her past, was frightened to die. But for now at least, despite her driven face and questioning eyes, I see peace and a moment of closure. I breathe in, I breathe out. Citation reference for this article MLA style: Hamish Kaden. "The Interminable Son." M/C: A Journal of Media and Culture 2.3 (1999). [your date of access] <http://www.uq.edu.au/mc/9905/son.php>. Chicago style: Hamish Kaden, "The Interminable Son," M/C: A Journal of Media and Culture 2, no. 3 (1999), <http://www.uq.edu.au/mc/9905/son.php> ([your date of access]). APA style: Hamish Kaden. (1999) The interminable son. M/C: A Journal of Media and Culture 2(3). <http://www.uq.edu.au/mc/9905/son.php> ([your date of access]).
APA, Harvard, Vancouver, ISO, and other styles
35

Hawley, Erin. "Re-imagining Horror in Children's Animated Film." M/C Journal 18, no. 6 (March 7, 2016). http://dx.doi.org/10.5204/mcj.1033.

Full text
Abstract:
Introduction It is very common for children’s films to adapt, rework, or otherwise re-imagine existing cultural material. Such re-imaginings are potential candidates for fidelity criticism: a mode of analysis whereby an adaptation is judged according to its degree of faithfulness to the source text. Indeed, it is interesting that while fidelity criticism is now considered outdated and problematic by adaptation theorists (see Stam; Leitch; and Whelehan) the issue of fidelity has tended to linger in the discussions that form around material adapted for children. In particular, it is often assumed that the re-imagining of cultural material for children will involve a process of “dumbing down” that strips the original text of its complexity so that it is more easily consumed by young audiences (see Semenza; Kellogg; Hastings; and Napolitano). This is especially the case when children’s films draw from texts—or genres—that are specifically associated with an adult readership. This paper explores such an interplay between children’s and adult’s culture with reference to the re-imagining of the horror genre in children’s animated film. Recent years have seen an inrush of animated films that play with horror tropes, conventions, and characters. These include Frankenweenie (2012), ParaNorman (2012), Hotel Transylvania (2012), Igor (2008), Monsters Inc. (2001), Monster House (2006), and Monsters vs Aliens (2009). Often diminishingly referred to as “kiddie horror” or “goth lite”, this re-imagining of the horror genre is connected to broader shifts in children’s culture, literature, and media. Anna Jackson, Karen Coats, and Roderick McGillis, for instance, have written about the mainstreaming of the Gothic in children’s literature after centuries of “suppression” (2); a glance at the titles in a children’s book store, they tell us, may suggest that “fear or the pretence of fear has become a dominant mode of enjoyment in literature for young people” (1). At the same time, as Lisa Hopkins has pointed out, media products with dark, supernatural, or Gothic elements are increasingly being marketed to children, either directly or through product tie-ins such as toys or branded food items (116-17). The re-imagining of horror for children demands our attention for a number of reasons. First, it raises questions about the commercialisation and repackaging of material that has traditionally been considered “high culture”, particularly when the films in question are seen to pilfer from sites of the literary Gothic such as Mary Shelley’s Frankenstein (1818) or Bram Stoker’s Dracula (1897). The classic horror films of the 1930s such as James Whale’s Frankenstein (1931) also have their own canonical status within the genre, and are objects of reverence for horror fans and film scholars alike. Moreover, aficionados of the genre have been known to object vehemently to any perceived simplification or dumbing down of horror conventions in order to address a non-horror audience. As Lisa Bode has demonstrated, such objections were articulated in many reviews of the film Twilight, in which the repackaging and simplifying of vampire mythology was seen to pander to a female, teenage or “tween” audience (710-11). Second, the re-imagining of horror for children raises questions about whether the genre is an appropriate source of pleasure and entertainment for young audiences. Horror has traditionally been understood as problematic and damaging even for adult viewers: Mark Jancovich, for instance, writes of the long-standing assumption that horror “is moronic, sick and worrying; that any person who derives pleasure from the genre is moronic, sick and potentially dangerous” and that both the genre and its fans are “deviant” (18). Consequently, discussions about the relationship between children and horror have tended to emphasise regulation, restriction, censorship, effect, and “the dangers of imitative violence” (Buckingham 95). As Paul Wells observes, there is a “consistent concern […] that horror films are harmful to children, but clearly these films are not made for children, and the responsibility for who views them lies with adult authority figures who determine how and when horror films are seen” (24). Previous academic work on the child as horror viewer has tended to focus on children as consumers of horror material designed for adults. Joanne Cantor’s extensive work in this area has indicated that fright reactions to horror media are commonly reported and can be long-lived (Cantor; and Cantor and Oliver). Elsewhere, the work of Sarah Smith (45-76) and David Buckingham (95-138) has indicated that children, like adults, can gain certain pleasures from the genre; it has also indicated that children can be quite media savvy when viewing horror, and can operate effectively as self-censors. However, little work has yet been conducted on whether (and how) the horror genre might be transformed for child viewers. With this in mind, I explore here the re-imagining of horror in two children’s animated films: Frankenweenie and ParaNorman. I will consider the way horror tropes, narratives, conventions, and characters have been reshaped in each film with a child’s perspective in mind. This, I argue, does not make them simplified texts or unsuitable objects of pleasure for adults; instead, the films demonstrate that the act of re-imagining horror for children calls into question long-held assumptions about pleasure, taste, and the boundaries between “adult” and “child”. Frankenweenie and ParaNorman: Rewriting the Myth of Childhood Innocence Frankenweenie is a stop-motion animation written by John August and directed by Tim Burton, based on a live-action short film made by Burton in 1984. As its name suggests, Frankenweenie re-imagines Shelley’s Frankenstein by transforming the relationship between creator and monster into that between child and pet. Burton’s Victor Frankenstein is a young boy living in a small American town, a creative loner who enjoys making monster movies. When his beloved dog Sparky is killed in a car accident, young Victor—like his predecessor in Shelley’s novel—is driven by the awfulness of this encounter with death to discover the “mysteries of creation” (Shelley 38): he digs up Sparky’s body, drags the corpse back to the family home, and reanimates him in the attic. This coming-to-life sequence is both a re-imagining of the famous animation scene in Whale’s film Frankenstein and a tender expression of the love between a boy and his dog. The re-imagined creation scene therefore becomes a site of negotiation between adult and child audiences: adult viewers familiar with Whale’s adaptation and its sense of electric spectacle are invited to rethink this scene from a child’s perspective, while child viewers are given access to a key moment from the horror canon. While this blurring of the lines between child and adult is a common theme in Burton’s work—many of his films exist in a liminal space where a certain childlike sensibility mingles with a more adult-centric dark humour—Frankenweenie is unique in that it actively re-imagines as “childlike” a film and/or work of literature that was previously populated by adult characters and associated with adult audiences. ParaNorman is the second major film from the animation studio Laika Entertainment. Following in the footsteps of the earlier Laika film Coraline (2009)—and paving the way for the studio’s 2014 release, Boxtrolls—ParaNorman features stop-motion animation, twisted storylines, and the exploration of dark themes and spaces by child characters. The film tells the story of Norman, an eleven year old boy who can see and communicate with the dead. This gift marks him as an outcast in the small town of Blithe Hollow, which has built its identity on the historic trial and hanging of an “evil” child witch. Norman must grapple with the town’s troubled past and calm the spirit of the vengeful witch; along the way, he and an odd assortment of children battle zombies and townsfolk alike, the latter appearing more monstrous than the former as the film progresses. Although ParaNorman does not position itself as an adaptation of a specific horror text, as does Frankenweenie, it shares with Burton’s film a playful intertextuality whereby references are constantly made to iconic films in the horror genre (including Halloween [1978], Friday the 13th [1980], and Day of the Dead [1985]). Both films were released in 2012 to critical acclaim. Interestingly, though, film critics seemed to disagree over who these texts were actually “for.” Some reviewers described the films as children’s texts, and warned that adults would likely find them “tame and compromised” (Scott), “toothless” (McCarthy) or “sentimental” (Bradshaw). These comments carry connotations of simplification: the suggestion is that the conventions and tropes of the horror genre have been weakened (or even contaminated) by the association with child audiences, and that consequently adults cannot (or should not) take pleasure in the films. Other reviewers of ParaNorman and Frankenweenie suggested that adults were more likely to enjoy the films than children (O’Connell; Berardinelli; and Wolgamott). Often, this suggestion came together with a warning about scary or dark content: the films were deemed to be too frightening for young children, and this exclusion of the child audience allowed the reviewer to acknowledge his or her own enjoyment of and investment in the film (and the potential enjoyment of other adult viewers). Lou Lumenick, for instance, peppers his review of ParaNorman with language that indicates his own pleasure (“probably the year’s most visually dazzling movie so far”; the climax is “too good to spoil”; the humour is “deliciously twisted”), while warning that children as old as eight should not be taken to see the film. Similarly, Christy Lemire warns that certain elements of Frankenweenie are scary and that “this is not really a movie for little kids”; she goes on to add that this scariness “is precisely what makes ‘Frankenweenie’ such a consistent wonder to watch for the rest of us” (emphasis added). In both these cases a line is drawn between child and adult viewers, and arguably it is the film’s straying into the illicit area of horror from the confines of a children’s text that renders it an object of pleasure for the adult viewer. The thrill of being scared is also interpreted here as a specifically adult pleasure. This need on the part of critics to establish boundaries between child and adult viewerships is interesting given that the films themselves strive to incorporate children (as characters and as viewers) into the horror space. In particular, both films work hard to dismantle the myths of childhood innocence—and associated ideas about pleasure and taste—that have previously seen children excluded from the culture of the horror film. Both the young protagonists, for instance, are depicted as media-literate consumers or makers of horror material. Victor is initially seen exhibiting one of his home-made monster movies to his bemused parents, and we first encounter Norman watching a zombie film with his (dead) grandmother; clearly a consummate horror viewer, Norman decodes the film for Grandma, explaining that the zombie is eating the woman’s head because, “that’s what they do.” In this way, the myth of childhood innocence is rewritten: the child’s mature engagement with the horror genre gives him agency, which is linked to his active position in the narrative (both Norman and Victor literally save their towns from destruction); the parents, meanwhile, are reduced to babbling stereotypes who worry that their sons will “turn out weird” (Frankenweenie) or wonder why they “can’t be like other kids” (ParaNorman). The films also rewrite the myth of childhood innocence by depicting Victor and Norman as children with dark, difficult lives. Importantly, each boy has encountered death and, for each, his parents have failed to effectively guide him through the experience. In Frankenweenie Victor is grief-stricken when Sparky dies, yet his parents can offer little more than platitudes to quell the pain of loss. “When you lose someone you love they never really leave you,” Victor’s mother intones, “they just move into a special place in your heart,” to which Victor replies “I don’t want him in my heart—I want him here with me!” The death of Norman’s grandmother is similarly dismissed by his mother in ParaNorman. “I know you and Grandma were very close,” she says, “but we all have to move on. Grandma’s in a better place now.” Norman objects: “No she’s not, she’s in the living room!” In both scenes, the literal-minded but intelligent child seems to understand death, loss, and grief while the parents are unable to speak about these “mature” concepts in a meaningful way. The films are also reminders that a child’s first experience of death can come very young, and often occurs via the loss of an elderly relative or a beloved pet. Death, Play, and the Monster In both films, therefore, the audience is invited to think about death. Consequently, there is a sense in each film that while the violent and sexual content of most horror texts has been stripped away, the dark centre of the horror genre remains. As Paul Wells reminds us, horror “is predominantly concerned with the fear of death, the multiple ways in which it can occur, and the untimely nature of its occurrence” (10). Certainly, the horror texts which Frankenweenie and ParaNorman re-imagine are specifically concerned with death and mortality. The various adaptations of Frankenstein that are referenced in Frankenweenie and the zombie films to which ParaNorman pays homage all deploy “the monster” as a figure who defies easy categorisation as living or dead. The othering of this figure in the traditional horror narrative allows him/her/it to both subvert and confirm cultural ideas about life, death, and human status: for monsters, as Elaine Graham notes, have long been deployed in popular culture as figures who “mark the fault-lines” and also “signal the fragility” of boundary structures, including the boundary between human and not human, and that between life and death (12). Frankenweenie’s Sparky, as an iteration of the Frankenstein monster, clearly fits this description: he is neither living nor dead, and his monstrosity emerges not from any act of violence or from physical deformity (he remains, throughout the film, a cute and lovable dog, albeit with bolts fixed to his neck) but from his boundary-crossing status. However, while most versions of the Frankenstein monster are deliberately positioned to confront ideas about the human/machine boundary and to perform notions of the posthuman, such concerns are sidelined in Frankenweenie. Instead, the emphasis is on concerns that are likely to resonate with children: Sparky is a reminder of the human preoccupation with death, loss, and the question of why (or whether, or when) we should abide by the laws of nature. Arguably, this indicates a re-imagining of the Frankenstein tale not only for child audiences but from a child’s perspective. In ParaNorman, similarly, the zombie–often read as an articulation of adult anxieties about war, apocalypse, terrorism, and the deterioration of social order (Platts 551-55)—is re-used and re-imagined in a childlike way. From a child’s perspective, the zombie may represent the horrific truth of mortality and/or the troublesome desire to live forever that emerges once this truth has been confronted. More specifically, the notion of dealing meaningfully with the past and of honouring rather than silencing the dead is a strong thematic undercurrent in ParaNorman, and in this sense the zombies are important figures who dramatise the connections between past and present. While this past/present connection is explored on many levels in ParaNorman—including the level of a town grappling with its dark history—it is Norman and his grandmother who take centre stage: the boundary-crossing figure of the zombie is re-realised here in terms of a negotiation with a presence that is now absent (the elderly relative who has died but is still remembered). Indeed, the zombies in this film are an implicit rebuke to Norman’s mother and her command that Norman “move on” after his grandmother’s death. The dead are still present, this film playfully reminds us, and therefore “moving on” is an overly simplistic and somewhat disrespectful response (especially when imposed on children by adult authority figures.) If the horror narrative is built around the notion that “normality is threatened by the Monster”, as Robin Wood has famously suggested, ParaNorman and Frankenweenie re-imagine this narrative of subversion from a child’s perspective (31). Both films open up a space within which the child is permitted to negotiate with the destabilising figure of the monster; the normality that is “threatened” here is the adult notion of the finality of death and, relatedly, the assumption that death is not a suitable subject for children to think or talk about. Breaking down such understandings, Frankenweenie and ParaNorman strive not so much to play with death (a phrase that implies a certain callousness, a problematic disregard for human life) but to explore death through the darkness of play. This is beautifully imaged in a scene from ParaNorman in which Norman and his friend Neil play with the ghost of Neil’s recently deceased dog. “We’re going to play with a dead dog in the garden,” Neil enthusiastically announces to his brother, “and we’re not even going to have to dig him up first!” Somewhat similarly, film critic Richard Corliss notes in his review of Frankenweenie that the film’s “message to the young” is that “children should play with dead things.” Through this intersection between “death” and “play”, both films propose a particularly child-like (although not necessarily child-ish) way of negotiating horror’s dark territory. Conclusion Animated film has always been an ambiguous space in terms of age, pleasure, and viewership. As film critic Margaret Pomeranz has observed, “there is this perception that if it’s an animated film then you can take the little littlies” (Pomeranz and Stratton). Animation itself is often a signifier of safety, fun, nostalgia, and childishness; it is a means of addressing families and young audiences. Yet at the same time, the fantastic and transformative aspects of animation can be powerful tools for telling stories that are dark, surprising, or somehow subversive. It is therefore interesting that the trend towards re-imagining horror for children that this paper has identified is unfolding within the animated space. It is beyond the scope of this paper to fully consider what animation as a medium brings to this re-imagining process. However, it is worth noting that the distinctive stop-motion style used in both films works to position them as alternatives to Disney products (for although Frankenweenie was released under the Disney banner, it is visually distinct from most of Disney’s animated ventures). The majority of Disney films are adaptations or re-imaginings of some sort, yet these re-imaginings look to fairytales or children’s literature for their source material. In contrast, as this paper has demonstrated, Frankenweenie and ParaNorman open up a space for boundary play: they give children access to tropes, narratives, and characters that are specifically associated with adult viewers, and they invite adults to see these tropes, narratives, and characters from a child’s perspective. Ultimately, it is difficult to determine the success of this re-imagining process: what, indeed, does a successful re-imagining of horror for children look like, and who might be permitted to take pleasure from it? Arguably, ParaNorman and Frankenweenie have succeeded in reshaping the genre without simplifying it, deploying tropes and characters from classic horror texts in a meaningful way within the complex space of children’s animated film. References Berardinelli, James. “Frankenweenie (Review).” Reelviews, 4 Oct. 2012. 6 Aug. 2014 ‹http://www.reelviews.net/php_review_template.php?identifier=2530›. Bode, Lisa. “Transitional Tastes: Teen Girls and Genre in the Critical Reception of Twilight.” Continuum: Journal of Media & Cultural Studies 24.5 (2010): 707-19. Bradshaw, Peter. “Frankenweenie: First Look Review.” The Guardian, 11 Oct. 2012. 6 Aug. 2014 ‹http://www.theguardian.com/film/2012/oct/10/frankenweenie-review-london-film-festival-tim-burton›. Buckingham, David. Moving Images: Understanding Children’s Emotional Responses to Television. Manchester and New York: Manchester University Press, 1996. Cantor, Joanne. “‘I’ll Never Have a Clown in My House’ – Why Movie Horror Lives On.” Poetics Today 25.2 (2004): 283-304. Cantor, Joanne, and Mary Beth Oliver. “Developmental Differences in Responses to Horror”. The Horror Film. Ed. Stephen Prince. New Brunswick, NJ: Rutgers UP, 2004. 224-41. Corliss, Richard. “‘Frankenweenie’ Movie Review: A Re-Animated Delight”. Time, 4 Oct. 2012. 6 Aug. 2014 ‹http://entertainment.time.com/2012/10/04/tim-burtons-frankenweenie-a-re-animated-delight/›. Frankenweenie. Directed by Tim Burton. Walt Disney Pictures, 2012. Graham, Elaine L. Representations of the Post/Human: Monsters, Aliens and Others in Popular Culture. Manchester: Manchester UP, 2002. Hastings, A. Waller. “Moral Simplification in Disney’s The Little Mermaid.” The Lion and the Unicorn 17.1 (1993): 83-92. Hopkins, Lisa. Screening the Gothic. Austin: U of Texas P, 2005. Jackson, Anna, Karen Coats, and Roderick McGillis. “Introduction.” The Gothic in Children’s Literature: Haunting the Borders. Eds. Anna Jackson, Karen Coats, and Roderick McGillis. New York: Routledge, 2008. 1-14. Jancovich, Mark. “General Introduction.” Horror: The Film Reader. Ed. Mark Jancovich. London: Routledge, 2002. 1-19. Kellogg, Judith L. “The Dynamics of Dumbing: The Case of Merlin.” The Lion and the Unicorn 17.1 (1993): 57-72. Leitch, Thomas. “Twelve Fallacies in Contemporary Adaptation Theory.” Criticism 45.2 (2003): 149-71. Lemire, Christy. “‘Frankenweenie’ Review: Tim Burton Reminds Us Why We Love Him.” The Huffington Post, 2 Oct. 2012. 6 Aug. 2014 ‹http://www.huffingtonpost.com/2012/10/03/frankenweenie-review-tim-burton_n_1935142.html›. Lumenick, Lou. “So Good, It’s Scary (ParaNorman Review)”. New York Post, 17 Aug. 2012. 3 Jun. 2015 ‹http://nypost.com/2012/08/17/so-good-its-scary/›. McCarthy, Todd. “Frankenweenie: Film Review.” The Hollywood Reporter, 20 Sep. 2012. 6 Aug. 2014 ‹http://www.hollywoodreporter.com/movie/frankenweenie/review/372720›. Napolitano, Marc. “Disneyfying Dickens: Oliver & Company and The Muppet Christmas Carol as Dickensian Musicals.” Studies in Popular Culture 32.1 (2009): 79-102. O’Connell, Sean. “Middle School and Zombies? Awwwkward!” Washington Post, 17 Aug. 2012. 3 Jun. 2015 ‹http://www.washingtonpost.com/gog/movies/paranorman,1208210.html›. ParaNorman. Directed by Chris Butler and Sam Fell. Focus Features/Laika Entertainment, 2012. Platts, Todd K. “Locating Zombies in the Sociology of Popular Culture”. Sociology Compass 7 (2013): 547-60. Pomeranz, Margaret, and David Stratton. “Igor (Review).” At the Movies, 14 Dec. 2008. 6 Aug. 2014 ‹http://www.abc.net.au/atthemovies/txt/s2426109.htm›. Scott, A.O. “It’s Aliiiive! And Wagging Its Tail: ‘Frankenweenie’, Tim Burton’s Homage to Horror Classics.” New York Times, 4 Oct. 2012. 6 Aug. 2014 ‹http://www.nytimes.com/2012/10/05/movies/frankenweenie-tim-burtons-homage-to-horror-classics.html›. Semenza, Gregory M. Colón. “Teens, Shakespeare, and the Dumbing Down Cliché: The Case of The Animated Tales.” Shakespeare Bulletin 26.2 (2008): 37-68. Shelley, Mary. Frankenstein, or, The Modern Prometheus. Hertfordshire: Wordsworth Editions, 1993 [1818]. Smith, Sarah J. Children, Cinema and Censorship: From Dracula to the Dead End Kids. London: I.B. Tauris, 2005. Stam, Robert. “Introduction: The Theory and Practice of Adaptation.” Literature and Film: A Guide to the Theory and Practice of Film Adaptation. Eds. Robert Stam and Alessandra Raengo. Oxford: Blackwell, 2005. 1-52. Wells, Paul. The Horror Genre: From Beelzebub to Blair Witch. London: Wallflower, 2000. Whelehan, Imelda. “Adaptations: the Contemporary Dilemmas.” Adaptations: From Text to Screen, Screen to Text. Eds. Deborah Cartmell and Imelda Whelehan. London: Routledge, 1999. 3-19. Wolgamott, L. Kent. “‘Frankenweenie’ A Box-Office Bomb, But Superior Film.” Lincoln Journal Star, 10 Oct. 2012. 18 Aug. 2014 ‹http://journalstar.com/entertainment/movies/l-kent-wolgamott-frankenweenie-a-box-office-bomb-but-superior/article_42409e82-89b9-5794-8082-7b5de3d469e2.html›. Wood, Robin. “The American Nightmare: Horror in the 70s.” Horror: The Film Reader. Ed. Mark Jancovich. London: Routledge, 2002. 25-32.
APA, Harvard, Vancouver, ISO, and other styles
36

Sanders, Shari. "Because Neglect Isn't Cute: Tuxedo Stan's Campaign for a Humane World." M/C Journal 17, no. 2 (March 6, 2014). http://dx.doi.org/10.5204/mcj.791.

Full text
Abstract:
On 10 September 2012, a cat named Tuxedo Stan launched his campaign for mayor of the Halifax Regional Municipality in Nova Scotia, Canada (“Tuxedo Stan for Mayor”). Backed by his human supporters in the Tuxedo Party, he ran on a platform of animal welfare: “Tuxedo Stan for Mayor Because Neglect Isn’t Working.” Artwork Courtesy of Joe Popovitch As a feline activist, Tuxedo Stan joins an unexpected—if not entirely unprecedented—cohort of cats that advocate for animal welfare through their “cute” appeals for humane treatment. From Tuxedo Stan’s internet presence to his appearance on Anderson Cooper’s CNN segment “The RidicuList,” Tuxedo Stan’s cute campaign opens space for a cultural imaginary that differently envisions animals’ and humans’ political responsibilities. Who Can Be a Moral Agent? Iris Marion Young proposes “political responsibility” as a way to answer a question central to human and animal welfare: “How should moral agents—both individual and organizational—think about their responsibilities in relation to structural social injustice?” (7). In legal frameworks, responsibility is connected to liability: an individual acts, harm occurs, and the law decides how much liability the individual should assume. However, Young redefines responsibility in relation to structural injustices, which she conceptualizes as “harms” that result from “structural processes in which many people participate.” Young argues that “because it is therefore difficult for individuals to see a relationship between their own actions and structural outcomes, we have a tendency to distance ourselves from any responsibility for them” (7). Young presents political responsibility as a call to share the responsibility “to engage in actions directed at transforming the structures” and suggests that the less-advantaged might organize and propose “remedies for injustice, because their interests [are] the most acutely at stake” and because they are vulnerable to the actions of others “situated in more powerful and privileged positions” (15). Though Young does not address animals, her conception of responsible agency raises a question: who can be a moral agent? Arguably, the answer to this question changes as cultural imaginaries expand to accommodate difference, including gender- and species-difference. Corey Wrenn analyzes a selection of anti-suffragette postcards that equate granting votes to women as akin to granting votes to cats. Young shifts responsibility from a liability to a political frame, but Wrenn’s work suggests that a further shift is necessary where responsibility is gendered and tied to domestic, feminized roles: Cats and dogs are gendered in contemporary American culture…dogs are thought to be the proper pet for men and cats for women (especially lesbians). This, it turns out, is an old stereotype. In fact, cats were a common symbol in suffragette imagery. Cats represented the domestic sphere, and anti-suffrage postcards often used them to reference female activists. The intent was to portray suffragettes as silly, infantile, incompetent, and ill-suited to political engagement. (Wrenn) Dressing cats in women’s clothing and calling them suffragettes marks women as less-than-human and casts cats as the opposite of human. The frilly garments, worn by cats whose presence evoked the domestic sphere, suggest that women belong in the domestic sphere because they are too soft, or perhaps too cute, to contend with the demands of public life. In addition, the cards that feature domestic scenes suggest that women should account for their families’ welfare ahead of their own, and that women’s refusal to accept this arithmetic marks them as immoral—and irresponsible—subjects. Not Schrödinger's Cat In different ways, Jacques Derrida and Carey Wolfe explore the question Young’s work raises: who can be a moral agent? Derrida and Wolfe complicate the question by adding species difference: how should (human) moral agents think about their responsibilities (to animals)? Prompted by an encounter with his cat, Jacques Derrida follows the figure of the animal, through a variety of texts, in order to make sensible the trace of “the animal” as it has appeared in Western traditions. Derrida’s cat accompanies him as Derrida playfully, and attentively, deconstructs the rationalist, humanist discourses that structure Western philosophy. Discourses, whose tenets reflect the systems of beliefs embedded within a culture, are often both hegemonic and invisible; at least for those who enjoy privileged positions within the culture, discourses may simply appear as common sense or common knowledge. Derrida argues that Western, humanist thinking has created a discourse around “the human” and that this discourse deploys a reductive figure of “the animal” to justify human supremacy and facilitate human exceptionalism. Human exceptionalism is the doctrine that humans’ superiority to animals exempts humans from behaving humanely towards those deemed non-human, and it is the hegemony of the discourse of human exceptionalism that Derrida contravenes. Derrida interrupts by entering the discourse with “his” cat and creating a counter-narrative that troubles “the human” hegemony by redefining what it means to think. Derrida orients his intellectual work as surrender—he surrenders to the gaze of his cat and to his affectionate response to her presence: “the cat I am talking about is a real cat, truly, believe me, a little cat. The cat that looks at me naked and that is truly a little cat, this cat I am talking about…It comes to me as this irreplaceable living being that one day enters my space, into this place where it can encounter me, see me, even see me naked” (6-9, italics in original). The diminutive Derrida uses to describe his cat, she is little and truly a little cat, gestures toward affection, or affect, as the “thing…philosophy has, essentially, had to deprive itself of” (7). For Derrida, rationalist thinking hurries to “enclose and circumscribe the concept of the human as much as that of reason,” and it is through this movement toward enclosure that rationalist humanism fails to think (105). While Derrida questions the ethics of humanist philosophy, Carey Wolfe questions the ethics of humanism. Wolfe argues that “the operative theories and procedures we now have for articulating the social and legal relation between ethics and action are inadequate” because humanism imbues discourses about human and/or animal rights with utilitarian and contractarian logics that are inherently speciesist and therefore flawed (192). Utilitarian approaches attempt to determine the morality of a given action by weighing the act’s aggregate benefit against its aggregate harm. Contractarian approaches evaluate a given (human or animal) subject’s ability to understand and comply with a social contract that stipulates reciprocity; if a subject receives kindness, that subject must understand their implied, moral responsibility to return it. When opponents of animal rights designate animals as less capable of suffering than humans and decide that animals cannot enter moral contracts, animals are then seen as not only undeserving of rights but as incapable of bearing rights. As Wolfe argues, rights discourse—like rationalist humanism—reaches an impasse, and Wolfe proposes posthumanist theory as the way through: “because the discourse of speciesism…anchored in this material, institutional base, can be used to mark any social other, we need to understand that the ethical and philosophical urgency of confronting the institution of speciesism and crafting a posthumanist theory of the subject has nothing to do with whether you like animals” (7, italics in original). Wolfe’s strategic statement marks the necessity of attending to injustice at a structural level; however, as Tuxedo Stan’s campaign demonstrates, at a tactical level, how much you “like” an animal might matter very much. Seriously Cute: Tuxedo Stan as a Moral Agent Tuxedo Stan’s 2012-13 campaign pressed for improved protections for stray and feral cats in the Halifax Regional Municipality (HRM). While “cute” is a subjective, aesthetic judgment, numerous internet sites make claims like: “These 30 Animals With Their Adorable Miniature Versions Are The Cutest Thing Ever. Awwww” (“These 30 Animals”). From Tuxedo Stan’s kitten pictures to the plush versions of Tuxedo Stan, available for purchase on his website, Tuxedo Stan’s campaign positioned him within this cute culture (Chisolm “Official Tuxedo Stan Minion”). Photo Courtesy of Hugh Chisolm, Tuxedo Party The difference between Tuxedo Stan’s cute and the kind of cute invoked by pictures of animals with miniature animals—the difference that connects Tuxedo Stan’s cute to a moral or ethical position—is the narrative of political responsibility attached to his campaign. While existing animal protection laws in Halifax’s Animal Protection Act outlined some protections for animals, “there was a clear oversight in that issues related to cats are not included” (Chisolm TuxedoStan.com). Hugh Chisholm, co-founder of the Tuxedo Party, further notes: There are literally thousands of homeless cats — feral and abandoned— who live by their willpower in the back alleys and streets and bushes in HRM…But there is very little people can do if they want to help, because there is no pound. If there’s a lost or injured dog, you can call the pound and they will come and take the dog and give it a place to stay, and some food and care. But if you do the same thing with a cat, you get nothing, because there’s nothing in place. (Mombourquette) Tuxedo Stan’s campaign mobilizes cute images that reveal the connection between unnoticed and unrelieved suffering. Proceeds from Tuxedo Party merchandise go toward Spay Day HRM, a charity dedicated to “assisting students and low-income families” whose financial situations may prevent them from paying for spay and neuter surgeries (Chisholm TuxedoStan.com). According to his e-book ME: The Tuxedo Stan Story, Stan “wanted to make a difference in the lives of tens of thousands of homeless, unneutered cats in [Halifax Regional Municipality]. We needed a low-cost spay/neuter clinic. We needed a Trap-Neuter-Return and Care program. We needed a sanctuary for homeless, unwanted strays to live out their lives in comfort” (Tuxedo Stanley and Chisholm 14). As does “his” memoir, Tuxedo Stan’s Pledge of Compassion and Action follows Young’s logic of political responsibility. Although his participation is mediated by human organizers, Tuxedo Stan is a cat pressing legislators to “pledge to help the cats” by supporting “a comprehensive feline population control program to humanely control the feline population and prevent suffering” and by creating “an affordable and accessible spay/neuter program” (Chisholm TuxedoStan.com). While framing the feral cat population as a “problem” that must be “fixed” upholds discourses around controlling subjected populations’ reproduction, Tuxedo Stan’s campaign also opens space for a counternarrative that destabilizes the human exceptionalism that encompasses his campaign. A Different ‘Logic’, a Different Cultural Imaginary As Tuxedo Stan launched his campaign in 2012, fellow feline Hank ran for the United States senate seat in Virginia – he received approximately 7,000 votes and placed third (Wyatt) – and “Mayor” Stubbs celebrated his 15th year as the honorary mayor of Talkeetna, Alaska, also in the United States: Fifteen years ago, the citizens of Talkeetna (pop. 800) didn’t like the looks of their candidates for mayor. Around that same time resident Lauri Stec, manager of Nagley’s General Store, saw a box of kittens and decided to adopt one. She named him Stubbs because he didn’t have a tail and soon the whole town was in love with him. So smitten were they with this kitten, in fact, that they wrote him in for mayor instead of deciding on one of the two lesser candidates. (Friedman) Though only Stan and Hank connect their candidacy to animal welfare activism, all three cats’ stories contribute to building a cultural imaginary that has drawn responses across social and news media. Tuxedo Stan’s Facebook page has 19,000+ “likes,” and Stan supporters submit photographs of Tuxedo Stan “minions” spreading Tuxedo Stan’s message. The Tuxedo Party’s website maintains a photo gallery that documents “Tuxedo Stan’s World Tour”: “Tuxedo Stan’s Minions are currently on their world tour spreading his message of hope and compassion for felines around the globe" (Chisholm TuxedoStan.com). Each minion’s photo in the gallery represents humans’ ideological and financial support for Tuxedo Stan. News media supported Tuxedo Stan, Hank for Senate, and Mayor Stubbs’s candidacies in a more ambiguous fashion. While Craig Medred argues that “Silly 'Alaska cat mayor' saga spotlights how easily the media can be scammed” (Medred), a CBC News video announced that Tuxedo Stan was “interested in sinking his claws into the top seat at City Hall” and ready to “mark his territory around the mayor's seat” (“Tuxedo Stan the cat chases Halifax mayor chair”), and Lauren Strapagiel reported on Halifax’s “cuddliest would-be mayor.” In an unexpected echo of Derrida’s language, as Derrida repeats that he is truly talking about a cat, truly a little cat, CNN journalist Anderson Cooper endorses Tuxedo Stan for mayor and follows his endorsement with this statement: If he’s serious about a career in politics, maybe he should come to the United States. Just look at the mayor of Talkeetna, Alaska. That’s Stubbs the cat, and he’s been the mayor for 15 years. I’m not kidding…Not only that, but right now, as we speak, there is a cat running for Senate from Virginia. (Cooper) As he introduces a “Hank for Senate” campaign video, again Cooper mentions that he is “not kidding.” While Cooper’s “not kidding” echoes Derrida’s “truly,” the difference in meanings is différance. For Derrida, his encounter with his cat is “a matter of developing another ‘logic’ of decision, of the response and of the event…a matter of reinscribing the différance between reaction and response, and hence this historicity of ethical, juridical, or political responsibility, within another thinking of life, of the living, within another relation of the living, to their own…reactional automaticity” (126). Derrida proceeds through the impasse, the limit he identifies within philosophical engagements with animals, by tracing the ways his little cat’s presence affects him. Derrida finds another logic, which is not logic but surrender, to accommodate what he, like Young, terms “political responsibility.” Cooper, however, applies the hegemonic logic of human exceptionalism to his engagement with feline interlocutors, Tuxedo Stan, Hank for Senate, and Mayor Stubbs. Although Cooper’s segment, called “The RidicuList,” makes a pretense of political responsibility, it is different in kind from the pretense made in Tuxedo Stan’s campaign. As Derrida argues, a “pretense…even a simple pretense, consists in rendering a sensible trace illegible or imperceptible” (135). Tuxedo Stan’s campaign pretends that Tuxedo Stan fits within humanist, hegemonic notions of mayoral candidacy and then mobilizes this cute pretense in aid of political responsibility; the pretense—the pretense in which Tuxedo Stan’s human fans and supporters engage—renders the “sensible” trace of human exceptionalism illegible, if not imperceptible. Cooper’s pretense, however, works to make legible the trace of human exceptionalism and so to reinscribe its discursive hegemony. Discursively, the political potential of cute in Tuxedo Stan’s campaign is that Tuxedo Stan’s activism complicates humanist and posthumanist thinking about agency, about ethics, and about political responsibility. Thinking about animals may not change animals’ lives, but it may change (post)humans’ responses to these questions: Who can be a moral agent? How should moral agents—both individual and organizational, both human and animal—“think” about how they respond to structural social injustice? Epilogue: A Political Response Tuxedo Stan died of kidney cancer on 8 September 2013. Before he died, Tuxedo Stan’s campaign yielded improved cat protection legislation as well as a $40,000 endowment to create a spay-and-neuter facility accessible to low-income families. Tuxedo Stan’s litter mate, Earl Grey, carries on Tuxedo Stan’s work. Earl Grey’s campaign platform expands the Tuxedo Party’s appeals for animal welfare, and Earl Grey maintains the Tuxedo Party’s presence on Facebook, on Twitter (@TuxedoParty and @TuxedoEarlGrey), and at TuxedoStan.com (Chisholm TuxedoStan.com). On 27 February 2014, Agriculture Minister Keith Colwell of Nova Scotia released draft legislation whose standards of care aim to prevent distress and cruelty to pets and to strengthen their protection. They…include proposals on companion animal restraints, outdoor care, shelters, companion animal pens and enclosures, abandonment of companion animals, as well as the transportation and sale of companion animals…The standards also include cats, and the hope is to have legislation ready to introduce in the spring and enacted by the fall. (“Nova Scotia cracks down”) References Chisolm, Hugh. “Tuxedo Stan Kitten.” Tuxedo Party Facebook Page, 20 Oct. 2012. 2 Mar. 2014. Chisholm, Hugh. “Official Tuxedo Stan Minion.” TuxedoStan.com. Tuxedo Stanley and the Tuxedo Party. 2 Mar. 2014. Chisolm, Hugh. “You're Voting for Fred? Not at MY Polling Station!” Tuxedo Party Facebook Page, 20 Oct. 2012. 2 Mar. 2014. Chisholm, Hugh, and Kathy Chisholm. TuxedoStan.com. Tuxedo Stanley and the Tuxedo Party. 2 Mar. 2014. Cooper, Anderson. “The RidicuList.” CNN Anderson Cooper 360, 24 Sep. 2012. 2 Mar. 2014. Crenshaw, Kimberlé. “Demarginalizing the Intersection of Race and Sex: A Black Feminist Critique of Antidiscrimination Doctrine, Feminist Theory and Antiracist Politics.” University of Chicago Legal Forum 1989: 139–67. 2 Mar. 2014. Derrida, Jacques. The Animal That Therefore I Am. Trans. David Willis. New York: Fordham University Press, 2008. Friedman, Amy. “Cat Marks 15 Years as Mayor of Alaska Town.” Newsfeed.time.com, 17 July 2012. 2 March 2014. Medred, Craig. “Silly ‘Alaska Cat Mayor’ Saga Spotlights How Easily the Media Can Be Scammed.” Alaska Dispatch, 11 Sep. 2014. 2 Mar. 2014. Mombourquette, Angela. “Candidate’s Ethics Are as Finely Honed as His Claws.” The Chronicle Herald, 27 Aug. 2012. 2 Mar. 2014. “Nova Scotia Cracks Down on Tethering of Dogs.” The Chronicle Herald 27 Feb. 2014. 2 Mar. 2014. Pace, Natasha. “Halifax City Council Doles Out Cash to Help Control the Feral Cat Population.” Global News 14 May 2013. 2 Mar. 2014. Popovitch, Joe. “Tuxedo Stan for Mayor Because Neglect Isn’t Working.” RefuseToBeBoring.com. 2 Mar. 2014. Strapagiel, Lauren. “Tuxedo Stan, Beloved Halifax Cat Politician, Dead at 3.” OCanada.com, 9 Sep. 2013. 2 Mar. 2014. “These 30 Animals with Their Adorable Miniatures Are the Cutest Thing Ever. Awwww.” WorthyToShare.com, n.d. 2 Mar. 2014. “Tuxedo Stan for Mayor Dinner Highlights.” Vimeo.com, 2 Mar. 2014. Tuxedo Stanley, and Kathy Chisholm. ME: The Tuxedo Stan Story. Upper Tantallon, Nova Scotia: Ailurophile Publishing, 2014. 2 Mar. 2014. “Tuxedo Stan the Cat Chases Halifax Mayor Chair.” CBC News, 13 Aug. 2012. 2 Mar. 2014. Wolfe, Cary. Animal Rites: American Culture, the Discourse of Species, and Posthumanist Theory. Chicago: University of Chicago Press, 2003. Wrenn, Corey. “Suffragette Cats Are the Original Cat Ladies.” Jezebel.com, 6 Dec. 2013. 2 Mar. 2014. Wyatt, Susan. “Hank, the Cat Who Ran for Virginia Senate, Gets MMore than 7,000 Votes.” King5.com The Pet Dish, 7 Nov. 2012. 2 Mar. 2014. Young, Iris Marion. “Political Responsibility and Structural Injustice.” Lindley Lecture. Department of Philosophy, University of Kansas. 5 May 2003.
APA, Harvard, Vancouver, ISO, and other styles
37

Brabazon, Tara. "Welcome to the Robbiedome." M/C Journal 4, no. 3 (June 1, 2001). http://dx.doi.org/10.5204/mcj.1907.

Full text
Abstract:
One of the greatest joys in watching Foxtel is to see all the crazy people who run talk shows. Judgement, ridicule and generalisations slip from their tongues like overcooked lamb off a bone. From Oprah to Rikki, from Jerry to Mother Love, the posterior of pop culture claims a world-wide audience. Recently, a new talk diva was added to the pay television stable. Dr Laura Schlessinger, the Mother of Morals, prowls the soundstage. attacking 'selfish acts' such as divorce, de facto relationships and voting Democrat. On April 11, 2001, a show aired in Australia that added a new demon to the decadence of the age. Dr Laura had been told that a disgusting video clip, called 'Rock DJ', had been televised at 2:30pm on MTV. Children could have been watching. The footage that so troubled our doyenne of daytime featured the British performer Robbie Williams not only stripping in front of disinterested women, but then removing skin, muscle and tissue in a desperate attempt to claim their gaze. This was too much for Dr Laura. She was horrified: her strident tone became piercing. She screeched, "this is si-ee-ck." . My paper is drawn to this sick masculinity, not to judge - but to laugh and theorise. Robbie Williams, the deity of levity, holds a pivotal role in theorising the contemporary 'crisis' of manhood. To paraphrase Austin Powers, Williams returned the ger to singer. But Williams also triumphed in a captivatingly original way. He is one of the few members of a boy band who created a successful solo career without regurgitating the middle of the road mantras of boys, girls, love, loss and whining about it. Williams' journey through post-war popular music, encompassing influences from both Sinatra and Sonique, forms a functional collage, rather than patchwork, of masculinity. He has been prepared to not only age in public, but to discuss the crevices and cracks in the facade. He strips, smokes, plays football, wears interesting underwear and drinks too much. My short paper trails behind this combustible masculinity, focussing on his sorties with both masculine modalities and the rock discourse. My words attack the gap between text and readership, beat and ear, music and men. The aim is to reveal how this 'sick masculinity' problematises the conservative rendering of men's crisis. Come follow me I'm an honorary Sean Connery, born '74 There's only one of me … Press be asking do I care for sodomy I don't know, yeah, probably I've been looking for serial monogamy Not some bird that looks like Billy Connolly But for now I'm down for ornithology Grab your binoculars, come follow me. 'Kids,' Robbie Williams Robbie Williams is a man for our age. Between dating supermodels and Geri 'Lost Spice' Halliwell [1], he has time to "love … his mum and a pint," (Ansen 85) but also subvert the Oasis cock(rock)tail by frocking up for a television appearance. Williams is important to theories of masculine representation. As a masculinity to think with, he creates popular culture with a history. In an era where Madonna practices yoga and wears cowboy boots, it is no surprise that by June 2000, Robbie Williams was voted the world's sexist man [2]. A few months later, in the October edition of Vogue, he posed in a British flag bikini. It is reassuring in an era where a 12 year old boy states that "You aren't a man until you shoot at something," (Issac in Mendel 19) that positive male role models exist who are prepared to both wear a frock and strip on national television. Reading Robbie Williams is like dipping into the most convincing but draining of intellectual texts. He is masculinity in motion, conveying foreignness, transgression and corruption, bartering in the polymorphous economies of sex, colonialism, race, gender and nation. His career has spanned the boy bands, try-hard rock, video star and hybrid pop performer. There are obvious resonances between the changes to Williams and alterations in masculinity. In 1988, Suzanne Moore described (the artist still known as) Prince as "the pimp of postmodernism." (165-166) Over a decade later, the simulacra has a new tour guide. Williams revels in the potency of representation. He rarely sings about love or romance, as was his sonic fodder in Take That. Instead, his performance is fixated on becoming a better man, glancing an analytical eye over other modes of masculinity. Notions of masculine crisis and sickness have punctuated this era. Men's studies is a boom area of cultural studies, dislodging the assumed structures of popular culture [3]. William Pollack's Real Boys has created a culture of changing expectations for men. The greater question arising from his concerns is why these problems, traumas and difficulties are emerging in our present. Pollack's argument is that boys and young men invest energy and time "disguising their deepest and most vulnerable feelings." (15) This masking is difficult to discern within dance and popular music. Through lyrics and dancing, videos and choreography, masculinity is revealed as convoluted, complex and fragmented. While rock music is legitimised by dominant ideologies, marginalised groups frequently use disempowered genres - like country, dance and rap genres - to present oppositional messages. These competing representations expose seamless interpretations of competent masculinity. Particular skills are necessary to rip the metaphoric pacifier out of the masculine mouth of popular culture. Patriarchal pop revels in the paradoxes of everyday life. Frequently these are nostalgic visions, which Kimmel described as a "retreat to a bygone era." (87) It is the recognition of a shared, simpler past that provides reinforcement to heteronormativity. Williams, as a gaffer tape masculinity, pulls apart the gaps and crevices in representation. Theorists must open the interpretative space encircling popular culture, disrupting normalising criteria. Multiple nodes of assessment allow a ranking of competent masculinity. From sport to business, drinking to sex, masculinity is transformed into a wired site of ranking, judgement and determination. Popular music swims in the spectacle of maleness. From David Lee Roth's skied splits to Eminem's beanie, young men are interpellated as subjects in patriarchy. Robbie Williams is a history lesson in post war masculinity. This nostalgia is conservative in nature. The ironic pastiche within his music videos features motor racing, heavy metal and Bond films. 'Rock DJ', the 'sick text' that vexed Doctor Laura, is Williams' most elaborate video. Set in a rollerdrome with female skaters encircling a central podium, the object of fascination and fetish is a male stripper. This strip is different though, as it disrupts the power held by men in phallocentralism. After being confronted by Williams' naked body, the observing women are both bored and disappointed at the lack-lustre deployment of masculine genitalia. After this display, Williams appears embarrassed, confused and humiliated. As Buchbinder realised, "No actual penis could every really measure up to the imagined sexual potency and social or magical power of the phallus." (49) To render this banal experience of male nudity ridiculous, Williams then proceeds to remove skin and muscle. He finally becomes an object of attraction for the female DJ only in skeletal form. By 'going all the way,' the strip confirms the predictability of masculinity and the ordinariness of the male body. For literate listeners though, a higher level of connotation is revealed. The song itself is based on Barry White's melody for 'It's ecstasy (when you lay down next to me).' Such intertextuality accesses the meta-racist excesses of a licentious black male sexuality. A white boy dancer must deliver an impotent, but ironic, rendering of White's (love unlimited) orchestration of potent sexuality. Williams' iconography and soundtrack is refreshing, emerging from an era of "men who cling … tightly to their illusions." (Faludi 14) When the ideological drapery is cut away, the male body is a major disappointment. Masculinity is an anxious performance. Fascinatingly, this deconstructive video has been demeaned through its labelling as pornography [4]. Oddly, a man who is prepared to - literally - shave the skin of masculinity is rendered offensive. Men's studies, like feminism, has been defrocking masculinity for some time. Robinson for example, expressed little sympathy for "whiny men jumping on the victimisation bandwagon or playing cowboys and Indians at warrior weekends and beating drums in sweat lodges." (6) By grating men's identity back to the body, the link between surface and depth - or identity and self - is forged. 'Rock DJ' attacks the new subjectivities of the male body by not only generating self-surveillance, but humour through the removal of clothes, skin and muscle. He continues this play with the symbols of masculine performance throughout the album Sing when you're winning. Featuring soccer photographs of players, coaches and fans, closer inspection of the images reveal that Robbie Williams is actually every character, in every role. His live show also enfolds diverse performances. Singing a version of 'My Way,' with cigarette in tow, he remixes Frank Sinatra into a replaying and recutting of masculine fabric. He follows one dominating masculinity with another: the Bond-inspired 'Millennium.' Some say that we are players Some say that we are pawns But we've been making money Since the day we were born Robbie Williams is comfortably located in a long history of post-Sinatra popular music. He mocks the rock ethos by combining guitars and drums with a gleaming brass section, hailing the lounge act of Dean Martin, while also using rap and dance samples. Although carrying fifty year's of crooner baggage, the spicy scent of homosexuality has also danced around Robbie Williams' career. Much of this ideology can be traced back to the Take That years. As Gary Barlow and Jason Orange commented at the time, Jason: So the rumour is we're all gay now are we? Gary: Am I gay? I am? Why? Oh good. Just as long as we know. Howard: Does anyone think I'm gay? Jason: No, you're the only one people think is straight. Howard: Why aren't I gay? What's wrong with me? Jason: It's because you're such a fine figure of macho manhood.(Kadis 17) For those not literate in the Take That discourse, it should come as no surprise that Howard was the TT equivalent of The Beatle's Ringo Starr or Duran Duran's Andy Taylor. Every boy band requires the ugly, shy member to make the others appear taller and more attractive. The inference of this dialogue is that the other members of the group are simply too handsome to be heterosexual. This ambiguous sexuality has followed Williams into his solo career, becoming fodder for those lads too unappealing to be homosexual: Oasis. Born to be mild I seem to spend my life Just waiting for the chorus 'Cause the verse is never nearly Good enough Robbie Williams "Singing for the lonely." Robbie Williams accesses a bigger, brighter and bolder future than Britpop. While the Gallagher brothers emulate and worship the icons of 1960s British music - from the Beatles' haircuts to the Stones' psychedelia - Williams' songs, videos and persona are chattering in a broader cultural field. From Noel Cowardesque allusions to the ordinariness of pub culture, Williams is much more than a pretty-boy singer. He has become an icon of English masculinity, enclosing all the complexity that these two terms convey. Williams' solo success from 1999-2001 occurred at the time of much parochial concern that British acts were not performing well in the American charts. It is bemusing to read Billboard over this period. The obvious quality of Britney Spears is seen to dwarf the mediocrity of British performers. The calibre of Fatboy Slim, carrying a smiley backpack stuffed with reflexive dance culture, is neither admitted nor discussed. It is becoming increasing strange to monitor the excessive fame of Williams in Britain, Europe, Asia and the Pacific when compared to his patchy career in the United States. Even some American magazines are trying to grasp the disparity. The swaggering king of Britpop sold a relatively measly 600,000 copies of his U.S. debut album, The ego has landed … Maybe Americans didn't appreciate his songs about being famous. (Ask Dr. Hip 72) In the first few years of the 2000s, it has been difficult to discuss a unified Anglo-American musical formation. Divergent discursive frameworks have emerged through this British evasion. There is no longer an agreed centre to the musical model. Throughout 1990s Britain, blackness jutted out of dance floor mixes, from reggae to dub, jazz and jungle. Plied with the coldness of techno was an almost too hot hip hop. Yet both were alternate trajectories to Cool Britannia. London once more became swinging, or as Vanity Fair declared, "the nerve centre of pop's most cohesive scene since the Pacific Northwest grunge explosion of 1991." (Kamp 102) Through Britpop, the clock turned back to the 1960s, a simpler time before race became 'a problem' for the nation. An affiliation was made between a New Labour, formed by the 1997 British election, and the rebirth of a Swinging London [5]. This style-driven empire supposedly - again - made London the centre of the world. Britpop was itself a misnaming. It was a strong sense of Englishness that permeated the lyrics, iconography and accent. Englishness requires a Britishness to invoke a sense of bigness and greatness. The contradictions and excesses of Blur, Oasis and Pulp resonate in the gap between centre and periphery, imperial core and colonised other. Slicing through the arrogance and anger of the Gallaghers is a yearning for colonial simplicity, when the pink portions of the map were the stable subjects of geography lessons, rather than the volatile embodiment of postcolonial theory. Simon Gikandi argues that "the central moments of English cultural identity were driven by doubts and disputes about the perimeters of the values that defined Englishness." (x) The reason that Britpop could not 'make it big' in the United States is because it was recycling an exhausted colonial dreaming. Two old Englands were duelling for ascendancy: the Oasis-inflected Manchester working class fought Blur-inspired London art school chic. This insular understanding of difference had serious social and cultural consequences. The only possible representation of white, British youth was a tabloidisation of Oasis's behaviour through swearing, drug excess and violence. Simon Reynolds realised that by returning to the three minute pop tune that the milkman can whistle, reinvoking parochial England with no black people, Britpop has turned its back defiantly on the future. (members.aol.com/blissout/Britpop.html) Fortunately, another future had already happened. The beats per minute were pulsating with an urgent affirmation of change, hybridity and difference. Hip hop and techno mapped a careful cartography of race. While rock was colonialisation by other means, hip hop enacted a decolonial imperative. Electronic dance music provided a unique rendering of identity throughout the 1990s. It was a mode of musical communication that moved across national and linguistic boundaries, far beyond Britpop or Stateside rock music. While the Anglo American military alliance was matched and shadowed by postwar popular culture, Brit-pop signalled the end of this hegemonic formation. From this point, English pop and American rock would not sail as smoothly over the Atlantic. While 1995 was the year of Wonderwall, by 1996 the Britpop bubble corroded the faces of the Gallagher brothers. Oasis was unable to complete the American tour. Yet other cultural forces were already active. 1996 was also the year of Trainspotting, with "Born Slippy" being the soundtrack for a blissful journey under the radar. This was a cultural force that no longer required America as a reference point [6]. Robbie Williams was able to integrate the histories of Britpop and dance culture, instigating a complex dialogue between the two. Still, concern peppered music and entertainment journals that British performers were not accessing 'America.' As Sharon Swart stated Britpop acts, on the other hand, are finding it less easy to crack the U.S. market. The Spice Girls may have made some early headway, but fellow purveyors of pop, such as Robbie Williams, can't seem to get satisfaction from American fans. (35 British performers had numerous cultural forces working against them. Flat global sales, the strength of the sterling and the slow response to the new technological opportunities of DVD, all caused problems. While Britpop "cleaned house," (Boehm 89) it was uncertain which cultural formation would replace this colonising force. Because of the complex dialogues between the rock discourse and dance culture, time and space were unable to align into a unified market. American critics simply could not grasp Robbie Williams' history, motives or iconography. It's Robbie's world, we just buy tickets for it. Unless, of course you're American and you don't know jack about soccer. That's the first mistake Williams makes - if indeed one of his goals is to break big in the U.S. (and I can't believe someone so ambitious would settle for less.) … Americans, it seems, are most fascinated by British pop when it presents a mirror image of American pop. (Woods 98 There is little sense that an entirely different musical economy now circulates, where making it big in the United States is not the singular marker of credibility. Williams' demonstrates commitment to the international market, focussing on MTV Asia, MTV online, New Zealand and Australian audiences [7]. The Gallagher brothers spent much of the 1990s trying to be John Lennon. While Noel, at times, knocked at the door of rock legends through "Wonderwall," he snubbed Williams' penchant for pop glory, describing him as a "fat dancer." (Gallagher in Orecklin 101) Dancing should not be decried so summarily. It conveys subtle nodes of bodily knowledge about men, women, sex and desire. While men are validated for bodily movement through sport, women's dancing remains a performance of voyeuristic attention. Such a divide is highly repressive of men who dance, with gayness infiltrating the metaphoric masculine dancefloor [8]. Too often the binary of male and female is enmeshed into the divide of rock and dance. Actually, these categories slide elegantly over each other. The male pop singers are located in a significant semiotic space. Robbie Williams carries these contradictions and controversy. NO! Robbie didn't go on NME's cover in a 'desperate' attempt to seduce nine-year old knickerwetters … YES! He used to be teenybopper fodder. SO WHAT?! So did the Beatles the Stones, the Who, the Kinks, etc blah blah pseudohistoricalrockbollocks. NO! Making music that gurlz like is NOT a crime! (Wells 62) There remains an uncertainty in his performance of masculinity and at times, a deliberate ambivalence. He grafts subversiveness into a specific lineage of English pop music. The aim for critics of popular music is to find a way to create a rhythm of resistance, rather than melody of credible meanings. In summoning an archaeology of the archive, we begin to write a popular music history. Suzanne Moore asked why men should "be interested in a sexual politics based on the frightfully old-fashioned ideas of truth, identity and history?" (175) The reason is now obvious. Femininity is no longer alone on the simulacra. It is impossible to separate real men from the representations of masculinity that dress the corporeal form. Popular music is pivotal, not for collapsing the representation into the real, but for making the space between these states livable, and pleasurable. Like all semiotic sicknesses, the damaged, beaten and bandaged masculinity of contemporary music swaddles a healing pedagogic formation. Robbie Williams enables the writing of a critical history of post Anglo-American music [9]. Popular music captures such stories of place and identity. Significantly though, it also opens out spaces of knowing. There is an investment in rhythm that transgresses national histories of music. While Williams has produced albums, singles, video and endless newspaper copy, his most important revelations are volatile and ephemeral in their impact. He increases the popular cultural vocabulary of masculinity. [1] The fame of both Williams and Halliwell was at such a level that it was reported in the generally conservative, pages of Marketing. The piece was titled "Will Geri's fling lose its fizz?" Marketing, August 2000: 17. [2] For poll results, please refer to "Winners and Losers," Time International, Vol. 155, Issue 23, June 12, 2000, 9 [3] For a discussion of this growth in academic discourse on masculinity, please refer to Paul Smith's "Introduction," in P. Smith (ed.), Boys: Masculinity in contemporary culture. Colorado: Westview Press, 1996. [4] Steve Futterman described Rock DJ as the "least alluring porn video on MTV," in "The best and worst: honour roll," Entertainment Weekly 574-575 (December 22-December 29 2000): 146. [5] Michael Bracewell stated that "pop provides an unofficial cartography of its host culture, charting the national mood, marking the crossroads between the major social trends and the tunnels of the zeitgeist," in "Britpop's coming home, it's coming home." New Statesman .(February 21 1997): 36. [6] It is important to make my point clear. The 'America' that I am summoning here is a popular cultural formation, which possesses little connection with the territory, institution or defence initiatives of the United States. Simon Frith made this distinction clear, when he stated that "the question becomes whether 'America' can continue to be the mythical locale of popular culture as it has been through most of this century. As I've suggested, there are reasons now to suppose that 'America' itself, as a pop cultural myth, no longer bears much resemblance to the USA as a real place even in the myth." This statement was made in "Anglo-America and its discontents," Cultural Studies 5 1991: 268. [7] To observe the scale of attention paid to the Asian and Pacific markets, please refer to http://robbiewilliams.com/july13scroll.html, http://robbiewilliams.com/july19scroll.html and http://robbiewilliams.com/july24scroll.html, accessed on March 3, 2001 [8] At its most naïve, J. Michael Bailey and Michael Oberschneider asked, "Why are gay men so motivated to dance? One hypothesis is that gay men dance in order to be feminine. In other words, gay men dance because women do. An alternative hypothesis is that gay men and women share a common factor in their emotional make-up that makes dancing especially enjoyable," from "Sexual orientation in professional dance," Archives of Sexual Behaviour. 26.4 (August 1997). Such an interpretation is particularly ludicrous when considering the pre-rock and roll masculine dancing rituals in the jive, Charleston and jitterbug. Once more, the history of rock music is obscuring the history of dance both before the mid 1950s and after acid house. [9] Women, gay men and black communities through much of the twentieth century have used these popular spaces. For example, Lynne Segal, in Slow Motion. London: Virago, 1990, stated that "through dancing, athletic and erotic performance, but most powerfully through music, Black men could express something about the body and its physicality, about emotions and their cosmic reach, rarely found in white culture - least of all in white male culture,": 191 References Ansen, D., Giles, J., Kroll, J., Gates, D. and Schoemer, K. "What's a handsome lad to do?" Newsweek 133.19 (May 10, 1999): 85. "Ask Dr. Hip." U.S. News and World Report 129.16 (October 23, 2000): 72. Bailey, J. Michael., and Oberschneider, Michael. "Sexual orientation in professional dance." Archives of Sexual Behaviour. 26.4 (August 1997):expanded academic database [fulltext]. Boehm, E. "Pop will beat itself up." Variety 373.5 (December 14, 1998): 89. Bracewell, Michael. "Britpop's coming home, it's coming home." New Statesman.(February 21 1997): 36. Buchbinder, David. Performance Anxieties .Sydney: Allen and Unwin, 1998. Faludi, Susan. Stiffed. London: Chatto and Windus, 1999. Frith, Simon. "Anglo-America and its discontents." Cultural Studies. 5 1991. Futterman, Steve. "The best and worst: honour roll." Entertainment Weekly, 574-575 (December 22-December 29 2000): 146. Gikandi, Simon. Maps of Englishness. New York: Columbia University Press, 1996. Kadis, Alex. Take That: In private. London: Virgin Books, 1994. Kamp, D. "London Swings! Again!" Vanity Fair ( March 1997): 102. Kimmel, Michael. Manhood in America. New York: The Free Press, 1996. Mendell, Adrienne. How men think. New York: Fawcett, 1996. Moore, Susan. "Getting a bit of the other - the pimps of postmodernism." In Rowena Chapman and Jonathan Rutherford (ed.) Male Order .London: Lawrence and Wishart, 1988. 165-175. Orecklin, Michele. "People." Time. 155.10 (March 13, 2000): 101. Pollack, William. Real boys. Melbourne: Scribe Publications, 1999. Reynolds, Simon. members.aol.com/blissout/britpop.html. Accessed on April 15, 2001. Robinson, David. No less a man. Bowling Green: Bowling Green State University, 1994. Segal, Lynne. Slow Motion. London: Virago, 1990. Smith, Paul. "Introduction" in P. Smith (ed.), Boys: Masculinity in contemporary culture. Colorado: Westview Press, 1996. Swart, S. "U.K. Showbiz" Variety.(December 11-17, 2000): 35. Sexton, Paul and Masson, Gordon. "Tips for Brits who want U.S. success" Billboard .(September 9 2000): 1. Wells, Steven. "Angst." NME.(November 21 1998): 62. "Will Geri's fling lose its fizz?" Marketing.(August 2000): 17. Woods, S. "Robbie Williams Sing when you're winning" The Village Voice. 45.52. (January 2, 2001): 98.
APA, Harvard, Vancouver, ISO, and other styles
38

Farrell, Nathan. "From Activist to Entrepreneur: Peace One Day and the Changing Persona of the Social Campaigner." M/C Journal 17, no. 3 (June 10, 2014). http://dx.doi.org/10.5204/mcj.801.

Full text
Abstract:
This article analyses the public persona of Jeremy Gilley, a documentary filmmaker, peace campaigner, and the founder of the organisation Peace One Day (POD). It begins by outlining how Gilley’s persona is presented in a manner which resonates with established archetypes of social campaigners, and how this creates POD’s legitimacy among grassroots organisations. I then describe a distinct, but not inconsistent, facet of Gilley’s persona which speaks specifically to entrepreneurs. The article outlines how Gilley’s individuality works to simultaneously address these overlapping audiences and argues that his persona can be read as an articulation of social entrepreneurship. Gilley represents an example of a public personality working to “crystallise issues and to normativise debates” (Marshall “Personifying” 370) concerning corporate involvement with non-profit organisations and the marketisation of the non-profit sector. Peace One Day (POD) is a UK-based non-profit organisation established in 1999 by actor-turned-documentary-filmmaker Jeremy Gilley. In the 1990s, while filming a documentary about global conflict, Gilley realised there was no internationally recognised day of ceasefire and non-violence. He created POD to found such a day and began lobbying the United Nations. In 2001, the 111th plenary meeting of the General Assembly passed a resolution which marked 21 September as the annual International Day of Peace (United Nations). Since 2001, POD has worked to create global awareness of Peace Day. By 2006, other NGOs began using the day to negotiate 24-hour ceasefires in various conflict zones, allowing them to carry out work in areas normally too dangerous to enter. For example, in 2007, the inoculation of 1.3 million Afghan children against polio was possible due to an agreement from the Taliban to allow safe passage to agencies working in the country during the day. This was repeated in subsequent years and, by 2009, 4.5 million children had been immunised (POD Part Three). While neither POD nor Gilley played a direct part in the polio vaccination programmes or specific ceasefires, his organisation acted as a catalyst for such endeavours and these initiatives would not have occurred without POD’s efforts.Gilley is not only the founder of POD, he is also the majority shareholder, key decision-maker, and predominant public spokesperson in this private, non-charitable, non-profit organisation (Frances 73). While POD’s celebrity supporters participate in press conferences, it is Gilley who does most to raise awareness. His public persona is inextricably linked with POD and is created through a range of presentational media with which he is engaged. These include social media content, regular blogposts on POD’s website, as well as appearances at a series of speaking events. Most significantly, Gilley establishes his public persona through a number of documentary films (Peace One Day; Day After; POD Part Three), which are shot largely from his perspective and narrated by his voiceover, and which depict POD’s key struggles and successes.The Peace Campaigner as an Activist and Entrepreneur In common with other non-profit organisations, POD relies on celebrities from the entertainment industries. It works with them in two key ways: raising the public profile of the organisation, and shaping the public persona of its founder by inviting comparisons of their perceived exceptionalness with his ostensible ordinariness. For example, Gilley’s documentaries depict various press conferences held by POD over a number of years. Those organised prior to POD recruiting celebrity spokespeople were “completely ignored by the media” whereas those held after celebrity backing from Jude Law and Angelina Jolie had been secured attracted considerable interest (Day After). Gilley explains his early difficulties in publicising his message by suggesting that he “was a nobody” (POD Part Three). This representation as a “nobody” or, more diplomatically, as “ordinary,” is a central component of Gilley’s persona. “Ordinariness” here means situating Gilley outside the political and entertainment elites and aligning him with more everyday suburban settings. This is done through a combination of the aesthetic qualities of his public presentation and his publically narrated back-story.Aesthetically speaking, Gilley presents his ordinariness through his casual attire and long hair. His appearance is similar to the campaigners, youth groups and school children he addresses, suggesting he is a representative of that demographic but also distancing him from political elites. The diplomats Gilley meets, such as those at the UN, wear the appropriate attire for their elite political setting: suits. In one key scene in the documentary Peace One Day, Gilley makes his first trip to the UN to meet Kofi Annan, UN General Secretary at the time, and appears at their doors clean cut and suitably dressed. He declares that his new appearance was designed to aid his credibility with the UN. Yet, at the same time, he makes explicit that he borrowed the suit from a friend and the tie from his grandfather and, prior to the meeting, it was decided, “the pony tail had to go.” Thus Gilley seeks the approval of both political elites and the ordinary public, and constructs a persona that speaks to both, though he aligns himself with the latter.Gilley’s back-story permeates his films and works to present his ordinariness. For example, POD has humble beginnings as an almost grassroots, family-run organisation, and Gilley depicts a campaign run on a shoestring from his mother’s spare bedroom in an ordinary suburban home. Although British Airways provided free flights from the organisation’s outset, Gilley shows his friends volunteering their time by organising fundraising events. POD’s modest beginnings are reflected in its founder, who confides about both his lack of formal education and lack of success as an actor (Day After). This “ordinariness” is constructed in opposition to the exceptional qualities of POD’s A-list celebrity backers—such as Angelina Jolie, who does enjoy success as an actor. This contrast is emphasised by inviting Jolie into Gilley’s everyday domestic setting and highlighting the icons of success she brings with her. For example, at his first meeting with Jolie, Gilley waits patiently for her and remarks about the expensive car which eventually arrives outside his house, denoting Jolie’s arrival. He notes in the voiceover to his The Day after Peace documentary, “this was unbelievable, Angelina Jolie sat on my sofa asking me what she could do, I couldn’t stop talking. I was so nervous.”Gilley promotes his ordinariness by using aesthetics and personal narrative. Evidence of how he struggled to realise his goals and the financial burdens he carried (Peace One Day) suggest that there is something authentic about Gilley’s vision for Peace Day. This also helps Gilley to align his public persona with common understandings of the political activist as a prophetic social visionary. POD is able to tap into the idea of the power of the individual as a force for change with references to Martin Luther King and Gandhi. Although Gilley makes no direct comparison between himself and these figures, blog entries such as “ten years ago, I had an idea; I dared to dream that I could galvanise the countries of the world to recognise an official day of ceasefire and nonviolence. Mad? Ambitious? Idealistic? All of the above” (Gilley “Dream”), invite comparisons with King’s “I Have a Dream” speech. This is further augmented by references to Gilley as an outsider to political establishments, such as the UN, which he is sure have “become cynical about the opportunity” they have to unite the world (BBC Interview).Interestingly, Gilley’s presentation as a pragmatic “change-maker” whose “passion is contagious” (Ahmad Fawzi, in POD Concert) also aligns him with a second figure: the entrepreneur. Where Gilley’s performances at school and community groups present his persona as an activist, his entrepreneur persona is presented through his performances at a series of business seminars. These seminars, entitled “Unleash Your Power of Influence,” are targeted towards young entrepreneurs and business-people very much consistent with the “creative class” demographic (Florida). The speakers, including Gilley, have all been successful in business (POD is a private company) and they offer to their audiences motivational presentations, and business advice. Although a semi-regular occurrence, it is the first two events held in July 2010 (Unleash 1) and November 2010 (Unleash 2) that are discussed here. Held in a luxury five-star London hotel, the events demonstrate a starkly different aspect of POD than that presented to community groups and schools, and the amateur grassroots ethic presented in Gilley’s documentary films—for example, tickets for Unleash 2 started at £69 and offered ‘goody bags’ for £95 (author’s observation of the event)—yet consistencies remain.Aesthetically speaking, Gilley’s appearance signifies a connection with these innovative, stereotypically young, founders of start-up companies and where Gilley is an outsider to political organisations; they are outsiders to business establishments. Further, many of these companies typically started, like POD, in a spare bedroom. The speakers at the Unleash events provide insights into their background which frequently demonstrate a rise from humble beginnings to business success, in the face of adversity, and as a result of innovation and perseverance. Gilley is not out of place in this environment and the modest beginnings of POD are relayed to his audience in a manner which bears a striking similarity to his for-profit counterparts.An analysis of Gilley’s presentations at these events demonstrates clear links between the dual aspects of Gilley’s public persona, the political economy of POD, and the underlying philosophy of the organisation—social entrepreneurship. The next section sets out some of the principals of social entrepreneurship and how the aspects of Gilley’s persona, outlined above, reinforce these.Personifying Social EnterpriseGenerally speaking, the business literature greatly emphasises entrepreneurs as “resourceful, value-creating change agents” who are “never satisfied with the status quo [... and are] a forceful engine of growth in our economy” (Dees and Economy 3-4). More recently, the focus of discussion has included social entrepreneurs. These individuals work within “an organisation that attacks [social and environmental] problems through a business format, even if it is not legally structured as a profit-seeking entity” (Bornstein and Davis xv) and advocate commercially oriented non-profit organisations that establish “win-win” relationships between non-profits and business.This coming together of the for- and non-profit sectors has range of precedents, most notably in “philanthrocapitalism” (Bishop and Green) and the types of partnerships established between corporations and environmentalists, such as Greenpeace Australia (Beder). However, philanthrocapitalism often encompasses the application of business methods to social problems by those who have amassed fortunes in purely commercial ventures (such as Bill Gates), and Beder’s work describes established for- and non-profit institutions working together. While social entrepreneurship overlaps with these, social entrepreneurs seek to do well by doing good by making a profit while simultaneously realising social goals (Bornstein and Davis 25).Read as an articulation of the coming together of the activist and the entrepreneur, Gilley’s individuality encapsulates the social enterprise movement. His persona draws from the commonalities between the archetypes of the traditional grassroots activist and start-up entrepreneur, as pioneering visionary and outsider to the establishment. While his films establish his authenticity among politically attuned members of the public, his appearances at the Unleash events work to signify the legitimacy of his organisation to those who identify with social entrepreneurialism and take the position that business should play a positive role in social causes. As an activist, Gilley’s creates his persona through his aesthetic qualities and a performance that draws on historical precedents of social prophets. As an entrepreneur, Gilley draws on the same aesthetic qualities and, through his performance, mitigates the types of disjuncture evident in the 1980s between environmental activists, politicians and business leaders, when environmentalist’s narratives “were perceived as flaky and failed to transform” (Robèrt 7). To do this, Gilley reconstitutes social and environmental problems (such as conflict) within a market metric, and presents the market as a viable and efficient solution. Consequently, Gilley asserts that “we live in a culture of war because war makes money, we need to live in a culture of peace,” and this depends on “if we can make it economical, if we can make the numbers add up” (Unleash).Social enterprises often eschew formal charity and Gilley is consistent with this when he states that “for me, I think it has to be about business. [...] I think if it’s about charity it’s not going to work for me.” Gilley asserts that partnerships with corporations are essential as “our world is going to change, when the corporate sector becomes engaged.” He, therefore, “want[s] to work with large corporations” in order to “empower individuals to be involved in the process of [creating] a more peaceful and sustainable world” (Unleash). One example of POD’s success in this regard is a co-venture with Coca-Cola.To coincide with Peace Day in 2007, POD and Coca-Cola entered into a co-branding exercise which culminated in a sponsorship deal with the POD logo printed on Coca-Cola packaging. Prior to this, Gilley faced a desperate financial situation and conceded that the only alternative to a co-venture with Coca-Cola was shutting down POD (Day After). While Coca-Cola offered financial support and the potential to spread Gilley’s message through the medium of the Coke can, POD presumably offered good publicity to a corporation persistently the target of allegations of unethical practice (for example, Levenson-Estrada; Gill; Thomas). Gilley was aware of the potential image problems caused by a venture with Coke but accepted the partnership on pragmatic grounds, and with the proviso that Coke’s sponsorship not accompany any attempt to influence POD. Gilley, in effect, was using Coca-Cola, displaying the political independence of the social visionary and the pragmatism of the entrepreneur. By the same token, Coca-Cola was using POD to garner positive publicity, demonstrating the nature of this “win-win” relationship.In his film, Gilley consults Ray C. Anderson, social enterprise proponent, about his ethical concerns. Anderson explains the merits of working with Coke. In his Unleash addresses, such ethical considerations do not feature. Instead, it is relayed that Coca-Cola executives were looking to become involved with a social campaign, consistent with the famous 1970s hilltop advertisement of “teaching the world to sing in harmony.” From a meeting at Coca-Cola’s headquarters in Atlanta, Gilley reveals, a correlation emerged between Gilley’s emphasis on Peace Day as a moment of global unity—encapsulated by his belief that “the thing about corporations [...] the wonderful thing about everybody […] is that everybody’s just like us” (Unleash)—and the image of worldwide harmony that Coca-Cola wanted to portray. It is my contention that Gilley’s public persona underpinned the manner in which this co-branding campaign emerged. This is because his persona neatly tied the profit motive of the corporation to the socially spirited nature of the campaign, and spoke to Coca-Cola in a manner relatable to the market. At the same time, it promoted a social campaign premised on an inclusiveness that recast the corporation as a concerned global citizen, and the social campaigner as a free-market agent.Persona in the Competitive Non-Profit SectorThrough a series of works P. David Marshall charts the increasing centrality of individuality as “one of the ideological mainstays of consumer capitalism [...and] equally one of the ideological mainstays of how democracy is conceived” (Marshall “New Media-New Self” 635). Celebrity, accordingly, can be thought of as a powerful discourse that works “to make the cultural centrality of individuality concretely real” (Marshall “New Media-New Self” 635). Beyond celebrity, Marshall offers a wider framework that maps how “personalisation, individuality, and the move from the private to the public are now part of the wider populace rather than just at play in the representational field of celebrity” (Marshall, “Persona” 158). This framework includes fundamental changes to the global, specifically Western, labour market that, while not a fait accompli, point to a more competitive environment in which “greater portions of the culture are engaged in regular—probably frequent—selling of themselves” and where self-promotion becomes a key tool (Marshall, “Persona” 158). Therefore, while consumerism comprises a backdrop to the proliferation of celebrity culture, competition within market capitalism contributes to the wider expansion of personalisation and individualism.The non-profit sector is also a competitive environment. UK studies have found an increase in the number of International NGOs of 46.6% from 1995/6-2005/6 (Anheier, Kaldor, and Glasius. 310). At the same time, the number of large charities (with an income greater than £10 million) rose, between 1999-2013, from 307 to 1,005 and their annual income rose from approximately £10bn to £36bn (Charity Commission). These quantitative changes in the sector have occurred alongside qualitative changes in terms of the orientation of individual organisations. For example, Epstein and Gang describe a non-profit sector in which NGOs compete against each other for funds from aid donors (state and private). It is unclear whether “aid will be allocated properly, say to the poorest or to maximize the social welfare” or to the “efficient aid-seekers” (294)—that is, NGOs with the greatest competitive capabilities. A market for public awareness has also emerged and, in an increasingly crowded non-profit sector, it is clearly important for organisations to establish a public profile that can gain attention.It is in this competitive environment that the public personae of activists become assets for NGOs, and Gilley constitutes a successful example of this. His persona demonstrates an organisation’s response to the competitive nature of the non-profit sector, by appealing to both traditional activist circles and the business sector, and articulating the social enterprise movement. Gilley effectively embodies social entrepreneurship—in his appearance, his performance and his back-story—bridging a gap between the for- and non-profit sectors. His persona helps legitimate efforts to recast the activist as an entrepreneur (and conversely, entrepreneurs as activists) by incorporating activist ideals (in this instance, peace) within a market framework. This, to return to Marshall’s argument, crystallises the issue of peace within market metrics such and normativises debates about the role of corporate actors as global citizens, presenting it as pragmatism and therefore “common sense.” This is not to undermine Gilley’s achievements but, instead, to point out how reading his public persona enables an understanding of efforts to marketise the non-profit sector and align peace activism with corporate power.References Anheier, Helmut K., Mary Kaldor, and Marlies Glasius. Global Civil Society 2006/7. London: Sage, 2007.BBC Storyville. Director Interview: Jeremy Gilley. BBC. 2004. 7 Feb. 2010.Beder, Sharon. Global Spin: The Corporate Assault on Environmentalism. Totnes, UK: Green Books, 2002.Bishop, Matthew, and Michael Green. Philanthrocapitalism. London: A&C Black, 2008.Bornstein, David, and Susan Davis. Social Entrepreneurship: What Everyone Needs to Know. New York: Oxford University Press, 2010.Charity Commission for England and Wales. “Sector Facts and Figures.” N.d. 5 Apr 2014.Day after Peace, The. Dir. Jeremy Gilley. Peace One Day, 2008.Dees, J. Gregory, and Peter Economy. "Social Entrepreneurship." Enterprising Nonprofits: A Toolkit for Social Entrepreneurs. Eds. J. Gregory Dees, Jed Emerson, and Peter Economy. New York: Wiley, 2001. 1-18.Epstein, Gil S., and Ira N. Gang. “Contests, NGOs, and Decentralizing Aid.” Review of Development Economics 10. 2 (2006): 285-296.Florida, Richard. The Flight of the Creative Class: The New Global Competition for Talent. New York: Harper Business, 2006.Frances, Nic. The End of Charity: Time for Social Enterprise. New South Wales: Allen & Unwin, 2008.Fraser, Nick. “Can One Man Persuade the World, via the UN, to Sanction a Global Ceasefire Day?” BBC. 2005. 7 Feb. 2010.Gill, Leslie. “Labor and Human Rights: The ‘Real Thing’ in Colombia.” Transforming Anthropology 13.2 (2005): 110-115.Gilley, Jeremy. “Dream One Day.” Peace One Day. 2009. 23 Jun 2010.Levenson-Estrada, Deborah. Trade Unionists against Terror: Guatemala City, 1954-1985. Chapel Hill: U of North Carolina P, 1994.Marshall, P. David. Celebrity and Power. Minneapolis: University of Minnesota Press, 2001.Marshall, P. David. “Intimately Intertwined in the Most Public Way: Celebrity and Journalism.” The Celebrity Culture Reader. Ed. P. David Marshall. Oxon: Routledge, 2006. 316-323.Marshall, P. David. “New Media – New Self: The Changing Power of Celebrity.” The Celebrity Culture Reader. Ed. P. David. Marshall. Oxon: Routledge, 2006. 634-644.Marshall, P. David. “Personifying Agency: The Public–Persona–Place–Issue Continuum.” Celebrity Studies 4.3 (2013): 369-371.Marshall, P. David. “Persona Studies: Mapping the Proliferation of the Public Self.” Journalism 15.2 (2014): 153-170.Newsnight. BBC 2. 20 Sep. 2010. 22.30-23.00.Peace One Day. Dir. Jeremy Gilley. Peace One Day, 2004.Peace One Day Concert: Live at the Royal Albert Hall Gilley. Dir. Jeremy Gilley. Peace One Day, 2008.Peace One Day Part Three. Dir. Jeremy Gilley. Peace One Day, 2010.Robèrt, Karl-Henrik. The Natural Step: Seeding a Quiet Revolution. Gabriola Island, British Columbia: New Society Publishers, 2002.Thomas, Mark. Belching Out the Devil: Global Adventure with Coca-Cola. London: Ebury Press, 2008.United Nations General Assembly. “International Day of Peace. A/RES/55/282" 111th Plenary Meeting. 2001. 10 June 2014 ‹http://www.un.org/en/ga/search/view_doc.asp?symbol=A/RES/55/282&Lang=E›.Unleash Your Power of Influence. Triumphant Events and Peace One Day. 2010.
APA, Harvard, Vancouver, ISO, and other styles
39

Rolls, Alistair. "The Re-imagining Inherent in Crime Fiction Translation." M/C Journal 18, no. 6 (March 7, 2016). http://dx.doi.org/10.5204/mcj.1028.

Full text
Abstract:
Introduction When a text is said to be re-appropriated, it is at times unclear to what extent this appropriation is secondary, repeated, new; certainly, the difference between a reiteration and an iteration has more to do with emphasis than any (re)duplication. And at a moment in the development of crime fiction in France when the retranslation of now apparently dated French translations of the works of classic American hardboiled novels (especially those of authors like Dashiell Hammett, whose novels were published in Marcel Duhamel’s Série Noire at Gallimard in the decades following the end of the Second World War) is being undertaken with the ostensible aim of taking the French reader back (closer) to the American original, one may well ask where the emphasis now lies. In what ways, for example, is this new form of re-production, of re-imagining the text, more intimately bound to the original, and thus in itself less ‘original’ than its translated predecessors? Or again, is this more reactionary ‘re-’ in fact really that different from those more radical uses that cleaved the translation from its original text in those early, foundational years of twentieth-century French crime fiction? (Re-)Reading: Critical Theory and Originality My juxtaposition of the terms ‘reactionary’ and ‘radical’, and the attempted play on the auto-antonymy of the verb ‘to cleave’, are designed to prompt a re(-)read of the analysis that so famously took the text away from the author in the late-1960s through to the 1990s, which is to say the critical theory of poststructuralism and deconstruction. Roland Barthes’s work (especially 69–77) appropriated the familiar terms of literary analysis and reversed them, making of them perhaps a re-appropriation in the sense of taking them into new territory: the text, formerly a paper-based platform for the written word, was now a virtual interface between the word and its reader, the new locus of the production of meaning; the work, on the other hand, which had previously pertained to the collective creative imaginings of the author, was now synonymous with the physical writing passed on by the author to the reader. And by ‘passed on’ was meant ‘passed over’, achevé (perfected, terminated, put to death)—completed, then, but only insofar as its finite sequence of words was set; for its meaning was henceforth dependent on its end user. The new textual life that surged from the ‘death of the author’ was therefore always already an afterlife, a ‘living on’, to use Jacques Derrida’s term (Bloom et al. 75–176). It is in this context that the re-reading encouraged by Barthes has always appeared to mark a rupture a teasing of ‘reading’ away from the original series of words and the ‘Meaning’ as intended by the author, if any coherence of intention is possible across the finite sequence of words that constitute the written work. The reader must learn to re-read, Barthes implored, or otherwise be condemned to read the same text everywhere. In this sense, the ‘re-’ prefix marks an active engagement with the text, a reflexivity of the act of reading as an act of transformation. The reader whose consumption of the text is passive, merely digestive, will not transform the words (into meaning); and crucially, that reader will not herself be transformed. For this is the power of reflexive reading—when one reads text as text (and not ‘losing oneself’ in the story) one reconstitutes oneself (or, perhaps, loses control of oneself more fully, more productively); not to do so, is to take an unchanged constant (oneself) into every textual encounter and thus to produce sameness in ostensible difference. One who rereads a text and discovers the same story twice will therefore reread even when reading a text for the first time. The hyphen of the re-read, on the other hand, distances the reader from the text; but it also, of course, conjoins. It marks the virtual space where reading occurs, between the physical text and the reading subject; and at the same time, it links all texts in an intertextual arena, such that the reading experience of any one text is informed by the reading of all texts (whether they be works read by an individual reader or works as yet unencountered). Such a theory of reading appears to shift originality so far from the author’s work as almost to render the term obsolete. But the thing about reflexivity is that it depends on the text itself, to which it always returns. As Barbara Johnson has noted, the critical difference marked by Barthes’s understandings of the text, and his calls to re-read it, is not what differentiates it from other texts—the universality of the intertext and the reading space underlines this; instead, it is what differentiates the text from itself (“Critical Difference” 175). And while Barthes’s work packages this differentiation as a rupture, a wrenching of ownership away from the author to a new owner, the work and text appear less violently opposed in the works of the Yale School deconstructionists. In such works as J. Hillis Miller’s “The Critic as Host” (1977), the hyphenation of the re-read is less marked, with re-reading, as a divergence from the text as something self-founding, self-coinciding, emerging as something inherent in the original text. The cleaving of one from and back into the other takes on, in Miller’s essay, the guise of parasitism: the host, a term that etymologically refers to the owner who invites and the guest who is invited, offers a figure for critical reading that reveals the potential for creative readings of ‘meaning’ (what Miller calls the nihilistic text) inside the transparent ‘Meaning’ of the text, by which we recognise one nonetheless autonomous text from another (the metaphysical text). Framed in such terms, reading is a reaction to text, but also an action of text. I should argue then that any engagement with the original is re-actionary—my caveat being that this hyphenation is a marker of auto-antonymy, a link between the text and otherness. Translation and Originality Questions of a translator’s status and the originality of the translated text remain vexed. For scholars of translation studies like Brian Nelson, the product of literary translation can legitimately be said to have been authored by its translator, its status as literary text being equal to that of the original (3; see also Wilson and Gerber). Such questions are no more or less vexed today, however, than they were in the days when criticism was grappling with translation through the lens of deconstruction. To refer again to the remarkable work of Johnson, Derrida’s theorisation of textual ‘living on’—the way in which text, at its inception, primes itself for re-imagining, by dint of the fundamental différance of the chains of signification that are its DNA—bears all the trappings of self-translation. Johnson uses the term ‘self-différance’ (“Taking Fidelity” 146–47) in this respect and notes how Derrida took on board, and discussed with him, the difficulties that he was causing for his translator even as he was writing the ‘original’ text of his essay. If translation, in this framework, is rendered impossible because of the original’s failure to coincide with itself in a transparently meaningful way, then its practice “releases within each text the subversive forces of its own foreignness” (Johnson, “Taking Fidelity” 148), thereby highlighting the debt owed by Derrida’s notion of textual ‘living on’—in (re-)reading—to Walter Benjamin’s understanding of translation as a mode, its translatability, the way in which it primes itself for translation virtually, irrespective of whether or not it is actually translated (70). In this way, translation is a privileged site of textual auto-differentiation, and translated text can, accordingly, be considered every bit as ‘original’ as its source text—simply more reflexive, more aware of its role as a conduit between the words on the page and the re-imagining that they undergo, by which they come to mean, when they are re-activated by the reader. Emily Apter—albeit in a context that has more specifically to do with the possibilities of comparative literature and the real-world challenges of language in war zones—describes the auto-differentiating nature of translation as “a means of repositioning the subject in the world and in history; a means of rendering self-knowledge foreign to itself; a way of denaturalizing citizens, taking them out of the comfort zone of national space, daily ritual, and pre-given domestic arrangements” (6). In this way, translation is “a significant medium of subject re-formation and political change” (Apter 6). Thus, translation lends itself to crime fiction; for both function as highly reflexive sites of transformation: both provide a reader with a heightened sense of the transformation that she is enacting on the text and that she herself embodies as a reading subject, a subject changed by reading. Crime Fiction, Auto-Differention and Translation As has been noted elsewhere (Rolls), Fredric Jameson made an enigmatic reference to crime fiction’s perceived role as the new Realism as part of his plenary lecture at “Telling Truths: Crime Fiction and National Allegory”, a conference held at the University of Wollongong on 6–8 December 2012. He suggested, notably, that one might imagine an author of Scandi-Noir writing in tandem with her translator. While obvious questions of the massive international marketing machine deployed around this contemporary phenomenon come to mind, and I suspect that this is how Jameson’s comment was generally understood, it is tempting to consider this Scandinavian writing scenario in terms of Derrida’s proleptic considerations of his own translator. In this way, crime fiction’s most telling role, as one of the most widely read contemporary literary forms, is its translatability; its haunting descriptions of place (readers, we tend, perhaps precipitously, to assume, love crime fiction for its national, regional or local situatedness) are thus tensely primed for re-location, for Apter’s ‘subject re-formation’. The idea of ‘the new Realism’ of crime, and especially detective, fiction is predicated on the tightly (self-)policed rules according to which crime fiction operates. The reader appears to enter into an investigation alongside the detective, co-authoring the crime text in real (reading) time, only for authorial power to be asserted in the unveiling scene of the denouement. What masquerades as the ultimately writerly text, in Barthes’s terms, turns out to be the ultimate in transparently meaningful literature when the solution is set in stone by the detective. As such, the crime novel is far more dependent on descriptions of the minutiae of everyday life (in a given place in time) than other forms of fiction, as these provide the clues on which its intricate plot hinges. According to this understanding, crime fiction records history and transcribes national allegories. This is not only a convincing way of understanding crime fiction, but it is also an extremely powerful way of harnessing it for the purposes of cultural history. Claire Gorrara, for example, uses the development of French crime fiction plots over the course of the second half of the twentieth century to map France’s coming to terms with the legacy of the Second World War. This is the national allegory written in real time, as the nation heals and moves on, and this is crime fiction as a reaction to national allegory. My contention here, on the other hand, is that crime fiction, like translation, has at its core an inherent, and reflexive, tendency towards otherness. Indeed, this is because crime fiction, whose origins in transnational (and especially Franco-American) literary exchange have been amply mapped but not, I should argue, extrapolated to their fullest extent, is forged in translation. It is widely considered that when Edgar Allan Poe produced his seminal text “The Murders in the Rue Morgue” (1841) he created modern crime fiction. And yet, this was made possible because the text was translated into French by Charles Baudelaire and met with great success in France, far more so indeed than in its original place of authorship. Its original setting, however, was not America but Paris; its translatability as French text preceded, even summoned, its actualisation in the form of Baudelaire’s translation. Furthermore, the birth of the great armchair detective, the exponent of pure, objective deduction, in the form of C. Auguste Dupin, is itself turned on its head, a priori, because Dupin, in this first Parisian short story, always already off-sets objectivity with subjectivity, ratiocination with a tactile apprehension of the scene of the crime. He even goes as far as to accuse the Parisian Prefect of Police of one-dimensional objectivity. (Dupin undoes himself, debunking the myth of his own characterisation, even as he takes to the stage.) In this way, Poe founded his crime fiction on a fundamental tension; and this tension called out to its translator so powerfully that Baudelaire claimed to be translating his own thoughts, as expressed by Poe, even before he had had a chance to think them (see Rolls and Sitbon). Thus, Poe was Parisian avant la lettre, his crime fiction a model for Baudelaire’s own prose poetry, the new voice of critical modernity in the mid-nineteenth century. If Baudelaire went on to write Paris in the form of Paris Spleen (1869), his famous collection of “little prose poems”, both as it is represented (timelessly, poetically) and as it presents itself (in real time, prosaically) at the same time, it was not only because he was spontaneously creating a new national allegory for France based on its cleaving of itself in the wake of Georges-Eugène Haussmann’s massive programme of urbanisation in Paris in the 1800s; it was also because he was translating Poe’s fictionalisation of Paris in his new crime fiction. Crime fiction was born therefore not only simultaneously in France and America but also in the translation zone between the two, in the self-différance of translation. In this way, while a strong claim can be made that modern French crime fiction is predicated on, and reacts to, the auto-differentiation (of critical modernity, of Paris versus Paris) articulated in Baudelaire’s prose poems and therefore tells the national allegory, it is also the case, and it is this aspect that is all too often overlooked, that crime fiction’s birth in Franco-American translation founded the new French national allegory. Re-imagining America in (French) Crime Fiction Pierre Bayard has done more than any other critic in recent years to debunk the authorial power of the detective in crime fiction, beginning with his re-imagining of the solution to Agatha Christie’s The Murder of Roger Ackroyd and continuing with that of Arthur Conan Doyle’s The Hound of the Baskervilles (1998 and 2008, respectively). And yet, even as he has engaged with poststructuralist re-readings of these texts, he has put in place his own solutions, elevating them away from his own initial premise of writerly engagement towards a new metaphysics of “Meaning”, be it ironically or because he has fallen prey himself to the seduction of detectival truth. This reactionary turn, or sting-lessness in the tail, reaches new heights (of irony) in the essay in which he imagines the consequences of liberating novels from their traditional owners and coupling them with new authors (Bayard, Et si les œuvres changeaient d’auteur?). Throughout this essay Bayard systematically prefers the terms “work” and “author” to “text” and “reader”, liberating the text not only from the shackles of traditional notions of authorship but also from the terminological reshuffling of his and others’ critical theory, while at the same time clinging to the necessity for textual meaning to stem from authorship and repackaging what is, in all but terminology, Barthes et al.’s critical theory. Caught up in the bluff and double-bluff of Bayard’s authorial redeployments is a chapter on what is generally considered the greatest work of parody of twentieth-century French crime fiction—Boris Vian’s pseudo-translation of black American author Vernon Sullivan’s novel J’irai cracher sur vos tombes (1946, I Shall Spit on Your Graves). The novel was a best seller in France in 1946, outstripping by far the novels of the Série Noire, whose fame and marketability were predicated on their status as “Translations from the American” and of which it appeared a brazen parody. Bayard’s decision to give credibility to Sullivan as author is at once perverse, because it is clear that he did not exist, and reactionary, because it marks a return to Vian’s original conceit. And yet, it passes for innovative, not (or at least not only) because of Bayard’s brilliance but because of the literary qualities of the original text, which, Bayard argues, must have been written in “American” in order to produce such a powerful description of American society at the time. Bayard’s analysis overlooks (or highlights, if we couch his entire project in a hermeneutics of inversion, based on the deliberate, and ironic, re-reversal of the terms “work” and “text”) two key elements of post-war French crime fiction: the novels of the Série Noire that preceded J’irai cracher sur vos tombes in late 1945 and early 1946 were all written by authors posing as Americans (Peter Cheyney and James Hadley Chase were in fact English) and the translations were deliberately unfaithful both to the original text, which was drastically domesticated, and to any realistic depiction of America. While Anglo-Saxon French Studies has tended to overlook the latter aspect, Frank Lhomeau has highlighted the fact that the America that held sway in the French imaginary (from Liberation through to the 1960s and beyond) was a myth rather than a reality. To take this reasoning one logical, reflexive step further, or in fact less far, the object of Vian’s (highly reflexive) novel, which may better be considered a satire than a parody, can be considered not to be race relations in the United States but the French crime fiction scene in 1946, of which its pseudo-translation (which is to say, a novel not written by an American and not translated) is metonymic (see Vuaille-Barcan, Sitbon and Rolls). (For Isabelle Collombat, “pseudo-translation functions as a mise en abyme of a particular genre” [146, my translation]; this reinforces the idea of a conjunction of translation and crime fiction under the sign of reflexivity.) Re-imagined beneath this wave of colourful translations of would-be American crime novels is a new national allegory for a France emerging from the ruins of German occupation and Allied liberation. The re-imagining of France in the years immediately following the Second World War is therefore not mapped, or imagined again, by crime fiction; rather, the combination of translation and American crime fiction provide the perfect storm for re-creating a national sense of self through the filter of the Other. For what goes for the translator, goes equally for the reader. Conclusion As Johnson notes, “through the foreign language we renew our love-hate intimacy with our mother tongue”; and as such, “in the process of translation from one language to another, the scene of linguistic castration […] is played on center stage, evoking fear and pity and the illusion that all would perhaps have been well if we could simply have stayed at home” (144). This, of course, is just what had happened one hundred years earlier when Baudelaire created a new prose poetics for a new Paris. In order to re-present (both present and represent) Paris, he focused so close on it as to erase it from objective view. And in the same instance of supreme literary creativity, he masked the origins of his own translation praxis: his Paris was also Poe’s, which is to say, an American vision of Paris translated into French by an author who considered his American alter ego to have had his own thoughts in an act of what Bayard would consider anticipatory plagiarism. In this light, his decision to entitle one of the prose poems “Any where out of the world”—in English in the original—can be considered a Derridean reflection on the translation inherent in any original act of literary re-imagination. Paris, crime fiction and translation can thus all be considered privileged sites of re-imagination, which is to say, embodiments of self-différance and “original” acts of re-reading. References Apter, Emily. The Translation Zone: A New Comparative Literature. Princeton: Princeton UP, 2006. Barthes, Roland. Le Bruissement de la langue. Paris: Seuil, 1971. Baudelaire, Charles. Le Spleen de Paris. Trans. Louise Varèse. New York: New Directions, 1970 [1869]. Bayard, Pierre. Qui a tué Roger Ackroyd? Paris: Les Éditions de Minuit, 1998. ———. L’Affaire du chien des Baskerville. Paris: Les Éditions de Minuit, 2008. ———. Et si les œuvres changeaient d’auteur? Paris: Les Éditions de Minuit, 2010. Benjamin, Walter. “The Task of the Translator.” Illuminations. Trans. Harry Zohn. New York: Harcourt, Brace & World, Inc., 1968. 69–82. Bloom, Harold, et al. Deconstruction and Criticism. New York: The Seabury Press, 1979. Collombat, Isabelle. “Pseudo-traduction: la mise en scène de l’altérité.” Le Langage et l’Homme 38.1 (2003): 145–56. Gorrara, Claire. French Crime Fiction and the Second World War: Past Crimes, Present Memories. Manchester: Manchester UP, 2012. Johnson, Barbara. “Taking Fidelity Philosophically.” Difference in Translation. Ed. Joseph F. Graham. Ithaca: Cornell UP, 1985. 142–48. ———. “The Critical Difference.” Critical Essays on Roland Barthes. Ed. Diana Knight. New York: G.K. Hall, 2000. 174–82. Lhomeau, Frank. “Le roman ‘noir’ à l’américaine.” Temps noir 4 (2000): 5–33. Miller, J. Hillis. “The Critic as Host.” Critical Inquiry 3.3 (1977): 439–47. Nelson, Brian. “Preface: Translation Lost and Found.” Australian Journal of French Studies 47.1 (2010): 3–7. Poe, Edgar Allan. “The Murders in the Rue Morgue.” Complete Tales and Poems of Edgar Allan Poe. New York: Vintage Books, [1841]1975. 141–68. Rolls, Alistair. “Editor’s Letter: The Undecidable Lightness of Writing Crime.” The Australasian Journal of Popular Culture 3.1 (2014): 3–8. Rolls, Alistair, and Clara Sitbon. “‘Traduit de l’américain’ from Poe to the Série Noire: Baudelaire’s Greatest Hoax?” Modern and Contemporary France 21.1 (2013): 37–53. Vuaille-Barcan, Marie-Laure, Clara Sitbon, and Alistair Rolls. “Jeux textuels et paratextuels dans J’irai cracher sur vos tombes: au-delà du canular.” Romance Studies 32.1 (2014): 16–26. Wilson, Rita, and Leah Gerber, eds. Creative Constraints: Translation and Authorship. Melbourne: Monash UP, 2012.
APA, Harvard, Vancouver, ISO, and other styles
40

Hummel, Kathryn. "Before and after A Night Out: The Impact of Revelation in Bangladesh." M/C Journal 14, no. 6 (November 18, 2011). http://dx.doi.org/10.5204/mcj.435.

Full text
Abstract:
I spent more than two years in Bangladesh and lived through several incarnations—as a volunteer for aid organisations, an expatriate socialite, a bidesi (foreigner) trying to live sodesi (locally)—before becoming an ethnographer and, simultaneously, a lover and fighter of my adopted country. During the winter of my second lifetime I was sexually assaulted and at the beginning of my third lifetime, I recounted the experience at an academic conference in Dhaka. Smitten by the possibility that personal revelation could overcome cross-cultural barriers, I read A Night Out to compel others to sympathise and share, perhaps even loosen the somewhat restricted discussion of sexual intimidation in Bangladesh. Yet the response to A Night Out was quiet, absorbed by the static of courtesy, and taught me that disclosure alone cannot transcend differences to reach a space of mutual understanding. Later, when I posted A Night Out online, I observed the continued and changing capacity of revelation to evoke responses from people across genders and cultures. This article argues that the impact of revelation, although difficult to quantify, is never static and depends significantly on context: first, by describing autoethnography, a way of writing about other cultures that connects the "autobiographical and personal to the cultural, social and political" (Ellis xix), in the "Before" section to give background to A Night Out; secondly, the "After" section considers the various responses to the story and discusses it as "both a process and a product" of cultural research (xix). Before A Night Out Switching lives between Australia and Bangladesh has shown me the value of cultural research that deconstructs traditional conceptions of the "Western" and "Eastern" worlds. In terms of the representations of women, those in the East are too often prescribed the characteristics of ignorance, poverty, illiteracy, domesticity, maternity, and victimization, while the Western woman is depicted as modern, educated, in control of her body and sexuality (Gandhi 86). As a researcher, ultimately, of the life stories of Bangladeshi women, I sought to decrease the misconceptions surrounding those who were, like me, never only "West" or "East", influenced but never solely defined by their culture. Autoethnography is a method of cultural research that makes connections between "individual experience and social processes" in ways that emphasise the essential falsity of cultural categories (Sparkes 217). To transcend these boundaries of people, place and time, autoethnographers make use of narrative, believing it to be "the best way to understand the human experience" because it is "the way humans understand their own lives" (Richardson 218). As a writer, I likewise believe that narrative provides a way to make sense of or negotiate one's place in relation to any space or group of people. In particular, telling personal stories "bears fruit" of "reaching out to others," provoking their own stories and emotional responses, thereby becoming an effective cultural research method (Four Arrows 106). I remember my admiration for the Bangladeshi writer Shabnam Nadiya, who in Woman Alone describes her isolating experiences of sexual molestation as a girl and, later, the realisation via the writing of Taslima Nasrin that "it happened everywhere, everyday ... to anyone" (2008). For Nadiya, self-reflexivity created a "bridge" between the interior practise of reading and the exterior "everyday lived life" of communal experience and identity (2008). While connections on such an intimate scale may be difficult or unwelcome, making them is significant as "the process of revolution itself" (Ware 239). Inspired by Nadiya to write a piece with enough emotional power to reach over the public space of the conference room, my revelation concerned one of my own experiences as a woman in Bangladesh. A Night Out I was never afraid of my city at night. The time I liked Dhaka best was when the day wore down to dusk and the sky looked like it had been brushed clean. When I lived near Dhanmondi Lake I would walk through the drab hues of the surrounding park with its concrete paths and dusty trees that stretched their reflections across the pond-green water. The park was always crowded with raucous wallahs (vendors) and power walking women in bright dresses, yet even so I was the focus of attention, haunted by exclamations of "Koto lomba!" (How tall!) until my shadows became longer than myself in the quartzy light, and I was not so noticeable. When I moved to the Newmarket area I would spend the twilight hours sitting barefoot on my balcony in a voluminous housedress, watching Dhaka's night stage. Children played games on the rooftop of the lower apartment block opposite, women unhooked lines of fresh laundry and groups of friends would chat or play guitar. Even when the evening azan growled from the megaphones of nearby mosques there was activity on the street below, figures moving under the marigold glare of the sodium streetlights or, in winter, stretching nets across the street for badminton matches. Rickshawallahs rang their bells to the call of the crows and there was always an obnoxious motorist laying into his car horn. I felt more a part of my neighbourhood at this distance than when I became, eight floors down, the all-too-visible spectacle of the only foreigner in the district. The flat, my only source of solitude in Dhaka, was in a peaceful building set at the end of a road that turned three corners before coming to a blind halt. Walking its length day and night to reach the main thoroughfare, I got to know the road well. A few old bungalows remained, with comfortably decaying verandas behind wrought-ironwork and the shade of banana trees. Past the first corner the road became an entry for Dhaka College and the high school opposite; houses gave way to walls papered with adverts, a cluster of municipal bins surrounded by litter and wooden shacks that served cha (tea) and fried snacks. I was on friendly terms with the grey-haired wallah who stalked the area daily with his vegetable cart and one betel-chewing woman who sorted the neighbourhood rubbish. Once I neared the college attention from the chawallahs and students became more harassing than friendly, but I continued to walk to and from my house and most of the time, I walked alone. When solitude turns oppressive, the solution is to open all windows and doors and let air and friends in. One evening I invited Mia and Farad, both journalists and wine-drinkers, who arrived before sunset and stayed almost til midnight. We all knew the later it became the harder it would be for Mia to reach her home across the city. A call to one of the less dodgy cab companies proved us right—there were no taxis available in the area. It would be better, said Farad, to walk to the main road and hail a cab from there. Reluctant to end the evening at the elevator, I locked my door and joined my friends on the walk out to Mipur Road, which even at midnight stirred with the occasional activity of tradesmen and drivers. After a few attempts, Farad flagged down a cab, negotiated a fare and recorded the driver's number. It was part of the safety training Mia and I had imbibed as foreigners over the years. Other examples included "Never buy spices from the sacks at the market" and "Never wear gold necklaces while riding rickshaws." "I should catch my bus," Farad announced after Mia's departure. "But you've left your books in my house," I replied. "I thought you were coming back to get them." Farad was incredibly sexy with his brooding face and shaggy black beard and I had hoped more time would reveal reciprocal interest. From one writer to another it was not a suggestive line, but I was too shy to be more explicit with my male friends in Bangladesh, who treated me as one of the boys and silenced me sometimes with their unexpectedly conservative views of women. Farad considered my comment. "I'll collect them later, or we can meet at the university in a few days. Do you need to catch a rickshaw to your door?" "I don't have any taka on me," I said, "and it's not far." I was, after all, in my own street, not being chauffeured home by a bleary-eyed driver. "Thanks for coming! Abar dekha hobe (see you again)." "Goodnight," Farad replied and as he turned to leave I saw him grin into his beard, amused by my tipsy pronunciation. Fatigue dropped heavily on my shoulders as I strolled back down the road. My flat, with its small clean bed and softly purring ceiling fans, seemed far away at the end of the alley. It was very quiet, as quiet as home when I used to walk through the city to the train station after late night shifts on the suicide hotline. The dim light in the street exposed its emptiness. The stalls along the road had shut hours earlier and the only movement came from a middle-aged man taking his exercise, swinging his arms widely from side to side as he strode home. As I turned the first corner of the alley, another man approached me from behind. I glanced at him, probably because he had glanced at me. "Are you OK?" he asked. "Fine." "What is your country?" "Look," I said, unaccountably feeling my heart rate increase, "I'm sorry, but I don't want to talk now." "No problem, no problem," he assured me, spreading his hands and smiling, displaying two charming rows of teeth. "Relax. You're very nice." My instinct was to smile back. We walked past the waste piles that had been emptied from the bins, ready for sorting. The woman I exchanged greetings with worked here on most days and instructed me on how to wear my orna (scarf) when it wasn't placed correctly over my chest. I wondered now where she slept at night. Calculating the closeness of my friend seemed less like idle speculation when the man who was walking beside me stepped directly into my path. He was tall and lean and wore a dark blue shirt. His face gleamed, as if he had been sweating during the day and had not washed off the residue. It occurred to me to twist past him and walk faster, maybe even run. I considered how fast and how far I could go in my thongs and wondered if I should kick them off, and then start to run. "No problem," the man repeated, holding out his hands again, placing them tightly behind my neck. He pulled me towards the wall as he forced me back by moving closer. Instant wetness struck me as I felt the concrete—my pelvic floor had made the first start of surprise. The strong hands moved quickly from my neck to my breasts. "I just want to…" said the man, squeezing both breasts like he was selecting fruit. He added, "You're very nice." I was wearing the only remotely attractive bra I owned, purchased from the supermarket on Dhanmondi 27. The cups, moulded from black synthetic lace, made my chest stick out in jaunty cones like a 1950s sex-bomb and the underwire dug into my chest. Clothes can be armour, yet in this case had depleted my self-preservation. I stood quite still, thinking only of what might happen next. I was against a wall in an alleyway at midnight, with no-one around except the man who was groping me. Finally I reacted, though it was not the reaction I would have guessed at my most objective self. Cowgirls get the blues, rough beasts slouch to be born and six foot one kick-boxing world travelling feminists scream like frightened cats with the shock of even minor violation. And certain men, I learned on my night out, chuckle at the distress they cause and then run away. After A Night Out The personal and public impacts of A Night Out proved to be cumulative over time and throughout retellings. When I read the piece at the Dhaka conference I was set to unleash the "transformative and efficacious potential" that autoethnography legendarily contains (Spry 712), though if my revelation achieved anything close to such a transformation, it was unclear. A female academic who had been chatting with me before my presentation, left the room directly after it. The students, mainly female undergraduates, had no questions to ask about any aspect of my paper. Whatever reactions my audience felt, if any, were not discussed. After my presentation, the male convenor privately expressed his regret over my experience and related more horrific examples. Sexual harassment of women is prevalent in Bangladesh yet so too is the culture of blaming the victim and denying the crime (cf. Lodhi; Mudditt; Nadiya), an attitude reflected through the use of the term "Eve Teasing," which assigns the provocative role to the woman and normalises the aggressive or sexual actions of the perpetrator (Kabeer 149). The response of this liberal and thoughtful man to my revelation was the only one that was articulated. By this measurement, A Night Out had failed to make the desired impact. One of the greatest reasons for this was the tension between the personal motivation behind my revelation and the public impact I had optimistically expected. A Night Out omits the reactions of my community immediately after my assault, when I was chastised for walking alone at such at late hour and for failing to defend myself, particularly given my size. In my street, gossip spread that I had not been groped but mugged, a less lecherous so perhaps more acceptable offense. I read A Night Out partly to gain some retrospective acknowledgement of my experience and in my determination I defied the complexities of a conservative country…[in which] women do not live alone, do not have male friends, do not travel by themselves or smoke cigarettes publicly and most definitely [...] do not talk or write about sexual topics. In Dhaka these things matter and 'decent women' are supposed to play by the rules. (Deen 35) Although I observed this conservatism to varying degrees in Bangladesh, I know that when women play outside the rules, negotiating cultural norms becomes a process of "alliance and conflict" that requires sensitivity to practise (Akhter 22)—a sensitivity that is difficult to grasp. The career of Bangladeshi writer Taslima Nasrin illustrates this: credited with opening doors of feminist discussion "that had been shuttered by genteel conservatism, by niceness, by ignorance and denial" (Nadiya), Nasrin diminished this effect and alienated her audience through subsequent "shock tactics and sensationalism" (Deen 56). Although my revelation had also alienated my audience, it was not the impact I had hoped for. While Linda Park-Fuller celebrates autoethnographic performance as a "transgressive act—a revealing of what has been kept hidden, a speaking of what has been silenced" (26), the conference experience made me realise the significance of cultural context to the impact of revelation. I considered recasting A Night Out in a setting that was more intimate than academic, to an audience prepared for the content and united by achieving a specific outcome, where responses could be given privately if desired. I would also have to shift my role from defiant storyteller to one who welcomed all types of feedback. By posting A Night Out online as a Facebook note, I not only fulfilled the requirements above but made the story accessible to a large audience of men and women of diverse cultural backgrounds, including Bangladeshi. The written replies I received were easier to decipher than the faces after the conference presentation. Among the responses, some from people I did not know at all, many conveyed their appreciation for the description of Bangladesh. Others commented on the risk I took in walking down the road at night and suggested ways I could defend myself in future. I was told I was tough to write the account and was invited to share more of my experiences. One friend in Bangladesh shared my note with others and wrote to describe the reaction of a female friend of his who was "terribly shocked" by what I had written about my breasts, more than my attraction to Farad or the sexual assault itself. This anonymous respondent's "pure cultural shock", which my conference audience may also have felt, was better communicated through the Facebook retelling of A Night Out, although I am unable to interpret the silence of the other Bangladeshi women I sent the note to. While the responses I received indicated my revelation had made some impact in its online context, I could not help being especially touched when a male friend wrote, "And as a Bangladeshi I feel sorry for [your trouble]." It is one matter to write up a personal experience and another to have it make a public impact. As my first reading of A Night Out shows, autoethnographic revelation contains the potential to alienate as well as to create sympathy with an audience. Combined with the second, more private and accessible, distribution of A Night Out, this "Before" and "After" analysis shows the evolution of the revelation's impact on my audience as well as myself, over time and within different cultural contexts, in the academic, social and online arenas. Although my experience confirms the impact autoethnography can make as a form of cultural research, it can only be strengthened by continued attempts to seek a balance between the projections and inflections of culture, self and audience. It is not only in the telling but in the re-telling that personal revelations will gather and continue to give impact, which is why I now present A Night Out to a new audience in a new context and await your new responses. References Akhter, Farida. Seeds of Movements: On Women's Issues In Bangladesh. Dhaka: Narigrantha Prabartana, 2007. Deen, Hanifa. Broken Bangles. New Delhi: Penguin, 1998. Ellis, Carolyn. The Ethnographic I: A Methodological Novel about Autoethnography. Walnut Creek: AltaMira P, 2004. Four Arrows. The Authentic Dissertation: Alternate Ways of Knowing, Research, and Representation. London: Routledge, 2008. Gandhi, Leela. Postcolonial Theory: A Critical Introduction. St Leonards: Allen and Unwin, 1998. Kabeer, Naila. Reversed Realities: Gender Hierarchies in Development Thought. London: Verso, 1994. Lodhi, Muhamad. "Reply." Unheard Voice: All Things Bangladesh. 25 Jun. 2011. 5 Oct. 2011 ‹http://unheardvoice.net/blog/2011/06/24/silence/#comments›. Mudditt, Jessica. "Mugged, Dragged and Scarred: Harrowing Tales from Foreigners In Dhaka." The Independent Digital 23 Aug. 2011: 1-2. Nadiya, Shabnam. "Woman Alone." The Daily Star—Features. 29 Sep. 2008. 5 Oct. 2011 ‹http://www.thedailystar.net/suppliments/2008/eid_special/woman.htm›. Park-Fuller, Linda. "Performing Absence: The Staged Personal Narrative as Testimony." Text and Performance Quarterly 20 (2000): 20–42. Richardson, Laurel. "Narrative Sociology." Representation in Ethnography. Ed. John Van Maanen, Thousand Oaks: Sage, 1995. 198–221. Sparkes, Andrew C. "Autoethnography: Self-Indulgence or Something More?" Ethnographically Speaking: Autoethnography, Literature and Aesthetics. Eds. Arthur Bochner and Carolyn Ellis. Walnut Creek: AltaMira, 2002. 209–32. Spry, Tami. "Performing Autoethnography: An Embodied Methodological Praxis." Qualitative Inquiry 7.6 (2001): 706–32. Ware, Vron. Beyond the Pale: White Women, Racism and History. London: Verso, 1992.
APA, Harvard, Vancouver, ISO, and other styles
41

Laforteza, Elaine M. "Cute-ifying Disability: Lil Bub, the Celebrity Cat." M/C Journal 17, no. 2 (February 18, 2014). http://dx.doi.org/10.5204/mcj.784.

Full text
Abstract:
Introduction Feline Hitler look-alikes. Dogs attired in hats and bow-ties. Rabbits wearing lace bonnets. Images of these animals abound on the Internet with a host of websites paying homage to their cuteness. Emphasising the cuteness of non-human animals by anthropomorphising them is a common trend online, but there is also another side to the human relationship with other animals that has created a different category of cuteness. The blogger, Tiffiny Carlson, remarks that there has been an “onslaught of virtual love for disabled animals” who are not dressed to look like humans or imagined as human look-alikes to signify as cute. Rather, an animal’s disability becomes the signifier for cuteness. Carlson defines this as “cute-ifying disability” wherein disability is what makes an animal cute. In this context, a dog with an artificial leg, a gold-fish with a “wheelchair”, and a cat with visible breathing difficulties register as cute precisely because of their disabilities. In this paper, I draw on Carlson’s idea of “cute-ifying” disability to analyse the popularity of the cat, Lil Bub (https://www.facebook.com/iamlilbub). In doing so, I name non-human animals as animals and human-animals as humans. This is not to state that humans are not animals, but rather to use these terms to make visible the hierarchical relationship developed between them. (Re)defining Disability and Cuteness Critical disability studies aims to challenge and unpack the norms through which disability is dominantly represented, understood and politicised in terms of a “lack”. In keeping with this intention, Tanya Titchkosky argues that perceptions about disability need to move away from defining disability as an object of knowledge. Instead, Titchkosky advocates for an experience that conceives of disability as a “space of interpretive encounter” (56) that enables a “way of perceiving and orienting toward the world” (4). Here, Titchkosky discusses disability in terms of the norms through which disability is treated, thus intimating that “disability” and “ability” are socio-cultural constructs that establish the norms through which human capacity and capability (mental, physical and emotional) are understood. In line with this observation, this section intends to analyse the norms through which disability is formed, and in turn, how these norms inform human-animal relations and their impact on “cuteness”. One of the fundamental norms that undergirds understandings of disability is the idea that disability is inferior to “ability”, so much so that the philosopher, Paul W. Taylor suggests that human illness and disablement equates to an animal’s existence, regardless if they are disabled or not. He specifies, “We [humans] have a sense of gratitude at the good fortune that we were not born one of them [animals], a sense that comes sharply into focus when, through some abnormality of birth or by some accident or disease a human being is reduced to leading an animal’s simple kind of life…In comparison with the severely restricted kind of existence that is the lot of plants and animals, our own human modes of life are naturally appreciated for being so much richer, fuller, more interesting and desirable in every way” (158). Taylor asserts that disability becomes equated to animality through defining both as simpler examples of existence. Animals are therefore recognised in a similar way to disabled humans, wherein both are rendered as reduced facsimiles of “interesting” and “desirable” human existence. Other scholars of critical human-animal studies, such as Kari Weil and Cary Wolfe also make a connection between animality and disability, but do so in such a way that challenges normative assumptions about both as lacking agency. Kari Weil argues that the normative ways in which the complexity of human expression and consciousness is measured according to linguistic ability is not necessarily correct, rather, it is “an obstacle to a…fullness of vision” (88). Weil claims that this “fullness of vision” is expressed by “beings who are removed from ‘normal’ sociolinguistic behavior. These beings may be nonhuman animals as well as persons with certain linguistic and cognitive disabilities” (88-89). Drawing on the example of Temple Grandin, (who has written about her life with autism and how this has enabled her to form a bond with animals), both Weil and Wolfe state that the idea of animals and disabled humans as “simple” needs re-assessment. Wolfe makes this clear when she cites Grandin’s first book, Emergence: Labeled Autistic, as demonstrating the interior narrative to autistic thought and experience, and therefore enabling an “unthinkable” act “because it had been medical dogma…that there was no ‘inside,’ no inner life, in the autistic…” (111). Wolfe uses this re-conception of the inner life of disability to think through the complexity of animals’ “interior” life. This is not to conflate animals with disabled humans, but instead, to offer a more nuanced understanding of representations of difference. Rosemarie Garland-Thomson analyses how these representations of difference normalise disability as a spectacle. She writes, “the history of disabled people in the Western world is in part the history of being on display, of being visually conspicuous while politically and socially erased” (56). Disability, then, is visibilised as a spectacle to be looked at as “other”, and in this act of looking, disabilities are rendered as irrelevant to “ordinary” normality. Garland- Thomson further indicates that curiosity preoccupies the human eye when gazing on perceived disabilities, wherein the compulsion to “gawk with abandon at the prosthetic hook, the empty sleeve, the scarred flesh…” occurs without seeing (or wanting to see) the whole body “of the person with a disability” (57). In this context, those who gawk fail to see the interior life Wolfe and Weir state is taken away from disability. Instead, disabled people are labelled in terms of their perceived anomalies to a normative social order. Garland-Thomson states that this process of looking at disability is considered “illicit” (2002: 57) and therefore the need to look away accompanies the compulsion to “gawk”. Why is this process of looking illicit? The stories of those who contend with disabilities provide an explanation. For example, the blogger, BigMamaDiva2, writes about how her son’s diagnosis of PDD-NOS (Pervasive Development Disorder-Not Otherwise Specified) was the official label used to identify the series of “symptoms” her son was exhibiting (1). PDD-NOS is under the umbrella of the Autism spectrum of diagnoses. In her blog, BigMamaDiva2 narrates how people perceive her son through a narrow lens defined by the hegemony of normalcy and the assumptions attached to autism. Through this lens, her son is deemed “limited” and “rude”. Part of the reason that he is perceived in this manner is the fact that he looks back and even stares intently at the people who misjudge him. The look of judgement people give him is thrown back in their faces, accounted for, and not dismissed. Even if BigMamaDiva2’s son does not intend to challenge these people, the fact that he does not give them the opportunity to look away, or to look with impunity, creates a sense of discomfort for those who mark out his “disability” and look down on him because of it. This exchange in looking/being looked at contributes to the illicitness in looking at disability because of the discomfort it brings to those who stare and those who are stared at. There is a message that informs this sense of discomfort; it is a message that tells those who are looked at that they are being judged as helpless and inferior. Extending this discomfort is the fact that those who are looked at can look back and stare in response to those who castigate them. This desire to “look away”, as Garland-Thomson puts it, intimates the need to look away before the person being stared at has the chance to look back. In this context, this sense of looking at/looking away attempts to construct a hierarchy wherein the exceptional is pathologized and the “ordinary” is normalised (Garland-Thomson 56). However, when a person views animals, a different kind of gaze can be evoked. This kind of gaze is informed by cuteness and how it frames some animals as human objects of appreciation and adoration. By “cuteness,” I refer to Joshua Dale’s definition of “cute” as: juvenile features that cause an affective reaction, somatic cuteness…namely, large head and small, round body; short extremities; big eyes; small nose and mouth. Whether genetic, or activated by learned signals, the cuteness response is also associated with a range of behavioral aspects, including: childlike, dependent, gentle, intimate, clumsy, and nonthreatening. Such physical and behavioral features trigger an attachment based on the desire to protect and take care of the cute object. (1) The reasons that contribute to the illicitness of looking at human disability are the factors which “cute-fy” animals and disability. It is precisely because of the animals’ supposed “disabled” characteristics of helplessness, inferiority and child-like appeal that package them as cute. In this context, this kind of animal refers to a domesticated pet. If that pet has a disability, this sense of cuteness is enhanced as it emphasises the factors which construct them as cute in the first place. Disability is thus “cute-fied” through asserting signifiers of disability as cute. The following section draws on this process of cute-fying disability to chart the ways in which animals are framed in a human/animal hierarchy that conceptualises disabled animals as commodified spectacles for human consumption. The following section also demonstrates how cute-fying disability also engenders a re-reading of disability in the manner advocated by Titchkosky, Weir, and Wolfe to “see” and contend with disabilities in a more ethical manner. Lil Bub: Commodity, Charity and Companion Lil Bub, a cat which has become a celebrity, is an example of how “cute-ifying” disability occurs online. According to Mike Bridavsky (Lil Bub’s carer/owner), this cat was: discovered as the runt of a healthy feral litter in a tool shed in rural Indiana, she was taken in as a rescue when it was clear that she would require special care. BUB was born with a multitude of genetic anomalies […] She is a “perma-kitten”, which means she will stay kitten sized and maintain kitten-like features her entire life. She also has an extreme case of dwarfism, which means her limbs are disproportionately small relative to the rest of her body and she has some difficulty moving around. She has very short, stubby legs and a weird, long, serpent-like body. Her lower jaw is significantly shorter than her upper jaw, and her teeth never grew in which is why her tongue is always hanging around. (1) As of the 16th of April 2014, Lil Bub’s genetic anomalies have garnered 669,617 likes on the Facebook page dedicated to her. This page has links to an online shop selling merchandise (for example, shirts, calendars, and mugs) highlighting Lil Bub’s genetic anomalies, as well as a YouTube channel which showcases Lil Bub’s disability as cuteness. A documentary about Lil Bub (Lil Bub & Friendz) also won the award for best online feature film at the 2013 Tribeca Film Festival. On both the Facebook page and the YouTube channel, people have written about how cute Lil Bub is. Many use highly emotive language to express how cute they think Lil Bub is, writing that they are “dying” from Lil Bub’s cuteness to how “overwhelmingly sweet” Lil Bub’s face is. These comments are predominantly in response to images of Lil Bub walking and sitting. On the Facebook page, these images are paired with captions written by Lil Bub’s owner and fans of Lil Bub. These captions imagine a context to Lil Bub’s expression of permanent cuteness, which shows her tongue hanging out and eyes that boggle in a look of surprise. For example, the caption “Friday!” is written above a picture of Lil Bub staring at the camera. Another caption, “must be raining yoghurt” is written above a picture of Lil Bub with a similar expression. Images of Lil Bub are predominantly the same, but the captions change to add diversity to what viewers can see on Facebook. Lil Bub also features on the online portal, I Can Has Cheezburger, which has a page dedicated to animals with disabilities (http://icanhas.cheezburger.com/tag/disabled). Carlson questions the popularity of these animals, and more specifically, why animal disabilities are considered as cute. Taking the definition of cute as categorising something/one as infantilised, needing assistance, and simpler than oneself, it can be argued that this definition matches with the views expressed by Taylor, as well as akin to how disability is seen in terms of “normality”. In this context, cuteness can encourage reductive ideas about disability and those who are differently-abled as “simple”. In Lil Bub’s case, several memes are made about her, including one with her usual look of surprise. This meme (http://cheezburger.com/7459833088#comments), which features on I Can Has Cheezburger, notes, “most cats look at you, questioning your intelligence…not this one.” The assumption that Lil Bub is not “condescending” (like other cats are supposed to be) is due to the fact that her tongue is sticking out because she has not grown any teeth. Her disability is framed as non-threatening, less confrontational than other cats, and therefore is a cuter, loveable option. In this context, disability is used to neutralise and make disability a manageable spectacle that can be commented on. Consequently, cuteness makes disability palatable by rearranging how people can consume and grasp the spectacle of disability. As mentioned earlier in this paper, Garland-Thomson writes about the illicitness which surrounds looking at disability. Cute-ifying disability through animals can remove the illicitness that informs the interaction Garland-Thomson describes. The online presence of cute animals, who are “cute” because of their disabilities, invites the human gaze to rest on their disabilities and encourages them to linger, to keep looking without feeling the need to look away. This desire to linger on the cute animal informs the commodification of Lil Bub. For example, the range of products produced to celebrate Lil Bub’s cuteness highlight how viewers are invited to visually absorb everything to do with Lil Bub. Cute-ifying disability, in terms of packaging “cute disabilities” as commodities, re-signifies how humans can perceive and view disability through rearranging the “awkward partnership” between disability and ability. Disability, in this case, can be marketed as “cute” and bought and sold because of its cuteness. However, the marketing of cuteness can also act as an entry point to think through and create awareness about complex social issues. For instance, cuteness can promote awareness about the “right to life” of disabled animals, which is one of Bridavsky’s aims. On a fact sheet written by Bridavsky, the message of celebrating difference is expressed: Beyond being overwhelmingly cute, exceptionally smart and painfully witty, BUB is an advocate for homeless and special needs pets all over the universe. Since before she was a star she has made it a point to spread a message of positivity. She proves that being different is better and she encourages the adoption of pets and helping those less fortunate. To date Lil BUB has directly raised more than $60,000 for various charities through her online store and meet-and-greets at animal shelters all of the country while spreading awareness about the importance of adoption, and spaying and neutering your pets. (1) While Bridavsky focuses on difference through the figure of Lil Bub’s cuteness, this does not detract from the potential cuteness has to expand normative horizons and go beyond acting in the service of enabling reductive norms. For instance, through Bridavsky’s initiative, Lil Bub has partnered with the American Society for the Prevention of Cruelty to Animals (ASPCA) to generate funds for cats with special needs. In this context, Lil Bub’s “cute-fied” disability enables humans to think charitably towards animals with disabilities, and brings awareness to animals with special needs. Moreover, the online presence of Lil Bub and other disabled animals, and their packaging as cute creatures, can operate in the service of disabled people. This is not to state that animals are only relevant in terms of human existence, but to specify that representations of disabilities can resignify normative ideas about disability as something that is other to the complexity of human existence. Viewing an animal’s disability online can be a recuperative process with humans with disabilities. For instance, Nancy, a person who commented on Carlson’s idea of “cute-ifying disability” on 24 February 2014, remarked: “Children identify with cartoons and animals. A lot. Children have told me how Winter the dolfin has a fake tail, and relate it to their leg brace. Or how they saw a dog in a wheelchair and they identified with it since they are in a wheelchair [sic]” (1). Conclusion As the examples above demonstrate, Lil Bub’s popularity can be read in terms of the interaction between the commodification and characterisation of animals as cute, the use of cuteness and disability to raise awareness and funding for charities, and the relationship between animals and humans as companions and sources of inspiration for one another. Cute-fying disability is informed through this complex assemblage that reorients one-sided ideas of cuteness as simply enabling ethical engagements with disability or disenabling such negotiations. At the heart of this is the question: “in whose interest is this for?” As Carlson notes, the issue is not so much in seeing animals as cute, but in not seeing humans with disabilities in a way that sees them as human beings (1). Carlson takes issue with the fact that the same level of benevolence and friendliness offered to disabled animals online is not extended to humans with disabilities. By this, Carlson is not suggesting that people see other people with disabilities as “cute”. Rather, she, like Garland-Thomson, advocate for the “process of dismantling the institutional, attitudinal, legislative, economic, and architectural barriers that keep people with disabilities from full participation in society” (75). The example of Lil Bub demonstrates the various ways through which these barriers are erected and challenged. For instance, Lil Bub has been framed in terms of a human/animal hierarchy that positions her as figure for human entertainment. Her disabilities have also positioned her within another kind of hierarchy wherein she is packaged as less complex and less threatening than “normal” cats, as suggested by the meme that claims that Lil Bub does not judge people, unlike other cats. Simultaneously, Lil Bub’s popularity has garnered awareness towards animals with disabilities and the help humans can offer to assist them. Moreover, Lil Bub, and other disabled animals that are represented as cute, are relatable as companions for humans and can be a source of inspiration for many people. In mapping out the nuances to cute-fying disability in Lil Bub’s case, this paper is not invested in stating whether cute-fying disability is wrong or right, but rather, to point towards the ways in which cute-fying disability can simultaneously work for and against ethical engagements with disability for humans and animals. References BigMamaDiva2. “Winn-ER son!!!” BigMamaDiva2, 2014. 10 Jan. 2014 ‹http://bigmamadiva2.blogspot.com.au/›. Bridavsky, Mike. Lil Bub: About. n.d. 2 Apr. 2014 ‹http://lilbub.com/about›. Carlson, Tiffiny. “Animals and Wheelchairs: Cute-ifying Disability.” Easy Stand Blog, 19 Feb. 2013. 17 Feb. 2014 ‹http://blog.easystand.com/2013/02/animals-and-wheelchairs-cute-ifying-disability/›. Dale, Joshua. Cute Studies, 2014. 17 Feb. 2014 ‹http://www.academia.edu/5132057/CFP_Cute_Studies›. Garland-Thomson, Rosemarie. “The Politics of Staring: Visual Rhetorics of Disability in Popular Photography.” In Disability Studies: Enabling the Humanities, eds. Sharon L. Snyder, Brenda Jo Brueggemann, and Rosemarie Garland-Thomson. New York: Modern Language Association, 2002. 56–75. Taylor, Paul W. “Are Humans Superior to Animals and Plants?” Environmental Ethics (Summer 1984): 149–160. Titchkosky, Tanya. The Question of Access: Disability, Space, Meaning. Toronto: University of Toronto Press, 2011. Weil, Kari. “Killing Them Softly: Animal Death, Linguistic Disability, and the Struggle for Ethics.” Configurations 14.1-2 (2006): 87–96. Wolfe, Cary. “Learning from Temple Grandin, or Animal Studies, Disability Studies, and Who Comes after the Subject.” New Formations (Spring 2008): 110–123.
APA, Harvard, Vancouver, ISO, and other styles
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography