Log in

Relevant bibliographies by topics / Taney

Contents

Journal articles
Dissertations / Theses
Books
Book chapters
Conference papers

Academic literature on the topic 'Taney'

Author: Grafiati

Published: 4 June 2021

Last updated: 7 February 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Taney.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Journal articles on the topic "Taney"

1

SIMON, JAMES F. "Lincoln and Chief Justice Taney." Journal of Supreme Court History 35, no. 3 (2010): 225–42. http://dx.doi.org/10.1111/j.1540-5818.2010.01248.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

2

Collings, D., and P. C. Brown. "The construction of Taney Bridge, Ireland." Proceedings of the Institution of Civil Engineers - Bridge Engineering 156, no. 3 (2003): 117–24. http://dx.doi.org/10.1680/bren.2003.156.3.117.

Full text

APA, Harvard, Vancouver, ISO, and other styles

3

Collins, Michael, and Ann Woolhandler. "Judicial Federalism under Marshall and Taney." Supreme Court Review 2017, no. 1 (2018): 337–84. http://dx.doi.org/10.1086/697687.

Full text

APA, Harvard, Vancouver, ISO, and other styles

4

Huebner, Timothy S., and R. Kent Newmyer. "The Supreme Court under Marshall and Taney." American Journal of Legal History 47, no. 3 (2005): 335. http://dx.doi.org/10.2307/30039536.

Full text

APA, Harvard, Vancouver, ISO, and other styles

5

Stern, Robert L. "Chief Justice Taney and the Shadow of Dred Scott." Journal of Supreme Court History 17, no. 1 (1992): 39–52. http://dx.doi.org/10.1111/j.1540-5818.1992.tb00075.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

6

O'Hara, James B. "Out of the Shadow: Roger Brooke Taney as Chief Justice." Journal of Supreme Court History 23, no. 1 (1998): 21–34. http://dx.doi.org/10.1111/j.1540-5818.1998.tb00124.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

7

Coumans, Jason P., John Stix, David A. Clague, and William G. Minarik. "The Magmatic Architecture of Taney Seamount-A, NE Pacific Ocean." Journal of Petrology 56, no. 6 (2015): 1037–67. http://dx.doi.org/10.1093/petrology/egv027.

Full text

APA, Harvard, Vancouver, ISO, and other styles

8

Carey, Patrick W. "Political Atheism: Dred Scott, Roger Brooke Taney, and Orestes A. Brownson." Catholic Historical Review 88, no. 2 (2002): 207–29. http://dx.doi.org/10.1353/cat.2002.0072.

Full text

APA, Harvard, Vancouver, ISO, and other styles

9

Etzkorn, Girard J. "Meditaciones vite Christi, olim S. Bonauenturo attributae.Iohannes de Caulibus , M. Stallings-Taney." Speculum 74, no. 4 (1999): 1074–75. http://dx.doi.org/10.2307/2887006.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

Paquette, Robert L. "The Mind of Roger Taney: New Light on the Dred Scott Decision." Academic Questions 29, no. 1 (2016): 34–48. http://dx.doi.org/10.1007/s12129-016-9549-9.

Full text

APA, Harvard, Vancouver, ISO, and other styles

More sources

Dissertations / Theses on the topic "Taney"

1

Davies, Tansy. "Tansy Davies compositions." Thesis, Royal Holloway, University of London, 2003. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.408915.

Full text

APA, Harvard, Vancouver, ISO, and other styles

2

Klívarová, Daniela. "Tanec a struktura." Doctoral thesis, Akademie múzických umění v Praze. Hudební fakulta AMU. Knihovna, 2009. http://www.nusl.cz/ntk/nusl-78244.

Full text

Abstract:

The doctoral thesis is contribution to contemporary dance as a dance genre. It is focused on qualitative research made in framework of two volumes of international cultural exchange in the field of dance: Pointe to Point, Third Asia-Europe Dance Forum held in Tokyo, 2005, and Pointe to Point, Fourth Asia-Europe Dance Forum realized in Warsawa, 2006.

APA, Harvard, Vancouver, ISO, and other styles

3

Janotová, Alice. "Lidový tanec na Prácheňsku." Master's thesis, Akademie múzických umění v Praze. Hudební fakulta AMU. Knihovna, 2006. http://www.nusl.cz/ntk/nusl-78837.

Full text

APA, Harvard, Vancouver, ISO, and other styles

4

Ratajová, Olga. "Tanec v základním školství." Master's thesis, Akademie múzických umění v Praze. Hudební fakulta AMU. Knihovna, 2010. http://www.nusl.cz/ntk/nusl-79407.

Full text

Abstract:

In my graduation thesis I focused on different ways of integration of dance into elementary school education. One of the ways is integrated elementary school and the basic school of arts where children can get after passing the talent exams and they are obliged to attend dance lessons for next nine years. This kind of schooling is for hand-picked children only. The second possibility is the Dance for schools project of "Tanec Praha" organisation and Dance and Motoric education - new subject in Framework Education Programme (government education framework). Those are the two ways of education of children from the first to the fifth grades where all children are attending Dance lessons. Main aim of my graduation thesis is research into beginnings and raelization of both ways. I interviewed not only dance teachers but also elementary schools headmasters. I was interested in teacher´s work with children and their contemporary results.

APA, Harvard, Vancouver, ISO, and other styles

5

Kolda, Michal. "Jak vyučovat společenský tanec." Master's thesis, Akademie múzických umění v Praze.Hudební a taneční fakulta. Knihovna, 2014. http://www.nusl.cz/ntk/nusl-177755.

Full text

Abstract:

The Master thesis follows up on the previous Bachelor thesis title Methodology of traching of the ballroom dancing and it focuses on the second phase of teaching. The thesis engages in describes methodological techniques in teaching individual dances and dance figures within the advanced ballroom dancing courses. Commentaries are included, dealing with potencial problems in teaching and frequent faults.

APA, Harvard, Vancouver, ISO, and other styles

6

Dercsényiová, Lucie. "Tanec v díle Bohuslava Martinů." Doctoral thesis, Akademie múzických umění v Praze. Hudební fakulta AMU. Knihovna, 2010. http://www.nusl.cz/ntk/nusl-79354.

Full text

Abstract:

The first part of the thesis called Dance in the Work of Bohuslav Martinů focuses on fourteen Martinů´s ballets that have been staged so far. The following part is devoted to dance adaptations of Martinů´s concert opuses. The final part of the thesis deals with three Martinů´s operas which include dance scenes: The Soldier and the Dancer, The Plays of Mary and The Suburban Theatre. The appendices comprise librettos of selected works and musical scores with stage directions written by the composer; the enclosed CD contains archive photographs of stage designs and photographs from performances.

APA, Harvard, Vancouver, ISO, and other styles

7

Indráková, Tereza. "Tanec v moderním státě Izrael." Master's thesis, Akademie múzických umění v Praze. Hudební fakulta AMU. Knihovna, 2010. http://www.nusl.cz/ntk/nusl-79404.

Full text

Abstract:

The aim of this work called Dance in Modern Israel is to present the situation of dance in modern Israel and to interpret its characteristics with showing the influences that have formulated it since the beginning of the creation process of the modern state. I presnt individual artists and institutions based on own experiences during my research in Israel. I present the phenomenon of dance in the wider social and cultural context. The core of his work dwells in defyning the uniqness of the Israeli identity through the world of dance in the contemporary Israeli society.

APA, Harvard, Vancouver, ISO, and other styles

8

Párová, Karolína. "Současný tanec v televizním vysílání." Master's thesis, Akademie múzických umění v Praze. Filmová a televizní fakulta AMU. Knihovna, 2011. http://www.nusl.cz/ntk/nusl-96933.

Full text

Abstract:

The thesis deals with the phenomenon of dance in television broadcasting with an emphasis on contemporary dance, which is defined as a manner of artistic expression (dance as a way of entertainment is not in focus). The goal of this thesis is not only to describe the historical relationship between dance and television from the very beginning of broadcasting, but particularly to point out the possibilities of working with dance on the small screen and to provide arguments to support the idea that contemporary dance on television has the potential to be an impressive event. An essential part of this thesis is also an analysis of the current situation in the Czech Republic and a proposal of issues for producers in providing dance on the screen to the Czech viewer in the future.

APA, Harvard, Vancouver, ISO, and other styles

9

Hayashi, Lucie. "Tanec v současné japonské společnosti." Doctoral thesis, Akademie múzických umění v Praze.Hudební a taneční fakulta. Knihovna, 2014. http://www.nusl.cz/ntk/nusl-178066.

Full text

Abstract:

In my dissertation I have tried to describe the position and perception of dance in contemporary Japanese society from the perspective of modern methods of dance research. I focused on the transformation of the status of dance in society during the 20th century and the beginning of the new millennium, especially in terms of professional dance, its financial and media support, education, occupation and social status of dance artists in various dance genres. Context is completed with a reflection on the current problems of Japanese society that, to a large extent, affect the nation´s approach to dance, as well as a sociological survey on the perception of dance from the perspective of the young generation. It also includes an insight into the linguistic labelling of dance in contemporary Japanese.

APA, Harvard, Vancouver, ISO, and other styles

10

Indráková, Tereza. "Tanec v současné izraelské společnosti." Doctoral thesis, Akademie múzických umění v Praze.Hudební a taneční fakulta. Knihovna, 2015. http://www.nusl.cz/ntk/nusl-253802.

Full text

Abstract:

In my dissertation Dance in Israeli Society I have tried to describe the position and perception of dance in contemporary Israeli society from the perspective of modern methods of anthropological research. I have used the methods of the work in the field - authentic interviews with Israeli dancers and Israeli choreographers, with the use of publications in English and Hebrew. My observation were focused on modern Israeli society but with understanding the context of the Jewish history and the transformation of the status of dance in Jewish society from the Biblical times, through the period of diaspora until the Zionist ideas that led to the creation of modern State Israel. Context is completed with a reflection on the current problems of Israeli society and a positive role of dance as a the medium in mutual understanding of different social groups in the contemporary society,. I accent the rolraelská kultura, židovské náboženství, izraelská společnost, národní identita, antropologie tance, tělesná kultura, pohybový jazyk, současný tanec, lidový tanec, etnický tanec, tanec v náboženství, Gaga, Feldenkrais, metoda Ilan Lev, Eshkol-Wachman Movement Notation e of dance in building of new modern State Israel and its culture in helping creating new Israeli culture and searching for the Israeli national identity. It also includes an insight into the methods and tools developed in Israel that are unique for the contemporary dance world in Israel,

APA, Harvard, Vancouver, ISO, and other styles

More sources

Books on the topic "Taney"

1

The Taney Court. ABC-CLIO, 2008.

APA, Harvard, Vancouver, ISO, and other styles

2

Swisher, Carl Brent. Taney period, 1836-1864. Cambridge University Press, 2010.

APA, Harvard, Vancouver, ISO, and other styles

3

Swisher, Carl Brent. Taney period 1836-1864. Cambridge University Press, 2010.

APA, Harvard, Vancouver, ISO, and other styles

4

Swisher, Carl Brent. Taney period 1836-64. Cambridge University Press, 2009.

APA, Harvard, Vancouver, ISO, and other styles

5

Siegel, Martin. The Taney court, 1836-1864. Associated Faculty Press, 1987.

APA, Harvard, Vancouver, ISO, and other styles

6

Looney, Janice Soutee. Taney County, Missouri, 1910 federal census. Janice Soutee Looney, 1990.

APA, Harvard, Vancouver, ISO, and other styles

7

1777-1864, Taney Roger Brooke, ed. Roger Taney: The Dred Scott legacy. Enslow Publishers, 1995.

APA, Harvard, Vancouver, ISO, and other styles

8

Dodd, Jerry A. Soil survey of Taney County, Missouri. U.S. Dept. of Agriculture, Natural Resources Conservation Service, 1996.

APA, Harvard, Vancouver, ISO, and other styles

9

Tweed, Carol Robinson. Taney: Portrait of a parish : a social and historicalprofile of the Parish of Taney in Dublin. Select Vestry, Taney Parish, 1994.

APA, Harvard, Vancouver, ISO, and other styles

10

The Supreme Court under Marshall and Taney. Harlan Davidson, 1986.

APA, Harvard, Vancouver, ISO, and other styles

More sources

Book chapters on the topic "Taney"

1

Menz, Astrid. "Taner, Haldun." In Kindlers Literatur Lexikon (KLL). J.B. Metzler, 2020. http://dx.doi.org/10.1007/978-3-476-05728-0_18497-1.

Full text

APA, Harvard, Vancouver, ISO, and other styles

2

Ku, Hsiao-Yuh. "R. H. Tawney." In Education for Democracy in England in World War II. Routledge, 2020. http://dx.doi.org/10.4324/9781315666228-5.

Full text

APA, Harvard, Vancouver, ISO, and other styles

3

Thompson, Noel. "R.H. Tawney (1880–1962)." In The Palgrave Companion to LSE Economics. Palgrave Macmillan UK, 2019. http://dx.doi.org/10.1057/978-1-137-58274-4_10.

Full text

APA, Harvard, Vancouver, ISO, and other styles

4

Parker, Julia. "Fabians, New Liberals and Tawney." In Citizenship, Work and Welfare. Palgrave Macmillan UK, 1998. http://dx.doi.org/10.1057/9780230504721_7.

Full text

APA, Harvard, Vancouver, ISO, and other styles

5

Winter, J. M. "Tawney, Richard Henry (1880–1962)." In The New Palgrave Dictionary of Economics. Palgrave Macmillan UK, 1987. http://dx.doi.org/10.1057/978-1-349-95121-5_1500-1.

Full text

APA, Harvard, Vancouver, ISO, and other styles

6

Winter, J. M. "Tawney, Richard Henry (1880–1962)." In The New Palgrave Dictionary of Economics. Palgrave Macmillan UK, 2008. http://dx.doi.org/10.1057/978-1-349-95121-5_1500-2.

Full text

APA, Harvard, Vancouver, ISO, and other styles

7

Atsız, Bedriye, and Astrid Menz. "Taner, Haldun: Şişhane'ye Yağmur Yağıyordu." In Kindlers Literatur Lexikon (KLL). J.B. Metzler, 2020. http://dx.doi.org/10.1007/978-3-476-05728-0_18498-1.

Full text

APA, Harvard, Vancouver, ISO, and other styles

8

Winter, J. M. "Tawney, Richard Henry (1880–1962)." In The New Palgrave Dictionary of Economics. Palgrave Macmillan UK, 2018. http://dx.doi.org/10.1057/978-1-349-95189-5_1500.

Full text

APA, Harvard, Vancouver, ISO, and other styles

9

Neumann, Christoph K., and Astrid Menz. "Taner, Haldun: Sersem Kocanın Kurnaz Karısı." In Kindlers Literatur Lexikon (KLL). J.B. Metzler, 2020. http://dx.doi.org/10.1007/978-3-476-05728-0_18499-1.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

Wei, Guodong, Zhiming Cui, Yumeng Liu, et al. "TANet: Towards Fully Automatic Tooth Arrangement." In Computer Vision – ECCV 2020. Springer International Publishing, 2020. http://dx.doi.org/10.1007/978-3-030-58555-6_29.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Conference papers on the topic "Taney"

1

Nwokebuihe, Stanley C., James L. Bunch, Evgeniy V. Torgashov, and Neil L. Anderson. "PSEUDO-3D ELECTRICAL RESISTIVITY INVESTIGATION OF AN AREA IN PROXIMITY TO THE TUMBLING CREEK CAVE, TANEY COUNTY, MISSOURI." In Symposium on the Application of Geophysics to Engineering and Environmental Problems 2015. Society of Exploration Geophysicists and Environment and Engineering Geophysical Society, 2015. http://dx.doi.org/10.4133/sageep.28-074.

Full text

APA, Harvard, Vancouver, ISO, and other styles

2

Chen, Whai-En, and Tzu-Hsuan Wu. "IPv6 VoIP Deployment on Taiwan Academic Network (TANet)." In 2011 IEEE Workshops of International Conference on Advanced Information Networking and Applications (WAINA). IEEE, 2011. http://dx.doi.org/10.1109/waina.2011.121.

Full text

APA, Harvard, Vancouver, ISO, and other styles

3

Hu, Tianliang, Liangzhi Cao, Hongchun Wu, and Kun Zhuang. "Code Development for the Neutronics/Thermal-Hydraulics Coupling Transient Analysis of Molten Salt Reactors." In 2017 25th International Conference on Nuclear Engineering. American Society of Mechanical Engineers, 2017. http://dx.doi.org/10.1115/icone25-67316.

Full text

Abstract:

A code system has been developed in this paper for the dynamics simulations of MSRs. The homogenized cross section data library is generated using the continuous-energy Monte-Carlo code OpenMC which provides significant modeling flexibility compared against the traditional deterministic lattice transport codes. The few-group cross sections generated by OpenMC are provided to TANSY and TANSY_K which is based on OpenFOAM to perform the steady-state full-core coupled simulations and dynamics simulation. For verification and application of the codes sequence, the simulation of a representative molten salt reactor core MOSART has been performed. For the further study of the characteristics of MSRs, several transients like the code-slug transient, unprotected loss of flow transient and overcooling transient have been analyzed. The numerical results indicated that the TANSY and TANSY_K codes with the cross section library generated by OpenMC has the capability for the dynamics analysis of MSRs.

APA, Harvard, Vancouver, ISO, and other styles

4

Li, Jacob, Wing-Yue G. Louie, Sharaf Mohamed, Francis Despond, and Goldie Nejat. "A user-study with Tangy the Bingo facilitating robot and long-term care residents." In 2016 IEEE International Symposium on Robotics and Intelligent Sensors (IRIS). IEEE, 2016. http://dx.doi.org/10.1109/iris.2016.8066075.

Full text

APA, Harvard, Vancouver, ISO, and other styles

5

Thompson, Christopher, Sharaf Mohamed, Wing-Yue G. Louie, Jiang Chen He, Jacob Li, and Goldie Nejat. "The robot Tangy facilitating Trivia games: A team-based user-study with long-term care residents." In 2017 IEEE International Symposium on Robotics and Intelligent Sensors (IRIS). IEEE, 2017. http://dx.doi.org/10.1109/iris.2017.8250117.

Full text

APA, Harvard, Vancouver, ISO, and other styles

6

Trung, Trinh Minh Quoc, and Nguyen Duc Thuan. "EVALUATE THE PERFORMANCE AND EFFECTIVENESS OF ALGORITHMS FOR DISCOVERING FUNCTIONAL DEPENDENCIES: TANE, FUN, FD_MINE AND ONTOLOGY FUNCTIONAL DEPENDENCIES." In HỘI NGHỊ KHOA HỌC CÔNG NGHỆ QUỐC GIA LẦN THỨ XIII NGHIÊN CỨU CƠ BẢN VÀ ỨNG DỤNG CÔNG NGHỆ THÔNG TIN. Publishing House for Science and Technology, 2020. http://dx.doi.org/10.15625/vap.2020.00152.

Full text

APA, Harvard, Vancouver, ISO, and other styles

7

Laraswati, Rini, Evan Purnama Ramdan, and Umi Kulsum. "Identifikasi Penyebab Penyakit Hawar Daun Bakteri Pada Kombinasi Pola Tanam System of Rice Intensification (SRI) dan Jajar Legowo." In Seminar Nasional Semanis Tani Polije 2021. Politeknik Negeri Jember, 2021. http://dx.doi.org/10.25047/agropross.2021.234.

Full text

Abstract:

Hawar daun bakteri (HDB) merupakan salah satu penyakit penting tanaman padi dengan kehilangan hasil mencapai 15-80%. Manipulasi iklim mikro melalui teknik pola tanam menjadi salah satu upaya pengendalian penyakit ini. Oleh karena itu, pada penelitian ini akan diidentifikasi penyebab penyakit HDB pada kombinasi pola tanam system of rice intensification (SRI) dan jajar legowo. Penelitian dilakukan di Balai Besar Peramalan Organisme Pengganggu Tanaman (BBPOPT), Jatisari, Karawang mulai bulan Agustus sampai September 2020. Kombinasi pola tanaman terdiri dari (1) SRI dengan kombinasi jarwo 2:1, (2) SRI dengan kombinasi jarwo 3:1, (3) SRI dengan kombinasi jarwo 4:1, (4) SRI dengan kombinasi jarwo 5:1, (5) SRI tanpa kombinasi, dan (6) Sistem tanem tegal (konvensional). Setiap petak kemudian dibagi menjadi 5 subpetak sebagai ulangan (1 titik di setiap sudut petak dan 1 titik di tengah-tengah petak). Gejala, kejadian dan keparahan penyakit diamati pada masing-masing subpetak. Tanaman yang menunjukkan gejala kemudian diidentifikasi secara molekuler dengan teknik polymerase chain reaction (PCR) meliputi proses ekstraksi total DNA dan amplifikasi nukleotida dengan menggunakan pasangan primer forward (F:CCTCTATGAGTCGGGAGCTG) dan primer reverse (R: ACACCGTGATGCAATGAAGA). Hasil pengamatan menunjukkan gejala berupa bercak abu-abu di tepi daun kemudian berkembang ke arah pangkal daun baik di satu atau dua sisi daun. Selanjutnya daun menjadi tidak beraturan dan mengering. Kejadian penyakit HDB sebesar 81.67 – 95%, sedangkan keparahan penyakit sebesar 27.97 – 42.44% disemua pola tanaman. Identifikasi dengan teknik PCR menunjukkan bahwa penyebab penyakit HDB adalah Xanthomonas oryzae pv. oryzae yang teramplifikasi pada band ukuran 230 – 250 bp.

APA, Harvard, Vancouver, ISO, and other styles

8

Abramson, S. B., J. Yang, E. D. Gomperts, C. K. Kasper, and E. J. Fedor. "RELATIVE THERAPEUTIC EFFICACY AND MOLECULAR WEIGHT DISTRIBUTION OF DRY-HEATED AND n-HEPTANE-HEATED PREPARATIONS OF FACTOR VIII." In XIth International Congress on Thrombosis and Haemostasis. Schattauer GmbH, 1987. http://dx.doi.org/10.1055/s-0038-1643920.

Full text

Abstract:

Recent reports by Kemoff et al. (1985) and Gomperts et al. (1987; a multicentered multinational trial) showed that Factor VIII (Antihemophilic Factor, or AHF) “wet” heat-treated in n-hep-tane (Profilate Heat-TreatedR) presented a lower risk of transmitting non-A, non-B hepatitis and HIV than AHF products heated as lyophilized powders. No direct comparison has been reported, however, of the therapeutic efficacy of these products. We compared recovery and half-life in vivo for Profilate Heat-Treated11 with those of the dry-heated products HT ProfilateR and Koate HTR. Two sets of six subjects with severe hemophilia A were infused with either Profilate Heat-TreatedR or a dry-heated AHF in a crossover trial, and blood samples were drawn at times from 10 min to 24 hr. Half-life was determined from a linear regression plot of log (plasma AHF) vs. time from 1 hr to 24 hr. The table gives the mean ± one standard deviation of initial recovery and half-life for each product comparison. Unpaired t-tests showed no significant differences between products. Spearman’s rank analysis showed a high degree of correlation for both the initial recovery and half-life of each product pair.Analysis of molecular weight (MW) distributions of Factor VIII:C polypeptides in several commercial products using the method of Weinstein showed the majority of AHF in all products tested to have MW = 100,000 - 110,000. H.T. FactorateR, which exhibited a substantial amount of the AHF polypeptide whose MW approximates 210,000, is reported by the manufacturer to have a half-life = 11 ± 3.9 hr. We thus conclude that the 210,000 MW form of AHF is not required for therapeutic efficacy.

APA, Harvard, Vancouver, ISO, and other styles

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!