Log in

Relevant bibliographies by topics / Template for Sustainable Product / Journal articles

To see the other types of publications on this topic, follow the link: Template for Sustainable Product.

Journal articles on the topic 'Template for Sustainable Product'

Author: Grafiati

Published: 4 June 2021

Last updated: 12 February 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic 'Template for Sustainable Product.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Collado, Isidro, José Botubol-Ares, María Durán-Peña, James Hanson, and Rosario Hernández-Galán. "Cp2Ti(III)Cl and Analogues as Sustainable Templates in Organic Synthesis." Synthesis 50, no. 11 (May 3, 2018): 2163–80. http://dx.doi.org/10.1055/s-0036-1591986.

Full text

Abstract:

This short review aims to provide an overview of the use of Cp2Ti(III)Cl and other related titanocene(III) species as coordinating reagents in template reactions in the selective preparation of C–C and C–O bonds. These complexes are able to assemble two components to produce powerful reactions possessing high regio-, chemo-, diastereo-, and enantioselectivity. The titanocene templates are divided into five structural types. The chemical transformations by these valuable templates, the substrate scope and mechanistic insights will also be described.1 Introduction2 Precedents for the Coordination of Ti(III) Species to Heteroatoms2.1 Coordination of Compounds with Hydrogen–Heteroatom Bonds to Ti(III) Species2.2 Coordination of Halogens to Ti(III) Species3 Types of Titanocene Templates4 Template Type I Mediated Organic Reactions4.1 Methylenecyclopropanation of Allylic Alcohols4.2 Base-Free O-Acylation of Alcohols and Phenol4.3 Epoxidation of Allylic Alcohols5 Template Type II Mediated Organic Reactions5.1 Ketone–Nitrile Cross-Coupling Reactions5.2 Imine–Nitrile Cross-Coupling Reactions5.3 Reductive Alkylation of Enones with Activated Alkenes6 Template Type III Mediated Organic Reactions6.1 Pinacol Coupling of Ketones7 Template Type IV Mediated Organic Reactions7.1 Michael-Type Addition of Aldehydes to Conjugated Enals7.2 Allylation, Crotylation, and Prenylation7.3 Barbier-Type Progargylation and Allenylation8 Template Type V Mediated Organic Reactions8.1 Protection of Alcohols as 2-O-THF and 2-O-THP Ethers8.2 Pinacol Coupling of Aldehydes8.3 McMurry Couplings9 Conclusions and Perspectives

APA, Harvard, Vancouver, ISO, and other styles

2

Ny, Henrik, Sophie Hallstedt, Karl-Henrik Robèrt, and Göran Broman. "Introducing Templates for Sustainable Product Development." Journal of Industrial Ecology 12, no. 4 (August 2008): 600–623. http://dx.doi.org/10.1111/j.1530-9290.2008.00061.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

3

Schraml, Rudolf, Karl Entacher, Alexander Petutschnigg, Timothy Young, and Andreas Uhl. "Matching Score Models for Hyperspectral Range Analysis to Improve Wood Log Traceability by Fingerprint Methods." Mathematics 8, no. 7 (July 2, 2020): 1071. http://dx.doi.org/10.3390/math8071071.

Full text

Abstract:

Traceability of natural resources, from the cradle to the final product is a crucial issue to secure sustainable material usage as well as to optimize and control processes over the whole supply chain. In the forest products industries the material can be tracked by different technologies, but for the first step of material flow, from the forest to the industry, no systematic and complete technology has been developed. On the way to close this data gap the fingerprint technology for wooden logs looks promising. It uses inherent properties of a wood stem for identification. In this paper hyperspectral cameras are applied to gain images of Norway spruce (Picea abies [L.] Karst.) log end faces in different spectral ranges. The images are converted to a biometric template of feature vectors and a matching algorithm is used to evaluate if the biometric templates are similar or not. Based on this, matching scores specific spectral ranges which contain information to distinguish between different log end faces are identified. The method developed in this paper is a necessary and successful step to define scanning system parameters for fingerprint recognition systems for wood log traceability from the forest.

APA, Harvard, Vancouver, ISO, and other styles

4

Zhang, Lei, Ka Yip Fung, Christianto Wibowo, and Rafiqul Gani. "Advances in chemical product design." Reviews in Chemical Engineering 34, no. 3 (April 25, 2018): 319–40. http://dx.doi.org/10.1515/revce-2016-0067.

Full text

Abstract:

Abstract The nature of chemical product design problems is diverse and multidisciplinary. It involves many design issues such as project management, market study, product design, process design, and economic analysis for better organizing the product design project and achieving better products. This article provides an overview of chemical product design with a multidisciplinary hierarchical framework including all the design issues and tasks. Each of the design issues and tasks are introduced and discussed, methods and tools are summarized and compared, challenges and perspectives are presented to help the chemical product design researchers on finding more novel, innovative and sustainable products, by the combined effort from academia and industry to develop a systematic generic framework, and tools including product simulator, process simulator, database manager, modeling tool, and templates for design problems.

APA, Harvard, Vancouver, ISO, and other styles

5

T. Al-Sarayreh, Khalid, Kenza Meridji, Mamdouh Alenezi, Mohammed Zarour, and Mohammed D. Al-Majali. "A sustainable procedural method of software design process improvements." Indonesian Journal of Electrical Engineering and Computer Science 21, no. 1 (January 1, 2021): 440. http://dx.doi.org/10.11591/ijeecs.v21.i1.pp440-449.

Full text

Abstract:

In practice, the software process is an intermediate phase for enhancement and improvements the design for different types of software products and help developers to converts the specified requirements into prototypes that implement the design into reality. The objective of this paper is to provide software developers, designers and software engineers who work in small companies with a standards-based process improvement using a procedural method technique including detailed steps for designing the small software systems into their companies. The method used in this paper includes 1) analysis four different types of commonly design processes used by industry such as CMMI, conventional or software process in ISO 19759, generic and engineering design processes. 2) mapping between those four design processes. 3) collect the dispersed design concepts proposed by those four processes. 4) proposed a sustainable procedural method of software design process improvements 5) Illustration of the applicability of the proposed approach using A template-based implementation. The primary result of this study is<strong> </strong>a guideline procedure with detailed steps for<strong> </strong>software design process improvements to help and guide developers in small companies to analyze and design a small software scales with limited cost and duration. In conclusion<strong>, </strong>this paper proposed a method to improve the design process for different kinds of the software systems<strong> </strong>using<strong> </strong>a template-based implementation to reduce the cost, effort and time needed in the implementation phase<strong> </strong>in small companies. The scientific implication<strong> </strong>behind a template-based implementation helps the system and software engineering to use this template easily in their small companies; because most of the time those engineering developers are responsible for analyzing, designing, implementing and testing their software systems during the whole software life cycle.

APA, Harvard, Vancouver, ISO, and other styles

6

Brennan, Maurice Edward, and Eugenia Valsami-Jones. "Safe by Design for Nanomaterials—Late Lessons from Early Warnings for Sustainable Innovation." NanoEthics 15, no. 2 (August 2021): 99–103. http://dx.doi.org/10.1007/s11569-021-00393-9.

Full text

Abstract:

AbstractThe Safe by Design conceptual initiative being developed for nanomaterials offers a template for a new sustainable innovation approach for advanced materials with four important sustainability characteristics. Firstly, it requires potential toxicity risks to be evaluated earlier in the innovation cycle simultaneously with its chemical functionality and possible commercial applications. Secondly, it offers future options for reducing animal laboratory testing by early assessment using in silico predictive toxicological approaches, minimizing the number that reaches in vitro and in vivo trials. Thirdly, it promotes a culture of shared responsibility for ethical and sustainable outcomes in the innovation process by promoting early dialogue between groups with vested interests. Finally, it offers the prospect of a more democratized innovation process by including civil society actors in decisions on product safety, commercial applications, and social utility. Collectively, these four characteristics offer the prospect for a new social contract between science, technology, and society for the societal alignment and sustainable innovation of advanced materials.

APA, Harvard, Vancouver, ISO, and other styles

7

Liou, Tzong-Horng, and Pie-Ying Wang. "A Sustainable Route to Synthesize Graphene Oxide/Ordered Mesoporous Carbon as Effect Nanocomposite Adsorbent." Journal of Nanoscience and Nanotechnology 20, no. 5 (May 1, 2020): 2867–77. http://dx.doi.org/10.1166/jnn.2020.17450.

Full text

Abstract:

Rice husk is an agricultural waste that provides an alternative renewable source of bioenergy. Burning rice husk can produce rice husk ash. The rice husk ash is a potential resource of low-cost precursor for synthesizing high value-added materials. This paper reports the synthesis of SBA-15 mesoporous silica from recycled rice husk ash waste. Next, graphene oxide/ordered mesoporous carbon (GO/CMK-3) nanocomposite was synthesized using the SBA-15 template. The composite was investigated by X-ray diffractometer, field-emission scanning electron microscope, transmission electron microscopy, Fourier transform infrared spectrometer, Raman spectrometer and surface area analyzer. Experimental results confirmed that GO/CMK-3 composite possessed high surface area (936 m2/g), large pore volume (1.077 cm3/g), and uniform pore size (4.35 nm). The mesopore structure was not destroyed by the introduction of GO. Methylene blue was employed as an adsorbate to evaluate the adsorption capacity of GO/CMK-3 composite. The GO/CMK-3 revealed much higher adsorption capacity levels than did pure CMK-3 and SBA-15. The adsorption capacity decreased with increasing solution temperature, and increasing initial concentration of dye. The thermodynamic observation indicated that the total adsorption process was spontaneous and exothermic. The conversion of rice husk ash waste into GO/CMK-3 composites can be regarded as an economically beneficial by-product for reducing environmental pollution.

APA, Harvard, Vancouver, ISO, and other styles

8

Needham, S. A., G. X. Wang, H. K. Liu, and L. Yang. "Nickel Oxide Nanotubes: Synthesis and Electrochemical Performance for Use in Lithium Ion Batteries." Journal of Nanoscience and Nanotechnology 6, no. 1 (January 1, 2006): 77–81. http://dx.doi.org/10.1166/jnn.2006.17907.

Full text

Abstract:

Uniform and aligned Nickel Oxide (NiO) nanotube bundles have been synthesized by a template process. Individual nanotubes are 60 μm long with a 200 nm outer diameter and wall thickness of 20–30 nm. The synthesis involved forming Ni(OH)2 nanotubes that were subsequently heated to 350°C in order to fully convert the product to NiO nanotubes. NiO nanotube powder was used in lithium-ion cells for assessment of lithium storage ability and electrochemical performance. Discharge capacity of the NiO nanotube electrode was in excess of 30% higher than that of the standard NiO nanocrystalline powder electrode after 20cycles. Impedance data suggests the NiO nanotube electrode provides more controlled and sustainable Li diffusion when compared to the NiO reference powder electrode system.

APA, Harvard, Vancouver, ISO, and other styles

9

Zhang, Fangbo, Jie Du, Jing Liu, Jinghan Li, Yaxian Lu, Guojing Wang, Shumei Li, Cuimiao Zhang, and Guang Jia. "Synthesis, properties, and bioapplications of multifunctional gadolinium orthophosphate hollow spheres." Modern Physics Letters B 33, no. 27 (September 30, 2019): 1950335. http://dx.doi.org/10.1142/s0217984919503354.

Full text

Abstract:

In this paper, gadolinium orthophosphate (GdPO4) hollow spheres with good luminescent properties, better drug loading and sustainable release have been synthesized by a template-oriented route. The precursor with core–shell structure was facilely prepared by a homogeneous precipitation and followed solvothermal method with 3-aminophenol-formaldehyde (APF) resin spheres as template. Subsequently, the APF template was eliminated and the crystalline GdPO4 hollow spheres were obtained after an annealing process. The structure, morphology, and formation process of the as-obtained GdPO4 hollow spheres have been investigated in detail. It is worth noting that lanthanide activator ions doped GdPO4 can perform optical and MRI dual-mode imaging functions. Moreover, the as-obtained GdPO4 hollow spheres exhibit good drug loading and sustained drug release behaviors. The unique hollow structure, dual-mode optical and MRI imaging capabilities, and good drug loading/release patterns enable the as-synthesized products to have enormous potential in bioimaging, drug delivery, and disease diagnosis.

APA, Harvard, Vancouver, ISO, and other styles

10

Barin, Gabriela Borin, Thalita Santos Bispo, Iara de Fátima Giminenez, and Ledjane Silva Barreto. "Carbon Nanostructures Synthesize from Coconut Coir Dust Mediated by Layered Clays through Hydrothermal Process." Materials Science Forum 727-728 (August 2012): 1355–59. http://dx.doi.org/10.4028/www.scientific.net/msf.727-728.1355.

Full text

Abstract:

Brazil has a large potential for energy generation and development of new materials from renewable resources through eco-friendly routes, which presents an alternative for construction of an eco-technological platform, where the entire lifecycle of the material or industrial product be sustainable. The proposal of the present work was synthesize carbon nanostructures from coconut coir dust and via template synthesis mediated by layered clays through hydrothermal process. The obtained materials were characterized by Raman Spectroscopy, Fourier Transform Infrared Spectroscopy and Scanning Electron Microscope (SEM). Carbon phase formation was indicated by infrared results with bands at 1444 cm-1and 1512 cm-1assigned to C=C of aromatic groups. Raman spectroscopy results showed presence of carbonaceous species by the appearance of D and G bands assigned to disordered and graphitic crystallites, respectively. SEM results showed overlapping sheets and plates formation. High Resolution Transmission Electron Microscopy measures are in progress.

APA, Harvard, Vancouver, ISO, and other styles

11

Acharya, Shakuntala, Apoorv Naresh Bhatt, Amaresh Chakrabarti, and Yukari Nagai. "Fostering Creativity in Design - An Empirical Study on Improvement of Requirement-satisfaction with Introduction of InDeaTe Tool." Proceedings of the Design Society: International Conference on Engineering Design 1, no. 1 (July 2019): 3631–40. http://dx.doi.org/10.1017/dsi.2019.370.

Full text

Abstract:

AbstractIn today's highly competitive market, product success is determined by two critical factors - innovation and sustainability. While innovation looks to rampantly satisfy the consumers' ever growing requirements with creative solutions, sustainability attempts to rationalise the precarious demands of desired requirements on economy, society and environment.InDeaTe - Innovation Design database and Template, a web-based, design process guidance tool, supports design of sustainable systems by incorporating sustainability requirements into the design process. This paper investigates the potential of the tool to improve the usefulness of a design, one of the indicators of the creativity of the solutions, apart from its novelty. Comparative studies are conducted to assess the improvement of ‘requirement-satisfaction’,a proxy measure for usefulness. Upon introduction of the tool into the design process, significant improvements are reported, thereby reflecting the ability of InDeaTe to increase the usefulness of solutions and foster creativity in design.

APA, Harvard, Vancouver, ISO, and other styles

12

Toumsri, P., W. Auppahad, S. Saknaphawuth, B. Pongtawornsakun, S. Kaowphong, D. Dechtrirat, J. Panpranot, and L. Chuenchom. "Facile preparation protocol of magnetic mesoporous carbon acid catalysts via soft-template self-assembly method and their applications in conversion of xylose into furfural." Philosophical Transactions of the Royal Society A: Mathematical, Physical and Engineering Sciences 379, no. 2209 (September 13, 2021): 20200349. http://dx.doi.org/10.1098/rsta.2020.0349.

Full text

Abstract:

Furfural is a valuable dehydration product of xylose. It has a broad spectrum of industrial applications. Various catalysts containing SO 3 H have been reported for the conversion of xylose into furfural. Nevertheless, the multi-step preparation is tedious, and the catalysts are usually fine powders that are difficult to separate from the suspension. Novel magnetic mesoporous carbonaceous materials (Fe/MC) were successfully prepared via facile self-assembly in a single step. A facile subsequent hydrothermal sulfonation of Fe/MC with concentrated H 2 SO 4 at 180°C gave mesoporous carbon bearing SO 3 H groups (SO 3 H@Fe/MC) without loss of the magnetic properties. Various techniques were employed to characterize the SO 3 H@Fe/MC as a candidate catalyst. It showed strong magnetism due to its Fe particles and possessed a 243 m 2 g −1 BET-specific surface area and a 90% mesopore volume. The sample contained 0.21 mmol g −1 of SO 3 H and gave a high conversion and an acceptable furfural yield and selectivity (100%, 45% and 45%, respectively) when used at 170°C for 1 h with γ-valerolactone as solvent. The catalyst was easily separated after the catalytic tests by using a magnet, confirming sufficient magneticstability. This article is part of the theme issue ‘Bio-derived and bioinspired sustainable advanced materials for emerging technologies (part 2)’.

APA, Harvard, Vancouver, ISO, and other styles

13

Vinogradova, Ekaterina, Olena Nikoliuk, and Anna Galimova. "Creation of the corporate information system based on knowledge economy." E3S Web of Conferences 208 (2020): 03011. http://dx.doi.org/10.1051/e3sconf/202020803011.

Full text

Abstract:

Nowadays it is impossible to remain competitive by operating on the same template for a long period of time. In order to gain an advantage in the market, companies should adapt to changes in the world as soon as possible and find new competitive mechanisms. Innovation is also needed in order to be able to offer consumers products that will differ from available in the market in rising competitive conditions. The task of the authors in this study is to find and investigate an effective way to plan and conduct production and economic activities through changing value guidelines: a transition from an orientation to material and technical factors to information resources, a part of the knowledge economy. The authors defined the main stages of the formation of a corporate information system based on a sustainable economy.

APA, Harvard, Vancouver, ISO, and other styles

14

Acharya, Shakuntala, Kiran Ghadge, B. S. C. Ranjan, Suman Devadula, and Amaresh Chakrabarti. "Evaluating the effectiveness of InDeaTe tool in supporting design for sustainability." Artificial Intelligence for Engineering Design, Analysis and Manufacturing 34, no. 1 (February 2020): 45–54. http://dx.doi.org/10.1017/s0890060419000337.

Full text

Abstract:

AbstractIn today's aggressive global market, innovation is key for success and design solutions require not only to achieve competitive edge, but also to address the growing environmental, social, and economic needs of the community at large. Consideration of these three pillars of sustainability makes a design inclusive, and life cycle thinking is found to be a promising approach across the literature. However, most supports for design address certain facets or aid singular tasks, and the use of design methods and tools, which have the potential to significantly improve the design process, is low due to inappropriate use and selection of these methods. InDeaTe (Innovation Design database and Template) is a holistic, knowledge-driven, computer-based tool for design of sustainable systems, such as products, manufacturing systems andservice systems and has been developed to address and integrate the aspects of sustainability on a singular design platform. It comprises of the generic design process Template that imbibes life cycle thinking into the process by incorporating consideration of every life cycle phase in each design stage, where design activities are performed iteratively. It further supports the design process by aiding the use and selection of appropriate design methods and tools in concurrence with the primary motivation of improving sustainability of the system with the aid of the InDeaTe Design Database. This paper discusses the ontological underpinnings behind the conceptualization of the InDeaTe methodology and the development of the supporting tool. The paper further reports empirical findings from six different case studies conducted for evaluating the effectiveness of InDeaTe tool in supporting design for sustainability (DfS). The results show that InDeaTe tool has potential in supporting DfS.

APA, Harvard, Vancouver, ISO, and other styles

15

Chen, Canxi, Abhishek Chaudhary, and Alexander Mathys. "Dietary Change Scenarios and Implications for Environmental, Nutrition, Human Health and Economic Dimensions of Food Sustainability." Nutrients 11, no. 4 (April 16, 2019): 856. http://dx.doi.org/10.3390/nu11040856.

Full text

Abstract:

Demand side interventions, such as dietary change, can significantly contribute towards the achievement of 2030 national sustainable development goals. However, most previous studies analysing the consequences of dietary change focus on a single dimension of sustainability (e.g., environment) using a limited number of indicators and dietary scenarios. A multi-dimension and multi-indicator analysis can identify the potential trade-offs. Here, starting from the current food consumption data (year 2011), we first designed nine alternative dietary scenarios (healthy Swiss diet, healthy global diet, vegetarian, vegan, pescatarian, flexitarian, protein-oriented and meat-oriented diets and a food greenhouse gas tax diet). Next we calculated three nutritional quality (nutrient balance score, disqualifying nutrient score, percent population with adequate nutrition), five environmental (greenhouse gas, water, land, nitrogen and phosphorus use), one economic (daily food expenditure) and one human health indicator (DALYs) for current and alternative diets. We found that transition towards a healthy diet following the guidelines of Swiss society of nutrition is the most sustainable option and is projected to result in 36% lesser environmental footprint, 33% lesser expenditure and 2.67% lower adverse health outcome (DALYs) compared with the current diet. On the other extreme, transition towards a meat or protein oriented diet can lead to large increases in diet related adverse health outcomes, environmental footprint, daily food expenditure and a reduction in intakes of essential nutrients (for Vitamin C, Fibre, Potassium and Calcium). We found that shifting to the vegetarian and vegan diet scenarios might lead to a reduction in intakes of certain micronutrients currently supplied primarily by animal-sourced foods (Vitamin B12, Choline and Calcium). Results show that achieving a sustainable diet would entail a high reduction in the intake of meat and vegetable oils and a moderate reduction in cereals, roots and fish products and at the same time increased intake of legumes, nuts, seeds, fruits and vegetables. We identify several current data and research gaps that need to be filled in order to get more accurate results. Overall, our analysis underscores the need to consider multiple indicators while assessing the dietary sustainability and provides a template to conduct such studies in other countries and settings. Future efforts should focus on assessing the potential of different interventions and policies that can help transition the population from current to sustainable dietary patterns.

APA, Harvard, Vancouver, ISO, and other styles

16

Hamed, K., W. Menzel, M. E. Mohamed, G. Dafallah, A. M. A. Gadelseed, and S. Winter. "First Report of Shallot virus X in Onion in Sudan." Plant Disease 96, no. 7 (July 2012): 1075. http://dx.doi.org/10.1094/pdis-03-12-0253-pdn.

Full text

Abstract:

Onion (Alium cepa L.) is among the most important vegetable field crops in Sudan. During a disease survey in crops (cvs. Kamleen Yellow and Abu-freua) conducted in 2010, samples showing mild mottling symptoms were collected from Shambat Research Station Farm, Khartoum North, Sudan. A CF-11 cellulose chromatography dsRNA preparation (4) of a mixed onion leaf sample of five plants (20 g) resulted, apart from smaller dsRNAs up to 3 kbp, in a high molecular weight dsRNA of approximately 9 kbp. This dsRNA was used as a template for a random reverse transcriptase (RT)-PCR followed by cloning (4) and sequencing of two randomly selected clones by the ABI BigDye Terminator v3.1 Cycle Sequencing Kit. Comparison with sequences available at GenBank revealed high identities to Shallot virus X (ShVX). ShVX is the type member of the genus Allexivirus (Alphaflexiviridae). One sequence obtained showed 84% nt and 98% aa sequence identity (genome position 414 to 1,285 of Accession No. M97264) to the replicase, whereas the other sequence partially covered the ORF4 and coat protein (CP) coding region (7,127 to 7,998). This sequence showed 80% nt (entire sequence) and 80/89% aa sequence identity to the ORF4 encoded protein/coat protein of a Russian ShVX isolate, respectively. ShVX was first reported in shallot in Russia (2) and subsequently in the Netherlands, Germany, India (3), and New Zealand (1). To confirm the presence of ShVX in Sudan, 32 symptomatic leaf samples were collected in 2011 from different onion fields in Khartoum North, with a similar disease incidence compared to 2010. Thirty-one of these onion samples reacted positively in a double antibody sandwich-ELISA with a ShVX-specific antiserum (DSMZ AS-1042). Total RNA was extracted from five ShVX-ELISA positive onion samples using the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer's protocol. Two primer pairs were also designed on the basis of sequences obtained in the random RT-PCR approach, targeting a 659-bp fragment of the coat protein region (ShVX-CPs 5′GTTGAATGTGGCGAGCGCAA3′ and ShVX-CPas 5′AGTGCAGAAGCCTTCCACA3′) or a 686-bp fragment of the replicase (ShVX-Rs 5′ATGTACTTCGGTACGGCATCA3′ and ShVX-R-as 5′TAATCGAATGAGGTCGGCCA3′). Fragments of the expected sizes were obtained for all positive samples. One RT-PCR product of each primer pair was directly sequenced, showing high sequence identities to those previously obtained (>98%). The random RT-PCR sequences obtained in this study were submitted to GenBank (JQ751056 and JQ751057). On the basis of the nucleotide sequences obtained with the dsRNA template, ShVX specific RT-PCR, and ELISA, the presence of ShVX in Sudan was confirmed in two consecutive years. To our knowledge, this is the first report of ShVX in Sudan and Africa, indicating this virus is more widespread than previously reported. The presence of ShVX also suggests the presence of its only known vector, the mite Aceria tulipae. The virus may have been introduced to Sudan by infected onion sets. Even if the impact of ShVX on onion production has not been determined, its identification and the availability of a diagnostic antiserum may be helpful to select virus-free propagation material in order to achieve sustainable onion production in Sudan. References: (1) Z. Egusquiza et al. New Disease Reports 18:29, 2008. (2) K. V. Kanyuka et al. J. Gen. Virol. 73:2553, 1992. (3) S. Majumder et al. New Disease Reports 15:52, 2007. (4) W. Menzel et al. Arch. Virol. 154:1343, 2009.

APA, Harvard, Vancouver, ISO, and other styles

17

Monastyrnaya, Elena, Gwenola Yannou Le Bris, Bernard Yannou, and Gaëlle Petit. "A template for sustainable food value chains." International Food and Agribusiness Management Review 20, no. 4 (July 24, 2017): 461–76. http://dx.doi.org/10.22434/ifamr2015.0061.

Full text

Abstract:

This paper proposes a template to assist food value chain actors in their collaborative efforts to develop common sustainable strategies and business models. Inspired by the simplicity of the Business Model Canvas, the template reintroduces sustainable practices as a support for management solutions for sustainable food value chains. The template requires cooperation between actors and stakeholders and comprises three steps: (1) identification of needs for sustainability; (2) development of value chain practices aimed to deliver sustainable value, and assignment of responsibilities to actors for these practices; and (3) formulation of a sustainable value proposition. The template also allows a simple graphical representation of sustainability in value chains, which helps improve communication between actors, and allows stakeholders to be kept informed. The template is applied to a sustainable pork value chain to illustrate how it captures various aspects of sustainability in the pork industry.

APA, Harvard, Vancouver, ISO, and other styles

18

White, Robin J., Anna Fischer, Caren Goebel, and Arne Thomas. "A Sustainable Template for Mesoporous Zeolite Synthesis." Journal of the American Chemical Society 136, no. 7 (February 7, 2014): 2715–18. http://dx.doi.org/10.1021/ja411586h.

Full text

APA, Harvard, Vancouver, ISO, and other styles

19

Roy, Robin. "Sustainable product-service systems." Futures 32, no. 3-4 (April 2000): 289–99. http://dx.doi.org/10.1016/s0016-3287(99)00098-1.

Full text

APA, Harvard, Vancouver, ISO, and other styles

20

van Weenen, J. C. "Towards sustainable product development." Journal of Cleaner Production 3, no. 1-2 (January 1995): 95–100. http://dx.doi.org/10.1016/0959-6526(95)00062-j.

Full text

APA, Harvard, Vancouver, ISO, and other styles

21

Hanssen, O. J. "Sustainable product systems—experiences based on case projects in sustainable product development." Journal of Cleaner Production 7, no. 1 (February 1999): 27–41. http://dx.doi.org/10.1016/s0959-6526(98)00032-8.

Full text

APA, Harvard, Vancouver, ISO, and other styles

22

AOYAMA, Kazuhiro, and Tsuyoshi KOGA. "3318 Design Knowledge Template for Product Design." Proceedings of the JSME annual meeting 2008.4 (2008): 213–14. http://dx.doi.org/10.1299/jsmemecjo.2008.4.0_213.

Full text

APA, Harvard, Vancouver, ISO, and other styles

23

Howarth, George, and Mark Hadfield. "A sustainable product design model." Materials & Design 27, no. 10 (January 2006): 1128–33. http://dx.doi.org/10.1016/j.matdes.2005.03.016.

Full text

APA, Harvard, Vancouver, ISO, and other styles

24

Sampaio, Álvaro M., Ana M. Sousa, Paulo Simões, and António J. Pontes. "Methodology for sustainable product design." Polymer Engineering & Science 58, no. 4 (November 15, 2017): 535–44. http://dx.doi.org/10.1002/pen.24765.

Full text

APA, Harvard, Vancouver, ISO, and other styles

25

Wang, Yan, Hong Tian, Emine Sarigöllü, and Wei Xu. "Nostalgia prompts sustainable product disposal." Journal of Consumer Behaviour 19, no. 6 (June 3, 2020): 570–80. http://dx.doi.org/10.1002/cb.1832.

Full text

APA, Harvard, Vancouver, ISO, and other styles

26

Scholl, Gerd. "SUSTAINABLE PRODUCT POLICY IN EUROPE." European Environment 6, no. 6 (November 1996): 183–93. http://dx.doi.org/10.1002/(sici)1099-0976(199611)6:6<183::aid-eet91>3.0.co;2-f.

Full text

APA, Harvard, Vancouver, ISO, and other styles

27

Kurzak-Mabrouk, Anna. "Innovative product sustainable – case analysis." Nowoczesne Systemy Zarządzania 13, no. 3 (September 24, 2018): 209–18. http://dx.doi.org/10.37055/nsz/129503.

Full text

Abstract:

W artykule autorka rozważa korzyści jakie środowisku naturalnemu przynosi generowanie innowacyjnych, zrównoważonych produktów. W tym celu przeprowadzona została analiza właściwości produktu wytworzonego zgodnie z zasadami zrównoważonego rozwoju oraz jego wpływ na środowisko. Bazą opracowania stała się kwerenda literatury zarówno zagranicznej jak i polskiej jak również badania dotyczące negatywnego wpływu prowadzonej działalności biznesowej na planetę Ziemię oraz analiza przypadku.

APA, Harvard, Vancouver, ISO, and other styles

28

Haid, Marco, and Julia N. Albrecht. "Sustainable Tourism Product Development: An Application of Product Design Concepts." Sustainability 13, no. 14 (July 16, 2021): 7957. http://dx.doi.org/10.3390/su13147957.

Full text

Abstract:

This study examines sustainable tourism products in tourism destinations. Based on concepts of sustainable product design, our study proposes a framework for sustainable tourism products by adapting an existing Design for Sustainability Framework to consider and analyze the characteristics and themes of sustainable (tourism) products as well as their impact and scope. Using a pragmatic qualitative approach, 15 semi-structured interviews with destination managers from the German-speaking Alpine region formed the empirical basis of the study. The results emphasize key themes and multiple characteristics associated with sustainable tourism products in tourist destinations, addressing all sustainability components and design innovation levels. This study is the first to apply existing sustainable product design concepts to destination contexts and discuss their applicability for sustainable tourism products. For practitioners, this study provides support for the development of sustainable tourism products and contributes to a better understanding of the effects and levels of these products as well as sustainability marketing.

APA, Harvard, Vancouver, ISO, and other styles

29

Shalij, P. R., G. V. Prabhushankar, and P. L. Biju. "Sustainable path modelling: a tool for sustainable product development." International Journal of Industrial and Systems Engineering 25, no. 3 (2017): 297. http://dx.doi.org/10.1504/ijise.2017.10002579.

Full text

APA, Harvard, Vancouver, ISO, and other styles

30

Onuma, Ayumi. "Sustainable consumption, sustainable development, and green net national product." Environmental Economics and Policy Studies 2, no. 3 (September 1999): 187–97. http://dx.doi.org/10.1007/bf03353910.

Full text

APA, Harvard, Vancouver, ISO, and other styles

31

Belshaw, Peter J. "Quantifying Intermediates in Template-Directed Natural Product Biosynthesis." Chemistry & Biology 11, no. 3 (March 2004): 288–90. http://dx.doi.org/10.1016/j.chembiol.2004.03.008.

Full text

APA, Harvard, Vancouver, ISO, and other styles

32

Ahn, Sang-gyeun. "A Personalization for Increasing Product Lifespan in Sustainable Product." International Journal of Environmental, Cultural, Economic, and Social Sustainability: Annual Review 1, no. 1 (2006): 72–75. http://dx.doi.org/10.18848/1832-2077/cgp/v01i01/54239.

Full text

APA, Harvard, Vancouver, ISO, and other styles

33

Heintz, Juliette, Jean-Pierre Belaud, Nishant Pandya, Moises Teles Dos Santos, and Vincent Gerbaud. "Computer aided product design tool for sustainable product development." Computers & Chemical Engineering 71 (December 2014): 362–76. http://dx.doi.org/10.1016/j.compchemeng.2014.09.009.

Full text

APA, Harvard, Vancouver, ISO, and other styles

34

Hamed, K., W. Menzel, M. E. Mohamed, K. A. Bakheet, and S. Winter. "First Report of Garlic common latent virus Infecting Garlic in Sudan." Plant Disease 97, no. 4 (April 2013): 562. http://dx.doi.org/10.1094/pdis-11-12-1018-pdn.

Full text

Abstract:

Garlic (Allium sativum L.) is one of the most important vegetable field crops in Sudan, cultivated on an area of more than 6,000 ha with a total yield of 27,000 t in 2010 (faostat.fao.org). As part of a project which started in 2010 to improve the garlic production in Sudan, samples from local varieties showing severe mosaic and/or mottling were collected in winter 2011 from the main production areas in River Nile State, Northern State, and Darfur State. The plant material used for garlic production came from Sudan and was not imported. Because no reliable data were available on which viruses occur in garlic in Sudan, specific tests were initially omitted. In order to get an overview of the viruses present, dsRNA was prepared of a mixed leaf sample (12 leaves of different samples). This resulted in a high molecular weight dsRNA of approximately 9 kbp that served as template for a random RT-PCR followed by cloning and sequencing (3). Three identical clones originating from one PCR product covering the C-terminal part of the coat protein to the N-terminal part of the nucleic acid binding protein showed the highest sequence similarity to Garlic common latent virus (GarCLV). The nucleotide sequence identities of the 554-bp insert range from 85% to an isolate from India (Accession No. FJ154841) up to 97% to a GarCLV isolate from The Netherlands (AB004804), identifying the virus as a Sudanese isolate of GarCLV, one of the most common garlic infecting viruses. GarCLV belongs to the genus Carlavirus (1) and has previously been reported from Asia, Europe, and South America ( http://sdb.im.ac.cn/vide/descr352.htm ). In order to confirm these results, a double antibody sandwich (DAS)-ELISA was performed with six individual garlic samples in which five samples showed a clear reaction with a GarCLV specific antiserum (AS-0230, DSMZ, Germany). The occurrence of GarCLV could be further confirmed for the ELISA positive samples by a specific RT-PCR using the primers published by Majumder and Baranwal (2). Fragments of the expected size were obtained for all five samples. In addition, one of the positive samples was examined by electron microscopy (Dr. K. Richert-Pöggeler, JKI Braunschweig); filamentous flexous particles typical for carlaviruses could be observed. The random RT-PCR sequence obtained in this study has been submitted to GenBank (KC013030). To our knowledge, this is the first report of GarCLV in garlic in Sudan and Africa. The impact of GarCLV on garlic production in Sudan needs to be evaluated, but the awareness of the occurrence of the virus and the availability of a reliable diagnostic tool will help to select virus-free propagation material. This will form the basis for a sustainable garlic production. References: (1) A. M. Q. King et al. Virus Taxonomy 924, 2012. (2) S. Majumder and V. K. Baranwal. Plant Dis. 93:106, 2009. (3) W. Menzel et al. Arch. Virol. 154:1343, 2009.

APA, Harvard, Vancouver, ISO, and other styles

35

Chen, Gang, Hong Chao Zhang, and Chang Yong Chu. "Decision Analysis in Sustainable Product Development." Advanced Materials Research 468-471 (February 2012): 370–73. http://dx.doi.org/10.4028/www.scientific.net/amr.468-471.370.

Full text

Abstract:

As one of the main contributors to global environmental degradation, mechatronic industry must take the responsibility of improving the environmental performance of its products. Compared with further development of green technology, setting environmental protection willingly and seriously as one of the engineering optimization objectives are also important. This paper analyzes the decision making processes from the viewpoint of product life cycle and serves the purpose of reaching a balance between economic profit and environmental performance for each life cycle participator.

APA, Harvard, Vancouver, ISO, and other styles

36

Wang, Cheng Jun, and Mei Rong Wang. "Sustainable Development of Agricultural Product Logistics." Applied Mechanics and Materials 522-524 (February 2014): 1817–21. http://dx.doi.org/10.4028/www.scientific.net/amm.522-524.1817.

Full text

Abstract:

As a large agricultural country, agricultural economic development determines the development of the national economy, and the logistics of agricultural products but restricts agricultural economic development, China's economic development is incompatible with the rural economy, largely agricultural logistics relationship enough disorders due. In this paper, according to the anti-agricultural own characteristics, the condition of the rural economy, the situation of logistics development, management system and development like logistics, be unbalanced urban and rural development and other factors put forward five agricultural logistics development model of sustainable development, and the corresponding development mechanism.

APA, Harvard, Vancouver, ISO, and other styles

37

Schoormans, Jan. "Routledge Handbook of Sustainable Product Design." Design Journal 21, no. 4 (June 19, 2018): 553–57. http://dx.doi.org/10.1080/14606925.2018.1467661.

Full text

APA, Harvard, Vancouver, ISO, and other styles

38

Cooper, Tim. "Product Development Implications of Sustainable Consumption." Design Journal 3, no. 2 (July 2000): 46–57. http://dx.doi.org/10.2752/146069200789390150.

Full text

APA, Harvard, Vancouver, ISO, and other styles

39

Marques, P. Carmona, M. Januário Charmier, and J. Oliveira Santos. "A Survey on Sustainable Product Development." Procedia Manufacturing 39 (2019): 1307–16. http://dx.doi.org/10.1016/j.promfg.2020.01.328.

Full text

APA, Harvard, Vancouver, ISO, and other styles

40

Hoffmann, Esther. "Consumer integration in sustainable product development." Business Strategy and the Environment 16, no. 5 (2007): 322–38. http://dx.doi.org/10.1002/bse.577.

Full text

APA, Harvard, Vancouver, ISO, and other styles

41

Huang, Yinlun, and Xiaojun Peng. "Sustainable Chemical Product and Process Engineering." ACS Sustainable Chemistry & Engineering 2, no. 1 (January 6, 2014): 1–2. http://dx.doi.org/10.1021/sc4005197.

Full text

APA, Harvard, Vancouver, ISO, and other styles

42

Boks, Casper, and Timothy C. McAloone. "Transitions in sustainable product design research." International Journal of Product Development 9, no. 4 (2009): 429. http://dx.doi.org/10.1504/ijpd.2009.027475.

Full text

APA, Harvard, Vancouver, ISO, and other styles

43

Parris, Thomas M. "Internet Resources for Sustainable Product Design." Environment: Science and Policy for Sustainable Development 48, no. 2 (March 2006): 3. http://dx.doi.org/10.3200/envt.48.2.3-3.

Full text

APA, Harvard, Vancouver, ISO, and other styles

44

Yang, Zheng Xiao, and Gang Yang. "Catia Template Design of Auto Rear Axle." Applied Mechanics and Materials 668-669 (October 2014): 1659–62. http://dx.doi.org/10.4028/www.scientific.net/amm.668-669.1659.

Full text

Abstract:

The rear axle structure is studied and analyzed, and the skeleton structure, elements and parameters provided in advance in the template are introduced briefly. Taking a typical part of rear axle for instance, using Catia software to design product template, so as to shorten the product development cycle.

APA, Harvard, Vancouver, ISO, and other styles

45

Miranda, Jhonattan, Roberto Pérez-Rodríguez, Vicente Borja, Paul K. Wright, and Arturo Molina. "Sensing, smart and sustainable product development (S3 product) reference framework." International Journal of Production Research 57, no. 14 (November 21, 2017): 4391–412. http://dx.doi.org/10.1080/00207543.2017.1401237.

Full text

APA, Harvard, Vancouver, ISO, and other styles

46

He, Bin, and Qianyi Yu. "Product sustainable design for carbon footprint during product life cycle." Journal of Engineering Design 32, no. 9 (May 7, 2021): 478–95. http://dx.doi.org/10.1080/09544828.2021.1921130.

Full text

APA, Harvard, Vancouver, ISO, and other styles

47

Nijhof, Andre, Marjolein Bakker, and Henk Kievit. "The role in encroachment of the sustainability aspects of value propositions." European Journal of Marketing 53, no. 10 (October 7, 2019): 2126–45. http://dx.doi.org/10.1108/ejm-11-2017-0879.

Full text

Abstract:

Purpose This paper aims to elucidate what concepts of encroachment in business-to-consumer markets explain the market share increase of companies with sustainability value propositions. It documents the encroachment field, analyses the practice of ten companies and proposes and defines the additional concept of transparency encroachment. Design/methodology/approach Semi-structured interviews were conducted with representatives of companies with an increase in customers and market share due to their sustainability value proposition. These were supplemented with secondary data, like documented interviews, sustainability reports and reports on market development. The interview transcripts and secondary data notes were coded using template analysis. Findings As the literature on encroachment assumes that new value propositions take away market share from incumbents due to advantages for customers, it is questionable whether it can explain how value propositions with advantages for society as a whole can encroach markets. The results of this study show that the dominant forms of encroachment in the current literature – high-end encroachment, low-end encroachment and business model encroachment – can only partly explain encroachment through sustainability value propositions. An additional encroachment form is identified: transparency encroachment. Research limitations/implications This research adds greater clarity to what companies do when they encroach markets with sustainability value propositions. Furthermore, the pattern of transparency encroachment is discussed to define the common aspects of this concept and to argue why these aspects are needed for encroachment. It implies that marketing activities should start from the perception that customers are allies – and not kings – in the development toward higher levels of sustainability. Practical implications The paper offers practical implications insofar as it deconstructs three aspects of transparency encroachment that are enacted by companies. Customer awareness, unique experience and customer contribution are all needed to enact transparency encroachment. It is argued that other companies introducing sustainability value propositions to encroach markets should find their own application of these three aspects to create the potential for successful encroachment. Social implications Because of the focus on sustainability aspects of value propositions, this study generates knowledge about the marketing and encroachment of products with a relatively positive impact on society. Adoption of the identified concept of transparency encroachment contributes to sustainable development. Originality/value To date, there has been very little marketing research that explores the role of sustainability value propositions in the encroachment of markets. Nonetheless, nowadays customers seem to look beyond their own benefits and are increasingly demanding a new approach that builds upon the sustainability aspects of products. This research adds greater clarity to encroachment through sustainability value propositions.

APA, Harvard, Vancouver, ISO, and other styles

48

Cervellon, Marie-Cecile, and Lindsey I. Carey. "Sustainable, hedonic and efficient." European Journal of Marketing 48, no. 7/8 (July 8, 2014): 1375–94. http://dx.doi.org/10.1108/ejm-07-2012-0392.

Full text

Abstract:

Purpose – This paper aims to investigate the influence of consumer reviews on the evaluation, post-experience, of products with a combination of sustainable, hedonic and utilitarian properties. Design/methodology/approach – In the first instance, consumer reviews for organic and non-organic cosmetics posted on the French Web site beauté-test.com were analyzed. Second, a full-factorial two product types (organic and non-organic) × three reviews (positive, negative and no reviews) experiment was conducted. Sixty French women tested a beauty product and evaluated it on hedonic and utilitarian (ambiguous and non-ambiguous) properties. In a second experiment, 132 English-speaking students evaluated an herbal tea at home, along a full-factorial two product types (fair-trade and non-fair-trade) × three product properties (hedonic, utilitarian ambiguous and utilitarian non-ambiguous) × two reviews (negative review and no review) between-subject design. Findings – First, consumers are significantly less influenced by reviews for hedonic products compared to utilitarian products. In particular, they rely on reviews when evaluating utilitarian ambiguous properties (e.g. anti-aging properties) which they find difficult to judge on their own. Second, consumers are more resistant to the persuasive effect of reviews when the product focus is on sustainable (organic or fair-trade) credentials, in particular when judging ambiguous properties. Originality/value – This paper explores a topic neglected in the literature so far: the moderating role of product properties and sustainability, in particular, on consumers’ responses to persuasion and consumer reviews in the context of this paper. Its originality lies in the demonstration that consumers learn through product testing for hedonic and utilitarian unambiguous product properties and through consumer reviews for utilitarian ambiguous product properties. Additionally, it highlights the resistance of sustainable products (organic and fair-trade in this research) to negative product reviews.

APA, Harvard, Vancouver, ISO, and other styles

49

Dose, Christian, Simon Ficht, and Oliver Seitz. "Reducing Product Inhibition in DNA-Template-Controlled Ligation Reactions." Angewandte Chemie International Edition 45, no. 32 (August 11, 2006): 5369–73. http://dx.doi.org/10.1002/anie.200600464.

Full text

APA, Harvard, Vancouver, ISO, and other styles

50

Polz, Martin F., and Colleen M. Cavanaugh. "Bias in Template-to-Product Ratios in Multitemplate PCR." Applied and Environmental Microbiology 64, no. 10 (October 1, 1998): 3724–30. http://dx.doi.org/10.1128/aem.64.10.3724-3730.1998.

Full text

Abstract:

ABSTRACT Bias introduced by the simultaneous amplification of specific genes from complex mixtures of templates remains poorly understood. To explore potential causes and the extent of bias in PCR amplification of 16S ribosomal DNAs (rDNAs), genomic DNAs of two closely and one distantly related bacterial species were mixed and amplified with universal, degenerate primers. Quantification and comparison of template and product ratios showed that there was considerable and reproducible overamplification of specific templates. Variability between replicates also contributed to the observed bias but in a comparatively minor way. Based on these initial observations, template dosage and differences in binding energies of permutations of the degenerate, universal primers were tested as two likely causes of this template-specific bias by using 16S rDNA templates modified by site-directed mutagenesis. When mixtures of mutagenized templates containing AT- and GC-rich priming sites were used, templates containing the GC-rich permutation amplified with higher efficiency, indicating that different primer binding energies may to a large extent be responsible for overamplification. In contrast, gene copy number was found to be an unlikely cause of the observed bias. Similarly, amplification from DNA extracted from a natural community to which different amounts of genomic DNA of a single bacterial species were added did not affect relative product ratios. Bias was reduced considerably by using high template concentrations, by performing fewer cycles, and by mixing replicate reaction preparations.

APA, Harvard, Vancouver, ISO, and other styles

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!