Dissertations / Theses on the topic 'Tomatoes – Breeding'

Thesis (MSC.Agriculture)) --University of Limpopo, 2009.
The aim of this experiment was to evaluate the effect of moisture stress on tomato, using non-destructive remote sensing techniques and agronomic traits under field and greenhouse conditions. Two tomato cultivars Roma VF and Flora Dade were used for the trial. The soil was fertilized optimally for all nutrients to avoid other stresses except water stress; a 2x2 factorial experiment was conducted using two levels of water regimes (stressed vs. control (non-stressed)) having four replicates and two cultivars using a Completely Randomized Design. Pots were put under greenhouse and field conditions. Canopy temperature was measured using an infrared thermometer, NDVI values were recorded using a green seeker hand-held optical sensor unit and stomatal opening were determined using a leaf porometer. Other agronomic traits including days taken for 50% flowering, plant height, number of fruits per plant and fruit yield per plant were recorded. Leaf temperature in stressed plants was high as compared to non-stressed plants, whereas NDVI and stomata conductance values were low. Number of fruits per plant was low; each plant had 4.00 fruits under field conditions and 5.00 fruits per plant under greenhouse conditions as compared to 9.00 fruits under field conditions and 13.00 under greenhouse conditions for non stressed plants. Stressed plants were shorter as compared to non-stressed plants and days taken for 50% flowering were delayed in both cultivars for stressed plants. Stressed plants showed a sign of stress at early stages of plant development. Most of these signs were found on the plants rather than on the fruits, the shape of the main stem of a growing plant was one of the good indicators as it became thin and stringy under stressed conditions. The experiment showed that it is possible to evaluate the effect of moisture stress on tomato by the use of canopy temperature, NDVI, stomatal conductance and agronomic traits.

Thesis (M.Sc. (Crop Science)) --University of Limpopo, 2012
Organic tomatoes are increasingly popular with larger market acceptance since organic farming uses limited or no artificial chemicals. Application of organic fertilisers such as cattle manure has potential to boost organic tomato productivity particularly under low input farming systems. However, information is required on the optimum level of manure application on different tomato cultivars to help emerging tomato farmers in South Africa. The objective of this study was to determine the relative response of yield and yield components among selected determinate and indeterminate tomato cultivars using different levels of cattle manure. Two separate field experiments were conducted at the University of Limpopo during 2007 and 2008 using a split plot design with three replications. Two sets of tomato cultivars were included in which one set consisted indeterminate types (Money Maker, Ox Heart and Sweetie) and the other determinates (Roma and Floradade). Cultivars were assigned as the main plot treatments with six rates of manure (0, 10, 20, 30, 40 and 50 in gram per plant) applied as the subplot treatments to each set. Results indicated significant interactions (P ≤ 0.01) between indeterminate tomato cultivars and levels of manure applied for fruit yield and fruit size in both experiments. Plant height showed variation from 78 to168 cm in Experiment I and 87 to 176 cm in Experiment II. During Experiment I fruit number varied from 23 to 91 per plant and 23 to 97 in Experiment II. Significant differences were detected among determinate cultivars on fruit yield varying from 7928 to 3 4705 kg per hectare during Experiment I and 3 169 to 2 9840 kg per hectare during Experiment II. Overall, the best level of manure for maximum fruit yield and greater fruit size was achieved at 40 g per plant in the indeterminate cultivar Sweetie. Conversely, the best level of manure for maximum fruit yield was achieved at 30 g per plant in determinate cultivar Roma. Thus, to achieve maximum yield, tomato growers could apply 600 and 800 kg per hectare manure on the determinate and indeterminate tomato cultivars, respectively.
the National Research Foundation (NRF)

No melhoramento de plantas, a variabilidade é fundamental na escolha dos genitores. Em contrapartida, quando comparado a outras espécies do gênero Solanum, o tomateiro dispõe de uma base genética estreita. Atualmente, na região sudoeste do Paraná há carência de cultivares de tomateiro de polinização aberta adaptadas a região e ao cultivo agroecológico. Desse modo, o objetivo deste trabalho foi caracterizar a variabilidade morfológica e molecular de genótipos de tomateiro de polinização aberta do BAGT da UTFPR – Pato Branco. O experimento foi conduzido na Área Experimental da UTFPR – Câmpus de Pato Branco, em delineamento de blocos ao acaso, com quatro repetições. A caracterização morfológica foi realizada em 17 genótipos, a partir de 41 descritores quantitativos e qualitativos de fruto e planta, avaliação de doenças e pragas e análises físicoquímicas de frutos. A variabilidade molecular foi analisada por meio de 20 iniciadores SSR em 19 genótipos de tomateiro. Os dados obtidos foram submetidos a diferentes análises multivariadas. Na caracterização da qualidade de fruto, 76,44% da variabilidade encontrada foi composta pelos descritores cromáticos b* (44,43%) e L*(7,21%), diâmetro da cicatriz do pedicelo (16,78%), número de lóculos (8,02%) e comprimento do fruto (8,02%). A dissimilaridade média morfológica geral entre os genótipos foi considerada baixa, os valores encontrados para os agrupamentos baseados nos caracteres quantitativos de planta foram de 0,34, 0,32 para os de frutos e para os caracteres gerais de 0,33. Dez dos 20 iniciadores que apresentaram bandas visíveis tiveram PIC superior à 0,58. A similaridade média obtida a partir dos fragmentos polimórficos amplificados através de 20 iniciadores SSR foi de 0,72. O genótipo comercial GA é morfologicamente e geneticamente semelhante ao genótipo UTFPR_046. O UTFPR_016 e UTFPR_029 apresentaram 90% de similaridade genética e ficaram alocados no mesmo agrupamento em todas as análises morfológicas, indicando alto grau de parentesco entre esses materiais. Os genótipos de fruto amarelo-alaranjado, UTFPR_008 e UTFPR_015, são morfologicamente semelhantes, no entanto, geneticamente são 41% divergentes. A dissimilaridade média morfológica (0,33) foi muito próxima da molecular (0,28). As análises morfológicas e moleculares permitiram identificar agrupamentos com características de interesse e a existência ou não da duplicidade no BAGT da UTFPR – Pato Branco. Os resultados deste trabalho contribuíram para a formação e caracterização do BAGT da UTFPR – Pato Branco e podem auxiliar no melhoramento genético de variedades de tomateiro de polinização aberta para o cultivo agroecológico na região sudoeste do Paraná.
In plant breeding, variability is critical in choosing the parents. In contrast, when compared to other species of the genus Solanum, the tomato has a narrow genetic base. Currently, in the southwestern region of Paraná there is a lack of openpollinated tomato cultivars adapted to the region and agroecological cultivation. Thus, the objective of this work was to characterize the morphological and molecular variability of the open – pollinated tomato genotypes of BAGT UTFPR – Pato Branco. The experiment was conducted in the Experimental Area of UTFPR – Pato Branco Campus, in a randomized block design, with four replications. The morphological characterization was performed in 17 genotypes, from 41 quantitative and qualitative descriptors of fruit and plant, evaluation of diseases and pests and physical-chemical analyzes of fruits. The molecular variability was analyzed by means of 20 SSR primers in 19 tomato genotypes. The data were submitted to different multivariate analyzes. In the characterization of fruit quality, 76.44% of the variability was composed by the chromatic descriptors b * (44.43%) and L * (7.21%), pedicel scar diameter (16.78%), number of loci (8.02%) and fruit length (8.02%). The general morphological average dissimilarity among the genotypes was considered low, the values found for the groupings based on the quantitative plant characters were 0.34, 0.32 for the fruits and for the general characters 0.33. Ten of the 20 primers that showed visible bands had PIC above 0.58. The average similarity obtained from polymorphic fragments amplified through SSR primers was 0.72. The commercial GA genotype is morphologically and genetically similar to the UTFPR_046 genotype. UTFPR_016 and UTFPR_029 presented 90% genetic similarity and were allocated in the same cluster in all morphological analyzes, indicating a high degree of kinship among these materials. The yellow-orange fruit genotypes, UTFPR_008 and UTFPR_015, are morphologically similar, however, genetically they are 41% divergent. The mean morphological dissimilarity (0.33) was very close to the molecular (0.28). Morphological and molecular analyzes allowed the identification of clusters with characteristics of interest and the existence or not of duplicity in BAGT UTFPR – Pato Branco. The results of this work contributed to the formation and characterization of UTFPR – Pato Branco BAGT and may help in the genetic improvement of open pollinated tomato varieties for agroecological cultivation in the southwestern region of Paraná.

Thesis (Ph. D. Agriculture (Plant Protection)) -- University of Limpopo, 2013
Global withdrawal of synthetic fumigant and non-fumigant nematicides due to their ecounfriendly impacts and high toxicity to non-target organisms, respectively, increased the research and development of alternatives for managing population densities of plantparasitic nematodes, particularly the root-knot (Meloidogyne species) nematodes. Although Meloidogyne species had been managed using genotypes that are resistant to plant-parasitic nematodes in various crops, various challenges negate the available or introgressed nematode resistance. In tomato (Solanum lycopersicum) production, nematode races and instability of nematode resistant genotypes under certain conditions necessitated the continued research and development of alternatives since most of the existing commercial tomato cultivars are highly susceptible to various biological races of Meloidogyne species. The aim of the study was to research and develop appropriate dosages of two phyto- nematicides which could be applied through drip irrigation system in open field tomato production systems, while the specific objectives were to: (1) determine whether a computer-based model could provide nonphytotoxic concentrations to tomato plants using fresh fruits of wild watermelon (Cucumis africanus) and wild cucumber (C. myriocarpus) under greenhouse conditions, (2) determine whether computer-based concentrations from the two plant species when using dried fruits would be less phytotoxic and more suppressive to nematodes, (3) investigate application time intervals for the two products, (4) determine responses of plant growth in tomato and nematode suppression in respect to the derived dosages, and and (5) validate dosages of fermented crude extracts from the two plant species with respect to plant growth of tomato and suppression of nematode numbers. xxxiii Greenhouse, microplot and field studies were set to test the hypotheses intended to achieve the stated objectives, with reliability of measured variables being ensured by using statistical levels of significance (P ≤ 0.05) and coefficients of determination (R2), while validity was ensured by conducting experiments at the same location over two seasons and/or by setting up factorial treatments. Firstly, fermented plant extracts of fresh fruits from C. africanus and C. myriocarpus consistently reduced population densities of Meloidogyne species by 80-92% and 50-90%, respectively. Tomato plants were highly sensitive to the two products as shown by the total degree of sensitivities (Σk) and biological index of 0 and 3, respectively. Also, the mean concentration stimulation range (MCSR) of 11% and 7% concentrations, respectively, attested to this phytotoxicity. Secondly, fermented crude extracts of dried fruits from C. africanus and C. myriocarpus also reduced population densities of Meloidogyne species by 78-97% and 87-97%, respectively. Tomato plants were highly tolerant to the two products in dried form as shown by the total degree of sensitivities (Σk) and biological index of 4 and 3, respectively. The MCSR values for C. africanus and C. myriocarpus dried fruits on tomato were 2.64% and 2.99%, respectively, which for the purpose of this study were individually adjusted to 3%, which translated to 36 L undiluted material/ha of 4 000 tomato plants. In subsequent studies, 3% concentration was used as the standard, along with double strength concentration, namely, 6% concentration. Thirdly, the MCSR values derived in Objective 4, namely 3% and 6% concentration for both Cucumis species using the CARD model were used in the optimisation of application time interval using the innovative concept of weeks (0, 1, 2, 3 and 4) in a 30-day month period. Application time interval for 3% and 6% concentrations of C. africanus fruits was xxxiv optimised at 2.40 and 2.61 weeks in a 30-day month period, respectively, which translated to 18 days [(2.4 weeks/4 weeks) × 30 days] and 20 days [(2.6 weeks/4 weeks) × 30 days], respectively. In contrast, for both concentrations from fermented crude extracts of C. myriocarpus fruits, application time interval was optimised at 16 days for 2.2 and 2.1 weeks, respectively. During optimisation of application frequencies, fermented crude extracts from C. africanus and C. myriocarpus reduced final population densities of M. incognita race 2 by 70-97% and 76-96%, respectively. Fourthly, optimum application intervals (time), allowed computation of dosage, which is a product of concentration and application frequency (dosage = concentration × application frequency). Fifthly, validation of the dosages under open field conditions suggested that 6% × 16-day dosage under crude extracts from C. myriocarpus fruit significantly (P ≤ 0.05) improved growth of tomato plants when compared with those of either 0% (untreated control) or 3% at 16 days. In contrast, dosages of C. africanus fruit at two application frequency had no effect on growth of tomato plants – suggesting that either of the dosages was suitable for use in tomato production since both reduced nematode numbers. During validation, the materials reduced nematode numbers by margins similar to those observed previously under other environments. In conclusion, crude extracts of the two Cucumis species have stimulatory concentrations which have potential similar reductive effects on population densities of Meloidogyne species and could serve as botanical nematicides. However, since plant responses to the two products differed in terms of their respective dosages and active ingredients, it implied that for further improvement of the two, the overriding focus should be on their interaction with the protected plants and nematode numbers. Ideally, future research xxxv should include environmental impact studies, especially on the influence of the products fruit quality of tomato, earthworms, fish and bees.

Thesis (Ph. D. Agriculture (Plant Protection)) -- University of Limpopo, 2013
Global withdrawal of synthetic fumigant and non-fumigant nematicides due to their ecounfriendly impacts and high toxicity to non-target organisms, respectively, increased the research and development of alternatives for managing population densities of plantparasitic nematodes, particularly the root-knot (Meloidogyne species) nematodes. Although Meloidogyne species had been managed using genotypes that are resistant to plant-parasitic nematodes in various crops, various challenges negate the available or introgressed nematode resistance. In tomato (Solanum lycopersicum) production, nematode races and instability of nematode resistant genotypes under certain conditions necessitated the continued research and development of alternatives since most of the existing commercial tomato cultivars are highly susceptible to various biological races of Meloidogyne species. The aim of the study was to research and develop appropriate dosages of two phyto- nematicides which could be applied through drip irrigation system in open field tomato production systems, while the specific objectives were to: (1) determine whether a computer-based model could provide nonphytotoxic concentrations to tomato plants using fresh fruits of wild watermelon (Cucumis africanus) and wild cucumber (C. myriocarpus) under greenhouse conditions, (2) determine whether computer-based concentrations from the two plant species when using dried fruits would be less phytotoxic and more suppressive to nematodes, (3) investigate application time intervals for the two products, (4) determine responses of plant growth in tomato and nematode suppression in respect to the derived dosages, and and (5) validate dosages of fermented crude extracts from the two plant species with respect to plant growth of tomato and suppression of nematode numbers. xxxiii Greenhouse, microplot and field studies were set to test the hypotheses intended to achieve the stated objectives, with reliability of measured variables being ensured by using statistical levels of significance (P ≤ 0.05) and coefficients of determination (R2), while validity was ensured by conducting experiments at the same location over two seasons and/or by setting up factorial treatments. Firstly, fermented plant extracts of fresh fruits from C. africanus and C. myriocarpus consistently reduced population densities of Meloidogyne species by 80-92% and 50-90%, respectively. Tomato plants were highly sensitive to the two products as shown by the total degree of sensitivities (Σk) and biological index of 0 and 3, respectively. Also, the mean concentration stimulation range (MCSR) of 11% and 7% concentrations, respectively, attested to this phytotoxicity. Secondly, fermented crude extracts of dried fruits from C. africanus and C. myriocarpus also reduced population densities of Meloidogyne species by 78-97% and 87-97%, respectively. Tomato plants were highly tolerant to the two products in dried form as shown by the total degree of sensitivities (Σk) and biological index of 4 and 3, respectively. The MCSR values for C. africanus and C. myriocarpus dried fruits on tomato were 2.64% and 2.99%, respectively, which for the purpose of this study were individually adjusted to 3%, which translated to 36 L undiluted material/ha of 4 000 tomato plants. In subsequent studies, 3% concentration was used as the standard, along with double strength concentration, namely, 6% concentration. Thirdly, the MCSR values derived in Objective 4, namely 3% and 6% concentration for both Cucumis species using the CARD model were used in the optimisation of application time interval using the innovative concept of weeks (0, 1, 2, 3 and 4) in a 30-day month period. Application time interval for 3% and 6% concentrations of C. africanus fruits was xxxiv optimised at 2.40 and 2.61 weeks in a 30-day month period, respectively, which translated to 18 days [(2.4 weeks/4 weeks) × 30 days] and 20 days [(2.6 weeks/4 weeks) × 30 days], respectively. In contrast, for both concentrations from fermented crude extracts of C. myriocarpus fruits, application time interval was optimised at 16 days for 2.2 and 2.1 weeks, respectively. During optimisation of application frequencies, fermented crude extracts from C. africanus and C. myriocarpus reduced final population densities of M. incognita race 2 by 70-97% and 76-96%, respectively. Fourthly, optimum application intervals (time), allowed computation of dosage, which is a product of concentration and application frequency (dosage = concentration × application frequency). Fifthly, validation of the dosages under open field conditions suggested that 6% × 16-day dosage under crude extracts from C. myriocarpus fruit significantly (P ≤ 0.05) improved growth of tomato plants when compared with those of either 0% (untreated control) or 3% at 16 days. In contrast, dosages of C. africanus fruit at two application frequency had no effect on growth of tomato plants – suggesting that either of the dosages was suitable for use in tomato production since both reduced nematode numbers. During validation, the materials reduced nematode numbers by margins similar to those observed previously under other environments. In conclusion, crude extracts of the two Cucumis species have stimulatory concentrations which have potential similar reductive effects on population densities of Meloidogyne species and could serve as botanical nematicides. However, since plant responses to the two products differed in terms of their respective dosages and active ingredients, it implied that for further improvement of the two, the overriding focus should be on their interaction with the protected plants and nematode numbers. Ideally, future research xxxv should include environmental impact studies, especially on the influence of the products fruit quality of tomato, earthworms, fish and bees.

Thesis (M.Sc. (Plant Production)) -- University of Limpopo, 2013
Two phytonematicides were researched and developed from fermented crude extracts of wild watermelon (Cucumis africanus) and wild cucumber (Cucumis myriocarpus) fruits for use as alternatives to methyl bromide in managing root-knot (Meloidogyne species) nematodes in tomato (Solanum lycopersicum) production. Fruits of C. africanus contain cucurbitacin B (C32H48O8), while those of C. myriocarpus contain cucurbitacin A, which comprises cucumin (C27H40O9) and leptodermin (C27H38O8). Phytonematicides from C. africanus and C. myriocarpus fruits are referred to as nemafric-B and nemarioc-A, respectively. The two phytonematicides, due to their origin from plant species with allelochemicals, have high potential of being phytotoxic to crops. The use of the Curve-fitting Allelochemical Response Dosage (CARD) computer-based model assisted in the establishment of concentrations which were stimulatory to growth of tomato (Solanum lycopersicum) plants, while exhibiting nematoxic properties to Meloidogyne species. The two phytonematicides were developed from crude extracts of fruits dried at 52˚C in air-forced ovens and ground in a Wiley mill through 1-mm-opening sieves. However, equipment for drying and grinding fruits would not be accessible to smallholder farmers who wished to prepare their own products on-farm. The objective of this study therefore, was to determine whether nemafric-BL and nemarioc-AL produced from fresh fruit of the two Cucumis species would be suitable for use (i.e. non phytotoxic) in tomato production for managing population densities of M. incognita race 2. In order to distinguish the products of fresh (F) fruits from those of dried (D) fruits, they were code-named nemafricF-BL or nemariocF-BL and nemafricD-BL or nemariocD AL, respectively, where G and L denoted granular and liquid formulations, respectively. Tomato cv. ‘Floradade’ seedlings were infested with 3 000 eggs and second-stage xv juveniles of M. incognita race 2. An equivalent of 40 g and 80 g dried fruit mass of nemafric-B and nemarioc-A, namely, 284 g and 411 g fresh fruit mass for nemafric-B and nemarioc-A, respectively, were separately fermented using EMROSA effective micro-organisms mixed with 16 L chlorine-free tapwater in 20 L container for 14 days at ± 25˚C, allowing pH to gradually decline to ± 3.7. Separate experiments for each product run concurrently. Treatments, namely, 0, 2, 4, 8, 16, 32 and 64% concentrations, where for instance, 2% = 20 ml/1000 ml x 100, were arranged in a randomised complete block design, with 10 replications. Blocking in the greenhouse was done for wind direction which was regularly erected by fans for cooling down the greenhouse. At 56 days after weekly application of each treatment, flower number, fruit number, dry shoot mass, dry root mass, dry fruit mass, plant height, stem diameter and nematode numbers were each subjected to analysis of variance. Nematode data were, prior to analysis, transformed using log10(x + 1), but untransformed data were reported. Using the sum of squares, nemafric-BL and nemarioc-AL treatments affected dry root mass, dry shoot mass, flowers number, fruit number, plant height and stem diameter. Nemafric-BL contributed 67%, 78%, 58%, 43%, 60% and 26%, while nemarioc-AL contributed 71%, 61%, 19%, 35%, 34% and 24% to total treatment variation of the six respective variables. Plant variables with significant (P ≤ 0.05) treatment effects were further subjected to the CARD model to generate seven biological indices, with three distinct phases, namely, stimulation, neutral and inhibition phases. Using the quantified stimulation phase, the mean concentration stimulation range (MCSR) was computed for each variable using two biological indices, namely, threshold stimulation point (Dm) and saturation point (Rh). The CARD model explained 98%, 99%, 98% and 98% of the quadratic models of dry root mass, dry shoot mass, plant height and stem diameter, xvi respectively, against increasing concentrations of nemarioc-AL. Similarly, the CARD model explained 99%, 96%, 84% and 93% of total treatment variation in the respective plant variables. The integrated MCSR [MSCR = Dm + (Rh/2)] for nemafric-BL on tomato plants was 7%, while that for nemarioc-AL was 4%. In the CARD model, the overall sensitivities (∑k) of tomato plants exposed to nemafric-BL and nemarioc-AL were 3 units and 5 units, respectively. Tomato plants were therefore, less sensitive to nemarioc-AL since it had higher ∑k value than nemafric-BL. At 4% nemarioc-AL and at 7% nemafric-BL, the two phytonematicides were each highly suppressive to population densities of M. incognita race 2. In conclusion, on the basis of non-phytotoxicity of the computed MCSR values and their suppressive effects on population densities of M. incognita race 2, the smallholder farmers could produce nemafric-BL and nemarioc-AL phytonematicides on-farm. However, the production of the two products from fresh fruits would not be sustainable since fruits of the two Cucumis species are highly seasonal due to the high incidence of post-harvest decays.
The Land Bank Chair of Agriculture – University of Limpopo, Limpopo Agro-processing Technology Station,and the Flemish Interuniversity Council of Belgium

Brewery effluent that had undergone treatment in an anaerobic digester (AD) was used as an alternative water and nutrient source for hydroponic crop production. Brewery effluent was demonstrated to contain sufficient nutrients to support the growth, flowering and fruiting of Lycopersicum escolentum "Moneymaker" tomato crops. The adjustment of the effluent pH with phosphoric acid to between pH 6.0 and 6.5 increased the development of the crops by around 100% compared to crops grown in unaltered effluent. The pH adjusted effluent-grown plants grew to a mean height of 831.4 ± 21.1 mm and a dry biomass weight of 42.34 ± 2.76 g compared to the unaltered pH effluent plants which grew to a height of 410.6 ± 20.5 mm and a weight of 7.65 ± 0.68 g after 49 days. Effluent treatment in high-rate algal ponds (HRAP) was determined to have no positive effect on the nutritional potential of the effluent for Moneymaker production. The effluent-grown plants did not perform as well as plants grown in inorganic-fertilizer and municipal water. Plants grown in effluent grew taller but did not produce significantly more fruit when phosphoric acid (height: 1573.3 ± 50.4 mm, 19.4 ± 1.4 fruit per plant) was compared to nitric acid (height: 1254.1 ± 25.4 mm, 15.6 ± 1.5 fruit per plant) as the pH adjustment over 72 days. Direct and secondary plant stresses from effluent alkalinity, ammonium nutrition, nitrogen limitation, sodium concentrations and heat stress among other factors were probably confounding variables in these trials and require further investigation. Considering the raw effluent composition and manipulating the AD operation is a potential opportunity to improve overall AD performance, reduce chemical inputs in the effluent treatment process, reduce the final effluent alkalinity, and increase available nitrogen content in the final effluent. The anaerobic digester discharging >1000 m³ of nutrient enriched effluent every day is a resource with considerable potential. The benefits of developing this resource can contribute to cost-reduction at the brewery, more efficient water, nutrient and energy management at the brewery, and offer opportunities for job creation and potentially benefit local food security.

Among viral diseases affecting cultivated tomato, Tomato yellow leaf curl disease (TYLCD) is one of the most devastating. This disease is caused by a complex of viruses of which Tomato yellow leaf curl virus (TYLCV) is regarded as the most important species. Current control strategies to fight viral diseases in tomato are mainly based on genetic resistance derived from wild relatives. In the present thesis, resistance derived from S. chilense and S. peruvianum has been exploited in breeding for resistance to TYLCD. In a previous study, TYLCV-resistant breeding lines derived from LA1932, LA1960 and LA1971 S. chilense accessions were developed. Therefore, the first objective of this thesis was to study the genetic control of the resistance derived from these accessions. With this aim, response to viral infection was assayed in segregating generations derived from the aforementioned resistant lines. The results obtained were compatible with a monogenic control of resistance. Resistance levels were higher in LA1960- and LA1971-derived F2 generations, as shown by slighter symptoms in the resistant plants and a higher number of asymptomatic plants compared with the results obtained in the LA1932-derived F2 generation. It is noteworthy that the level of resistance present in our materials is comparable to or even higher than the levels found in tomato lines homozygous for Ty-1. The response in plants heterozygous for the resistance gene was comparable to the response in homozygous plants for all three sources employed. This implies that the resistance genes derived from all three sources seem to be almost completely dominant. This effect was stronger for LA1971-derived resistance. The results were similar when comparing viral accumulation, as was expected, since a positive correlation was found in these families between viral accumulation and symptom scores. This has important implications in breeding, since the resistance will be used mostly for hybrid development. Our second objective was to map the loci associated with the major resistance genes identified. A total of 263 markers were screened, 94 of them being polymorphic between both species. Recombinant analysis allowed the resistance loci to be localized on chromosome 6, in a marker interval of 25 cM. This interval includes the Ty-1/Ty-3 region, where two S. chilense-derived TYLCD resistance loci were previously mapped. In order to test if the resistance genes identified in our populations were allelic to Ty-1 and Ty-3, further fine mapping was carried out. A total of 13 additional molecular markers distributed on chromosome 6 allowed 66 recombinants to be identified, and the resistance region to be shortened to a marker interval of approximately 950 kb, which overlaps with the Ty-1/Ty-3 region described previously by other authors. Therefore, the results obtained indicate that closely linked genes or alleles of the same gene govern TYLCV resistance in several S. chilense accessions. The third objective of the present thesis was to start the construction of a set of introgression lines (ILs) derived from Solanum peruvianum accession PI 126944 into the cultivated tomato genetic background. Once this collection of ILs is developed, it will represent a powerful tool for exploiting the resistance to different pathogens found in this particular accession in addition to other possible characters of interest. The starting plant material consisted of several segregating generations that were derived from two interspecific hybrids previously obtained by our group. Many crosses and embryo rescue were required to obtain subsequent generations due to the high sexual incompatibility that exists between tomato and PI 126944. Several mature fruits from the most advanced generations produced a few viable seeds, although embryo rescue was also employed to obtain progeny. As only a few plants were obtained by direct backcrossing, additional crosses were made in order to increase the number of descendants. A high degree of incompatibility was also found in crosses between sib plants. A total of 263 molecular markers were tested in some generations, 105 being polymorphic between tomato and PI 126944. Available generations were genotyped with these polymorphic markers in order to determine which alleles of S. peruvianum were already introgressed. On average, 79, 78 and 84 % of the S. peruvianum genome was represented in the pseudo-F2, pseudo-F4 and pseudo-F5 generations, respectively, for the markers analyzed. A reduction in the S. peruvianum genome was observed in more advanced generations, such as BC1 (56 %), pseudo-F2-BC1 (60 %) and pseudo-F3-BC1 (70 %). A greater reduction was observed in the pseudo-F3-BC2 generation (33 %). As a consequence of the reduction in the S. peruvianum genome, a loss of incompatibility was observed in some cases. The S. peruvianum genome was almost completely represented among the different plants of the most advanced generations. An evaluation for resistance to TYLCD and Tomato spotted wilt virus (TSWV) was carried out in some of the advanced generations, some of which were resistant to one or both viruses. In conclusion, we have conducted a successful and deeper exploitation of two wild species with proved resistance to TYLCD, S. chilense and S. peruvianum, identifying and fine mapping new genes of resistance.
Julián Rodríguez, O. (2014). Exploitation of Solanum chilense and Solanum peruvianum in tomato breeding for resistance to Tomato yellow leaf curl disease [Tesis doctoral no publicada]. Universitat Politècnica de València. https://doi.org/10.4995/Thesis/10251/36867
TESIS

Cultivated tomato plants are extremely susceptible to the two-spotted spider mite Tetranychus urticae Koch. Selection for pest resistance is usually a crucial step required to achieve successful genetic resistance transfer from wild into cultivated tomato genotypes. S. habrochaites LA2329, a wild relative of tomato, is highly resistant to arthropods. Its resistance has been attributed to the presence of a high density of type IV and type VI trichomes and abundant production of 7-epi-zingiberene, a sesquiterpene hydrocarbon. The interspecific backcross hybrids used in this research were derived from the cross between the wild relative tomato, S. habrochaites LA2329, and the cultivated tomato, S. lycopersicum ‘Zaofen 2’ (ZH2). This population has been directly selected for type IV trichome density and zingiberene. The arthropod resistance status of the backcross hybrids was unknown when this research was initiated. Thus, the main objective of the research was to verify the transfer of arthropod resistance from S. habrochaites to cultivated tomato. The effects of glandular trichome densities and leaf zingiberene contents on spider mite behavior and biology were also explored. Also, the chemical composition of the trichome secretions in the wild tomato donor is segregating for presence and abundance of sesquiterpenoids related to zingiberene. The bioactivity of these sesquiterpenoids was explored in this research. To evaluate the relative bioactivities of zingiberene alcohol and 7-epizingiberene, extracted from glandular trichomes of Solanum habrochaites accession LA2329, as well as alpha-zingiberene obtained from ginger oil, these were purified by silica gel chromatography and bioassayed with two-spotted spider mites, Tetranychus urticae Koch (Acari: Tetranychidae) using a bean leaf disc bioassay. Zingiberene alcohol was most efficacious and alpha-zingiberene, was least efficacious, while the efficacy of 7-epizingiberene was intermediate. Thus, tomato breeders should consider introgression of the genes responsible for the oxidation of 7-epizingiberene into zingiberene alcohol to potentially improve the spider mite resistance of cultivated tomato. Also, it is possible that this compound may be exploited as eco-biopesticide approach for integrated pest management against a broad spectrum of herbivorous pests. To verify transfer of arthropod resistance, a bioassay utilizing whole leaves was employed. Nine hybrids (BC3F3 and BC3F4) were chosen for this bioassay, based on variation of type IV trichome density and zingiberene concentration among the hybrids. The experiment also included three susceptible and three resistant control plants. Mite responses on some of the hybrids were similar to those on the resistant wild donor parent, S. habrochaites, as indicated by number of leaflet surfaces infested by mites, degree of mite webbing and feeding damage. Egg density on four backcross hybrids was similar to that on the S. habrochaites resistant controls. Based these results, we concluded that resistance had been successfully transferred from the wild accessions to the hybrids by deployment of backcrossing and indirect selection. There was a significant negative correlation of almost all mite behavioral and biological responses with Type IV trichome density and zingiberene content. This bioassay illuminated behavioral variations of mites associated with presence or absence of leaf compounds and glandular trichome densities. Also, the results support the idea that introgression of type IV trichomes and zingiberene has led to effective spider mite resistance. In another bioassay-based experiment to verify transfer of resistance, seven interspecific backcross hybrids (BC3F2), the resistant parent LA2329, and two susceptible cultivated tomato lines, the recurrent parent ZH2 and ‘Small Roma’, were used in thumbtack bioassays. Mite movement was measured by imaging bioassayed leaves at 15, 20, 30, 45, and 60 min intervals. In addition to confirming transfer of spider mite resistance, other objectives included determination of the relative contributions of type IV and VI trichome densities and leaf compounds to mite behavior over time intervals. Our findings confirmed the transfer of mite repellency from the wild resistant parent to advanced backcross hybrids. Several backcross hybrids performed similarly to the wild donor parent, displaying shorter distances traveled on the leaves after 15 and 30 min. The type IV and type VI trichome densities as well as zingiberene contents had a significant positive correlation with the number of spider mites remaining on tack. There was a significant negative correlation of type IV density and zingiberene concentration with the total distance travelled by mites for both the abaxial and adaxial surfaces across most time intervals. Stepwise multiple regression analysis showed that the type IV trichome density was the most critical factor, and zingiberene content was a secondary factor across over most time intervals. T. urticae remained longer on the thumbtack heads and traveled shorter distances on the leaf surface of the wild donor parent LA2329 and the interspecific hybrids compared to S. lycopersicum leaves. These results indicated that introgression of genetic resistance, especially repellence, against spider mite from the wild relative into cultivated tomato varieties has been successfully achieved. In conclusion, trichome type IV and/or zingiberene content has been successfully transferred from the wild relative into interspecific tomato hybrids, and the hybrids show significant adverse impact on spider mite behavior and/or biology in whole leaf and thumbtack bioassays. Type IV trichome density is the most crucial factor in mite deterrence while zingiberene seemed to be a second key factor across most of time durations for both surfaces. Collectively, several backcross hybrids had similar leaf characteristics to the S. habrochaites LA2329, also may be a potential source of resistance to other insect pests.

A utilização de cultivares resistentes às viroses de plantas tornou-se estratégia relevante para o cultivo de tomateiro. Para isso fontes de resistência são incluídas em programas de melhoramento genético visando à obtenção de linhagens e/ou novas cultivares resistentes a esses patógenos. As tospoviroses são responsáveis por grandes perdas econômicas em cultivos do tomateiro em todo o mundo, visto que, elevadas taxas de infecção tem acarretado em perdas econômicas consideráveis para inúmeros países. O objetivo do trabalho visou a caracterização de linhagens de tomateiro de hábito de crescimento determinado resistentes a tospovírus, utilizando caracteres agronômicos e marcadores associados a genes de resistência à doença. Foram utilizados 16 genótipos de tomateiro de hábito de crescimento determinado, sendo doze linhagens experimentais e quatro testemunhas comerciais. Usou-se delineamento em blocos casualizados, com 16 tratamentos e 3 repetições. Avaliaram-se uniformidade de planta (UP), vigor da planta (VP), altura de planta (AP), pegamento de fruto (PGF), cobertura foliar (CF), massa média do fruto (MMF), comprimento (C), diâmetro equatorial (D), razão entre comprimento e diâmetro (R C/D), tamanho da cicatriz peduncular (CP), forma da base (FB), firmeza do fruto (FF), espessura do pericarpo (EP), número de lóculos (NL), produção total (PT), número de frutos descartados (NFD), produção descartada (PD) e produção comercial (PC). Para a análise molecular, utilizou-se o par de primers Sw-5-2 (F = 5\' AATTAGGTTCTTGAAGCCCATCT 3\'; R = 5\' TTCCGCATCAGCCAATAGTGT 3\'). Nas condições em que o presente trabalho foi conduzido e, de acordo com os resultados obtidos, concluiu-se que todas as linhagens estudadas confirmaram a presença do gene Sw-5 em análise molecular, portanto, são resistentes a tospovírus, sendo recomendadas para serem utilizadas como genitoras.
Resistance of cultivars to viruses has become a relevant strategy for tomato cultivation. Sources of resistance are included in breeding programs to obtain lines and /or resistant hybrids. The tospoviroses are responsible for large economic losses in tomato crops worldwide. The objective of this work was the characterization of tomato lines resistant to Tospovirus, using agronomic traits and molecular markers. We used sixteen tomatoes genotypes, twelve of them were experimental lines and four were commercial controls. The experiment was carried out at the research field area with random blocks design with sixteen treatments and three replications. The following agronomical traits were assessed: plant uniformity (UP), plant vigour (VP), plant height (AP), fruit setting (PGF), leaf cover (CF), average fruit weight (PMF), fruit length (C), fruit width (D), relation between length and width fruit (R C/D), size of the peduncular scar (CP), pistil scar (FB), fruit firmness (FF), fruit pericarp thickness (EP), fruit loculus number (NL), total production (PT), not marketable fruit yield (PD) and marketable yield (PC). To the molecular analysis, we used the primers pair Sw-5-2 (F = 5’ AATTAGGTTCTTGAAGCCCATCT 3’; R = 5’ TTCCGCATCAGCCAATAGTGT 3’). According to the results, for the conditions in which the present experiment was conducted, we concluded that all genotypes confirmed the presence of the Sw-5 gene in molecular analysis, therefore, they are resistant to tospovirus, recommended to be used as parental lines.

The domesticated tomato Solanum lycopersicum (L.), formerly known as Lycopersicon esculentum is a genetically well-studied crop species with high-density linkage and molecular maps based on crosses done between cultivated tomato and its distant related wild species. Wild tomato species harbor a wealth of resistance to many pathogens that have been introgressed into domesticated tomato for genetic control of diseases and pests and for improvement of many agronomic traits. The wild tomato S. peruvianum (L.) is the source of the Sw-5 gene, characterized and mapped to chromosome 9 of the tomato genome and introgressed into elite tomato germplasm, providing resistance to the tospovirus Tomato spotted wilt virus (TSWV). TSWV has been reported to be a major problem for tomato growers in many parts of the world, which in some cases, has resulted in tomato fields having been abandoned for some time. Additionally, there are reports that new races of TSWV have evolved that overcome Sw-5. TSWV replicates in both, plant cells and in the alimentary canal cells of thrips and then transmitted to plants by this insect acting as a vector. Both, TSWV and thrips have co-evolved to infest and infect more than 1090 plants species in over 100 families, thrips becoming resistant to pesticides and easily escaping by hiding deep in plant parts. World trade has disseminated thrips all over the world and environmental pressures have forced TSWV to recombine its RNA to overcome new resistance.

A protease FtsH pertence à superfamília das proteínas AAA (ATPases Associadas à diversas Atividades celulares) cujos membros estão amplamente distribuídos entre procariotos e eucariotos. Nas plantas superiores, elas são codificadas por genes nucleares e sintetizadas por ribossomos citosólicos com uma seqüência de direcionamento na extremidade amino-terminal responsável pela translocação da pré-proteína para o interior das organelas, notadamente mitocôndrias e cloroplastos. Com o objetivo de caracterizar o processo de translocação da proteína aos tilacóides e sua regulação gênica em plantas, isolou-se um cDNA de frutos de tomate (Lycopersicon esculentum Mill. cv. MicroTom), cuja seqüência de aminoácidos revela a presença de todos os motivos clássicos pertencentes a uma protease do tipo FtsH-p1. A caracterização inicial da proteína indicou a presença de um típico peptídeo de trânsito cloroplástico em sua extremidade amino-terminal. A fim de definir qual região da proteína madura está envolvida no direcionamento da protease às membranas, foram realizadas construções gênicas contendo diferentes comprimentos da região amino-terminal da FtsH-p1 de tomate fusionados ao gene repórter GFP (green fluorescent protein). Estudos realizados a partir de frações enriquecidas de cloroplastos, estroma e tilacóide, provenientes de plantas transgênicas expressando estavelmente estas construções, revelaram que todas as proteínas de fusão acumularam-se no estroma sendo, portanto incapazes de associarem-se aos tilacóides. Estes dados indicam que a inserção da FtsH-p1 de tomate nas membranas dos tilacóides dependem de informação presente na proteína madura, necessária para a interação com as membranas ou mesmo com um fator adicional desconhecido. Alem disso, foi mostrado que membros da família das proteases do tipo das FtsHs em plantas não apresentam o clássico motivo RRXFLK, previamente descrito como essencial para a translocação dependente de uma dupla arginina (Tat). Devido ao envolvimento de ortólogos desta proteína em processos fisiológicos importantes nas plantas, abriu-se a possibilidade de estudar a regulação da FtsH-p1 de tomate via clonagem e caracterização da sua região promotora. Uma vez clonada, 4 deleções à partir da extremidade 5’ nesta região foram realizadas e fusionadas de forma a dirigirem a expressão do gene repórter uidA (GUS). Estas construções foram expressas estavelmente em plantas de tabaco, a fim de estudar sua regulação em diferentes tecidos, estádios de desenvolvimento e em resposta a estímulos ambientais ou situações de estresse. Os resultados preliminares mostraram que a seqüência regulatória clonada é responsível tanto à fatores ambientais, como luz, quanto aos hormônios auxina, citocinina e giberelina. Além disso, foi observada uma regulação negativa na presença de peróxido de hidrogênio. Entretanto, tratamentos envolvendo estresse salino, bem como variações na temperatura não geram nenhum efeito na atividade da enzima GUS. O mesmo ocorre quando as plantas são colocadas em presença de ácido abscísico (ABA). Os resultados deste estudo contribuem significativamente para um melhor entendimento dos mecanismos de regulação envolvidos no controle da expressão gênica da FtsH-p1 de tomate, bem como sugerem novas perspectivas no direcionamento de proteínas às membranas.
The FtsH protease belongs to the AAA family (ATPases associated with different cellular activities) whose members are widely distributed in prokaryotes and eukaryotes. In higher plants, these proteins are nuclear-encoded and synthesized by cytosolic ribosomes as larger molecular weight precursors. These molecules carry at the N-terminal extension a specific targeting sequence that directs translocation of the preproteins to the envelope membranes of mitochondria and chloroplasts. In the present work, a tomato (Lycopersicon esculentum Mill. cv. MicroTom) fruit cDNA encoding a plastid FtsH-p1 has been isolated, cloned and characterized. In order to define the protein domains involved on thylakoid targeting, several gene constructions were prepared carrying increasing lengths of the N-terminal region of tomato FtsH fused to the gfp (green fluorescent protein) reporter gene. In vivo expression studies based on onion cells or stable expression in transgenic tobacco plants showed that the chimeric proteins were translocated to plastids. In addition, sub-organellar fractionation indicated that GFP accumulated in the stromal fraction, instead of being translocated to the thylakoid membrane. These data suggest that membrane insertion of tomato FtsH-p1 requires information present in the mature protein. One remarkable finding was that members of the FtsH family do not present the classical RRXFLK motif, that has been shown to be essential for the Tat-dependent pathway. The FtsH-family members are involved in important physiological processes in plant cells. Therefore, this study opened up the possibility of studying the FtsH-p1 gene regulation by characterization of its regulatory region. After cloning a 1700 bp fragment corresponding to 5’ upstream region of the tomato FtsH coding sequence, four deletions of the promoter region were performed and the resulting fragments were fused to the uidA (GUS) reporter gene. These gene constructs were stable expressed in tobacco plants and further characterized. The results showed that the promoter region is positively regulated by light and the phytohormones auxin, cytokine and gibberelin. Besides, the promoter was down regulated by hydrogen peroxide. However, GUS activity was not affected by salt stress, variations on the temperature and abcisic acid treatment. The results presented here expand the current understanding of factors involved on FtsH gene regulation as well as bring new insights on the protein targeting to membranes.

La connaissance de la diversité génétique de R. solanacearum autant que la connaissance du déterminisme génétique de la résistance sont importantes pour établir une stratégie de lutte contre cette bactérie ubiquiste. Elles permettent de choisir et d'orienter des méthodes de lutte et le développement d'outils de contrôle de quarantaine adaptés. Dans un contexte scientifique de plus en plus tourné en génétique par l'approche plante modèle et dans lequel les Solanacées occupent la place de plante pionnière d'une part, et d'autre part par l'émergence de contournement des résistances liées à la grande diversité génotypique et phénotypique de R. solanacearum (au point où on parle ici de complexe d'espèce), l'objectif de cette thèse est de contribuer à établir les bases d'un programme d'amélioration des Solanacées contre cette phytobactériose majeure au Cameroun. En recourant à une approche moléculaire, notamment la méthode de caractérisation phylophasique qui décrit la diversité génétique des souches de R. solanacearum en quatre phylotypes et séquevars, nous avons révélé l'existence de trois phylotypes dans ce pays d'Afrique dont la diversité agro-climatique lui vaut le surnom d'" Afrique en miniature ". Ces phylotopes sont le I (Asiaticum), II (Americanum) et III (Africanum). Les souches du phylotype III du Cameroun se sont révélées génétiquement distinctes des souches africaines de référence originaires du Zimbabwe et de l'Océan Indien. Les souches isolées sur pomme de terre dans les hauts plateaux de l'Ouest du Cameroun se classent dans les deux phylotypes, à savoir le II (r3-bv2) et le III. Ces souches du phylotype II et III des hauts plateaux de l'Ouest infectent aussi bien la pomme de terre que la tomate, et pourraient constituer une menace économique pour ces cultures dans cette région. Dans cette étude, les souches du phylotype I émergent en zone forestière humide comme une contrainte majeure à la culture des Solanacées. Ce constat a orienté le choix d'une souche de ce phylotype (CMR143) dans les travaux de la cartographie génétique de la résistance chez le piment. Pour ce faire, deux géniteurs de résistance différents CM334 et PM687 ont été considérés. Ces études génétiques ont montré une forte héritabilité de la résistance au flétrissement bactérien chez le piment. La détection de QTL par analyse de variance (ANOVA), par cartographie d'intervalle, simple (SIM) et composite (CIM), ont révélé l'existence de 3 à 6 QTLs et d'interactions digéniques dans le contrôle de la résistance du piment au flétrissement bactérien. Ces résultats confirment le caractère oligogénique de la résistance du piment au flétrissement bactérien. En mettant ensemble ces QTLs et ces interactions digéniques, 47 à 64 % de la variance phénotypique sont expliqués selon le caractère de résistance considéré. Par ailleurs, il est montré que la résistance du piment au flétrissement bactérien est fortement associée à la limitation de l'envahissement de la tige par la bactérie. De plus, cette étude a mis en évidence le caractère phylotype-spécifique de la résistance, car seulement 33% de facteurs génétiques contribuent au contrôle du flétrissement bactérien lors de tests avec le phylotype 2. La localisation de ces derniers permet de conclure en validant partiellement l'hypothèse de synténie entre la tomate et le piment.

Lycopersicon esculentum Mill. cv. Rodade was developed in South Africa for the fresh produce market. This cultivar is also of major importance for South African tomato breeding programmes because of its resistance to bacterial wilt. In this study, aspects of the effects of 6-benzyladenine on adventitious shoot formation by both L. esculentum cv. Rodade and Lycopersicon peruvianum Mill. were studied in vitro. These included the regeneration of adventitious shoots, the effects of different incubation times, the uptake and metabolism of BA and the effect of auxin on the metabolism of BA in both leaf and callus tissue of the two species. Adventitious buds could be regenerated on all tissue types except for callus tissue of L. esculentum. A stepwise increase in the percentage shoots produced was observed indicating a period of induction wherein incubation on a medium containing BA is beneficial to the production of shoots. Leaf tissue was more responsive to BA treatments than callus tissue of both species. The main route of BA metabolism in both species is from BA to [9R]BA and [9R-MP]BA. Callus tissue of L. esculentum cv. Rodade however converted BA to the 3- and 9- glucosides of BA rather than to metabolically active forms of the cytokinin. The auxin, indole-3-acetic acid, played a definite role in the conversion of BA to [3G]BA and [9G]BA in leaf tissue of the tomato cultivar tested, but had no effect in callus tissue of this species.
Thesis (Ph.D.)-University of Natal, Pietermaritzburg, 1993.

M. Tech. Agriculture
Tomatoes (Solanum lycopersicum) and sweet or bell peppers (Capsicum annuum L.) belong to the Solanaceae family. They constitute an excellent source of phenolic (flavonoids), vitamin C (ascorbic acid) and carotenoids (especially lycopene, b- carotene, a precursor of vitamin A), known as antioxidants. The aim of this study was to investigate the influence of photo-selective nets (ChromatiNet™) (red, pearl and yellow) with 40% shading on postharvest fruit quality parameters (Soluble solids content, Titratable acidity, fruit mass and firmness), bioactive compounds (ascorbic acid, total phenols, flavonoid, lycopene, b-carotene contents), antioxidant scavenging activity, odour active aroma compounds and the sensory quality of three indeterminate sweet pepper cultivars HTSP-5 (green), HTSP-3 (red) and Celaya (yellow) and three tomato cultivars (AlfaV, Irit, and SCX 248). A commercial black net (control) with 25% shading was included for comparison.

Thesis (MSc. Agriculture (Horticulture)) -- University of Limpopo, 2018
The production of tomato (Solanum lycopersicum L.) plants had been crucial in various parts of the world since tomato fruit contribute widely to human health. However, most tomato cultivars had been shown to be highly susceptible to plant-parasitic nematodes, especially the root-knot (Meloidogyne species) nematodes. Two cucurbitacin-containing phytonematicides, namely, Nemarioc-AL and Nemafric-BL phytonematicides, manufactured from fruits of Cucumis species, are being researched and developed in South Africa as an alternative for management of Meloidogyne species. Most trials on tomato plants and cucurbitacin-containing phytonematicides had been under greenhouse conditions, with limited information on their interactive effects under microplot and field conditions. The objectives of this study were: (1) to determine the interactive effects of Nemarioc-AL and Nemafric-BL phytonematicides on growth and accumulation of nutrient elements in leaf tissues of tomato plants under microplot conditions and (2) to investigate the interactive effects of Nemarioc-AL and Nemafric-BL phytonematicides on growth and accumulation of nutrient elements in leaf tissues of tomato plants under field conditions. In the microplot study, uniform four-week-old tomato cv. 'HTX 14' seedlings were transplanted in 4 L plastic bags containing loam soil and Hygromix-T at the 3:1 ratio (v/v). Plastic bags were inserted into holes at 0.50 m inter-row spacing and 0.60 m intra-row spacing. The 2 x 2 factorial trial, with the first and second factors being Nemarioc-AL and Nemafric-BL phytonematicides, respectively, each at two levels. The four treatments, namely, AL0BL0, AL0AL1, BL0BL1 and AL1BL1, were arranged in a randomised complete block design. Treatments were xxiv applied seven days after transplanting and repeated weekly until harvest. Under field conditions, uniform four-week-old tomato cv. 'HTX 14' seedlings were transplanted into the field at 0.50 m inter-row spacing and 0.60 m intra-row spacing. Treatments, experimental designs and application interval were as those under microplot conditions. At 60 days after the treatments, seedlings AL × BL interaction was not significant on all plant variables in Experiment 1 under microplot conditions, whereas in Experiment 2 the interaction was highly significant (P ≤ 0.01) on dry shoot mass, contributing 72% in total treatment variation (TTV) of the variable. Relative to untreated control, the two-way matrix showed that the interaction reduced dry shoot mass by 8%. Nemarioc-AL phytonematicide had a significant (P ≤ 0.05) effect on stem diameter in Experiment 1 under field conditions, whereas Nemafric-BL phytonematicide had significant effects on plant height in Experiment 2, contributing 39 and 56% in TTV of the respective variables. Relative to untreated control, Nemarioc-AL phytonematicide increased stem diameter by 4%, whereas Nemafric-BL phytonematicide increased plant height by 2%. The interaction was also significant (P ≤ 0.05) on Na and S and highly significant (P ≤ 0.01) on Zn, contributing 76, 26 and 6%, respectively, in TTV of the respective variables in Experiment 1 under field conditions. Using a two-way matrix, the interaction increased Na and S by 12 and 41%, respectively, but reduced Zn by 52%. In Experiment 2, the interaction was highly significant (P ≤ 0.01) on P alone, contributing 16% in TTV of the variable, with the interaction reducing P by 76%. Nemarioc-AL phytonematicide had significant effects (P ≤ 0.05) on Ca and highly significant effects (P ≤ 0.01) on S, contributing 31 and 58% in TTV of the respective variables in Experiment 1. Relative to untreated control, Nemarioc-AL phytonematicide increased P by 39%. In xxv Experiment 2, Nemarioc-AL phytonematicide had significant effects on Ca and highly significant effects (P ≤ 0.01) on S, contributing 66 and 49% in TTV of the respective variables. Relative to untreated control, Nemarioc-AL phytonematicide reduced Ca by 19% and S by 36%, respectively. Nemafric-BL phytonematicide had a significant effect (P ≤ 0.05) on P, contributing 33% in TTV of the variable in Experiment 1. Relative to untreated control, Nemafric-BL phytonematicide increased P by 41%. In Experiment 2, Nemafric-BL phytonematicide had significant effects (P ≤ 0.05) on S, contributing 40% in TTV of the variable. Relative to untreated control, Nemafric-BL phytonematicide reduced S by 33%. At 74 days after initiating the treatments under field conditions, the interaction of Nemarioc-AL and Nemafric-BL phytonematicides were not significant for plant height, stem diameter, fresh fruit and dry shoot mass in both experiments. Nemarioc-AL phytonematicide was also not significant in all plant variables in both experiments. Effects of Nemafric-BL phytonematicide were highly significant on dry shoot mass in Experiment 1 and stem diameter in Experiment 2, contributing 60 and 67% in TTV of the respective variables. Relative to untreated control, Nemafric-BL phytonematicide reduced dry shoot mass by 28% and increased stem diameter by 11% in Experiment 1 and Experiment 2, respectively. The AL × BL interaction had significant effects (P ≤ 0.05) on P, contributing 57% in TTV of the variable in Experiment 1. Relative to untreated control, the interaction increased P by 12%. In Experiment 2, the interaction had significant effects (P ≤ 0.05) on K, Mg, S and Mn, contributing 78, 65, 74 and 68% in TTV of the respective variables. Using a two-way matrix, relative to untreated control, the interaction increased K by 8%, but reduced Mg, Mn and S by 14, 82 and 1%, respectively. Nemarioc-AL phytonematicide was not significant in both the xxvi experiments, whereas Nemafric-BL phytonematicide had significant effects on Mg in Experiment 1, contributing 68% in TTV of the variable. Relative to untreated control, Nemafric-BL phytonematicide increased Mg by 15%. In conclusion, the interaction of Nemarioc-AL and Nemafric-BL phytonematicides were not compatible with each other as they had undesirable effects on growth of tomato plants and accumulation of most essential nutrient elements in leaf tissues of this plant.
National Research Foundation (NRF)

Thesis (M. A. Agriculture (Plant Protection)) -- University of Limpopo, 2019
The influence of cultural practices can be modified by environmental conditions such as container-type or positioning. The objective of the study was to determine whether container-type and positioning would have an influence on the growth of tomato plants and suppression of Meloidogyne javanica exposed to biomuti (Trial 1) and Afrikelp (Trial 2). Different container-types were filled with approximately 10.4 L growing mixture comprising steam-pasteurised sandy loam soil and Hygromix-T at 3:1 (v/v) ratio. The containers were established in microplots at 0.6 m × 0.6 m spacing, with treatments being brown pot-below; brown pot-above, black pot-below, black pot-above, plastic bag-above and plastic bag-below. Tomato (Solanum lycopersicum L.) cv. 'Floradade' seedlings were each transplanted and irrigated with 500 ml chlorine-free tapwater every other day. Seven days after transplanting, each plant was inoculated with 2000 eggs and second-stage juveniles (J2) of M. javanica. Biomuti and Afrikelp, obtained from the Agricultural Research Council (ARC) Vegetable, Ornamentals and Plants (VOP), were applied in separate trials weekly at 2.5%. At 56 days after inoculation, plant growth including selected nutrient elements and nematode variables were measured. Data were subjected to analysis of variance, with separation of means achieved using Fisher’s Least Significant Difference test at the probability level of 5%. In the biomuti trial, container-type and positioning had a significant effect on plant height, fruit number, dry root mass, dry shoot mass and fruit mass, contributing 82, 48, 44, 85 and 89% in total treatment variation (TTV) of the respective variables. Relative to brown pot-below; black pot above, plastic bag-above and brown pot-above reduced plant variables, whereas treatment effects were not significant on nematode variables. In the Afrikelp trial, trends where similar to those in biomuti, treatments had highly significant effects on xvi plant height, dry root mass, dry shoot mass and gall rating, contributing 91, 88, 66 and 60% in TTV of the respective variables. Relative to brown pot-below; black pot above, plastic bag-above and brown pot-above reduced the plant variables, but had no significant effects on nematode variables. Generally, plastic bags and polyethylene pots below-ground improved most plant growth variables when compared to those in containers positioned above-ground.

Thesis (M.Sc. (Horticulture)) -- University of Limpopo, 2019
Tomato (Solanum lycopersicum L.) is one of the most popular and widely consumed vegetable crops all over the world. They play a vital role in human diet and good sources of vitamins and minerals. However, low soil fertility is a major challenge to vegetable crops production for growers in Africa. Soils in the arid and semi-arid regions like South Africa have little nutrient and mineral contents, which adversely affect plant growth and quality. Therefore, the objectives of the study were to determine the effects of sole and combined applications of Effective Microorganisms enriched compost, broiler manure and inorganic (NPK) fertiliser applications, on growth and yield of three tomato varieties and to assess the influence of the applied fertiliser on nutritional composition of three tomato varieties. Field experiments were conducted at Horticultural skill centre, University of Limpopo (Mankweng), and at Mphebatho farm, Apel, Limpopo province, South Africa. The experiment was laid out in a 7 x 3 split-plot design. Recommended amount of organic and inorganic fertilisers was used. The treatments were: control (without fertiliser application), NPK (2:3:4(30) at a rate of 200 N ha-1, 260 P ha-1 and 257 K ha-1, applied as N from Urea, P from superphosphate and K from potassium chloride (KCl), mineralised broiler manure (10 000 kg ha-1), ½ NPK + ½ broiler manure rates, EM enriched compost (14 m3 ha-1), ½ EM compost + ½ NPK rates, and ½ EM compost + ½ broiler manure rates. Three tomato varieties (Floradade, Roma and Moneymaker) seedlings were transplanted using standard spacing of 30 x 60 cm. Chlorophyll contents of leaves, biomass production, plant height, fruit number, stem diameter and branch number were determined after six weeks of transplanting and fortnightly thereafter. The interactions between tomato varieties and fertiliser materials with regard to plant height were not significant (P ≤ 0.05) at both sites (Apel and Mankweng). Average plant height (63.75 cm) obtained in Moneymaker grown in EM compost treatment was significantly highest at Apel, for Floradade (42.25 cm) in broiler manure treatment while that of Roma variety (39.63 cm) was found in ½ EM compost + ½ NPK treatment at 8 WAT. Similar trend was also recorded at 10 WAT. For Mankweng the significantly (P ≤ 0.05) highest average plant height at 8 WAT (66.63 cm) was obtained in Moneymaker grown in ½ broiler manure + ½ NPK treatment for Floradade (45.63 cm) obtained in broiler manure treatment, and 44.50 cm recorded for Roma in broiler manure treatment. Similar trend was also followed at 10 WAT. At vi Apel, significantly highest average number of tomato fruits at 8, 10 and 12 WAT were recorded in treatment with ½ EM + ½ NPK while the least values were found in control. Whereas at Mankweng the variation in number of tomato fruits under different fertiliser treatments were not significant. Similar, non-significant interactions (V x F) for tomato shoot nutritional composition were found in tomato grown at both sites (Apel and Mankweng) in relation to fertiliser treatments. At Apel however, comparing the fertiliser treatments, tomato grown in soil treated with ½ broiler manure + ½ NPK had the significantly highest average (3.01 %) K content while the least value (2.65 %) was obtained in the control. Similarly, significantly highest mean (44.33 mg kg-1) Zn was found in crops grown in the same treatment, but the lowest significant value (36.50 mg kg-1) was obtained in ½ EM + ½ NPK treatment. For Mn and Fe contents in tomato significantly highest mean values (150.17 mg kg-1 and 2381 mg kg-1) for Mn and Fe respectively were found in sole broiler manure treatment while the least values 114.83 mg kg-1 and 1357.6 mg kg-1 for Mn and Fe respectively were found in ½ EM + ½ NPK and sole NPK treatments respectively. It may be concluded that in tomato production, combined application of organic and inorganic sources of nutrients can be more beneficial and can be adopted by smallholder farmers with limited resources.
DAFF Zero hunger

碩士
國立嘉義大學
農業生物技術研究所
97
Abstract Genetic mapping is a powerful strategy to determinate the location of genes on chromosomes via the usage of molecular marker systems and segregation populations. Initially the mapping informations show that the level of linkage relationship between markers and trait of interest can be established. According to the results, the markers linked to specific traits can be used for further map-based cloning to obtain the target gene. In addition, the linked information also can be immediately used for marker-assisted selection in traditional breeding to accelerate its efficiency due to rapid, convenient, and large-scale selection at any growth stage of plants. So far, there are some commonly-used polymorphism-detecting systems for mapping usage including of restriction fragment length polymorphisms (RFLP), amplified fragment length polymorphism (AFLP), random amplified polymorphic DNA (RAPD) and simple sequence length polymorphism (SSLP). The goal of this experiment is to identify molecular markers linked with heat-tolerant traits. Based on previous studies, 5 SSR markers were used for marker-assisted selection and distinguished tomato lines into two catalogues of heat-tolerant and –sensitive lines. Otherwise, the AFLP method with 100 primer combinations was initially used to detect polymorphism difference among two parental lines and F1 plants, then selected 41 primer combinations of them were used to detect molecular polymorphism among 65 individuals in a F2 population.

Thesis (M.A. Agricultural Management (Plant Production)) -- University of Limpopo, 2015
Tomato (Solanum lycopersicum L.) production had been ranked as the most important commodity in terms of job and wealth creation within the auspices of the National Development Plan (NDP) framework in Limpopo Province. However, soil-borne diseases including plant-parasitic nematodes preclude the successful monoculturing of this commodity and therefore inducing instability in job creation. Generally, after growing a tomato crop for one season in commercial tomato-production systems, the land is being fallowed for 3-5 years under natural grasses. Attempts are being initiated to ensure that during the 3-5 years the land be occupied by an economic alternative crop in order to level off job instability as broadly articulated in the NDP framework. The production of sweet stem sorghum (Sorghum bicolor L.) for ethanol production during the 3-5 years fallowing period could potentially be attractive to commercial tomato-producing famers. Preliminary agronomic evaluations demonstrated that sweet stem sorghum var. ndendane-X1 had attributes to fulfil the identified need. However, the degree of nematode resistance of the variety to Meloidogyne incognita race 2 and M. javanica, which are dominant in Limpopo Province, along with the compatibility of var. ndendane-X1 to phytonematicides used in tomato production had not been documented. The objectives of the study were, therefore, to determine whether sweet stem sorghum var. ndendane-X1: (1) had any degree of nematode resistance to M. incognita race 2 under both greenhouse and microplot conditions, (2) had any degree of nematode resistance to M. javanica under greenhouse conditions, and (3) would be compatible with phytonematicides used in suppression of population densities of xiv Meloidogyne species in tomato production under field conditions. In the greenhouse trials, seeds were sown in 20-cm-diameter plastic pots and each seedling inoculated with 0, 600, 1 000, 1 400, 1 800 and 2 200 eggs and second-stage juveniles (J2s) of M. incognita race 2 or M. javanica. Treatments were arranged in a randomised complete block design (RCBD), with 10 replicates (n = 60). In the microplot trial, seeds were sown in 30-cm-diameter plastic pots and buried 75% deep in a 0.30-m intra-row and 0.25-m inter-row spacing. Treatments, namely, 0, 200, 600, 1 000, 1 400, 1 800 and 2 200 J2s of M. incognita race 2 were arranged in RCBD, with 14 replications (n = 98). In a Meloidogyne-infested field trial, seeds were sown at 0.2-m inter-row and 0.3-m intra-row spacing, with treatments 0, 2, 4, 6, 8 and 10 g nemafric-BG phytonematicide/plant, arranged in RCBD, with 13 replications (n = 78). The degree of nematode resistance was measured using host-status and host-sensitivity, which provide information on reproduction of the target nematode and plant damage due to nematode infection, respectively. Nematode reproduction was measured through the reproductive factor (RF), which is a proportion of final nematode population density (Pf) to initial nematode population density (Pi), summarised as RF = Pf/Pi. In all nematode resistance trials, RF was equivalent to zero, which implied that var. ndendane-X1 was a non-host to both M. incognita race 2 and M. javanica. Additionally, in both greenhouse and microplot trials, sweet stem sorghum var. ndendane-X1 did not suffer any significant damage due to infection by Meloidogyne species. Using nematode-plant relation concepts, sweet stem sorghum var. ndendane-X1 was resistant to M. incognita race 2 and M. javanica under greenhouse and microplot conditions. Under field conditions, nemafric-BG phytonematicide reduced eggs and J2s of Meloidogyne species in root and soil samples xv by 76-85% and 24-65%, respectively, without nematode effect on plant growth, suggesting that nemafric-BG could be integrated with nematode resistance in var. ndendane-X1 to manage nematode population densities. In conclusion, pilot projects where sweet stem sorghum var. ndendane-X1 could be used during the 3-5 years fallowing period in a tomato-sweet stem sorghum crop rotation system should be established to assess: (i) the economics of the proposed cropping system, (ii) the effect of the cropping system on soil-borne diseases, including plant-parasitic nematodes, and (iii) the effect of the cropping system on soil health.