To see the other types of publications on this topic, follow the link: Torquay United A.F.C.
Journal articles on the topic 'Torquay United A.F.C'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Torquay United A.F.C.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Milus, E. A., E. Seyran, and R. McNew. "Aggressiveness of Puccinia striiformis f. sp. tritici Isolates in the South-Central United States." Plant Disease 90, no. 7 (July 2006): 847–52. http://dx.doi.org/10.1094/pd-90-0847.
Full textAbstract:
Although stripe rust, caused by Puccinia striiformis f. sp. tritici, has been an occasional problem on wheat in the south-central United States from 1941 until 1999, the disease has been consistently severe in the region since 2000. Furthermore, since 2000, the geographic range of stripe rust in the eastern United States has expanded, and the old population of races has been replaced by a new population. The objective of this study was to determine whether new isolates of the pathogen were more aggressive and better adapted to warmer temperatures than old isolates. In all, 6 old isolates (collected before 2000) and 14 new isolates (collected since 2000) were evaluated at 12 and 18°C for latent period on wheat seedlings and urediniospore germination on Noble agar. At 12°C, old and new isolates had similar latent periods and spore germination percentages. However, at 18°C, new isolates averaged 2 days less for latent period and double the spore germination compared with old isolates. Therefore, the new isolates are better adapted and, thus, more aggressive at warmer temperatures than the old isolates. These differences may have contributed to the severity of recent epidemics in the region and to the expanded geographic range for stripe rust.
2
Brar, G. S., and H. R. Kutcher. "Race Characterization of Puccinia striiformis f. sp. tritici, the Cause of Wheat Stripe Rust, in Saskatchewan and Southern Alberta, Canada and Virulence Comparison with Races from the United States." Plant Disease 100, no. 8 (August 2016): 1744–53. http://dx.doi.org/10.1094/pdis-12-15-1410-re.
Full textAbstract:
Wheat stripe rust, caused by Puccinia striiformis f. sp. tritici, has been common across Saskatchewan, Canada since 2000. Fifty-nine isolates of P. striiformis f. sp. tritici, the majority of which were collected between 2011 and 2013 from Saskatchewan and southern Alberta, were analyzed for virulence frequency and diversity and compared with isolates characterized in the Pacific Northwest and Great Plains regions of the United States. In all, 31 wheat differentials, including 20 near-isogenic lines and 1 triticale variety, differentiated 59 P. striiformis f. sp. tritici isolates into 33 races, of which one race, C-PST-1, represented 31% of the isolates. None of the races were virulent on Yr5, Yr15, or YrSP. Virulence frequency ranged from 65 to 98% on YrA, Yr2, Yr8, Yr9, Yr27, Yr29, Yr32, YrSu, ‘Heines VII’, and ‘Nord Deprez’. Race C-PST-6 was virulent on the greatest number of the differentials (n = 25) and C-PST-18 on the fewest (n = 14). Discriminant analysis of principal components and multivariate cluster analyses detected three and four major groups, respectively, which differed from each other in terms of virulence spectrum and year of collection. The diversity of the P. striiformis f. sp. tritici population in southern Alberta was greater than in Saskatchewan, which indicated that, although P. striiformis f. sp. tritici is primarily windborne over great distances and does not usually overwinter, there are detectable differences in virulence between these regions of western Canada. Comparative analyses of virulence frequency of Saskatchewan or southern Alberta isolates with isolates representing races from the Great Plains and the Pacific Northwest of the United States indicated greater similarity of Saskatchewan races to the Great Plains despite strong correlations with both parts of the United States. This suggests that the P. striiformis f. sp. tritici population in Saskatchewan is a mixture of inoculum from both parts of the United States.
3
Lopes, Maria. "C. F. Hartt's Contribution to Brazilian Museums of Natural History." Earth Sciences History 13, no. 2 (January 1, 1994): 174–79. http://dx.doi.org/10.17704/eshi.13.2.v747x4571u0472k5.
Full textAbstract:
Charles Frederic Hartt (1840-1878), a geologist who took part in Louis Agassiz's Thayer Expedition in 1865, returned to Brazil several times during his life: a solo trip in 1867, two of his own expeditions (while he was professor of geology at Cornell University), the Morgan Expeditions of 1870 and 1871, and his final voyage, which started in 1874. Hartt is known for his opposition to Agassiz's glacial theory of the Amazon River basin, for his contributions to Brazilian geological knowledge, and for his rôle in the Geological Commission of Brazil. Lesser known are his contributions and links to Brazilian Natural History Museums, institutions which played an important and lasting role in the development of geological sciences in Barizl. In Brazil, Hartt combined enthnographical work with his geological explorations, and he continued the ethnographical work initiated by Domingos Soares Ferreira Penna, a naturalist from Rio de Janeiro Museu Nacional who later became the director of Museu Paraense. When the Museu Paraense opened in 1871, Hartt donated books and what became the museum's first geological collections: both North American samples and samples which Hartt had collected in the Amazon region, some of which were sent to the United States to be classified and then returned to Brazil. From 1876 to 1877, Hartt was employed by the Museu Nacional as head of the 3rd Section-Physical Sciences, Mineralogy, Geology and Paleontology, a position which enhanced his research, collecting, and his conferences. Even though Hartt had a three-year contract, he resigned after one year to devote all of his energies to the Comissão Geológica do Imperio do Brasil, the geological survey of Brazil which he directed. Despite his short official connection with the museum in Rio, Hartt's activities with Brazilian museums provide insight into the issues relating to the transfer and adaptation of institutional models from one country to another.
4
McKeever, David. "EVOLVING INTERPRETATION OF MULTILATERAL TREATIES: ’ACTS CONTRARY TO THE PURPOSES AND PRINCIPLES OF THE UNITED NATIONS’ IN THE REFUGEE CONVENTION." International and Comparative Law Quarterly 64, no. 2 (March 31, 2015): 405–44. http://dx.doi.org/10.1017/s0020589315000032.
Full textAbstract:
AbstractThe 1951 Refugee Convention does not apply to a person with respect to whom there are serious reasons for considering that ‘he has been guilty of acts contrary to the purposes and principles of the United Nations’ (Article 1(F)(c)). To date, this exclusion clause has generally been interpreted by courts, commentators and UNHCR in a static manner which fails to take into account developments in international law and practice. This paper considers the ‘evolutive approach’ to treaty interpretation, generally, and applies this approach, alongside standard rules of treaty interpretation, to Article 1(F)(c). This paper challenges a number of assertions commonly made regarding this clause, and concludes that it should be interpreted to the effect that conduct amounting to serious or sustained human rights violations, such that would constitute ‘persecution’ for the purposes of Article 1(A)(2) of the Convention, meets the standard for exclusion under Article 1(F)(c).
5
Warren, Jaimie M., and Sarah F. Covert. "Differential Expression of Pine and Cronartium quercuum f. sp. fusiforme Genes in Fusiform Rust Galls." Applied and Environmental Microbiology 70, no. 1 (January 2004): 441–51. http://dx.doi.org/10.1128/aem.70.1.441-451.2004.
Full textAbstract:
ABSTRACT Cronartium quercuum f. sp. fusiforme is the causative agent of fusiform rust disease of southern pines in the United States. This disease is characterized by the formation of woody branch and stem galls. Differential display was used to identify pine genes whose expression is altered by C. quercuum f. sp. fusiforme infection and to identify C. quercuum f. sp. fusiforme genes that are expressed in fusiform rust galls. Six pine cDNAs that appeared to be differentially expressed in galled and healthy stems and 13 C. quercuum f. sp. fusiforme cDNAs expressed in galled tissues were identified. A probe that hybridizes specifically to C. quercuum f. sp. fusiforme 18S rRNA was used to estimate that 14% of the total RNA in fusiform rust galls was from C. quercuum f. sp. fusiforme. This finding was used to calibrate gene expression levels in galls when comparing them to expression levels in uninfected pines or in isolated C. quercuum f. sp. fusiforme cultures. According to Northern analysis and reverse transcriptase PCR analysis, all six of the pine clones were expressed at lower levels in galls than in healthy tissues. Seven of the nine C. quercuum f. sp. fusiforme clones that were assayed were expressed at higher levels in galls than in axenic culture. A number of the cDNAs encode proteins that are similar to those that play roles in plant development, plant defense, or fungal stress responses.
6
Lam, David K. "Revisiting the Separate Products Issue: United States v. Microsoft Corp., 147 F. 3d 935 (D. C. Cir. 1998)." Yale Law Journal 108, no. 6 (April 1999): 1441. http://dx.doi.org/10.2307/797333.
Full text
7
Davies, John G. "United States v. Stacey C. Koon, 833 F. Supp. 769 (C.D. Cal. 1993) (1993 U.S. Dist. LEXIS 17926)." Federal Sentencing Reporter 7, no. 4 (January 1, 1995): 205–8. http://dx.doi.org/10.2307/20639791.
Full text
8
Fletcher, Betty B. "United States v. Stacey C. Koon, 34 F.3d 1416 (9th Cir. 1994) (1994 U.S. App. LEXIS 22588)." Federal Sentencing Reporter 7, no. 4 (January 1, 1995): 209–13. http://dx.doi.org/10.2307/20639792.
Full text
9
Pedrozo, R., and C. R. Little. "First Report of Seedborne Fusarium thapsinum and its Pathogenicity on Soybean (Glycine max) in the United States." Plant Disease 98, no. 12 (December 2014): 1745. http://dx.doi.org/10.1094/pdis-08-14-0806-pdn.
Full textAbstract:
A three-year survey from 2010 to 2012 was conducted in Kansas to investigate the identity and diversity of seedborne Fusarium spp. in soybean. A total of 408 soybean seed samples from 10 counties were tested. One hundred arbitrarily selected seeds from each sample were surface-sterilized for 10 min in a 1% sodium hypochlorite solution to avoid contaminants and promote the isolation of internal fusaria. Seeds were rinsed with sterile distilled water and dried overnight at room temperature (RT). Surface-sterilized seeds were plated on modified Nash-Snyder medium and incubated at 23 ± 2°C for 7 days. Fusarium isolates were single-spored and identified by morphological characteristics on carnation leaf agar (CLA) and potato dextrose agar (PDA) (3). From 276 seedborne Fusarium isolates, six were identified as F. thapsinum (2). On CLA, F. thapsinum isolates produced abundant mycelium and numerous chains of non-septate microconidia produced from monophialides. Microconidia were club-shaped and some were napiform. No chlamysdospores were found. On PDA, three of the isolates presented characteristic dark yellow pigmentation and three were light violet. Confirmation of the isolates to species was based on sequencing of an elongation factor gene (EF1-α) segment using primers EF1 and EF2 and the beta-tubulin gene using primers Beta1 and Beta2 (1). Sequence results (~680 bp, EF primers; ~600 bp, beta-tubulin primers) were confirmed by using the FUSARIUM-ID database (1). All isolates matched F. thapsinum for both genes sequenced (Accession No. FD01177) at 99% identity. Koch's postulates were completed for two isolates of F. thapsinum under greenhouse conditions. Soybean seeds (Asgrow AG3039) were imbibed with 2.5 × 105 conidia ml−1 for 48 h. After inoculation, seeds were dried for 48 h at RT. One isolate each of F. equiseti and F. oxysporum were used as the non-pathogenic and pathogenic inoculation controls, respectively. In addition, non-inoculated seeds and seeds imbibed in sterile distilled water (mock) were also used. Twenty-five seeds from each treatment were planted in pots (500 ml) with autoclaved soil and vermiculite (1:1). The experiment was a completely randomized design with three replicates (pots) per isolate. The entire experiment was repeated three times. After 21 days, aggressiveness of both F. thapsinum isolates was assessed using initial stand (%), final stand (%), and seed mortality (% of non-germinated seeds). Both seedborne F. thapsinum isolates caused reduced emergence and final stand, and increased seedling mortality when compared to the non-inoculated and F. equiseti controls (P< 0.0001). No significant difference was observed between F. thapsinum isolates and F. oxysporum. F. thapsinum isolates were re-isolated from wilted seedlings and non-germinated seeds, but not from the control treatments. Typically, F. thapsinum is considered a pathogen of sorghum, but it has also been recovered from bananas, peanuts, maize, and native grasses (3). However, its presence on soybean plant tissues and its pathogenicity has never been reported. To our knowledge, this is the first report of seedborne F. thapsinum and its pathogenicity on soybean in the United States. References: (1) D. M. Geiser et al. Eur. J. Plant Pathol. 110:473, 2004. (2) C. J. R. Klittich et al. Mycologia 89:644, 1997. (3) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Oxford, UK, 2006.
10
Gonzalez-Redondo, JM, TA Stoming, KD Lanclos, YC Gu, A. Kutlar, F. Kutlar, T. Nakatsuji, B. Deng, IS Han, and VC McKie. "Clinical and genetic heterogeneity in black patients with homozygous beta-thalassemia from the southeastern United States." Blood 72, no. 3 (September 1, 1988): 1007–14. http://dx.doi.org/10.1182/blood.v72.3.1007.1007.
Full textAbstract:
Abstract The presence of various substitutions and deletions resulting in beta- thalassemia was studied in 19 black patients with homozygous beta- thalassemia and in numerous relatives; all patients were from Georgia, South Carolina, and Alabama. Methodology included gene mapping, amplification of genomic DNA with Taq polymerase, identification of known nucleotide substitutions or a single nucleotide deletion through hybridization with synthetic oligonucleotides, cloning and sequencing of a beta-globin gene, and sequencing of amplified genomic DNA. Of the 38 chromosomes tested, 21 (55%) had the A----G substitution at nt -29, eight (21%) had the C----T substitution at nt -88, three (8%) had the substitution at codon 24, while one each of the following abnormalities were also detected: frameshift at codon 6, a C----A mutation at nt 848 of the beta IVS-II (new), an A----T mutation at codon 61 (new), a deletion of 1.35 kilobases including the 5′ end of beta, a Ggamma(Agammadelta beta) degree-thalassemia, and one thalassemia determinant that remained unidentified. The C----A mutation at nt 848 of IVS-II occurred at a position 3 nucleotides 5′ to the third exon, adjacent to the invariant AG dinucleotide of the acceptor sequence. The A----T mutation in codon 61 (AAG----TAG) resulted in the creation of a stop codon and thus in beta degree-thalassemia. The various mutations occurred on chromosomes with different haplotypes; however, chromosomes with a specific mutation but with different haplotypes belonged to one specific framework, which suggested that crossovers were responsible for these different types. Hemoglobin (Hb) F levels were generally high (55% to 75% with 98.5% in one patient with beta degree/beta degree); a few patients with specific haplotypes and an alpha-thalassemia-2 heterozygosity had a lower Hb F level. The Ggamma in the Hb F was consistently high when the C----T mutation occurred at nt -158 to the Cap site of the Ggamma-globin gene; seven patients with +/+ at this site had an average Ggamma of 73.8%, eight patients with +/- had 64.8%, and one patient with -/- had 34.2%. Variations in hematologic values and in Hb F, Ggamma, and Hb A2 levels of relatives with a beta- thalassemia heterozygosity depended to some extent on the types of mutations or deletions and on the haplotypes of the chromosomes with the beta-thalassemia determinant.
11
Gonzalez-Redondo, JM, TA Stoming, KD Lanclos, YC Gu, A. Kutlar, F. Kutlar, T. Nakatsuji, B. Deng, IS Han, and VC McKie. "Clinical and genetic heterogeneity in black patients with homozygous beta-thalassemia from the southeastern United States." Blood 72, no. 3 (September 1, 1988): 1007–14. http://dx.doi.org/10.1182/blood.v72.3.1007.bloodjournal7231007.
Full textAbstract:
The presence of various substitutions and deletions resulting in beta- thalassemia was studied in 19 black patients with homozygous beta- thalassemia and in numerous relatives; all patients were from Georgia, South Carolina, and Alabama. Methodology included gene mapping, amplification of genomic DNA with Taq polymerase, identification of known nucleotide substitutions or a single nucleotide deletion through hybridization with synthetic oligonucleotides, cloning and sequencing of a beta-globin gene, and sequencing of amplified genomic DNA. Of the 38 chromosomes tested, 21 (55%) had the A----G substitution at nt -29, eight (21%) had the C----T substitution at nt -88, three (8%) had the substitution at codon 24, while one each of the following abnormalities were also detected: frameshift at codon 6, a C----A mutation at nt 848 of the beta IVS-II (new), an A----T mutation at codon 61 (new), a deletion of 1.35 kilobases including the 5′ end of beta, a Ggamma(Agammadelta beta) degree-thalassemia, and one thalassemia determinant that remained unidentified. The C----A mutation at nt 848 of IVS-II occurred at a position 3 nucleotides 5′ to the third exon, adjacent to the invariant AG dinucleotide of the acceptor sequence. The A----T mutation in codon 61 (AAG----TAG) resulted in the creation of a stop codon and thus in beta degree-thalassemia. The various mutations occurred on chromosomes with different haplotypes; however, chromosomes with a specific mutation but with different haplotypes belonged to one specific framework, which suggested that crossovers were responsible for these different types. Hemoglobin (Hb) F levels were generally high (55% to 75% with 98.5% in one patient with beta degree/beta degree); a few patients with specific haplotypes and an alpha-thalassemia-2 heterozygosity had a lower Hb F level. The Ggamma in the Hb F was consistently high when the C----T mutation occurred at nt -158 to the Cap site of the Ggamma-globin gene; seven patients with +/+ at this site had an average Ggamma of 73.8%, eight patients with +/- had 64.8%, and one patient with -/- had 34.2%. Variations in hematologic values and in Hb F, Ggamma, and Hb A2 levels of relatives with a beta- thalassemia heterozygosity depended to some extent on the types of mutations or deletions and on the haplotypes of the chromosomes with the beta-thalassemia determinant.
12
Seal, Bruce S. "Avian pneumoviruses and emergence of a new type in the United States of America." Animal Health Research Reviews 1, no. 1 (June 2000): 67–72. http://dx.doi.org/10.1017/s1466252300000062.
Full textAbstract:
AbstractAvian pneumovirus (APV) primarily causes an upper respiratory disease recognized as turkey rhinotracheitis (TRT) or swollen head syndrome (SHS) in chickens. The virus was first isolated in South Africa during the early 1970s and has subsequently been reported in Europe, Asia and South America. In February 1997, a serologically distinct APV isolate was officially reported in the USA following an outbreak of TRT during the previous year. This was the first report of these virus types in the USA; they were previously considered exotic to the USA and Canada. The predicted matrix (M) proteins of European APV type A and B isolates share 89% identity in their amino acid sequence. However, the predicted M protein of APV/CO is only 78%similar to the APV type A and 77% similar to the APV type B protein sequence. The predicted amino acid sequence of the US APV isolate's fusion (F) protein has 72% sequence identity to the F protein of APV type A and 71%sequence identity to the F protein of type B. This compares with the 83%sequence identity between the predicted amino acid sequences of the F proteins of APV types A and B. The lack of sequence heterogeneity among the US APV isolates over 2 years suggests that these viruses have maintained a relatively stable population since the first outbreak of TRT. Phylogenetic analysis of the M and F proteins, together with the serological uniqueness of the US APV isolates, supports their classification as a new APV, designated type C.
13
Menze, Roger, Mary Jo McMullen, Lynn J. White, and James M. Dougherty. "Core Temperature Monitoring of Firefighters During Hazardous Materials Training Sessions." Prehospital and Disaster Medicine 11, no. 2 (June 1996): 108–11. http://dx.doi.org/10.1017/s1049023x00042746.
Full textAbstract:
AbstractObjective:To determine core temperature (Tc) elevations in hazardous materials (HazMat) technicians wearing level-A fully encapsulated, chemically resistive suits (FECRSs) during training scenarios.Design:Cross-sectional, observational feasibility study with Institutional Review Board approval.Setting:HazMat training scenarios held during the summer of 1994. Weather conditions included both rainy and sunny days, with a mean ambient temperature of 75.8°F(24.3°C) (range 69–83° F [20.6–28.3°C).Participants:Nine male firefighters participating in training scenarios in the Midwestern United States.Interventions:Each volunteer swallowed a capsule containing a Tc sensor developed by the National Aeronautics and Space Administration. The capsule continuously monitored Tc and stored data in an ambulatory recorder worn under the level-A FECRS during training.Results:Mean age of the volunteers was 34 years, mean weight was 92.6 kg, and average baseline Tc was 36.7°C (97.1°F) (range 35.3–38.2°C [95.5–100°F]). Time in the FECRS averaged 25.4 minutes (range 14–35 minutes). All subjects demonstrated increased Tc while in the suit; the mean Tc increase was 0.8°C (1.4°F) (range 0.2–1.3°C [0.4–2.3°F]). The Tc continued to increase during wet decontamination procedures and after suit removal. Mean heat storage values (ΔTcx LBMx 3.47 kJ) were calculated, and found to be moderately elevated to 3.6 kJ/kg (range 2.1–4.6 kJ/kg).Conclusion:These observations support the validity and significance of implementing prophylactic measures for firefighters using protective clothing. Simple protective measures include enforced time limitations, hydration, and efforts to minimize heat buildup by avoiding both direct sunlight and unnecessary time encapsulated in the suit.
14
Ma, Wu, Grant M. Domke, Christopher W. Woodall, and Anthony W. D’Amato. "Land Use Changes, Disturbances, and Their Interactions on Future Forest Aboveground Biomass Dynamics in the Northern US." Forests 10, no. 7 (July 23, 2019): 606. http://dx.doi.org/10.3390/f10070606.
Full textAbstract:
Land use change (LUC), disturbances, and their interactions play an important role in regional forest carbon (C) dynamics. Here we quantified how these activities and events may influence future aboveground biomass (AGB) dynamics in forests using national forest inventory (NFI) and Landsat time series data in the Northern United States (US). Total forest AGB predictions were based on simulations of diameter growth, mortality, and recruitment using matrix growth models under varying levels of LUC and disturbance severity (low (L), medium (M), and high (H)) every five years from 2018 to 2098. Land use change included the integrated effects of deforestation and reforestation/afforestation (forest [F]→agriculture [A], settlements [S, urbanization/other], and A&S→F), specifically, conversion from F→A, F→S, F→A&S, A→F, S→F, and A&S→F. Disturbances included natural and anthropogenic disturbances such as wildfire, weather, insects and disease, and forest harvesting. Results revealed that, when simultaneously considering both medium LUC and disturbances, total forest AGB predictions of LUC + fire, LUC + weather, LUC + insect & disease, and LUC + harvest indicated substantial increases in regional C stocks (± standard deviation) from 1.88 (±0.13) to 3.29 (±0.28), 3.10 (±0.24), 2.91 (±0.19), and 2.68 (±0.17) Pg C, respectively, from 2018 to 2098. An uncertainty analysis with fuzzy sets suggested that medium LUC under disturbances would lead to greater forest AGB C uptake than undisturbed forest C uptake with high certainty, except for LUC + harvest. The matrix models in this study were parameterized using NFI and Landsat data from the past few decades. Thus, our results imply that if recent trends persist, LUC will remain an important driver of forest C uptake, while disturbances may result in C emissions rather than undisturbed forest C uptake by 2098. The combined effects of LUC and disturbances may serve as an important driver of C uptake and emissions in the Northern US well into the 21st century.
15
POUILLOT, RÉGIS, WAYNE SCHLOSSER, JANE M. VAN DOREN, SHERRI B. DENNIS, and JANELL R. KAUSE. "Assessment of the Risk of Salmonellosis Linked to the Consumption of Liquid Egg Products Made from Internally Contaminated Shell Eggs Initially Stored at 65°F (18°C) Compared with Eggs Stored at 45°F (7°C)." Journal of Food Protection 83, no. 5 (April 14, 2020): 767–78. http://dx.doi.org/10.4315/0362-028x.jfp-19-376.
Full textAbstract:
ABSTRACT According to the U.S. Food and Drug Administration's (FDA's) rule on “Prevention of Salmonella Enteritidis in Shell Eggs during Production, Storage, and Transportation,” shell eggs intended for human consumption are required to be held or transported at or below 45°F (7.2°C) ambient temperature beginning 36 h after time of lay. Meanwhile, eggs in hatcheries are typically stored at a temperature of 65°F (18.3°C). Although most of those eggs are directed to incubators for hatching, excess eggs have the potential to be diverted for human consumption as egg products through the “breaker” market if these eggs are refrigerated in accordance with FDA's requirement. Combining risk assessment models developed by the U.S. Department of Agriculture's Food Safety and Inspection Service for shell eggs and for egg products, we quantified and compared Salmonella Enteritidis levels in eggs held at 65°F versus 45°F, Salmonella Enteritidis levels in the resulting egg products, and the risk of human salmonellosis from consumption of those egg products. For eggs stored 5 days at 65°F (following 36 h at 75°F [23.9°C] in the layer house), the mean level of Salmonella Enteritidis contamination is 30-fold higher than for eggs stored at 45°F. These increased levels of contamination lead to a 47-fold increase in the risk of salmonellosis from consumption of egg products made from these eggs, with some variation in the public health risk on the basis of the egg product type (e.g., whole egg versus whole egg with added sugar). Assuming that 7% of the liquid egg product supply originates from eggs stored at 65°F versus 45°F, this study estimates an additional burden of 3,562 cases of salmonellosis per year in the United States. A nominal range uncertainty analysis suggests that the relative increase in the risk linked to the storage of eggs at higher temperature estimated in this study is robust to the uncertainty surrounding the model parameters. The diversion of eggs from broiler production to human consumption under the current storage practices of 65°F (versus 45°F) would present a substantive overall increase in the risk of salmonellosis. HIGHLIGHTS
16
Rowe, D. Bradley, Frank A. Blazich, Stuart L. Warren, and Thomas G. Ranney. "Seed Germination of Three Provenances of Rhododendron catawbiense: Influence of Light and Temperature." Journal of Environmental Horticulture 12, no. 3 (September 1, 1994): 155–58. http://dx.doi.org/10.24266/0738-2898-12.3.155.
Full textAbstract:
Abstract Seeds of three provenances of Rhododendron catawbiense Michx. (Catawba rhododendron) were collected during Fall 1992 from the following localities in the southeastern United States: Cherokee Co., GA [34°20′N, 84°23′W, elev. = 320 m (1050 ft)], Johnston Co., NC [35°45′N, 78°12′W, elev. = 67 m (220 ft)], and Yancey Co., NC [35°45′N, 82°16′W, elev. = 1954 m (6410 ft)]. Following drying for 1 month and storage at 4°C (39°F), seeds were removed from storage in January 1993 and germinated at 25°C (77°F) or an 8/16 hr thermoperiod of 25°/15°C (77°/59°F) with daily photoperiods of 0, ½, 1, 2, 4, 8, 12, or 24 hr. Regardless of temperature and provenance, seeds required light for germination. Negligible germination for all provenances in total darkness was overcome by daily photoperiods as short as ½ hr. All provenances commenced germination earlier at 25°C (77°F) than at 25°/15°C (77°/59°F). Mean germination at day 24 for both temperature treatments and for all photoperiods with the exception of total darkness was 98%, 90%, and 80% for the Yancey, Johnston, and Cherokee Co. provenances respectively. Light and temperature requirements for seed germination of all provenances were similar, although seeds of the higher elevation, Yancey Co. provenance exhibited greater vigor; they germinated at a faster rate with greater cumulative germination.
17
Yu, Jialin, Gary E. Vallad, and Nathan S. Boyd. "Evaluation of Allyl Isothiocyanate as a Soil Fumigant for Tomato (Lycopersicon esculentum Mill.) Production." Plant Disease 103, no. 11 (November 2019): 2764–70. http://dx.doi.org/10.1094/pdis-11-18-2013-re.
Full textAbstract:
Fusarium wilt (Fusarium oxysporum f. sp. lycopersici), root-knot nematodes (Meloidogyne spp.), and purple nutsedge (Cyperus rotundus L.) are among the most damaging soilborne pests for tomato (Lycopersicon esculentum Mill.) production in the southeastern United States. Allyl isothiocyanate (allyl ITC) was evaluated as a potential fumigant alternative for control of soilborne pathogens, nematodes, and weeds. Shank- or drip-injected allyl ITC at rates ranging from 221 to 367 kg ha−1 exhibited excellent performance, reducing the recovery of total F. oxysporum from treated soils. Shank- or drip-injected allyl ITC at 367 kg ha−1 provided equivalent control of C. rotundus compared with 1,3-dichloropropene + chloropicrin and metam potassium, respectively. Totally impermeable film (TIF) did not further reduce the recovery of F. oxysporum and various nematodes from soil treated with allyl ITC compared with virtually impermeable film (VIF). However, TIF mulch significantly improved C. rotundus control versus shank- or drip-injected allyl ITC treatments under VIF mulch. Overall, allyl ITC is an effective methyl bromide alternative against F. oxysporum, C. rotundus, and plant-parasitic nematodes Criconemella spp. and Hoplolaimus spp. in plasticulture tomato production.
18
Zaabi, Mouza Al, Syed Mahboob Shah, Mohamud Sheek-Hussein, Abdishakur Abdulle, Abdulla Al Junaibi, and Tom Loney. "Results From the United Arab Emirates’ 2016 Report Card on Physical Activity for Children and Youth." Journal of Physical Activity and Health 13, s2 (November 2016): S299—S306. http://dx.doi.org/10.1123/jpah.2016-0312.
Full textAbstract:
Background:The Active Healthy Kids 2016 United Arab Emirates (UAE) Report Card provides a systematic evaluation of how the UAE is performing in supporting and engaging physical activity (PA) in children and adolescents.Methods:The Active Healthy Kids Global Alliance framework and standardized set of procedures were used to perform the systematic assessment of PA in UAE youth and children. Indicator grades were based on the proportion of children and youth achieving a defined benchmark: A = 81% to 100%; B = 61% to 80%; C = 41% to 60%; D = 21% to 40%; F = 0% to 20%; INC = incomplete data.Results:Overall Physical Activity Level and Active Transportation both received a grade of D-/F-. Sedentary Behavior and Family and Peers both received a C- minus grade and School was graded D. Minus grades indicate PA disparities related to age, gender, nationality, socioeconomic status, and geographic location. Government Strategies and Investments received a B+ grade. Sport Participation, Active Play, and Community and the Built Environment were graded INC due to a lack of nationally representative data for all 7 emirates.Conclusions:The majority of UAE children are not achieving the daily recommended level of PA. The UAE leadership has invested significant resources into improving PA through school- and community-based PA interventions; however, inter- and intraemirate population-based strategies remain fragmented.
19
Panter, Karen L., Rebecca E. Ashley, Karin M. Guernsey, and Caroline M. Johnson. "Preliminary Studies on Propagation of Osha." HortTechnology 14, no. 1 (January 2004): 141–43. http://dx.doi.org/10.21273/horttech.14.1.0141.
Full textAbstract:
Osha (Ligusticum porteri) is a perennial plant native to the Rocky Mountain region of the United States and has been used as a medicinal herb to alleviate certain ailments caused by viruses, yeasts, and other microbes. It is generally harvested in the wild and is believed to be in danger of overharvest. The objectives of this study were to determine if osha could be grown successfully from seeds, seeds still attached to umbels, root cuttings, and/or vegetative crown cuttings. Seeds were harvested from the wild in Fall 2000. Roots were collected in May 2001. Seeds, either detached or attached to umbels, were given one of four treatments: 1) no stratification; 2) 6 weeks at 4.4 °C (40 °F); 3) 4 weeks each alternating 4.4 °C, then 12 hour 20.0 °C (68 °F) and 12 hours 30.0 °C (86 °F); or 4) 12 weeks at 4.4 °C. Roots were divided into crown cuttings, each containing a vegetative node, and were placed on a 21.1 °C (70 °F) mist propagation bench until rooted. Twelve weeks of stratification, whether seed was detached or attached to umbels, were beneficial for germination of osha seeds, but only gave about 11% emergence. Propagation from root cuttings was not successful. Propagation via vegetative crown cuttings was most successful, with 90% of cuttings rooting. Vegetative propagation of osha appears to be the most promising method, preferable over seed propagation.
20
Alarcon, Arthur L. "United States v. Nino C. Duarte, 901 F.2d 1498 (9th Cir. April 27, 1990) (1990 U.S. App. LEXIS 5453)." Federal Sentencing Reporter 3, no. 1 (June 1, 1990): 22–24. http://dx.doi.org/10.2307/20639265.
Full text
21
Bratton, Howard C. "United States v. Weslie C. Mays, 902 F.2d 1501 (10th Cir. May 7, 1990) (1990 U.S. App. LEXIS 7273)." Federal Sentencing Reporter 3, no. 2 (September 1990): 79–82. http://dx.doi.org/10.2307/20639287.
Full text
22
Contie,, Leroy J. "United States v. William C. Kemper, 908 F.2d 33 (6th Cir. July 19, 1990) (1990 U.S. App. LEXIS 12038)." Federal Sentencing Reporter 3, no. 4 (January 1, 1991): 188–91. http://dx.doi.org/10.2307/20639327.
Full text
23
Holloway,, William J. "United States v. Ernie C. Doyan, 909 F.2d 412 (10th Cir. July 24, 1990) (1990 U.S. App. LEXIS 12358)." Federal Sentencing Reporter 4, no. 1 (July 1, 1991): 15–18. http://dx.doi.org/10.2307/20639385.
Full text
24
Lloyd, Lorna. "C. Bridge, F. Bongiorno, and D. Lee (Eds) (2010).The High Commissioners. Australia's Representatives in the United Kingdom, 1910–2010." Diplomacy & Statecraft 22, no. 4 (December 2011): 742–44. http://dx.doi.org/10.1080/09592296.2011.625847.
Full text
25
Hansen, James D. "Effect of Cold Temperature Treatments on the Mortality of Eggs and Feeding Larvae of the Oriental Fruit Moth." HortTechnology 12, no. 2 (January 2002): 203–5. http://dx.doi.org/10.21273/horttech.12.2.203.
Full textAbstract:
Two cold storage treatments were evaluated against eggs, early instars, and late instars of the oriental fruit moth [Cydia molesta (Lepidoptera: Tortricidae)] a quarantine pest for Mexico of stone and pome fruit from the United States. In the first, `Delicious' apples (Malus domestica) were infested with these life stages and treated for 13 weeks in cold storage at 38 °F (3.3 °C) in replicated studies. In the second, the same life stages infesting `Delicious' apples were exposed to air temperatures slightly above freezing, 33.3 ± 0.7 °F (0.7 ± 0.4 °C), up to 7 weeks to simulate near commercial storage conditions. Weekly subsamples of the life stages were examined for survival. At 38 °F, complete mortality was obtained for eggs and early instars by the eighth week, and for late instars by the tenth week. At near freezing temperatures, eggs and early instars died by the fourth week, and late instars eliminated by the sixth week. This study demonstrated that the treatments were effective against the infesting life stages.
26
Gachango, E., W. Kirk, L. Hanson, A. Rojas, and P. Tumbalam. "First Report of Fusarium torulosum Causing Dry Rot of Seed Potato Tubers in the United States." Plant Disease 95, no. 9 (September 2011): 1194. http://dx.doi.org/10.1094/pdis-04-11-0291.
Full textAbstract:
Fusarium dry rot of potato (Solanum tuberosum L.) is a postharvest disease caused by several Fusarium species and is of worldwide importance. Thirteen species of Fusarium have been implicated in fungal dry rots of potatoes worldwide. Among them, eight species have been reported in the northern United States (2). In Michigan potato production, F. sambucinum was the predominant species reported to be affecting seed potato in storage and causing seed piece decay after planting (3). Some previous identifications of F. sambucinum as dry rot may have been F. torulosum since F. torulosum was previously classified within F. sambucinum (4). To further investigate this, dry rot symptomatic tubers were collected from Michigan seed lots in the summers of 2009 and 2010. Small sections from the margins of necrotic regions were cut with a scalpel, surface sterilized in 0.5% sodium hypochlorite for 10 s, rinsed twice in sterile distilled water, and blotted with sterile filter paper. The tissue pieces were plated on half-strength potato dextrose agar (PDA) amended with 0.5 g/liter of streptomycin sulfate and incubated at 23°C for 5 to 7 days. Cultures resembling Fusarium species were transferred onto water agar, and single hyphal tips from actively growing isolates were removed and plated either on carnation leaf agar (CLA) or on half-strength PDA to generate pure cultures. Among the Fusarium isolates obtained, five isolates were identified as F. torulosum (GenBank Accessions Nos. JF803658–JF803660). Identification was based on colony and conidial morphology on PDA and CLA, respectively. These features included slow growth (2.8 ± 0.2 cm in 5 days), white mycelium that became pigmented with age, narrow concentric rings, red or white pigmentation on agar, macroconidia (32.4 ± 0.4 μm average length) with five septa, a pointed apical cell, and a foot-shaped basal cell (4). The identity was confirmed through DNA extraction followed by amplification and sequencing of the translation elongation factor (EF-1α) gene region (1). The Fusarium-ID.v (1) and the NCBI database were used to obtain the closest match (99%) to previously sequenced materials (GenBank Accession No. AJ543611). Pathogenicity testing was done on disease-free potato tubers cv. Red Norland. Tubers were surface sterilized for 10 min in 0.5% sodium hypochlorite and rinsed twice in distilled water. Three tubers per isolate were injected with 20 μl of a conidial suspension (106 conidia/ml) made from F. torulosum cultures grown on PDA for 7 to 10 days. Control tubers were injected with 20 μl of sterile distilled water. All tubers inoculated with F. torulosum developed typical potato dry rot symptoms consisting of a brown and dry decay. There was no disease incidence on the control tubers. F. torulosum was reisolated from the symptomatic tubers. To our knowledge, this is the first report of F. torulosum causing potato dry rot in the United States. References: (1) D. Geiser et al. Eur. J. Plant Pathol. 110:473, 2004. (2) L. E. Hanson et al. Phytopathology 86:378, 1996. (3) M. L. Lacy and R. Hammerschmidt. Fusarium dry rot. Extension Bulletin. Retrieved from http://web1.msue.msu.edu/msue/iac/onlinepubs/pubs/E/E2448POT , 23 May 2010. (4) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Wiley-Blackwell, Hoboken, NJ, 2006.
27
Daly, Christopher, Mark P. Widrlechner, Michael D. Halbleib, Joseph I. Smith, and Wayne P. Gibson. "Development of a New USDA Plant Hardiness Zone Map for the United States." Journal of Applied Meteorology and Climatology 51, no. 2 (February 2012): 242–64. http://dx.doi.org/10.1175/2010jamc2536.1.
Full textAbstract:
AbstractIn many regions of the world, the extremes of winter cold are a major determinant of the geographic distribution of perennial plant species and of their successful cultivation. In the United States, the U.S. Department of Agriculture (USDA) Plant Hardiness Zone Map (PHZM) is the primary reference for defining geospatial patterns of extreme winter cold for the horticulture and nursery industries, home gardeners, agrometeorologists, and plant scientists. This paper describes the approaches followed for updating the USDA PHZM, the last version of which was published in 1990. The new PHZM depicts 1976–2005 mean annual extreme minimum temperature, in 2.8°C (5°F) half zones, for the conterminous United States, Alaska, Hawaii, and Puerto Rico. Station data were interpolated to a grid with the Parameter-Elevation Regressions on Independent Slopes Model (PRISM) climate-mapping system. PRISM accounts for the effects of elevation, terrain-induced airmass blockage, coastal effects, temperature inversions, and cold-air pooling on extreme minimum temperature patterns. Climatologically aided interpolation was applied, based on the 1971–2000 mean minimum temperature of the coldest month as the predictor grid. Evaluation of a standard-deviation map and two 15-yr maps (1976–90 and 1991–2005 averaging periods) revealed substantial vertical and horizontal gradients in trend and variability, especially in complex terrain. The new PHZM is generally warmer by one 2.8°C (5°F) half zone than the previous PHZM throughout much of the United States, as a result of a more recent averaging period. Nonetheless, a more sophisticated interpolation technique, greater physiographic detail, and more comprehensive station data were the main causes of zonal changes in complex terrain, especially in the western United States. The updated PHZM can be accessed online (http://www.planthardiness.ars.usda.gov).
28
Liu, H. Y., and J. L. Sears. "First Report of Pelargonium zonate spot virus from Tomato in the United States." Plant Disease 91, no. 5 (May 2007): 633. http://dx.doi.org/10.1094/pdis-91-5-0633b.
Full textAbstract:
Pelargonium zonate spot virus (PZSV) was first isolated from tomato in southern Italy in 1982 (1) and later was also reported from Spain (3) and France (2). Infected tomato plants showed stunting, malformation, yellow rings and line patterns on the leaves, and concentric chlorotic ringspots on the stems. In June of 2006, more than 100 tomato (Lycopersicon esculentum Mill.) plants exhibiting symptoms similar to PZSV were observed in seven acres of tomato fields in Yolo County, California. The causal agent was mechanically transmitted to several indicator species. Symptoms on infected plants included local lesions on Beta macrocarpa, Chenopodium amaranticolor, C. capitatum, C. quinoa, Cucumis melo, Cucurbita pepo, and Tetragonia expansa, and systemic infection on Capsicum annuum, Chenopodium murale, L. esculentum, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum, Physalis floridana, and P. wrightii. Two field-infected tomato plants and one each of the mechanically inoculated host plant were positive with double-antibody sandwich (DAS)-ELISA using a commercial PZSV IdentiKit (Neogen Europe Ltd., Ayr, Scotland, UK). Partially purified virions stained with 2% uranyl acetate contained spherical to ovate particles. The particle diameters ranged between 25 and 35 nm. Published sequences of PZSV (GenBank Accession Nos. NC_003649 for RNA1, NC_003650 for RNA2, and NC_003651 for RNA3) were used to design three sets of primer pairs specific for PZSV RNA1 (R1-F: 5′ TGGCTGGCTTTTTCCGAACG 3′ and R1-R: 5′ CCTAATCTGTTGGTCCGAACTGTC 3′), RNA2 (R2-F: 5′ GCGTGCGTATCATCAGAAATGG 3′ and R2-R: 5′ ATCGGGAGCAG AGAAACACCTTCC 3′), and RNA3 (R3-F: 5′ CTCACCAACTGAAT GCTCTGGAC 3′ and R3-R: 5′ TGGATGCGTCTTTCCGAACC 3′) for reverse transcription (RT)-PCR tests. Total nucleic acids were extracted from field-infected tomato plants and partially purified virions for RT-PCR. RT-PCR gave DNA amplicons of the expected sizes. The DNA amplicons were gel purified and sequenced. The sequenced amplicons had 92, 94, and 96% nt sequence identity to PZSV RNA1, RNA2, and RNA3, respectively. The symptomatology, serology, particle morphology, and nucleotide sequences confirm the presence of PZSV in a tomato field in California. To our knowledge, this is the first report of the occurrence of PZSV in the United States. References: (1) D. Gallitelli. Ann. Appl. Biol. 100:457, 1982. (2) K. Gebre-Selassie et al. Plant Dis. 86:1052, 2002. (3) M. Luis-Arteaga et al. Plant Dis. 84:807, 2000.
29
Fisher Gregory, N., R. P. Mulrooney, A. Y. Rossman, and L. A. Castlebury. "Anthracnose Caused by Discula fraxinea on the New Host Chinese Fringetree and White Ash in Delaware." Plant Disease 88, no. 4 (April 2004): 427. http://dx.doi.org/10.1094/pdis.2004.88.4.427b.
Full textAbstract:
Leaf blight or anthracnose symptoms have been noted on the current year's growth of Chinese fringetree (Chionanthus retusis L.) since the early 1990s in Newark, DE. Symptoms begin as dark, greenish brown, water-soaked lesions on the edges of young leaves. With time, lesions enlarge, turn darker brown, and coalesce with necrotic areas turning dry and light brown. Isolations from infected leaves consistently yielded a golden brown fungal culture on acidified potato dextrose agar. Similar symptoms were observed on white ash (Fraxinus americana L.), from which a similar fungus was isolated. C. retusis and F. americana belong to the Oleaceae, the olive family. Acervuli were inconspicuous on leaves, but conidia were easily observed. Conidia were small, non-septate, ellipsoidal, hyaline, and averaged 5.5 × 3.5 μm. In culture, the fungus formed conspicuous, concentric zones of flocculent mycelium and spherical conidiomata when exposed to diurnal light. Isolates from C. retusis and ash were identified as Discula fraxinea (Peck) Redlin & Stack, the anamorph of Gnomoniella fraxini Redlin & Stack (Gnomoniaceae, Diaporthales) (3). Sequences of the internal transcribed spacer region (ITS) of rDNA indicated that the isolates from C. retusis and white ash (GenBank Accession No. AY455810-AY455818) were conspecific with D. fraxinea isolates from Maryland and Oregon, with six or fewer base pair substitutions or insertion/deletions (indels) across all isolates. Ash anthracnose has been reported from the central and eastern United States and California, the prairie provinces in Canada, and recently from British Columbia, usually under the synonyms of Gloeosporium aridum and G. fraxineum (1,2). Koch's postulates were completed when isolates of D. fraxinea from C. retusis, green ash (F.pennsylvanica Marsh.), and white ash were inoculated onto 3- to 4-year-old trees of C. retusis and F. americana in 2000 and 2001. Seven replicate branches with emerging leaves were sprayed to runoff with a conidial suspension (60,000 conidia per ml) and covered with plastic bags for 24 h. After 20 days, 85% of C. retusis branches inoculated with a C. retusis isolate developed symptoms, and D. fraxinea was isolated from 78.6% of symptomatic leaves. Isolates from green ash in Maryland and white ash in Delaware produced symptoms on 57% of C. retusis branches. Only 37% of white ash branches inoculated with isolates from C. retusis and white ash developed symptoms, but D. fraxinea was isolated from 100% of symptomatic leaves. No symptoms developed on control branches. To our knowledge, this is the first report of D. fraxinea on C. retusis or on any member of that plant genus (1,2). In addition, D. fraxinea has not previously been reported on F. americana in Delaware. Specimens and cultures of D. fraxinea from C. retusis (BPI 746408, CBS 114058) and F. americana (BPI 746411, CBS 114051) were deposited at the U.S. National Fungus Collection and the Centraalbureau voor Schimmelcultures, The Netherlands. References: (1) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN, 1989. (2) D. F. Farr et al. Fungal Databases. Systematic Botany and Mycology Laboratory, On-line publication. ARS, USDA, 2003. (3) S. C. Redlin and R. W. Stack. Mycotaxon 32:175, 1988.
30
Ji, P., J. Yin, and K. L. Jackson. "First Report of Root Rot Caused by Fusarium solani on Benincasa hispida in the United States." Plant Disease 96, no. 2 (February 2012): 294. http://dx.doi.org/10.1094/pdis-06-11-0494.
Full textAbstract:
Root rot was observed on wax gourd (Benincasa hispida (Thunb.) Cogn.) cv. Black Giant in August 2010 in a commercial vegetable farm in southern Georgia. Approximately 5% of the plants were affected and infected roots turned light to dark brown with partial or entire roots affected and the lower leaves became wilted. Symptomatic roots from six plants were surface sterilized with 0.6% sodium hypochlorite and plated on potato dextrose agar (PDA) medium. Pure cultures had white mycelia and spore masses and were obtained from all six plants by subculturing hyphal tips onto PDA. One- to two-celled, oval- to kidney-shaped microconidia and cylindrical macroconidia with two or three cells plus apical and basal cell were produced, which averaged 12.5 × 4 μm and 28 × 4.5 μm, respectively. Microconidia were abundant and macroconidia were sparse on PDA. Single-spore isolates were obtained and identified as a Fusarium sp. by PCR analysis with primers ITS-Fu-f and ITS-Fu-r (1). Genomic DNA of two isolates obtained from different plants was extracted and a portion of the translation elongation factor 1-α (TEF) gene of the isolates was amplified and sequenced (3). When compared with sequences available in the GenBank database, DNA sequences of the two isolates (GenBank Accession No. JF928376) shared 100% sequence identity with F. solani strain FRC S1734 (GenBank Accession No. DQ247527). The fungus was identified as F. solani (Mart.) Sacc. based on molecular analysis and morphological characteristics (2). Oat grains were separately infected with two isolates, BG2a and BG6, and used to inoculate healthy, 3-week-old wax gourd seedlings (cv. Black Giant) under greenhouse conditions (14-h photoperiod, 24 to 30°C). Each seedling was grown in a 10-cm pot containing a commercial potting mix, and five healthy plants were inoculated with each isolate by placing 15 infected oat grains around each plant at a depth of 5 cm in the soil. Five plants treated with noninfected oat grains served as controls. Symptoms identical to those on field samples developed on all inoculated plants 3 weeks after inoculation but not on the control plants. F. solani was reisolated from inoculated symptomatic plants and the identity was confirmed, which completed Koch's postulates. The experiment was repeated one more time under similar conditions. To our knowledge, this is the first report of root rot caused by F. solani on wax gourd in the United States. Wax gourd is an important specialty crop in the southeastern United States and the occurrence of this disease needs to be taken into account in wax gourd production. References: (1) K. A. Abd-Elsalam et al. Afr. J. Biotechnol. 2:82, 2003. (2) C. Booth. Fusarium Laboratory Guide to the Identification of the Major Species. CMI, Kew, England, 1977. (3) D. M. Geiser et al. Eur. J. Plant Pathol. 110:473, 2004.
31
Kou, L. P., V. L. Gaskins, Y. G. Luo, and W. M. Jurick. "First Report of Fusarium avenaceum Causing Postharvest Decay of ‘Gala’ Apple Fruit in the United States." Plant Disease 98, no. 5 (May 2014): 690. http://dx.doi.org/10.1094/pdis-07-13-0803-pdn.
Full textAbstract:
Apples are kept in controlled atmosphere cold storage for 9 to 12 months and are highly susceptible to postharvest decay caused by various fungi. Fusarium avenaceum is a wound pathogen that has been shown to account for the majority of Fusarium rot on apple fruit in Croatia (1). F. avenaceum produces an array of mycotoxins including moniliformin, acuminatopyrone, and chrysogine, which are of primary concern for the apple processing industry (2). In February 2013, ‘Gala’ apple fruits with soft, circular, brown, watery lesions with characteristic abundant whitish mycelium covering the surface of the colonized fruit were obtained from bins from a commercial storage facility located in Pennsylvania. Several samples were collected and prepared for pathogen isolation. Apples were rinsed with sterile water, and the lesions were sprayed with 70% ethanol until runoff. The apple skin was aseptically removed with a scalpel, and asymptomatic tissue was placed onto full strength potato dextrose agar (PDA) petri plates without antibiotics and incubated at 25°C under natural light. Two single-spore isolates were propagated on PDA and permanent cultures were maintained as slants and stored in a cold room at 4°C in the dark. Fungal colonies initially formed abundant fluffy white mycelium and produced a golden orange pigment on PDA at 25°C. Isolates were identified as Fusarium based on cultural and conidial morphology as macroconidia were slightly falcate, thin-walled, usually 3 to 5 septate, with a tapering apical cell that was on average 23.6 μm long × 5.0 μm wide (n = 50). Microconidia were produced on PDA plates while chlamydospores were not evident. Identity of the isolates was confirmed through DNA extraction followed by amplification and sequencing of the translation elongation factor (EF-1α, 350 bp) gene region. The amplicons were sequenced using the forward and reverse primers and assembled into a consensus representing 2X coverage. MegaBLAST analysis revealed that both isolates were 100% identical with many other culture collection F. avenaceum sequences in Genbank (Accessions JQ949291.1, JQ949305.1, and JQ949283.1), which confirms their identification in conjunction with the morphological observations. Koch's postulates were conducted to determine pathogenicity using organic ‘Gala’ apple fruit that were surface sanitized with soap and water, sprayed with 70% ethanol, and wiped dry. The fruit were wounded with a finishing nail to 3 mm depth, inoculated with 50 μl of a conidial suspension (1 × 104 conidia/ml) using a hemocytometer, and stored at 25°C in 80-count boxes on paper trays for 21 days. Water-only controls were symptomless. Ten fruit composed a replicate for each isolate, and the experiment was repeated. Symptoms observed on artificially inoculated ‘Gala’ apple fruit were identical to the decay observed on ‘Gala’ apples that were obtained from cold storage. Decay caused by F. avenaceum may represent an emerging problem for the apple storage and processing industry. Therefore, it is important to monitor for this pathogen to prevent future losses and mycotoxin contamination of processed fruit products caused by this fungus. To the best of our knowledge, this is the first report of Fusarium rot caused by F. avenaceum on apple fruit from cold storage in the United States. References: (1) Z. Sever et al. Arch. Ind. Hygiene Toxicol. 63:463, 2012. (2) J. L. Sorenson. J. Agric. Food Chem. 57:1632, 2009.
32
LOVE, DAVID C., ROBERT M. LANE, BENJAMIN J. K. DAVIS, KATE CLANCY, JILLIAN P. FRY, JAMIE HARDING, and BOBBI HUDSON. "Performance of Cold Chains for Chesapeake Bay Farmed Oysters and Modeled Growth of Vibrio parahaemolyticus." Journal of Food Protection 82, no. 1 (December 28, 2018): 168–78. http://dx.doi.org/10.4315/0362-028x.jfp-18-044.
Full textAbstract:
ABSTRACT Temperature-controlled supply chains (cold chains) require an unbroken chain of refrigeration to maintain product quality and safety. This study investigated cold chains for farmed oysters raised in the Chesapeake Bay, one of the largest shellfish-growing regions in the United States, and sold live to the half-shell market in surrounding states. Temperature sensors were used in boxes of oysters from February to September 2017, which generated 5,250 h of temperature data. Thirty-nine businesses participated in the temperature sensor study, and 26 of those businesses participated in interviews to further understand how cold chains function. Internal oyster temperatures were measured above 50°F (10°C) for over 1 h in 19% (7 of 36) of shipments, which is a temperature that exceeds National Shellfish Sanitation Program criteria. The highest internal oyster temperature recorded in any shipment was 54.5°F (12.5°C). Some parts of the cold chain had difficulty maintaining storage temperatures below 45°F (7.2°C) in warmer months when Vibrio control plans were in effect. We modeled the effects of temperature on Vibrio parahaemolyticus. The model predicted moderate bacterial growth before oysters were under temperature control, but cold chains prevented further bacterial growth and provided a moderate drop-off in V. parahaemolyticus abundance.
33
Díaz Arias, M. M., G. P. Munkvold, and L. F. Leandro. "First Report of Fusarium proliferatum Causing Root Rot on Soybean (Glycine max) in the United States." Plant Disease 95, no. 10 (October 2011): 1316. http://dx.doi.org/10.1094/pdis-04-11-0346.
Full textAbstract:
Fusarium spp. are widespread soilborne pathogens that cause important soybean diseases such as damping-off, root rot, Fusarium wilt, and sudden death syndrome. At least 12 species of Fusarium, including F. proliferatum, have been associated with soybean roots, but their relative aggressiveness as root rot pathogens is not known and pathogenicity has not been established for all reported species (2). In collaboration with 12 Iowa State University extension specialists, soybean roots were arbitrarily sampled from three fields in each of 98 Iowa counties from 2007 to 2009. Ten plants were collected from each field at V2-V3 and R3-R4 growth stages (2). Typical symptoms of Fusarium root rot (2) were observed. Symptomatic and asymptomatic root pieces were superficially sterilized in 0.5% NaOCl for 2 min, rinsed three times in sterile distilled water, and placed onto a Fusarium selective medium. Fusarium colonies were transferred to carnation leaf agar (CLA) and potato dextrose agar and later identified to species based on cultural and morphological characteristics. Of 1,230 Fusarium isolates identified, 50 were recognized as F. proliferatum based on morphological characteristics (3). F. proliferatum isolates produced abundant, aerial, white mycelium and a violet-to-dark purple pigmentation characteristic of Fusarium section Liseola. On CLA, microconidia were abundant, single celled, oval, and in chains on monophialides and polyphialides (3). Species identity was confirmed for two isolates by sequencing of the elongation factor (EF1-α) gene using the ef1 and ef2 primers (1). Identities of the resulting sequences (~680 bp) were confirmed by BLAST analysis and the FUSARIUM-ID database. Analysis resulted in a 99% match for five accessions of F. proliferatum (e.g., FD01389 and FD01858). To complete Koch's postulates, four F. proliferatum isolates were tested for pathogenicity on soybean in a greenhouse. Soybean seeds of cv. AG2306 were planted in cones (150 ml) in autoclaved soil infested with each isolate; Fusarium inoculum was applied by mixing an infested cornmeal/sand mix with soil prior to planting (4). Noninoculated control plants were grown in autoclaved soil amended with a sterile cornmeal/sand mix. Soil temperature was maintained at 18 ± 1°C by placing cones in water baths. The experiment was a completely randomized design with five replicates (single plant in a cone) per isolate and was repeated three times. Root rot severity (visually scored on a percentage scale), shoot dry weight, and root dry weight were assessed at the V3 soybean growth stage. All F. proliferatum isolates tested were pathogenic. Plants inoculated with these isolates were significantly different from the control plants in root rot severity (P = 0.001) and shoot (P = 0.023) and root (P = 0.013) dry weight. Infected plants showed dark brown lesions in the root system as well as decay of the entire taproot. F. proliferatum was reisolated from symptomatic root tissue of infected plants but not from similar tissues of control plants. To our knowledge, this is the first report of F. proliferatum causing root rot on soybean in the United States. References: (1) D. M. Geiser et al. Eur. J. Plant Pathol. 110:473, 2004. (2) G. L. Hartman et al. Compendium of Soybean Diseases. 4th ed. The American Phytopathologic Society, St. Paul, MN, 1999. (3) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Oxford, UK, 2006. (4) G. P. Munkvold and J. K. O'Mara. Plant Dis. 86:143, 2002.
34
Enhaili, Aziz. "DANIEL, Donald C. F., Bradd C. HAYES, Chantal DE JONGE OUDRAT. Coercive Inducement and the Containment of International Crises Washington, United States Institute of Peace, 1999, 293 p." Études internationales 32, no. 1 (2001): 124. http://dx.doi.org/10.7202/704268ar.
Full text
35
Rodriguez-Salamanca, L. M., T. B. Enzenbacher, M. L. Derie, L. J. du Toit, C. Feng, J. C. Correll, and M. K. Hausbeck. "First Report of Colletotrichum coccodes Causing Leaf and Neck Anthracnose on Onions (Allium cepa) in Michigan and the United States." Plant Disease 96, no. 5 (May 2012): 769. http://dx.doi.org/10.1094/pdis-01-12-0022-pdn.
Full textAbstract:
In July of 2010, dry, oval lesions, each with a salmon-colored center and bleached overall appearance, were observed on the leaves and neck of onions plants growing in production fields of Newaygo, Ottawa, Kent, and Ionia counties, Michigan. Acervuli and setae that are characteristic of Colletotrichum spp. were observed with a dissecting microscope, and elliptical conidia (8 to 23 × 3 to 12 μm) with attenuated ends were observed with a compound microscope. Symptomatic tissues were excised and cultured onto potato dextrose agar amended with 30 and 100 ppm of rifampicin and ampicillin, respectively. The cultures produced pale salmon-colored sporulation after growing for 5 days at 22 ± 2°C and black microsclerotia after 2 weeks. Six isolates were confirmed as C. coccodes based on sequence analysis of the internal transcribed (ITS) region of the ribosomal DNA and a 1-kb intron of the glutamine synthase gene (GS) (2). Sequences were submitted to GenBank (Accession Nos. JQ682644 and JQ682645 for ITS and GS, respectively). Pathogenicity tests were conducted on two- to three-leaved ‘Stanley’ and ‘Cortland’ onion seedlings. Prior to inoculation, seedlings were enclosed in clear plastic bags overnight to provide high relative humidity. The bags were removed, and seedlings were sprayed inoculated with a C. coccodes conidial suspension (5 × 105 conidia/ml and 25 ml/plant) in sterile double-distilled water. Control seedlings were sprayed with sterile double-distilled water. Tween (0.01%) was added to the conidial suspension and the water. Plants were enclosed in bags for 72 h postinoculation and incubated in growth chambers at 28°C day/23°C night with a 12-h photoperiod. Sunken, oval lesions were observed on the foliage of the onion seedlings inoculated with C. coccodes 4 days postinoculation. Lesions coalesced and foliage collapsed 7 days postinoculation. Control plants remained asymptomatic. When five leaf samples per replication were detached and incubated in a moist chamber for 3 days at 21 ± 2°C, abundant acervuli and setae were observed on the symptomatic tissue but not on control tissue. C. coccodes was consistently recovered from the onion seedling lesions. Six different Colletotrichum spp. have been reported to cause diseases on onions worldwide (1,4). C. circinans, which causes smudge, is an occasional onion pathogen in Michigan, while C. gloeosporioides has only been reported to be infecting onions in Georgia (3). To our knowledge, this is the first report of C. coccodes infecting and causing disease in onions plants. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , August 6, 2010. (2) J. C. Guerber et al. Mycologia 95:872. 2003. (3) C. Nischwitz et al. Plant Dis. 92:974. 2008. (4) H. F. Schwartz, and K. S. Mohan. Compendium of Onion and Garlic Diseases and Pests, 2nd ed. The American Phytopathological Society, St. Paul, MN. 1995.
36
Santamaria, Luisa, Emmalea G. Ernest, Nancy F. Gregory, and Thomas A. Evans. "Inheritance of Resistance in Lima Bean to Phytophthora phaseoli, the Causal Agent of Downy Mildew of Lima Bean." HortScience 53, no. 6 (June 2018): 777–81. http://dx.doi.org/10.21273/hortsci12748-18.
Full textAbstract:
The oomycete Phytophthora phaseoli is one of the most threatening pathogens of lima bean (Phaseolus lunatus) in the humid Mid-Atlantic United States. In the last 60 years, P. phaseoli has evolved to overcome genetic resistance in the host and several physiological races have been identified during the last 6 decades. Six physiological races A, B, C, D, E, and F have been identified over the years. Only race F has been detected in the field over the past decade. Identifying and characterizing sources of resistance to this pathogen and determining the nature of resistance were the main objectives. Eight commercial cultivars and 35 germplasm accessions of P. lunatus were evaluated for their reaction to races E and F. Four commercial cultivars and four accessions with resistance to race E, and two cultivars and four accessions with resistance to race F were identified. None of the germplasm evaluated were resistant to both races. Five populations of F2 plants and a recombinant inbred line (RIL) population were produced and inoculated to investigate the inheritance of resistance to races E and F. Resistance to races E and F was determined to be conferred by single, independent, dominant genes.
37
Ivy, D. J., M. Rigby, M. Baasandorj, J. B. Burkholder, and R. G. Prinn. "Global emission estimates and radiative impact of C<sub>4</sub>F<sub>10</sub>, C<sub>5</sub>F<sub>12</sub>, C<sub>6</sub>F<sub>14</sub>, C<sub>7</sub>F<sub>16</sub> and C<sub>8</sub>F<sub>18</sub>." Atmospheric Chemistry and Physics Discussions 12, no. 5 (May 24, 2012): 12987–3014. http://dx.doi.org/10.5194/acpd-12-12987-2012.
Full textAbstract:
Abstract. Global emission estimates based on new atmospheric observations are presented for the acylic high molecular weight perfluorocarbons (PFCs): decafluorobutane (C4F10), dodecafluoropentane (C5F12), tetradecafluorohexane (C6F14), hexadecafluoroheptane (C7F16) and octadecafluorooctane (C8F18). Emissions are estimated using a 3-dimensional chemical transport model and an inverse method that includes a growth constraint on emissions. The observations used in the inversion are based on newly measured archived air samples that cover a 39-yr period, from 1973 to 2011, and include 36 Northern Hemispheric and 46 Southern Hemispheric samples (Ivy et al., 2012). The derived emission estimates show that global emission rates were largest in the 1980s and 1990s for C4F10 and C5F12, and in the 1990s for C6F14,C7F16 and C8F18. After a subsequent decline, emissions have remained relatively stable, within 20%, for the last 5 yr. Bottom-up emission estimates are available from the Emission Database for Global Atmospheric Research version 4.2 (EDGARv4.2) for C4F10, C5F12, C6F14 and C7F16, and inventories of C4F10, C5F12 andC6F14 are reported to the United Nations' Framework Convention on Climate Change (UNFCCC) by Annex 1 countries that have ratified the Kyoto Protocol. The atmospheric measurement based emission estimates are 20 times larger than EDGARv4.2 for C4F10 and over three orders of magnitude for C5F12. The derived emission estimates for C6F14 largely agree with the bottom-up estimates from EDGARv4.2. Moreover, the C7F16 emission estimates are comparable to those of EDGARv4.2 at their peak in the 1990s, albeit significant underestimation for the other time periods. There are no bottom-up emission estimates for C8F18, thus the emission rates reported here are the first for C8F18. The reported inventories for C4F10, C5F12 and C6F14 to UNFCCC are five to ten times lower than those estimated in this study. In addition, we present measured infrared absorption spectra for C7F16 and C8F18, and estimate their radiative efficiencies and global warming potentials (GWPs). We find that C8F18's radiative efficiency is similar to trifluoromethyl sulfur pentafluoride's (SF5CF3) at 0.57 W m−2 ppb−1, which is the highest radiative efficiency of any measured atmospheric species. Using the 100-yr time horizon GWPs, the high molecular weight perfluorocarbons studied here contributed up to 15.4% of the total PFC emissions in CO2 equivalents in 1997 and 6% of the total PFC emissions in 2009.
38
Uppala, S., B. M. Wu, and T. N. Temple. "First Report of Fusarium solani on Utah Sweetvetch in the United States." Plant Disease 97, no. 3 (March 2013): 423. http://dx.doi.org/10.1094/pdis-08-12-0789-pdn.
Full textAbstract:
Utah sweetvetch (Hedysarum boreale Nutt.) is a native American perennial nitrogen fixing legume used mainly in rangeland reclamation, soil rejuvenation, and erosion control. In June 2011, a field of Utah sweetvetch grown for seeds in central Oregon had approximately 15% of the plants exhibiting chlorosis, defoliation, stunting, wilting, and/or death. Dissection of the crown of symptomatic plants revealed discolored pinkish brown vascular tissue. Symptomatic tissues from six random plants were surface sterilized, placed on acidified potato dextrose agar (PDA) medium, and cultured for 7 days at room temperature, which allowed six fungal isolates (SS1 through SS6) to be collected. On PDA, all six isolates had rapid, creamy white colored growth. Based on observations of 1-week-old isolates, microconidia were oval to kidney shaped, single celled, 8 to 10 × 2.5 to 4 μm, and formed at the tips of long unbranched monophialides. Macroconidia were three to four septate, cylindrical to slightly curved, with characteristic foot shaped basal cell and blunt apical cell, 37 to 49 × 4.4 to 5.3 μm. Chlaymydospores observed were 8.5 to 11 × 7.6 to 9 μm. Based on fungal references (1,2,3), the isolates were identified as Fusarium solani (Mart.) Sacc. Identification of the isolates at the molecular level was determined by amplification of the internal transcribed spacer (ITS) region using PCR and amplicon sequencing. Botrytis cinerea and F. graminearum cultures were used as controls for the extraction, amplification, and sequencing steps. Genomic DNA was extracted from mycelia using protocols of the MOBIO Ultraclean Soil DNA Isolation Kit (MO-BIO Laboratories Inc, Carlsbad, CA, USA). PCR was performed using ITS1/ITS4 primers and resulted in 563- to 573-bp amplicons, which were sequenced. Analysis of the ITS sequences (GenBank Accession Nos. JX524018 to JX524023) for the six fungal isolates using BLASTn revealed a 99% sequence identity with F. solani strains (AB470903, AB513851, AJ608989, EF152426, EU029589, and HM214456). Pathogenicity was confirmed on Utah sweetvetch plants in the greenhouse. Seeds of Utah sweetvetch were first plated on acidified PDA for germination; healthy seedlings were then selected and transplanted into pots with sterilized soil after 2 weeks of growth. The plants were kept in a greenhouse at Central Oregon Agricultural Research Center, Madras, Oregon. Ten 40-day-old healthy vetch plants were inoculated by drenching with a mixed conidial suspension (107 conidia/ml) of the six F. solani isolates. Ten plants drenched with sterile distilled water were included as controls. Symptoms of chlorosis and stunting similar to those in the commercial field were observed within 30 days of inoculation on 8 of 10 inoculated plants, while control plants were symptomless. Fungal isolates identical to F. solani were reisolated from the symptomatic plants. To our knowledge, this is the first report of F. solani on Utah sweetvetch plants. References: (1) C. Booth. The Genus Fusarium. CMI, Kew, Surrey, UK, 1971. (2) P. E. Nelson et al. Fusarium species: An illustrated manual for identification. The Pennsylvania State University Press, USA, 1983. (3) H. I. Nirenberg. A simplified method for identifying Fusarium spp. occurring on wheat. Can. J. Bot. 59:1599, 1980.
39
Arthur, Jeffrey B., and James B. Dworkin. "Current Topics in Industrial and Labor Relations Research and Practice." Journal of Management 17, no. 3 (September 1991): 515–51. http://dx.doi.org/10.1177/014920639101700301.
Full textAbstract:
Recent research on six current topics in industrial and labor relations is reviewed: (a) the decline in union membership in the United States, (b) concession bargaining, (c) unions and employee participation programs, (d) the effect of unions on productivity and profits, (e) dispute resolution, and (f) international industrial relations. For each topic, major research findings are summarized and evaluated along with suggestions forfuture research. The article concludes by considering future scenarios for the U.S. labor movement.
40
Bettauer, Ronald J. "The United Nations Compensation Commission— Developments Since October 1992." American Journal of International Law 89, no. 2 (April 1995): 416–23. http://dx.doi.org/10.2307/2204215.
Full textAbstract:
Paragraph 16 of Security Council Resolution 687 (April 3, 1991) reaffirmed that “Iraq … is liable under international law for any direct loss, damage, … or injury to foreign Governments, nationals and corporations, as a result of Iraq’s unlawful invasion and occupation of Kuwait.” This resolution and Security Council Resolution 692 (May 20, 1991) established the United Nations Compensation Commission (UNCC) to administer a system to provide compensation for claims for which Iraq is liable under paragraph 16. The Commission has a Governing Council, composed of the members of the Security Council; panels of commissioners, appointed from time to time to review particular groups of claims; and a secretariat headed by an Executive Secretary. The Commission’s Governing Council first met in Geneva in July 1991 and in the first year of its existence adopted decisional criteria for six categories of claims: Category “A” — claims of individuals for fixed amounts for departure from Iraq or Kuwait; Category “B” — claims of individuals for fixed amounts for death or serious personal injury; Category “C” —claims of individuals for amounts up to $100,000; Category “D” —claims of individuals for amounts above $100,000; Category “E” —claims of corporations; and Category “F” — claims of governments and international organizations.
41
Liberti, Daniele, Jeffrey A. Rollins, and Philip F. Harmon. "Evidence for Morphological, Vegetative, Genetic, and Mating-Type Diversity in Sclerotinia homoeocarpa." Phytopathology® 102, no. 5 (May 2012): 506–18. http://dx.doi.org/10.1094/phyto-06-11-0180.
Full textAbstract:
Morphology, vegetative compatibility groups, and molecular characteristics were compared among 47 isolates of the dollar spot pathogen Sclerotinia homoeocarpa. Isolates were collected from cool- and warm-season turfgrasses in Florida and the northern United States. Mycelial pigment accumulation, substratal stromata formation, and symptom development were used to separate the collection into two distinct morphological types: a common-type (C-type) and a Floridian-type (F-type). Phylogenetic relationships estimated from ITS sequences supported the morphological typing. Identification and characterization of the S. homoeocarpa mating-type locus revealed an idiomorphic organization for both C- and F-types with nearly equal frequencies of each mating types present in both groups. These findings suggest heterothallic control of mating and indicate potential for outcrossing in both groups. Dollar spot disease of turfgrass in Florida is caused by two distinct morphological types of S. homoeocarpa which may be cryptic species. These findings could have implications for disease management.
42
Park, J. H., and J. Juzwik. "Fusarium Canker of Bitternut Hickory Caused by Fusarium solani in the North-Central and Northeastern United States." Plant Disease 96, no. 3 (March 2012): 455. http://dx.doi.org/10.1094/pdis-09-11-0766.
Full textAbstract:
Multiple annual cankers were observed on the upper main stems of bitternut hickory (Carya cordiformis) exhibiting top dieback in Indiana, Iowa, Minnesota, New York, Ohio, and Wisconsin during a 2006 to 2008 survey of declining hickory. The top-killed trees had normal-sized, green leaves below and the cankers were oval, sunken, and bounded by heavy callus that seemed to arrest further canker expansion. Fusarium solani was consistently isolated from the margins of inner bark lesions or discolored sapwood of the cankers. When cultured on potato dextrose agar, the isolates grew rapidly with abundant aerial mycelium. On carnation leaf agar, thick-walled macroconidia with 4 to 5 septa were produced in cream, blue-green, or blue sporodochia. Macroconidia were generally cylindrical with a blunt or rounded apical cell and a rounded or foot-shaped basal cell. Microconidia were oval to kidney shaped with 0 to 1 septa and were produced in false heads on elongate monophialides. Chlamydospores were formed singly or in pairs. These morphological characteristics are consistent with descriptions of F. solani (2). The identities of 42 representative isolates were confirmed by sequencing the translation elongation factor (tef) 1-α gene. BLAST analysis of the sequences from each isolate against the GenBank and FUSARIUM-ID database found 98 to 100% similarities to F. solani isolates (GenBank Accession Nos. DQ246841, DQ247025, DQ247282, and DQ247436 and FUSARIUM-ID isolate FD01041). Two haplotypes (BB and BC) were distinguished based on the tef 1-α gene sequences that differed by 10 bp. Pathogenicity tests were conducted with two isolates of each haplotype on asymptomatic C. cordiformis (12 to 21 cm in diameter) in forest stands. In May 2009 in Wabasha County, MN, 0.1-ml spore suspensions (1 × 104 macroconidia/ml) or sterile water was placed in one of three holes (0.6 cm in diameter) drilled to the cambium of 12 trees. The holes were sealed with moist cotton and moldable putty. A duplicate trial, but with BB and BC isolates from Wisconsin, was initiated in Chippewa County, WI in June 2009. The extent of inner bark necrosis was assessed 13 months after inoculation in both sites. Inoculations with F. solani in Minnesota resulted in inner bark lesions with average lengths of 20 and 30 mm for the BB and BC haplotypes, respectively. In Wisconsin, BB and BC haplotypes caused inner bark lesions with average lengths of 34 and 38 mm, respectively. While sunken or open cankers were found for all the BC isolate inoculations, relatively small and callus-bounded cankers were found for BB isolate inoculations. All control wounds were callus-closed with average wound lengths of 12 and 23 mm in Minnesota and Wisconsin, respectively. The same haplotype of F. solani used for inoculation was recovered from each canker as confirmed by analysis of tef 1-α gene sequences. F. solani was not obtained from control wounds. To our knowledge, this is the first report of a canker caused by F. solani on bitternut hickory (1). The same fungus has been previously reported to cause cankers on stems of other hardwood tree genera in the eastern United States and Canada. We hypothesize that numerous main-stem cankers caused by F. solani lead to top dieback of bitternut hickory. References: (1) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN, 1989. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Ames, IA, 2006.
43
Clayton, Alan, Jeannette Montufar, and Dan Middleton. "Operation of Long Semitrailers in the United States." Transportation Research Record: Journal of the Transportation Research Board 1833, no. 1 (January 2003): 79–86. http://dx.doi.org/10.3141/1833-11.
Full textAbstract:
The regulation and use of long semitrailers (57 to 60 ft) in the United States are discussed. Industrial information was obtained from interviewing 42 state and federal regulatory and compliance officials, vehicle manufacturers, motor carriers, and shippers. Field data from a June 2002 investigation of long semitrailer use on an Interstate highway section in Texas are presented. No known significant literature exists on the topic under discussion. The research found that long semitrailers operate, either regularly or under permit, in 19 states. They are principally used by a few large private and for-hire carriers, transporting mainly tissue paper, empty cans, hay, cotton, empty storage container drums, household goods, snack foods, and general freight. The extent of their operation is largely unknown or unclear to many of those involved with truck size and weight research and development activities, highway planners and designers, and industry participants. The following are addressed: ( a) issues about long semitrailer operation in the United States and the growth potential of these vehicles relative to the TRB Special Report 267 proposal to allow wide-scale use of six-axle tractor-semitrailers at a gross vehicle weight of 90,000 Ib; ( b) background on using long semitrailers; ( c) operational issues associated with long semitrailers; ( d) typical dimensional characteristics and cubic payloads of long semitrailers compared with standard semitrailers; ( e) field data on the use of long semitrailers in Texas; and ( f) regulations, permit requirements, and allowable geographic scope of operation for long semitrailers.
44
Sherchan, Samendra P., Shalina Shahin, Jeenal Patel, Lauren M. Ward, Sarmila Tandukar, Sital Uprety, Bradley W. Schmitz, Warish Ahmed, Stuart Simpson, and Pradip Gyawali. "Occurrence of SARS-CoV-2 RNA in Six Municipal Wastewater Treatment Plants at the Early Stage of COVID-19 Pandemic in The United States." Pathogens 10, no. 7 (June 23, 2021): 798. http://dx.doi.org/10.3390/pathogens10070798.
Full textAbstract:
In this study, we investigated the occurrence of Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2) RNA in primary influent (n = 42), secondary effluent (n = 24) and tertiary treated effluent (n = 34) collected from six wastewater treatment plants (WWTPs A–F) in Virginia (WWTP A), Florida (WWTPs B, C, and D), and Georgia (WWTPs E and F) in the United States during April–July 2020. Of the 100 wastewater samples analyzed, eight (19%) untreated wastewater samples collected from the primary influents contained SARS-CoV-2 RNA as measured by reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) assays. SARS-CoV-2 RNA were detected in influent wastewater samples collected from WWTP A (Virginia), WWTPs E and F (Georgia) and WWTP D (Florida). Secondary and tertiary effluent samples were not positive for SARS-CoV-2 RNA indicating the treatment processes in these WWTPs potentially removed SARS-CoV-2 RNA during the secondary and tertiary treatment processes. However, further studies are needed to understand the log removal values (LRVs) and transmission risks of SARS-CoV-2 RNA through analyzing wastewater samples from a wider range of WWTPs.
45
Roy, K. W., M. V. Patel, and R. E. Baird. "Colonization of Heterodera glycines cysts by Fusarium solani form A, the cause of sudden death syndrome, and other fusaria in soybean fields in the midwestern and southern United States." Phytoprotection 81, no. 2 (April 12, 2005): 57–67. http://dx.doi.org/10.7202/706200ar.
Full textAbstract:
Fusarium solani form A and other fusaria were isolated from surface disinfested cysts of Heterodera glycines collected from the rhizosphere of soybean (Glycine max) plants symptomatic for sudden death syndrome, collected from fields in the midwestern and southern United States. Two forms of Fusarium solani pathogenic to soybean were isolated: form A, the cause of sudden death syndrome, and form B, the cause of seedling disease and root rot. Fusarium solani form B was more frequently isolated than form A. Fusarium solani form A occurred in cysts in 82% of the cystinfested fields containing plants symptomatic of sudden death syndrome, with maximum and average isolation frequencies (across fields and years) of 28 and 7%, respectively. This fungus was not found in cysts from five fields lacking sudden death syndrome. Isolates of F. solani form B were found in high frequency in cysts from each of those fields; F. solani form B occurred in cysts in 94% of the cyst-infested fields containing sudden death syndrome, with maximum and average isolation frequencies (across years and fields) of 48 and 16%, respectively. Fusarium oxysporum (the species with the third highest average isolation frequency), F. chlamydosporum, F. equiseti, F. moniliforme, and F. pallidoroseum (syn. F. semitectum) were also isolated. Based on cyst population densities occurring in soil and percentages of cysts colonized by F. solani form A, the maximum and average numbers of colonized cysts per 500 cm3 of rhizosphere soil were 149 and 22, respectively. Fusarium solani form A survived at a high rate in cysts in soil stored for 8 months at ca 10 C, indicating an ability to overwinter in cysts between soybean growing seasons. Fusarium solani form A had a poor survival rate in cysts in soil stored for 20 months. Compared to F. solani form A, maximum and average numbers of F. solani form B in cysts per 500 cm3 soil were higher, at 700 and 82, respectively. Furthermore, the survival rate of cysts in soil stored for 8 and 20 months was also higher. Isolates of F. solani form A from cysts were as virulent on soybean as isolates from diseased roots.
46
Liu, Bo, Larry Stein, Kimberly Cochran, Lindsey J. du Toit, Chunda Feng, Braham Dhillon, and James C. Correll. "Characterization of Leaf Spot Pathogens from Several Spinach Production Areas in the United States." Plant Disease 104, no. 7 (July 2020): 1994–2004. http://dx.doi.org/10.1094/pdis-11-19-2450-re.
Full textAbstract:
Leaf spot diseases have become a major concern in spinach production in the United States. Determining the causal agents of leaf spots on spinach, their prevalence and pathogenicity, and fungicide efficacy against these pathogens is vital for effective disease management. Spinach leaves with leaf spots were collected from Texas, California, Arizona, and South Carolina from 2016 to 2018, incubated in a moist chamber, and plated on potato dextrose and tryptic soy agar media. Fungal and bacterial colonies recovered were identified based on morphology and sequence analysis of the internal transcribed spacer rDNA and 16S rRNA, respectively. Two predominant genera were isolated: (i) Colletotrichum spp., which were identified to species based on sequences of both introns of the glutamate synthetase (GS-I) and glyceraldehyde-3-phosphate dehydrogenase (gapdh-I) genes; and (ii) Stemphylium spp., identified to species based on sequences of the gapdh and calmodulin (cmdA) genes. Anthracnose (Colletotrichum spinaciae) and Stemphylium leaf spot (Stemphylium vesicarium and S. beticola) were the predominant diseases. Additional fungi recovered at very limited frequencies that were also pathogenic to spinach included Colletotrichum coccodes, C. truncatum, Cercospora beticola, and Myrothecium verrucaria. All of the bacterial isolates were not pathogenic on spinach. Pathogenicity tests showed that C. spinaciae, S. vesicarium, and S. beticola caused significant leaf damage. The fungicides Bravo WeatherStik (chlorothalonil), Dithane F-45 (mancozeb), Cabrio (pyraclostrobin), and Merivon (fluxapyroxad and pyraclostrobin) were highly effective at reducing leaf spot severity caused by an isolate of each of C. spinaciae and S. vesicarium, when inoculated individually and in combination.
47
Ploetz, R. C., A. J. Palmateer, D. M. Geiser, and J. H. Juba. "First Report of Fusarium Wilt Caused by Fusarium oxysporum on Roselle in the United States." Plant Disease 91, no. 5 (May 2007): 639. http://dx.doi.org/10.1094/pdis-91-5-0639a.
Full textAbstract:
Roselle, Hibiscus sabdariffa var. sabdariffa, is an annual that is grown primarily for its inflated calyx, which is used for drinks and jellies. It is native from India to Malaysia, but was taken at an early date to Africa and is now widely grown in the tropics and subtropics (2). In late 2005, dying plants were noted by a producer in South Florida. Plants wilted, became chlorotic, and developed generally unthrifty, sparse canopies. Internally, conspicuous vascular discoloration was evident in these plants from the roots into the canopy. After 5 days on one-half-strength potato dextrose agar (PDA), salmon-colored fungal colonies grew almost exclusively from surface-disinfested 5 mm2 pieces of vascular tissue. On banana leaf agar, single-spored strains produced the following microscopic characters of Fusarium oxysporum: copious microconidia on monophialides, infrequent falcate macroconidia, and terminal and intercalary chlamydospores. Partial, elongation factor 1-α (EF1-α) sequences were generated for two of the strains, O-2424 and O-2425, and compared with previously reported sequences for the gene (3). Maximum parsimony analysis of sequences showed that both strains fell in a large, previously described clade of the F. oxysporum complex (FOC) that contained strains from agricultural hosts, as well as human clinical specimens (2; clade 3 in Fig. 4); many of the strains in this clade have identical EF1-α sequences. Strains of F. oxysporum recovered from wilted roselle in Egypt, O-647 and O-648 in the Fusarium Research Center collection, were distantly related to the Florida strains. We are not aware of other strains of F. oxysporum from roselle in other international culture collections. Roselle seedlings were inoculated with O-2424 and O-2425 by placing a mycelial plug (5 mm2, PDA) over a small incision 5 cm above the soil line and then covering the site with Parafilm. Parafilm was removed after 1 week, and plants were incubated under ambient temperatures (20 to 32°C) in full sun for an additional 5 weeks (experiment 1) or 7 weeks (experiment 2). Compared with mock-inoculated (wound + Parafilm) control plants, both O-2424 and O-2425 caused significant (P < 0.05) vascular disease (linear extension of discolored xylem above and below wound site) and wilting (subjective 1 to 5 scale); both isolates were recovered from affected plants. F. oxysporum-induced wilt of roselle has been reported in Nigeria (1) and Malaysia (4) where the subspecific epithet f. sp. rosellae was used for the pathogen. We are not aware of reports of this disease elsewhere. To our knowledge, this is the first report of F. oxysporum-induced wilt of roselle in the United States. Research to determine whether the closely related strains in clade 3 of the FOC are generalist plant pathogens (i.e., not formae speciales) is warranted. References: (1) N. A. Amusa et al. Plant Pathol. J. 4:122, 2005. (2) J. Morton. Pages 81–286 in: Fruits of Warm Climates. Creative Resource Systems, Inc., Winterville, NC, 1987. (3) K. O'Donnell et al. J. Clin. Microbiol. 42:5109, 2004. (4) K. H. Ooi and B. Salleh. Biotropia 12:31, 1999.
48
Delgado, Javier A., Paul B. Schwarz, James Gillespie, Viviana V. Rivera-Varas, and Gary A. Secor. "Trichothecene Mycotoxins Associated with Potato Dry Rot Caused by Fusarium graminearum." Phytopathology® 100, no. 3 (March 2010): 290–96. http://dx.doi.org/10.1094/phyto-100-3-0290.
Full textAbstract:
Fusarium graminearum, a known producer of trichothecene mycotoxins in cereal hosts, has been recently documented as a cause of dry rot of potato tubers in the United States. Due to the uncertainty of trichothecene production in these tubers, a study was conducted to determine the accumulation and diffusion of trichothecenes in potato tubers affected with dry rot caused by F. graminearum. Potato tubers of cv. Russet Burbank were inoculated with 14 F. graminearum isolates from potato, sugar beet, and wheat and incubated at 10 to 12°C for 5 weeks to determine accumulation of trichothecenes in potato tubers during storage. Twelve of the isolates were classified as deoxynivalenol (DON) genotype and two isolates were as nivalenol (NIV) genotype. Trichothecenes were detected only in rotted tissue. DON was detected in all F. graminearum DON genotype isolates up to 39.68 μg/ml in rotted potato tissue. Similarly, both NIV genotype isolates accumulated NIV in rotted potato tissue up to 18.28 μg/ml. Interestingly, isolates classified as genotype DON accumulated both DON and NIV in the dry rot lesion. Potato tubers were then inoculated with two isolates of F. graminearum chemotype DON and incubated up to 7 weeks at 10 to 12°C and assayed for DON diffusion. F. graminearum was recovered from >53% of the isolations from inoculated tubers at 3 cm distal to the rotted tissue after 7 weeks of incubation but DON was not detected in the surrounding tissue. Based in this data, the accumulation of trichothecenes in the asymptomatic tissue surrounding dry rot lesions caused by F. graminearum is minimal in cv. Russet Burbank potato tubers stored for 7 weeks at customary processing storage temperatures.
49
Ranger, Brian S., Engy A. Mahrous, Lydia Mosi, Sarojini Adusumilli, Richard E. Lee, Angelo Colorni, Martha Rhodes, and P. L. C. Small. "Globally Distributed Mycobacterial Fish Pathogens Produce a Novel Plasmid-Encoded Toxic Macrolide, Mycolactone F." Infection and Immunity 74, no. 11 (August 21, 2006): 6037–45. http://dx.doi.org/10.1128/iai.00970-06.
Full textAbstract:
ABSTRACT Mycobacterium ulcerans and Mycobacterium marinum are closely related pathogens which share an aquatic environment. The pathogenesis of these organisms in humans is limited by their inability to grow above 35°C. M. marinum causes systemic disease in fish but produces localized skin infections in humans. M. ulcerans causes Buruli ulcer, a severe human skin lesion. At the molecular level, M. ulcerans is distinguished from M. marinum by the presence of a virulence plasmid which encodes a macrolide toxin, mycolactone, as well as by hundreds of insertion sequences, particularly IS2404. There has been a global increase in reports of fish mycobacteriosis. An unusual clade of M. marinum has been reported from fish in the Red and Mediterranean Seas and a new mycobacterial species, Mycobacterium pseudoshottsii, has been cultured from fish in the Chesapeake Bay, United States. We have discovered that both groups of fish pathogens produce a unique mycolactone toxin, mycolactone F. Mycolactone F is the smallest mycolactone (molecular weight, 700) yet identified. The core lactone structure of mycolactone F is identical to that of M. ulcerans mycolactones, but a unique side chain structure is present. Mycolactone F produces apoptosis and necrosis on cultured cells but is less potent than M. ulcerans mycolactones. Both groups of fish pathogens contain IS2404. In contrast to M. ulcerans and conventional M. marinum, mycolactone F-producing mycobacteria are incapable of growth at above 30°C. This fact is likely to limit their virulence for humans. However, such isolates may provide a reservoir for horizontal transfer of the mycolactone plasmid in aquatic environments.
50
Scruggs, A. C., and L. M. Quesada-Ocampo. "Etiology and Epidemiological Conditions Promoting Fusarium Root Rot in Sweetpotato." Phytopathology® 106, no. 8 (August 2016): 909–19. http://dx.doi.org/10.1094/phyto-01-16-0009-r.
Full textAbstract:
Sweetpotato production in the United States is limited by several postharvest diseases, and one of the most common is Fusarium root rot. Although Fusarium solani is believed to be the primary causal agent of disease, numerous other Fusarium spp. have been reported to infect sweetpotato. However, the diversity of Fusarium spp. infecting sweetpotato in North Carolina is unknown. In addition, the lack of labeled and effective fungicides for control of Fusarium root rot in sweetpotato creates the need for integrated strategies to control disease. Nonetheless, epidemiological factors that promote Fusarium root rot in sweetpotato remain unexplored. A survey of Fusarium spp. infecting sweetpotato in North Carolina identified six species contributing to disease, with F. solani as the primary causal agent. The effects of storage temperature (13, 18, 23, 29, and 35°C), relative humidity (80, 90, and 100%), and initial inoculum level (3-, 5-, and 7-mm-diameter mycelia plug) were examined for progression of Fusarium root rot caused by F. solani and F. proliferatum on ‘Covington’ sweetpotato. Fusarium root rot was significantly reduced (P < 0.05) at lower temperatures (13°C), low relative humidity levels (80%), and low initial inoculum levels for both pathogens. Sporulation of F. proliferatum was also reduced under the same conditions. Qualitative mycotoxin analysis of roots infected with one of five Fusarium spp. revealed the production of fumonisin B1 by F. proliferatum when infecting sweetpotato. This study is a step toward characterizing the etiology and epidemiology of Fusarium root rot in sweetpotato, which allows for improved disease management recommendations to limit postharvest losses to this disease.