To see the other types of publications on this topic, follow the link: Turned pale.
Journal articles on the topic 'Turned pale'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Turned pale.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Gibbons, A. "AMERICAN ASSOCIATION OF PHYSICAL ANTHROPOLOGISTS MEETING: European Skin Turned Pale Only Recently, Gene Suggests." Science 316, no. 5823 (April 20, 2007): 364a. http://dx.doi.org/10.1126/science.316.5823.364a.
Full text
2
Ginzburg, M. "D-r Way. (Adelaide, in Australia). Ectopic gestation, ruptured left Fallopian tube, haemato-salpynx of the right tube of same patient. (The Avstralasian medical Gazette, 1894, IX, p. 299). Ectopic pregnancy, rupture of the left Fallopian tube and hemorrhage in the right tube." Journal of obstetrics and women's diseases 9, no. 3 (September 22, 2020): 280. http://dx.doi.org/10.17816/jowd93280.
Full textAbstract:
The young woman, who considered herself pregnant, developed blood and pain after 5 weeks of pregnancy and lasted for six weeks. She was admitted to the hospital for the operation. In the left side of the pelvis, an elastic tumor the size of an orange was hidden, displaced the uterus to the right, and a stretched tube was felt behind the uterus. During anesthesia, the patient's breathing suddenly became superficial and the pulse weakened, the patient turned pale.
3
Golov, A. P. "On the statistics of cases of native healing of complex uterine fibroids." Journal of obstetrics and women's diseases 6, no. 2 (August 18, 2020): 183. http://dx.doi.org/10.17816/jowd62183.
Full textAbstract:
Nun L., 43 years old, in the monastery since the age of 14. Monthly from 15 years, after 3 weeks for 8-4 days, the day before the curves and during their severe pain: blood is scarce and pale. The author has known the patient since 1884; She turned to him many times for advice about severe abdominal pain, constipation, bleeding and throat pain, but did not allow herself to be examined. The author could only notice that the patient's abdomen was enlarged and that this enlargement was progressing.
4
Alexandre-Collier, Agnès. "‘Less Stale, Only Slightly Less Male, but Overwhelmingly Less Pale’: the 2015 New Conservative Brexiters in the House of Commons." Parliamentary Affairs 72, no. 3 (June 15, 2018): 588–615. http://dx.doi.org/10.1093/pa/gsy023.
Full textAbstract:
AbstractThis article will study the new face of Conservative Euroscepticism in the House of Commons, with a special focus on the 2015 intake of MPs who were supposedly ‘less stale, male and pale’ and their attitudes to the British referendum on the EU. In this respect, this article will also take a specific interest in new Conservative Black and Asian Minority Ethnic (BAME) MPs who turned out to be more active on the ‘leave’ side of the referendum campaign, thus serving as a showcase for the party's strategy of ‘decontaminating’ the Brexit brand and its hyperglobalist geopolitical perspective.
5
Sano, Junta, and Shigeki Habaue. "Dual Temperature and Metal Salts-Responsive Interpenetrating Polymer Networks Composed of Poly (N-isopropylacrylamide) and Polyethylene Glycol." Polymers 13, no. 11 (May 27, 2021): 1750. http://dx.doi.org/10.3390/polym13111750.
Full textAbstract:
Novel interpenetrating polymer networks (IPNs) composed of poly(N-isopropylacrylamide) (poly-NIPAM) and polyethers—namely, polyethylene glycol (PEG) and poly(tetramethylene oxide)—were synthesized in the absence and presence of polysiloxane containing a silanol residue. Gelation was accomplished using end-capped polyethers with trimethoxysilyl moieties and proceeded through simultaneous radical gelation of NIPAM and condensation of the silyl groups to form siloxane linkages. Thus, a novel one-step method constructing an IPN structure was provided. The obtained IPNs showed a gentle temperature-responsive volume change in water owing to the constructed poly-NIPAM gel component. In addition, a specific color-change response to chemical stimuli, such as CuCl2 and AgNO3 in water, was observed only when both components of poly-NIPAM and PEG existed in a gel form. For example, a single network gel composed of poly-NIPAM or PEG was isolated as a pale blue hydrogel, whereas IPNs composed of poly-NIPAM and PEG components turned yellow after swelling in an aqueous CuCl2 solution (0.1 M, pale blue). Dual-responsive functionalities of the synthesized hydrogels to temperature and metal salts, along with volume and color changes, were demonstrated.
6
Tyrrell, Ian. "ROBERT WIEBE'STHE SEARCH FOR ORDER, FIFTY YEARS ON." Journal of the Gilded Age and Progressive Era 17, no. 2 (April 2018): 397–411. http://dx.doi.org/10.1017/s1537781417000883.
Full textAbstract:
When invited to write this retrospective review, I turned to my library shelves to pick up once moreThe Search for Order, 1877–1920.My faded paperback copy has a striking image of a railroad track, peeling off into the distance, past a mine site, and then disappearing over the horizon. The colors are shades of red, a black tinged in the glow of red, and a pale pink sky. The scene conveys both an unsettling alarm at the turmoil of society in the coloration, and a binding process through the railroad. I have just discovered that Saul Lambert (a noted illustrator) drew this evocative scene for Hill and Wang, and the job was exceedingly well done.
7
LI, HAI-JIAO, MENG ZHOU, and JING SI. "Perenniporia punctata sp. nov. (Polyporales, Basidiomycota), a new species discovered from China." Phytotaxa 360, no. 1 (July 10, 2018): 54. http://dx.doi.org/10.11646/phytotaxa.360.1.5.
Full textAbstract:
Taxonomic and phylogenetic studies on Perenniporia were carried out. Phylogeny based on ITS and nrLSU regions revealed that a species clustered within the Perenniporia s.s. clade, further morphological study showed three specimens collected from Hubei Province, central China represent an undescribed species. In the present study, Perenniporia punctata sp. nov. is described. It is characterized by its perennial, resupinate basidiocarps, small circular pores (6–9 per mm) with colour of cream, buff-yellow to pale yellow which turned to clay-buff to cinnamon when bruised, distinctly stratified tubes, a dimitic hyphal system with slightly dextrinoid, cyanophilous skeletal hyphae, and broadly ellipsoid to subglobose, truncate, hyaline, thick-walled, smooth, IKI–, strongly cyanophilous basidiospores (5.5–7 × 4–6 µm).
8
Ana Jurin, Martić, Vidanec Nenad, Smilović Joško, Mavrić Matija, Novak Miljenko, and Jambrešić Petra Mustač. "Acute abdomen as complication of a knee arthroscopy: A case report." Archives of Surgery and Clinical Research 4, no. 2 (December 22, 2020): 051–53. http://dx.doi.org/10.29328/journal.ascr.1001054.
Full textAbstract:
A knee arthroscopy in spinal anaesthesia was performed on a 67 years old male patient. During the procedure the patient was hemodynamically stable, until he suddenly turned pale and started complaining of severe pain in lower abdomen with signs of guarding. The procedure was finished as urgently as possible and after releasing the tourniquet we noticed significant difference in volume of the leg, with redness distal to tourniquet. Urgent lab results were essentially unremarkable and the patient was sent for the urgent radiological diagnostics. CD of the left leg described fluid in the soft tissues of the thigh, scrotum, and abdomen; and the unenhanced CT of the abdomen showed free fluid along the entire femoral shaft of the left thigh, extending towards pelvis and abdomen to perihepatic and perisplenic space, and retroperitoneum, with gas bubbles tracking along anterior aspect of the left thigh into the left retroperitoneum. He was admitted to the ICU, and within few hours all symptoms have resolved and his further recovery was without complications.
9
Jęcz, Jadwiga. "Gdzie jest Komandor? Motyw śmierci w kontekście nieobecności Kamiennego Gościa w utworach Tadeusza Micińskiego „Przy grobie Don Juana Tenorio” i Bolesława Leśmiana [„Zbladła twarz Don Żuana, gdy w ulicznym mroku”]." Prace Literackie 56 (June 29, 2017): 83–101. http://dx.doi.org/10.19195/0079-4767.56.6.
Full textAbstract:
Where is the Commander? The death motif in the context of nonpresence of the Stone Guest in works by Tadeusz Miciński Przy grobie Don Juana Tenorio [By the grave of Don Juan Tenorio] and Bolesław Leśmian Zbladła twarz Don Żuana, gdy w ulicznym mroku [Don Juan’s face turned pale] The story of don Juan, persistently retold by many poets, seems to be only a pretext for showing the problem of presence/absence of Commander and, as a consequence, death motif in the Tadeusz Miciński and Bolesław Leśmian’ s poems. In the don Juan Tenorio history’s final fragments, the Stone Guest was coming to call for don Juan’s conversion. On the seducer’s incessant refusals and rebelling against the laws set by God and society, the Stone Guest was killing him. Don Juan de Maraña, by contrast, has decided to enter a convent — Commander has reclaimed the sinner. In my article I would like to present the motif of death, love, pride, punishment and conversion in two Young Poland’s poems and I would like to describe these problems considering the époque’s esthetic and cultural dimension.
10
Csöndes, I. "Effect of culture media on the growth and morphology of Hungarian Macrophomina phaseolina isolates." Acta Agronomica Hungarica 60, no. 2 (June 1, 2012): 109–29. http://dx.doi.org/10.1556/aagr.60.2012.2.3.
Full textAbstract:
Macrophomina phaseolina (Tassi) Goidanich can cause serious yield losses in several plant species. Investigations were made on the colony morphology of fifty Macrophomina phaseolina isolates from Hungary, one from Spain and two from Serbia on six different culture media to detect differences between the isolates. The fungus exhibited the most intensive growth on maize-flour agar, followed by the Sabouraud-glucose, maltextract, potato-dextrose, Czapek-Dox and watery agar media. Investigations on the macromorphology of the isolates revealed different extents of aerial mycelia formation and differences in the zonal structure of microsclerotial formation on the individual media. One isolate (Mp 38) turned the Sabouraud-glucose agar medium pale pink. Investigations on the micromorphology of the cultures showed that the isolates also varied with respect to microsclerotial characters (size, shape and production of microsclerotia). The microsclerotia of this fungal pathogen had the greatest diameter (averaging 135.31 μm) on Sabouraud-glucose agar medium. This study was the first in Hungary to prove that Macrophomina phaseolina could be grown on nutrient-deficient watery agar, suggesting that it can tolerate a wide range of ecological circumstances.
11
Bezarov, Oleksandr. "Jewish Pogroms in the Historical Context of the First Russian Revolution." Науковий вісник Чернівецького національного університету імені Юрія Федьковича. Історія 1, no. 47 (June 30, 2018): 115–27. http://dx.doi.org/10.31861/hj2018.47.115-127.
Full textAbstract:
The article studies the place and role of Jewish pogroms in the Russian Empire in thehistorical context of the First Russian Revolution of 1905 – 1907. It was proved that Jewish pogroms were a trigger mechanism used by opposition and revolutionary groups in the Russian Empire and beyond, in order to provoke a political confrontation with the Russian government, which was postfactum declared to be the fault of the «mass murder of peaceful Jews». The corresponding propaganda of the «pogrom policy of autocracy» was supported by the opposition and revolutionary periodical press. According to the logic of the Russian opposition it should, firstly, destabilize the internal situation in the country, and, secondly, discredit the autocracy in the eyes of the world community. The confrontation was critical when both sides of the conflict began to resort to the method of pogroms provocation. If anti-government groups used this method at the beginning of the revolutionary events, the Russian authorities turned to the corresponding «services» of the monarchists and the Russian citizens loyal to the regime at the final stage of the revolution when the government demanded more determination in its suppression. The author believes that the First Russian Revolution failed to solve the Jewish question. Accordingly, Russian Jewry again turned into a hostage in the confrontation of the autocracy with the opposition political groups, and the territory of the Jewish Pale of Settlement remained a human capacity and source of energy in the development of the Russian revolutionary movement in subsequent years as well, because if the autocracy succeeded in breaking out the victory of the hands of Jewish revolutionaries in 1905 – 1907, it was only at the cost of victims of their own citizens.
Keywords: Jewish pogroms 1905 ‒ 1907, First Russian Revolution, Bund, Jewish self-defence, Russianempire
12
Prasetyono, Theddeus O. H., and Jesslyn Gustin. "One-Per-Mil Tumescent Infiltration Technique for Vascular Malformation Surgery in Hand and Upper Extremity." Hand Surgery 20, no. 03 (September 21, 2015): 447–52. http://dx.doi.org/10.1142/s0218810415500380.
Full textAbstract:
Background: To present the efficacy of 1:1,000,000 tumescent solution for resection of vascular malformation in hand and upper extremity without tourniquet application. Methods: Four patients with five slow flow vascular malformations were retrospectively reviewed. Prior to incision, 1:1,000,000 tumescent solution was infiltrated subcutaneously surrounding the lesion until the skin turned pale. Amount of tumescent solution injected, the length of surgery, the clarity of the operative field, and the complications were recorded. Clarity of operative field was categorized as totally bloodless, minimum bleeding, acceptable bleeding, and bloody. In the surgeries under local anesthesia, we also recorded self-reported intra-operative pain using VAS score, onset of pain, and conversion of anesthesia. Results: The injected amount of the tumescent solution ranged from 4.5 to 200 mL, with the length of surgery ranged from 60 to 150 minutes. One out of 5 cases was totally bloodless, 3 cases were minimum bleeding and 1 case was acceptable bleeding. Minor skin necrosis was recorded in 1 patient. Neither intra-operative pain nor conversion from local to general anesthesia was reported. Conclusions: 1:1,000,000 tumescent solution is effective for resection of slow flow vascular malformation in hand and upper extremity without tourniquet application.
13
Salem, N. Y., and H. S. Farag. "Clinical, Hematologic, and Molecular Findings in Naturally OccurringBabesia canis vogeliin Egyptian Dogs." Veterinary Medicine International 2014 (2014): 1–6. http://dx.doi.org/10.1155/2014/270345.
Full textAbstract:
Background. Canine babesiosis is a clinically important hemoprotozoan parasite affecting dogs. The goal of this present study was to determine the clinical symptoms and to establish its hematological and microscopic detection and compare it with the PCR findings attained from dogs infected withBabesia canis vogeli.Methodology/Principal Findings. 13-PCR confirmed Babesia-infected dogs were examined; seminested PCR was used to discover the precise type ofBabesiaandBabesia canis vogeliwas the only subspecies detected. The most consistent clinical signs were elevated rectal temperature and a pale mucous membrane. Thrombocytopenia, monocytosis, and lymphocytosis, along with a significant reduction in red cell parameters, were the most commonly recorded hematologic alterations. Microscopic examination revealed the presence of typical large merozoites and trophozoites ofB. canisin the ratio 76.92%.Conclusions/Significance. The presumptive diagnosis of canine babesiosis should be based on a fever and anemia, while thrombocytopenia is considered the hallmark of the disease; microscopic examination may not be very revealing in the detection at low parasitemia, but it remains the most rapid confirmatory method. Seminested PCR turned out to be a sensitive and accurate method for diagnosis; during the process of differentiation betweenBabesiasubspecies, onlyB. canis subsp. vogeliwas detected.
14
Kim, M. K., Y. H. Lee, K. M. Cho, and J. Y. Lee. "First Report of Cobweb Disease Caused by Cladobotryum mycophilum on the Edible Mushroom Pleurotus eryngii in Korea." Plant Disease 96, no. 9 (September 2012): 1374. http://dx.doi.org/10.1094/pdis-01-12-0015-pdn.
Full textAbstract:
Pleurotus eryngii is one of the most commercially important mushrooms in Korea. In May 2009, unusual symptoms were observed in P. eryngii grown in mushroom farms in Changnyeong and Hapcheon, in Gyeong-nam Province, Korea. One of the main symptoms was cobweb-like growth of fungal mycelia over the mushroom surface. Colonies on the surface rapidly overwhelmed the mushrooms, which turned pale brown or yellow. Mushrooms eventually turned dark brown and became rotten. Colonies of the isolates on potato dextrose agar (PDA) were yellowish, and a reddish or orange color was evident in the agar. The colonies grew 20 to 30 mm per day on PDA. Large spores with a single septum were produced on vertically branched conidiophores bearing two to four, mostly three to four, sporogenous cells, ranging from 17.2 to 20.5 μm long and 8.0 to 10.2 μm thick. The shape of the conidia was ellipsoid and obovoid. These morphological characteristics are consistent with descriptions of Cladobotryum mycophilum, a causal agent of cobweb disease in Agaricus bisporus (1,4). To identify the isolated fungal pathogen, the ITS region was amplified with ITS1 and ITS4 primers and sequenced. The sequence data from the isolate was deposited in GenBank (Accession No. JF693809). A BLAST search showed that the isolated strain belonged to a species of Cladobotryum. The highest similarity (99.5%) was to the ITS sequence of C. mycophilum (teleomorph Hypomyces odoratus) (GenBank Accession Nos. JF505112 and Y17096) (3,4). The strain that was tested for pathogenicity was grown on PDA at 25°C for 72 h. The inoculum was prepared by flooding the agar surface with 10 ml of sterilized double distilled water and scraping it with a spatula. The resulting spore suspension was filtered through three layers of cheesecloth. Conidial concentration was adjusted with a hemacytometer to 1 × 106 conidia ml–1. A conidia suspension was inoculated onto each of several stages of mushroom cultivation with a pipette. The control was spotted with double distilled water. In the case of infection during the inoculation and spawn running stages, the fungal mycelia colonized the media and hampered development of the mycelium of P. eryngii. In the regeneration and primordia formation stages of the host, the mycelium of the pathogen covered the surface of the plastic bottle containing the substrates and developed many spores. In the growing and harvesting stages, the surface of mushroom was overwhelmed by the mycelium of the fungal pathogen and turned pale or dark brown, accompanied by cracking of the stipe surface and finally rotting with a foul odor. These symptoms were similar to the observation from natural infection. The symptoms of the cobweb-like disease in A. bisporus (1,2) were observed within 5 to 7 days of inoculation with conidia suspensions of C. mycophilum. Fungi isolated from inoculated mushrooms were shown to be identical, based on phenotypic characteristic, to the inoculated strain used in these pathogenicity tests. No symptoms were observed on controls. To our knowledge, this is the first report on the occurrence of C. mycophilum on the edible mushroom P. eryngii in Korea. Based on the pathogenicity test results, the pathogen could attack P. eryngii in any cultivation stage, making it a potentially serious fungal pathogen in P. eryngii. References: (1) C. G. Back et al. J. Gen. Plant Pathol. 76:232, 2010. (2) R. H. Gaze. Mushroom J. 546:23, 1995. (3) F. J. Gea et al. Plant Dis. 95:1030, 2011. (4) H. M. Grogan and R. H. Gaze. Mycol. Res. 104:357, 2000.
15
Mills, S. J., A. R. Kampf, A. M. McDonald, G. Favreau, and P. J. Chiappero. "Forêtite, a new secondary arsenate mineral from the Cap Garonne mine, France." Mineralogical Magazine 76, no. 3 (June 2012): 769–75. http://dx.doi.org/10.1180/minmag.2012.076.3.24.
Full textAbstract:
AbstractForêtite, ideally Cu2Al2(AsO4)(OH,O,H2O)6, is a new secondary arsenate mineral from the Cap Garonne mine, Var, France (IMA2011-100). It has also been identified at the Salsigne gold mine, Languedoc-Roussillon, France. Although it was identified as a potentially new mineral in 1993, a formal description has only been possible as a result of a new find in a chamber called Annex S located near the entrance of the Cap Garonne mine. Forêtite occurs as pale sky blue to aqua aggregates, up to ∼0.1 mm across, made up of minute plates no more than 20 μm in length. It has a very pale blue streak. Individual crystals have a vitreous lustre and are transparent, whereas clusters appear translucent. The calculated density is 3.286 g cm–3. The crystals are brittle, with an irregular fracture and have a hardness of ∼3–4 on Moh's scale. Forêtite is found in direct association with bariopharmacoalumite, cyanotrichite, parnauite, chalcophyllite and mansfieldite in an Al-rich assemblage which is presumed to have formed under acidic conditions. It is biaxial; the average refractive index measured in white light on aggregates of forêtite crystals is 1.620(5). The empirical formula (based on 10 oxygen atoms per formula unit) is Cu1.94(Al1.96Fe0.04)Σ2.00(As0.84S0.09Si0.04)Σ0.97O10H5.19. Raman spectroscopy confirms the presence of OH and H2O in the structure. Forêtite is triclinic, space group P, with a = 6.969(9), b = 7.676(9), c = 8.591(11) Å, α = 82.01(9), β = 71.68(8), γ = 102.68(8)°, V = 415(1) Å3 and Z = 2. The five strongest lines in the X-ray powder diffraction pattern [d in A ˚ , (I), (hkl)] are as follows: 7.307, (100), (010, 00); 3.141, (24), (200, 00); 2.818, (24), (20, 20); 4.519, (23), (111); 2.343, (22), (11). The mineral is named in honour of Dr Jean-Paul Forêt, who co-founded the project that turned the Cap Garonne mine into a protected site and museum.
16
Nakazawa, Masaru, Takashi Kawamura, and Hirotaka Ishikawa. "Study on Single Sheet Separation from Stacked Flexible Sheets." Journal of Robotics and Mechatronics 10, no. 3 (June 20, 1998): 221–28. http://dx.doi.org/10.20965/jrm.1998.p0221.
Full textAbstract:
We presents a study on separating a single sheet from stacked flexible sheets such as paper, conducted to develop a higher-performance page turner for the disabled. The page turner must separate a single sheet of paper from stacked multiple sheets each time a page is turned. Human dexterity separating sheets using two fingers when turn page was considered, the mechanical principle involved discussed, and experiments and theory compared.
17
Ernst, Daniel R. "Legal Positivism, Abolitionist Litigation, and the New Jersey Slave Case of 1845." Law and History Review 4, no. 2 (1986): 337–65. http://dx.doi.org/10.2307/743831.
Full textAbstract:
At 10:00 A.M. on May 21, 1845, ‘the tall, straight figure and pale, grave face of the slave's friend, Alvan Stewart’, turned toward the justices of the New Jersey Supreme Court as he commenced his opening argument in the companion cases, State v. Post and State v. Van Beuren. In the ensuing hours, Stewart argued for the immediate abolition of slavery and black apprenticeship in New Jersey. Although Stewart relied upon many authorities, the justices and the attorneys for the defendants believed that his most promising argument was based upon the state constitution of 1844, the first of the state's fundamental laws to declare that ‘all men are by nature free and independent’. On the following day, the defense counsel—A.O. Zabriskie, a Hackensack attorney, and Joseph P. Bradley, the future U.S. Supreme Court Justice—spoke with ‘much energy and ingenuity’ until five o'clock. The reply of the ‘Abolition Ajax’ lasted until 10:30 and closed with an impassioned appeal to the justices. ‘Such was the impressiveness with which the closing appeal of the advocate for freedom was delivered’, a newspaperman reported, that none of the large audience wished to ‘break the spell his eloquence had cast upon the assembly’. At length, the bench arose, and Chief Justice Joseph Hornblower adjourned the court.
18
Yan, Shulin, Naixin Zhao, and Xiao-Hua Zhang. "Myroides phaeus sp. nov., isolated from human saliva, and emended descriptions of the genus Myroides and the species Myroides profundi Zhang et al. 2009 and Myroides marinus Cho et al. 2011." International Journal of Systematic and Evolutionary Microbiology 62, Pt_4 (April 1, 2012): 770–75. http://dx.doi.org/10.1099/ijs.0.029215-0.
Full textAbstract:
A novel bacterial strain, designated MY15T, was isolated from a saliva sample taken from a student during a teaching experiment in China. Phylogenetic analyses based on 16S rRNA gene sequences showed that the novel strain was most closely related to Myroides marinus JS-08T, Myroides odoratimimus LMG 4029T and Myroides profundi D25T with 96.5 %, 96.3 % and 96.1 % gene sequence similarities, respectively, demonstrating that the novel strain belonged to the genus Myroides . Strain MY15T formed pale yellow colonies that turned to brown on Luria–Bertani (LB) agar and that gave off a characteristic fruity odour. Cells were Gram-staining-negative, rod-shaped and non-motile. The new isolate contained menaquinone 6 (MK-6) as the major respiratory quinone and C15 : 0 iso (51.2 %), C17 : 0 iso 3-OH (12.9 %) and C13 : 0 iso (10.5 %) as the dominant fatty acids. The G+C content of the DNA was 34.3 mol%. On the basis of this study, based on a polyphasic taxonomic approach, strain MY15T ( = DSM 23313T = LMG 25566T) represents a novel species of the genus Myroides , for which the name Myroides phaeus sp. nov. is proposed. Emended descriptions of the genus Myroides and of the species M. profundi and M. marinus are also given.
19
Chen, R. S., W. L. Wang, J. C. Li, Y. Y. Wang, and J. G. Tsay. "First Report of Papaya Scab Caused by Cladosporium cladosporioides in Taiwan." Plant Disease 93, no. 4 (April 2009): 426. http://dx.doi.org/10.1094/pdis-93-4-0426c.
Full textAbstract:
In March of 2008, a leaf scab disease was observed in a papaya (Carica papaya L.) orchard at Guoshing, 24.03°N, 120.51°E, in Nantou County, Taiwan. Infected papayas developed symptoms of numerous, pale green, water-soaked areas, 0.5 to 1.5 mm. Infected leaves gradually turned white to gray on the upper surface and small, circular swellings were observed on the abaxial surface. Lesions may coalesce to cover more than 50% of the leaf, rendering them to fall prematurely. Lesions on the lower surface of the leaves were covered with olive-gray patches of mycelia and abundant conidia. Pieces (~2 × 2 mm) of diseased leaf tissue from margins of individual lesions were surface disinfected in 1% sodium hypochlorite solution for 1 min, rinsed in sterile water, plated on water agar, and incubated at 25°C. After 4 days, mycelium was isolated and transferred to potato dextrose agar (PDA). Five isolates (Cc-5 to Cc-9) were isolated and identified as Cladosporium cladosporioides (Fresen.) de Vries based on the velvety, olive-brown with almost black reverse colony color and dimensions and color of conidia and conidiophores (1). Conidia formed in long branched chains that readily disarticulate, single celled, elliptical to limoniform, 2 to 9 (4.6) × 2 to 3 (2.2) μm. Conidia were pale-to-olive brown and smooth to verruculose. Ramoconidia were 0 to 1 septate, 6 to 14 (9.4) × 2 to 4 (2.7) μm, smooth or sometimes minutely verruculose. Conidiophores were pale-to-olive brown, macro- and micronemateus, smooth or sometimes verruculose, 68 to 244 (141.7) × 3.2 to 4 (3.9) μm. To confirm the identity of the fungus, the internal transcribed spacer (ITS) 1 and 4 regions and mitochondrial small subunit (mtSSU) rDNA were sequenced (GenBank Accession Nos. EU935608 and FJ362555), which had 99% homology to the ITS and mtSSU rDNA of C. cladosporioides (GenBank Accession Nos. EU497957 and AY291273, respectively). Pathogenicity tests were conducted in the greenhouse at 25°C with natural daylight conditions. Fungal isolate Cc-6 was used; it was grown on PDA for 6 days and a spore suspension was made (106 spores/ml). Three papaya seedlings (cv. Horng-Fe) were sprayed with the spore suspension and covered with plastic bags. Control treatments were sprayed with sterile water. After 2 days, the bags were removed. Symptoms developed on all inoculated seedlings 4 days after inoculation. In all cases, the typical scab symptom, pale green, water-soaked areas on the lower leaf surface, were observed. C. cladosporioides was reisolated from inoculated leaves following the procedure used for the original isolation. Control seedlings developed no symptoms. The five isolates are being maintained at the DBST, NCYU, Taiwan. Previously, papaya scab reported in China was caused by C. cariciolum Corda (2), C. caricinum C. F. Zhang et P. K. Chi (3), and C. cladosporioides (4). To our knowledge, this is the first report of C. cladosporioides causing papaya scab in Taiwan. References: (1) M. B. Ellis. Dematiaceous Hyphomycetes. CMI, Kew, Surrey, England, 1971. (2) H.-H. Peng and Z.-Y. Zhang. J. Yunnan Agric. Univ. 12:23, 1997. (3) C.-F. Zhang. Ph.D. thesis. South China Agricultural University, Guangzhou, P.R.C., 1995. (4) Z. Y. Zhang et al. Flora Fungorum Sinicorum 14:1, 2003.
20
Gubler, W. D., and A. J. Feliciano. "Occurrence of Leaf Blotch and Stem-End Rot of Strawberry in the Central Coast of California." Plant Disease 83, no. 2 (February 1999): 199. http://dx.doi.org/10.1094/pdis.1999.83.2.199a.
Full textAbstract:
Leaf blotch and stem-end rot caused by Gnomonia comari P. Karst. (anamorph, Zythia fragariae Laibach) were observed in a strawberry fruit production field at Watsonville, CA, in 1996. Z. fragariae has been known for years to attack leaves and cause leaf blotch but this is the first time that the perfect stage, G. comari, was identified and documented to infect fruits and cause stem-end rot in California. Symptoms on leaves included pin-point lesions, brownish to purplish blotches, and characteristic large V-shaped lesions. On the fruit, infection showed more frequently on the calyx. Symptoms on the calyx ranged from small lesions on the sepals to a completely infected calyx that turned necrotic and brittle. Calyx infection was observed on seemingly healthy green and ripe fruits. Infected fruits ripened prematurely and turned pale red to brownish in color. They remained firm but were often invaded by secondary organisms including Botrytis cinerea. When infected leaves and fruits were surface sterilized and incubated under humid condition, perithecia and pycnidia readily developed on the lesions. Ascospores oozed from the tip of the perithecial neck while numerous spores oozed out of the pycnidium. The pathogen was identified as G. comari based on size and morphology of the perithecia, asci, and ascospores (1), and the spores were identified as Z. fragariae based on morphology of the conidia and conidiophores (2). Both the spores and ascospores produced pycnidia and perithecia on potato dextroxe agar at room temperature. Inoculation of healthy leaves and fruits with each fungus resulted in development of symptoms of leaf blotch and stem-end rot similar to those observed in the field. G. comari and Z. fragariae were reisolated from newly developing lesions on symptomatic leaves and fruits. Since 1996, stem-end rot has been observed more frequently in fruit production areas in the central coast of California, particularly during wet years. Reference: (1) A. Bolay. Ber. Schweiz. Bot. Ges. 81:398, 1971. (2) J. Fall. Can. J. Bot. 32:172, 1954.
21
Lamichhane, J. R., G. M. Balestra, and L. Varvaro. "Severe Outbreak of Bacterial Canker Caused by Clavibacter michiganensis subsp. michiganensis on Tomato in Central Italy." Plant Disease 95, no. 2 (February 2011): 221. http://dx.doi.org/10.1094/pdis-09-10-0635.
Full textAbstract:
From May to July 2010, severe outbreaks of bacterial canker of tomato (Solanum lycopersicum L.) were observed in 16 fields in the Province of Viterbo, central Italy. Cultivars affected were Uno Rosso, Peto 1296, UG 812, UG 822, and Podium. Disease incidence ranged from 70 to 100% and was highest for Uno Rosso followed by UG 812, UG 822, Peto 1296, and Podium. Leaf symptoms initially appeared as interveinal, pale green, water-soaked areas that quickly turned yellow-brown to necrotic, resembling sunburn. Infected parts of the plants began to wilt and then die. Light yellow-to-brown streaks or cankers appeared on stems and the cankers darkened. As the disease progressed, affected stems split lengthwise and a pale yellow-to-reddish brown discoloration of the vascular tissue was observed. The pith of infected stems turned brown, granular to mealy, and filled with cavities. Dividing the stem into two pieces lengthwise revealed yellowing of vascular tissues in the fruits that otherwise was asymptomatic. Eventually, vascular wilting and premature death of entire plants were observed. Once a month, infected samples were randomly collected three times from each field from five plants. A gram-positive, nonmotile, nonspore forming, aerobic, curved, rod-shaped bacterium was consistently isolated onto nutrient broth yeast extract agar medium from symptomatic plant tissues. Strains tested positive for gelatin liquefaction, H2S production from peptone, utilization of citrate and negative for starch hydrolysis. Forty-five isolates were used to inoculate four-o'clock (Mirabilis jalapa L.) plants by injecting a bacterial suspension of the appropriate isolate in sterilized distilled water (108 CFU/ml) into leaves (1). Known strains of Clavibacter michiganensis subsp. michiganensis (DPP22) and Pseudomonas fluorescens (DPP09N) were used as positive and negative control treatments, respectively. Four leaves per plant and three plants were inoculated for each bacterial strain and control treatment. All 45 tomato field isolates and the known strain of C. michiganensis subsp. michiganensis produced a hypersensitive reaction within 48 h. Pathogenicity tests were performed on 3-week-old, potted tomato seedlings (cv. Ciliegino) by placing a drop of the appropriate bacterial suspension (108 CFU/ml) on wounds created by excising the leaf petiole. The inoculated plants were maintained at 26 ± 1°C in a greenhouse. The two control isolates were similarly inoculated onto tomato seedlings. After 15 days, all inoculated plants developed symptoms, whereas negative control plants remained asymptomatic. Bacteria reisolated from inoculated leaf lesions had the same characteristics as the original bacteria. A 1,400-bp region of the 16S rDNA was amplified from 15 of the 45 strains with primers NOC 1F (AGAGTTTGATCATGGCTCAG) and NOC 3R (ACGGTTACCTTGTTACGACTT) and sequenced (GenBank Accession Nos. HQ144228 to HQ144242; strains CmmVT1 to CmmVT15). A BlastN search of the sequences in GenBank revealed the tomato strains had 99 to 100% identity with the 16S rDNA sequences of C. michiganensis subsp. michiganensis strains (GenBank Accession Nos. EU 685335, AM711867, and AM410696). In Italy, this pathogen was first reported in 1914 in Vasto and later in a few other regions. However, to our knowledge, this is the first observation of widespread outbreaks in >300 ha of tomato fields with severe economic losses. Reference: (1) R. D. Gitaitis. Plant Dis. 74:58, 1990.
22
HEINRICH, BERND. "Is ‘Reflectance’ Basking Real?" Journal of Experimental Biology 154, no. 1 (November 1, 1990): 31–43. http://dx.doi.org/10.1242/jeb.154.1.31.
Full textAbstract:
Various kinds of butterflies raise both (or sometimes one) of their pairs of wings while basking with their body at approximately right angles to the incident solar radiation and with their wings held at an acute angle to the incident sunlight. I here test the effects of wing posture on thoracic temperature in so-called ‘reflectance’ basking. 1. Butterflies with pale yellow or white dorsal wing surfaces held with their wings at 45, 90 or 180° with respect to each other (or 22–23, 45 and 90°with respect to the solar radiation) heated to mean thoracic temperatures (Tth) of 38.2, 39.5 and 39.9°C, respectively, in direct sunlight. These closely similar values of T^ are significantly different (P < 0.02) from each other, but the difference is in the opposite direction to that predicted by the solar reflectance hypothesis. 2. The Tth of butterflies tested under a sun lamp in the laboratory showed the same trend of Tth with wing angle. Reflectance from the wings thus makes little or no practical contribution to the animal's heating response. 3. Butterflies with wings at 45° that were heated from above with a sun lamp showed an immediate increase in Tth when turned at right angles to a gentle air stream. Thoracic temperature immediately declined when they were again turned to face the air stream. 4. Those butterflies that were at right angles to the air stream showed an immediate increase in Tth when the wings were raised from 180 to 45°, and their Tth again declined to previous values when the wings were again lowered. However, little or no effect of wing angle on Tth was observed when the wing angle of butterflies parallel to the air stream was altered. These results indicate that wing elevation in basking butterflies does not increase Tth by way of solar reflection from the wings. Instead, the raised wings increase Tth by reducing convective cooling. ‘Reflectance’ basking is a form of dorsal basking used by species of butterflies that perch above vegetation rather than above a heated substratum.
23
Dallagnol, L. J., L. V. Ferreira, J. A. Araujo-Filho, L. E. A. Camargo, and F. R. de Castro-Moretti. "Gray Mold Caused by Botryotinia fuckeliana on Edible Pods of Pea in Brazil." Plant Disease 98, no. 4 (April 2014): 569. http://dx.doi.org/10.1094/pdis-08-13-0814-pdn.
Full textAbstract:
Gray mold on edible pods of snow pea (Pisum sativum Lam. [Fabaceae]) was observed in greenhouse-cultivated pea (cvs. Luana Gigante and Gigante Flor Roxa) in the city of Pelotas (Rio Grande do Sul, Brazil) in September and October 2012. The incidence of diseased pods was high (∼25% of immature pods) after up to 3 cloudy and rainy days that hindered the ventilation inside the greenhouse resulting in high relative humidity. Infection occurred first on senescing petals adhered to the forming pods, leading to pod abortion or rotting that began at the contact site with the infected petal. The first symptoms on pods included water soaked tissue that quickly turned light brown and progressed to necrosis. Conidia and conidiophores produced on profuse gray mycelium could be easily seen on infected tissue 2 to 3 days after the appearance of symptoms. Conidiophores were smooth-walled, 400 μm to over 1.5 mm long, hyaline to pale brown, and branched in their upper part; each branch ended with a hemispherical or spherical swelling, 5 to 9 μm in diameter with minute sterigmata. Macroconidia were globose, ellipsoidal, smooth, hyaline to pale brown, usually with protuberant hila, 7 to 15 × 5 to 9 μm. Microconidia were not observed. On potato dextrose agar (PDA), colonies were fast-growing, white, low, covering entire 10 cm petri plates in 4 to 5 days when they turned gray to brownish-gray. Conidiophores and conidia were often formed in sectors. Shield-like, elliptical, lenticular to irregular, black, 1.5 to 6.0 × 1.0 to 4.0 mm sclerotia developed in 10-day-old colonies incubated at room temperature. Genomic DNA was extracted from conidia, conidiophores, and mycelium and used to amplify both the internal transcribed spacer (ITS) (ITS1-5.8s-ITS2) region and the β-tubulin gene using the ITS1/4 and Bt2a/b primers, respectively (1,4). The ITS (541 bp) and β-tubulin (467 bp) sequences were deposited in GenBank under accessions KC683713 and KC683712, respectively. BLASTn searches revealed similarity of 100% (EF207415) and 99% (FQ790278) with Botryotinia fuckeliana (De Bary) Whetzel for the ITS and β- tubulin sequences, respectively. Based on morphological characteristics and sequence analysis, the pathogen causing pod rot of peas was identified as B. fuckeliana. To fulfill Koch's postulates, 10 unwounded pods of P. sativum ‘Luana Gigante’ were inoculated by depositing PDA plugs (5 mm) colonized with fungal mycelium on their surface. Non-inoculated and mock-inoculated pods with sterile PDA plugs served as control. Inoculated and control pods were incubated inside a clear plastic box (11 × 11 × 3.5 cm) and over moistened filter paper under 12-h photoperiod at 25 ± 1°C. A surrounding water-soaked halo was visible only on pods inoculated with the fungus 48 h after inoculation (hai). Intense sporulation and necrosis were visible 96 hai. Botrytis spp. was previously detected, through standard blotter test, on seeds of P. sativum in Brazil, but without pathogenicity test nor its transmission through seeds (2,3). To our knowledge, this is the first report of B. fuckeliana causing epidemics on pea pods in Brazil. The high incidence of the disease in a protected environment has the potential to cause significant economic impact due to its damage to the pods, rendering them unmarketable. References: (1) N. L. Glass and G. Donaldson. Appl. Environ. Microbiol. 61:1323, 1995. (2) M. A. S. Mendes et al. Fungos em Plantas no Brasil. Embrapa-Cenargen, Brasília, 1998. (3) W. M. Nascimento and S. M. Cícero. Rev. Bras. Sementes 13:5, 1991. (4) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.
24
Reis, Ailton, Leonardo S. Boiteux, Milton L. Paz-Lima, Patrícia P. Silva, and Carlos A. Lopes. "Powdery mildew of Allium species caused by Oidiopsis taurica in Brazil." Horticultura Brasileira 22, no. 4 (December 2004): 758–60. http://dx.doi.org/10.1590/s0102-05362004000400018.
Full textAbstract:
Oidiopsis taurica Salmon (Syn. Oidiopsis sicula Scalia) was identified as the causal agent of a powdery mildew disease occurring on distinct Allium species in Brazil. This disease was initially observed in plastic house and field-grown garlic (Allium sativum) and leek (A. porrum) accessions in Brasília (Federal District) and in field-grown and greenhouse onion (A. cepa) cultivars in Belém do São Francisco (Pernambuco State) and Brasília, respectively. Typical symptoms consisted of chlorotic areas on the leaf surface corresponding to a fungal colony. These lesions turned to a brownish color with the progress of the disease. Fungi morphology was similar to that described for O. taurica. Endophytic mycelium emerging through estomata, light pale conidia were dimorphic (lanceolate primary conidia and somewhat cylindrical secondary conidia), fibrosin bodies were absent, conidia formed predominantly single (not in chains), and appressoria were non-lobed. Its sexual stage, Leveillula taurica (Lev.) Arnaud, was not observed. Inoculations were performed with the O. taurica isolates from distinct Allium hosts. These isolates were also pathogenic to sweet pepper and tomato, indicating an apparent absence of host specialization. One bunching onion (A. fistulosum) accessions was not infected by O. taurica suggesting that this species might carry useful resistance alleles to this pathogen. This is the first formal report of a powdery mildew disease on species of the genus Allium in Brazil. This disease might become important on these vegetable crops especially in hot and dry areas such as those in the Central and Northeast regions of Brazil.
25
Noonkester, Myron C. "The Third British Empire: Transplanting the English Shire to Wales, Scotland, Ireland, and America." Journal of British Studies 36, no. 3 (July 1997): 251–84. http://dx.doi.org/10.1086/386137.
Full textAbstract:
During their hegemony in world affairs, the English exported persons, commodities, and texts to regions that they absorbed into a widening pale of influence. Discussion of these ventures has consumed a vast literature. What once seemed to be a simple matter of transporting Protestantism (or convicts) into an overseas wilderness or making distant lands safe for English farming and trade now seems a matter too complex to be captured in a metaphor or an alliterative catchphrase. Yet it remains a matter of historical fascination that a relatively small archipelago off the coast of Europe not only could become the first “modern” nation-state but could then transform itself into a vast global empire, ultimately making it seem as if the affairs of this proverbial workshop encompassed world history itself. For many years, such success seemed too evident for investigation, and scholarly attention turned toward explaining how this achievement unraveled or declined. The result has been a quest for detailed precision and microhistorical reconstruction on the part of those who have adopted an “empirical,” geopolitical approach to imperialism and an outpouring of criticism from those who, on the opposite end of the ideological spectrum, have penned polemical classics whose evocative, if not evidentiary, power envisioned revolution as historical destiny and a means of filling the intellectual and political void left by imperial evacuation. Their disagreements notwithstanding, however, both categories of imperial commentary display relative innocence of the paradox that imperial power represented: that, despite voluble criticism, it enjoyed eclipsing success for a time and produced effects whose mysteries continue to survive postcolonial deconstruction.
26
Prakasha, D. P., G. Ramya, and G. B. Srinivasalu. "Morphogenetic Responses in Anthurium Andreanum (Hort) Cultivars." Current Agriculture Research Journal 5, no. 1 (May 29, 2017): 135–40. http://dx.doi.org/10.12944/carj.5.1.16.
Full textAbstract:
In this study, in vitro morphogenetic responses have been studied in popular Anthurium andreanum cultivars Tropical Red, Acropolis, Sun Glow, Esmeralda, Chaco, Pistachio, Neveda and Safari employing explants of various types and growth stages, through indirect organogenesis. Creamy and compact callus initiated in cut ends along the veins of Leaf lamina with mid rib (LLMR) and petiole with leaf (PL) explants of various cultivars in 30-120 days of inoculation, it was sub cultured and incubated in dark for proliferation. Leaf tip, candle and petioles did not show any kind of response, turned brown and died later. Explants from young pale green leaves with smooth structure showed early response in all cultivars. Callus proliferation rate was 3.0-5.0 times 30-35 days of incubation in various cultivars. Shoot bud initiation and elongation observed after 45-60 days incubation in dark. Number of shoot buds per explants ranged from 30-60 per explants and 8-10 buds attained 1.5-2.5 cm in height. Then, shoots were separated, inoculated in shoot elongation medium and incubated in light. Remaining callus was sub cultured in callus multiplication medium and incubated in dark. Callus and shoot multiplication ratio was 1-2 and 2.5-4.2 times respectively. Shoots attained 4-5.3 cm in height in 45-55 days, rooted and ready for hardening in 65-80 days. Rooted plantlets were hardened in 1:1 ratio soil rite and coco-peat mix in portrays, transferred to beds prepared with coconut coir-pith, 95% plants survived, appeared normal and flowered. In this paper, materials, methodology, results will be discussed.
27
Erper, I., H. Mennan, U. Budak, and E. Kaya Altop. "Exserohilum monoceras, Newly Reported on Late Watergrass in Turkey." Plant Disease 95, no. 4 (April 2011): 497. http://dx.doi.org/10.1094/pdis-12-10-0867.
Full textAbstract:
Echinochloa species are major weeds in rice-cropping systems and are among the most noxious weeds in the world. Throughout the world, Echinochloa oryzicola Vasing, (late watergrass) is one of the most important and serious weed species of this genus. In September 2010, punctiform, purplish dark brown leaf spots were observed on leaves and sheaths of Echinochloa oryzicola in a rice field in Terme, Turkey (41°13.412′N, 36°56.248′E). Individual lesions ranged from 1 to 3 mm in diameter. Infected leaf and sheaths were surface disinfected for 1 min in 1% NaOCl, plated on potato dextrose agar (PDA), and incubated at 25°C. Colonies of pure cultures on PDA turned to dark green colonies with increasing age. Conidia were 87 to 147 (120) × 15 to 21 (19) μm (n = 50), 6 to 10 pseudoseptate, straight or slightly curved, fusiform, tapering gradually toward the base, pale-to-dark straw colored, smooth, with a small protruding plenum-type hilum. The fungus was identified as Exserohilum monoceras (Drechsler) Leonard & Suggs based on its micromorphology and cultural features (1,2). Conidia were harvested from 3-week-old cultures grown on PDA by brushing the surface of the colonies with a small paint brush, suspending the conidia in sterile distilled water and filtering through cheesecloth for pathogenicity tests. Conidia were then diluted in sterile distilled water plus 0.1% polysorbate 20 to a concentration of 1 × 106 conidia/ml. Leaves and stems of Echinochloa oryzicola at the three-leaf stage were spray inoculated with 10 ml of this aqueous suspension per plant. Three inoculated plants and three noninoculated plants were placed in a dew chamber at 18 to 22°C with continuous dew, and after 48 h, plants were moved to a greenhouse bench. Symptoms, similar to those originally observed in the field, began to appear on the leaf and sheaths approximately 10 days later and E. monoceras was reisolated, successfully completing Koch's postulates. No symptoms developed on the control plants. E. monoceras has also been reported on Echinochloa oryzicola in Japan (3). To our knowledge, this is the first report of leaf spot on Echinochloa oryzicola caused by E. monoceras in Turkey where the fungus may have potential as a biological control agent. References: (1) M. B. Ellis. Dematiaceous Hyphomycetes. Commonwealth Mycological Institute. Kew, Surrey, England, 1971. (2) M. Sisterna and R. Bezus. Plant Dis. 85:803, 2001. (3) H. Tsukamoton et al. Ann. Phytopathol. Soc. Jpn. 64:526, 1998.
28
Wang, S. H., D. Zhao, and J. J. Gao. "First Report of Corynespora Leaf Spot Caused by C. cassiicola on Golden Vicary Privet (Ligustrum × vicaryi) in China." Plant Disease 97, no. 8 (August 2013): 1113. http://dx.doi.org/10.1094/pdis-11-12-1062-pdn.
Full textAbstract:
Golden vicary privet (Ligustrum × vicaryi Rehd.), a hybrid between L. ovalifolium ‘Aureum’ Rehd. and L. vulgare L., is widely used as a landscape shrub for horticultural ornamentation. From 2009 to 2011, a leaf spot disease of L. × vicaryi was observed in the parks in Luoyang, Henan Province, China. Lesions were initially brown and punctiform, and with age the lesions turned into elliptic, subcircular to irregular and pale brown, faintly zonate, and depressed. Fully mature lesions were mostly irregular to circular, 5 to 15 mm in diameter, centers tan to dark brown, with reddish brown to reddish purple margins of varying width. The disease eventually caused substantial premature defoliation. After infected leaves were collected from parks and maintained in a humid atmosphere, a layer of black mold developed on the surface of the lesions. Conidiophores were cylindrical, straight to slightly curved, brown, unbranched (2 to 7 septa), and were 98.5 to 403.9 μm in length, 4.5 to 6.6 μm in width. Conidia were solitary or in short chains containing two to five spores, and were cylindrical or obclavate, straight or flexuose (3 to 19 pseudosepta), pale olivaceous brown or brown when mature, and were 78.8 to 315.2 μm in length by 5.3 to 12.3 μm in width. Morphological characteristics of the fungus were similar to those of Corynespora cassiicola (Berk. & Curt.) Wei (1). Lesions on leaves were excised, surface sterilized, and plated on potato dextrose agar (PDA) and incubated at 25°C for 2 to 3 days. A fungus was isolated from the lesions, and pure isolates that were obtained after from single spored isolates were cultured on PDA. Colonies on PDA formed concentric growth rings, abundant aerial mycelia, and were grey or dark brown in color. The isolate ST1 was selected as a representative for molecular identification. The ITS1-5.8S-ITS2 region of the isolate was amplified by PCR with primers ITS1/ITS4 (3) and sequenced. BLAST analysis of the 559 bp amplicon (GenBank Accession No. KC138855) indicated 100% sequence similarity with C. cassiicola (GU138988) (2). To validate Koch's postulates, pathogenicity tests were performed by spraying leaves of five healthy potted L. vicaryi with a 106 conidia per ml aqueous suspension. Control plants were inoculated with sterile water. Plants were covered with plastic bags for 24 h after inoculation and maintained at 25°C. After 3 days, all inoculated plants showed typical symptoms, whereas water sprayed controls remained healthy. C. cassiicola was consistently reisolated from these lesions. The reisolated conidia showed the same morphological characteristics as described above. To our knowledge, this is the first report of leaf spot caused by C. cassiicola on L. × vicaryi in China. Its confirmation is a significant step toward management recommendations for growers. References: (1) M. B. Ellis et al. Corynespora cassiicola. CMI Descriptions of Pathogenic Fungi and Bacteria, no. 303. Commonwealth Mycological Institute, Kew, UK, 1971. (2) X. B. Liu et al. Plant Dis. 94:916, 2010. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.
29
Corcoran, Clodagh, and Rose Doyle. "Page Turner." Books Ireland, no. 255 (2003): 15. http://dx.doi.org/10.2307/20632530.
Full text
30
Anscombe, N. "Page turner." Engineering & Technology 5, no. 18 (December 4, 2010): 26–29. http://dx.doi.org/10.1049/et.2010.1804.
Full text
31
Park, J. H., S. E. Cho, K. S. Han, B. S. Kim, and H. D. Shin. "First Report of Choanephora Rot Caused by Choanephora cucurbitarum on Hosta plantaginea in Korea." Plant Disease 99, no. 1 (January 2015): 158. http://dx.doi.org/10.1094/pdis-07-14-0751-pdn.
Full textAbstract:
Hosta plantaginea (Lam.) Asch. is an herbaceous perennial plant with ornamental value. In August 2013, water-soaked spots and wet rot were found on flowers of H. plantaginea in a garden bedded out for landscaping in Hongcheon County, Korea. Symptoms initially appeared as water-soaked spots at the tips of flowers. Dark gray spots on flower petals often coalesced and led to rotting of flowers, with abundant sporulation. However, no symptoms were found on the leaves. Approximately 30% of the flowers were affected in the landscape bed. A fungal isolate was obtained by plating surface-disinfested diseased flower tissue on potato dextrose agar (PDA). Fungal colonies covering the plate (diam. 90 mm) in 48 h were white at first, with abundant aerial mycelia, but later turned pale yellow with abundant sporangiola. Sporangiophores bearing sporangiola were aseptate, hyaline, and usually arose from infected tissue. Sporangiola were ellipsoid to ovoid, indehiscent, brown to dark brown, pediculate, 7 to 12 μm wide and 9 to 20 μm high, and showed longitudinal striations at high magnification. Sporangia were few-spored to multispored, pale brown to brown, and 50 to 150 μm. Sporangiospores from sporangia were broadly ellipsoid, brown to pale brown, with hyaline polar appendages, 8 to 10 μm wide and 15 to 22 μm high. Zygospores were not observed. The morphological and cultural characteristics, especially based on shape and striation of sporangiola, were identical with those of Choanephora cucurbitarum (Berk. & Ravenel) Thaxt. (2,3). A representative specimen was deposited in the Korea University Herbarium (KUS-F27540). Genomic DNA was extracted using a DNeasy Plant Mini Kit (Qiagen Inc., Valencia, CA). The primers ITS1/ITS4 and NL1/LR3 were used to amplify the internal transcribed spacer (ITS) region of rDNA and the D1/D2 region of the large subunit (LSU), respectively (4). The PCR products were purified and directly sequenced. The resulting 594-bp ITS and 680-bp D1/D2 sequences were submitted to GenBank (Accession Nos. KM200034 and KM200035). A GenBank BLAST search of the fungal database showed that the sequences of ITS and D1/D2 regions matched those of C. cucurbitrarum (JN943006 and JN939195) with 100% similarity. A pathogenicity test was conducted by spraying three healthy potted plants (2 months old) with a sporangiola suspension (2 × 104 conidia/ml). Another three potted plants of the same age were treated with sterile water and served as controls. The plants were kept in humid chambers for 2 days and placed in a greenhouse (28°C and 60 to 80% RH). After 4 to 5 days, water-soaked spots were evident on the flowers of inoculated plants. No symptoms were observed on control plants. A pathogenicity test was conducted twice with the same results, fulfilling Koch's postulates. C. cucurbitarum has a wide host range but has not been previously reported to cause disease on H. plantaginea (1). To our knowledge, this is the first report of C. cucurbitarum on H. plantaginea globally as well as in Korea. Choanephora rot of flowers is an issue under high-moisture conditions, so allowing for adequate airflow and a dry plant canopy should aid in disease suppression. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases. Syst. Mycol. Microbiol. Lab. Online publication, ARS, USDA, retrieved July 11, 2014. (2) P. M. Kirk. Mycol. Pap. 152:1, 1984. (3) A. Saroj et al. Plant Dis. 96:293, 2012. (4) G. Walther et al. Persoonia 30:11, 2013.
32
Arduin, M., G. W. Fernandes, and J. E. Kraus. "Morphogenesis of galls induced by Baccharopelma dracunculifoliae (Hemiptera: Psyllidae) on Baccharis dracunculifolia (Asteraceae) leaves." Brazilian Journal of Biology 65, no. 4 (November 2005): 559–71. http://dx.doi.org/10.1590/s1519-69842005000400002.
Full textAbstract:
The commonest insect gall on Baccharis dracunculifolia (Asteraceae) leaves is induced by Baccharopelma dracunculifoliae (Hemiptera, Psyllidae). The gall-inducing insect attacks young leaves in both the unfolded and the fully expanded stages. Four developmental phases were observed in this type of gall: 1) A folding phase, during which the leaf lamina folded upward alongside the midrib and the edges of the upper portion of the leaf approached each other, forming a longitudinal slit. A single chamber was formed on the adaxial surface of the leaf; 2) A swelling phase, in which the folded leaf tissues thickened and the edges of the leaf drew closer together, narrowing the slit. In this phase the gall matured, turning succulent, fusiform and pale green. The single nymphal chamber was lined with white wax and was able to house from one to several nymphs; 3) A dehiscence phase, characterized by the opening of the slit to release inducers; and 4) A senescence phase, when the gall turned dark and dry. The dermal system of the mature gall was composed of a single-layered epidermis. The mesophyll was swollen, and the swelling was due mainly to hyperplasia of the parenchyma. The vascular tissues along the midrib vein were conspicuous and the perivascular fibers resembled parenchymal cells. The hypertrophied secretory cavities contained low lipophylic content. This gall does not form nutritive tissue, but salivary sheaths left by the inducers were observed near the parenchyma, vascular bundles and secretory cavities. This study complements our current knowledge of gall biology and sheds further light on the plasticity of plant tissues stimulated by biotic factors.
33
Zeng, Qingrui, Suyue Guo, Yuanbo Sun, Zhuojuan Li, and Wei Feng. "Protonation-Induced Enhanced Optical-Light Photochromic Properties of an Inorganic-Organic Phosphomolybdic Acid/Polyaniline Hybrid Thin Film." Nanomaterials 10, no. 9 (September 15, 2020): 1839. http://dx.doi.org/10.3390/nano10091839.
Full textAbstract:
A phosphomolybdic acid/polyaniline (PMoA/PANI) optical-light photochromic inorganic/organic hybrid thin film was successfully synthesized by protonation between the the multiprotonic acid phosphomolybdic acid (H3PO4·12MoO3) and the conductive polymer polyaniline. The stable Keggin-type structure of PMoA was maintained throughout the process. Protonation and proton transfer successfully transformed the quinone structure of eigenstate PANI into the benzene structure of single-polarized PANI in the PMoA/PANI hybridized thin film, and proton transfer transformed the benzene structure of single-polarized PANI back to the quinone structure of eigenstate PANI in the PMoA/PANI hybrid thin film, as verified by Fourier transform infrared spectroscopy (FTIR) and X-ray photoelectron spectroscopy (XPS). The average distribution of PMoA/PANI was observed by atom force microscopy (AFM). Interestingly, protonation of PMoA caused PANI to trigger transformation of the quinone structure into the single-polarized benzene structure, which enhanced the electron delocalization ability and vastly enhanced the maximum light absorption of the PMoA/PANI hybrid thin film as confirmed by density functional theory (DFT), electrochemistry, and ultraviolet-visible spectroscopy (UV-Vis) studies. Under optical-light illumination, the pale-yellow PMoA/PANI hybrid thin film gradually turned deep blue, thus demonstrating a photochromic response, and reversible photochromism was also observed in the presence of hydrogen peroxide (H2O2) or oxygen (O2). After 40 min of optical-light illumination, 36% of the Mo5+ species in PMoA was photoreduced via a protonation-induced proton transfer mechanism, and this proton transfer resulted in a structural change of PANI, as observed by XPS, generating a dominant structure with high maximum light absorption of 3.46, when compared with the literature reports.
34
Ishida, Kyoko, and Taizo Hogetsu. "Role of resin canals in the early stages of pine wilt disease caused by the pine wood nematode." Canadian Journal of Botany 75, no. 2 (February 1, 1997): 346–51. http://dx.doi.org/10.1139/b97-036.
Full textAbstract:
The role of cortical resin canals in the early development of a pine wilt disease in Japanese black pine, Pinus thunbergii, was studied. A part of the bark of a 2 cm long segment from a current-year stem was removed by a tangential cut with a razor blade. Both cortex-exposed segments with cut cortical resin canals (designated as +RC segments) and those without cut resin canals (–RC segments) were obtained by chance. When a virulent nematode isolate (S6-1) was inoculated onto the cut surface, the surface of the +RC segments turned brown 4 d after inoculation, and in some segments this browning occurred more intensely around cortical resin canals. When segments were cut transversely at the middle, the transverse cut surface of the inoculated +RC segments was brown and fragile, but that of the inoculated –RC segments was pale green and stable, as was that of the non-inoculated controls. Correspondingly, tissue cells including epithelial cells of the cortical resin canal of the +RC segments were all dead, but those of the –RC segments and the controls were alive. When nematodes were inoculated onto the inner surface (cambium side) of a bark peeling at which cambial xylem cells were exposed, they did not kill the cambial cells. When inoculated on the transverse cut end of a bark peeling from which nematodes would enter resin canals, nematodes killed all cells in the peeling. The above results indicate that nematodes do not kill cortical cells immediately after inoculation but become harmful to pine cells after living in cortical resin canals. Key words: Bursaphelenchus xylophilus, pine wilt disease, pine wood nematode, Pinus thunbergii, resin canal.
35
McBeath, J. H., M. Cheng, P. A. Gay, and T. Yokogi. "First Report of Leaf Smut on Fescue (Festuca rubra) Caused by Urocystis agropyri in Interior Alaska." Plant Disease 92, no. 4 (April 2008): 652. http://dx.doi.org/10.1094/pdis-92-4-0652a.
Full textAbstract:
In June and early July of 2003 and July of 2007, a smut disease was found on fescue (Festuca rubra L.) at the Fairbanks Golf and Country Club and vicinities, Interior Alaska. Diseased plants were pale green-to-slightly yellow and stunted. The lesions were long, narrow, yellowish green streaks parallel to the veins of leaves and sheaths. At a later stage, sori developed under the epidermis and the leaves and sheaths turned silvery gray. Rupture of the epidermis resulted in the release of masses of black spores that covered the leaves, especially along and within infected sheaths. Microscopic observation showed spore balls consisting of one-to-four, dark reddish brown teliospores surrounded by small, hyaline-to-light brown sterile cells. The spore balls were globose to elongate and 16 to 32 × 18 to 38 μm. The teliospores were globose, dark reddish brown, and 7.5 to 20 μm in diameter. Urocystis agropyri is recognized by R. W. Smiley et al. (2) and J. D. Smith et al. (3) as occurring on turf grasses; K. Vánky (4) restricts this species to Elymus spp. and recognizes U. ulei as the valid species infecting Festuca spp, including F. rubra. On the basis of host symptoms and morphology of spores, the smut found on F. rubra in Alaska fits better with published descriptions of U. agropyri (Preuss) Schrot (2,3), however, it likely is not conspecific with flag smut of wheat. For molecular verification of this identification, DNA was isolated from teliospores with a DNeasy Plant Mini Kit (Qiagen, Valencia, CA). Primers were designed for amplification of the large subunit ribosomal gene based on the only two published sequences of U. ranunculi (Lib.) Moesz (GenBank Accession No. AF009879) and U. colchici (Schltdl.) Rabenh (GenBank Accession No. AF009878) (1). A 400-bp PCR product was amplified by the forward primer 3′-GCATTGTAAACTCAGAAGTGTTATCCG-5′ and reverse primer 5′-TTCCCTAAACCTATATCCGGCG-3′. Nucleotide sequence of the PCR product (GenBank Accession No. AY547283) shared 97.7% homology with U. ranunculi and 98.2% with U. colchici. Comparison of nucleotide sequences will be more meaningful in the identification of species of Urocystis when additional sequences are published. To our knowledge, this is the first report of U. agropyri from turfgrass in Alaska. References: (1) D. Begerow et al. Can. J. Bot. 75:2045, 1997. (2) R. W. Smiley et al. Compendium of Turfgrass Diseases. 3rd ed. The American Phytopathological Society, St Paul, MN, 2005. (3) J. D. Smith et al. Page 189 in: Fungal Diseases of Amenity Turf Grassess. E. & F. N. Spon, London, 1989. (4) K. Vánky. Page 308 in: European Smut Fungi. Gustav Fischer Verlag, NY. 1994.
36
Makal, Henny V. G., and Deflly A. S. Turang. "PEMANFAATAN EKSTRAK KASAR BATANG SERAI UNTUK PENGENDALIAN LARVA Crosidolomia binotalis Zell. PADA TANAMAN KUBIS." EUGENIA 17, no. 1 (April 1, 2011): 16. http://dx.doi.org/10.35791/eug.17.1.2011.95.
Full textAbstract:
Theresearch wasaimed to assess effect of some concentrations of lemon grass stem extract to C.binotalis larvae. The advantage of the research was to give information the use lemon grass stemextract as a botanical insecticide to control C. binotalis larvae. The result showed that after applicationof the lemon grass stem extract, the C. binotalis larvae showed symptoms such as inactive of eating,inactive of movement and eventually death of larvae C. binotalis.The death of larvae was showingchanging of color at dorsal and ventral. The color at the dorsal became pale yellow and the color atventral turned to light brown.The death larvae subsequently were hardened and the entire body thelarvae were blackish brown.The percentage of C. binotalis larvae mortality increased when theconcentration of lemon grass stem extract was also increased.Concentration 80 g/50 ml resulted 95 %death of total tested larvae. It could be concluded thatlemon grass stem extract can be used to controllarvae of C.binotalis on cabbage. ABSTRAKPenelitian ini bertujuan untuk mengetahui pengaruh beberapa konsentrasi ekstrak batang seraiterhadap larva C. binotalis. Manfaat dari penelitian ini adalah untuk memberikan informasi tentangpenggunaan ekstrak batang serai sebagai insektisida botani untuk mengendalikan larva C. binotalis.Gejala kematian larva C. binotalis setelah aplikasi ekstrak batang serai pada awalnya larva kelihatangelisah, tidak aktif makan kemudian menjadi tidak aktif bergerak dan akhirnya mati. Larva yang matiterjadi perubahan warna, pada bagian dorsal berwarna kuning pucat dan bagian ventral berwarnacoklat muda dan lama kelamaan seluruh tubuh mengeras dan berwarna coklat kehitaman. Hasilpenelitian menunjukan bahwa persentase mortalitas larva C binotalis meningkat seiring denganmeningkatnya konsentrasi ekstrak batang serai yang diaplikasikan. Pada konsentrasi ekstrak batangserai 80g/ml menyebabkan mortalitas sebesar 95% dari keseluruhan larva uji. Berdasarkan hasil ini,ekstrak batang serai dapat digunakan untuk mengendalikan larva C. binotalis pada kubis.
37
Diaz-Perez, Juan C., S. Bautista, and R. Villanueva. "Response of the Mamey Sapote (Pouteria sapota L.) Fruit to Storage." HortScience 33, no. 3 (June 1998): 457a—457. http://dx.doi.org/10.21273/hortsci.33.3.457a.
Full textAbstract:
The mamey sapote is a fruit highly appreciated by its sweet flavor. Although this crop has been cultivated in tropical America for several centuries, there is still little horticultural information about it. The fruit is very perishable and postharvest losses are usually large. The objective was to evaluate the postharvest changes in fruit quality under storage conditions. Fruit grown in Morelos, Mexico, were harvested when there was a color change from green to pink in the tissue just below the fruit cortex. Fruit were stored at 10 °C or kept at 20 °C (65% RH) or ambient temperature (Mean daily temperature = 27 °C) for 24 days or until fruit deteriorated. After storage at 10 °C, fruit were kept at 20 °C to allow for fruit ripening. Fruit kept at 27 °C ripened 3 days after harvest, while those at 20 °C ripened 5 days after harvest. Fruit at 10 °C showed little physical or chemical changes over the storage period. Ripening included fruit softening, a change in pulp color from a yellow or pale pink to an intense pink color, and an increase in SSC. No change in fruit cortex color was detected as ripening progressed. Ripe fruit showed a 30% to 35% of SSC, and a firmness (resistance to penetration) of 7 N. In overripe fruit, pulp color turned brown. Fruit stored at 10 °C and then ripened at 20 °C showed an irregular ripening, with portions of the fruit with a high firmness and others with a low firmness. This irregular ripening was more severe on fruit stored at 10 °C for 14 days than those stored for 7 days. This disorder was probably a result of chilling injury.
38
Mager, Tino. "Neither past nor present : Authenticity and late twentieth-century architectural heritage." Architectural Research Quarterly 23, no. 2 (June 2019): 137–48. http://dx.doi.org/10.1017/s1359135519000125.
Full textAbstract:
It was the present moment. No one need wonder that Orlando started, pressed her hand to her heart, and turned pale. For what more terrifying revelation can there be than that it is the present moment? That we survive the shock at all is only possible because the past shelters us on one side and the future on another. But we have no time now for reflections.(Virginia Woolf, Orlando)How long does the present moment last? Where and when does the past begin and how does the present end? In physics – or more precisely in the special theory of relativity – the present can be defined as the coordinate origin in a spacetime diagram – an unextended point that separates an observer’s past and future light cones. From that point of view, the present has no duration at all; the past instantly assimilates the future without any hesitation in between. However, time perception tells us that we actually experience a ‘here and now’. Psychologists believe that the time range we perceive as the present, the socalled specious present, lasts about three seconds – the interval duration after which the brain may be said to reset its attention. This is already infinitely more than no duration at all but this recognition is still not enough to explain concepts like the present time or ‘today’ as an indicator of the contemporary. In the domain of history, the present seems to be a much more complex construction. When we speak of phenomena as contemporary, we place them in an extended present. We concede that the present encompasses the recent past and the near future – a temporal range that provides a stage for the actions and reactions that shape our world.
39
Khusanbaev, K. S., A. F. Yusupov, A. A. Abdushukurova, T. F. Sultonmurodov, and N. A. Ergashev. "A clinical case of surgical correction of post-traumatic aphakia." Modern technologies in ophtalmology, no. 3 (July 15, 2021): 191–94. http://dx.doi.org/10.25276/2312-4911-2021-3-191-194.
Full textAbstract:
Purpose. To present a clinical case of surgical treatment of post-traumatic aphakia by the method of corneoscleral IOL fixation using the combined method of Kanabrava and Kozhukhov. Material and methods. In March 2021, patient A., born in 1992, turned to the RSSPCEM. diagnosed with OS Condition after a penetrating injury to the eye. Corneal scar. Post-traumatic aphakia. Foreign body (non-metallic) driven into the retina. A decision was made on OS surgical treatment of aphakia by the method of transscleral IOL fixation as the most gentle method, taking into account the paracentral scar of the cornea. And do not remove the foreign body, but additionally restrict it with laser coagulates. Results. On the 14th day after the operation, visual acuity OS 0.7, IOP 18. The eye is calm, there is a scar on the cornea in the paraoptic zone, transparent in the rest of the zone, the anterior chamber is deep, the iris is subatrophic, the pupil is 3 mm, deformed, the IOL is in the posterior chamber, centered. The fundus of the eye: the optic disc is pale pink, the boundaries are clear, the reflex is blurred in the macular zone, the foreign body is limited by pigmented laser coagulates. The standard postoperative drop regimen is recommended. Conclusions. 1. Corneoscleral fixation of the IOL according to the combined method of Canabrava and Kojuhov in the aphakic eye in complicated cases allows to achieve good refractive results with the developed technique of execution. 2. Preliminary laser limitation of an encapsulated non-metallic foreign body gives confidence in the stability of the retina in the intra- and postoperative period. 3. Further clinical observations are required using the above-described surgical technique for correcting aphakia Key words: сorneoscleral fixation, aphakia, Canabrava, Kojuhov.
40
Wang, X., J. Wang, J. Gao, and L. Yang. "First Report of Leaf Spot Disease on Schisandra chinensis Caused by Phoma glomerata in China." Plant Disease 96, no. 2 (February 2012): 289. http://dx.doi.org/10.1094/pdis-09-11-0760.
Full textAbstract:
Schisandra chinensis (Turcz.) Baill is a perennial liana belonging to the Schisandra genus of the family Magnoliaceae, which is cultivated in China as an important medicinal plant. In the summer of 2008, we observed a previously unknown foliar disease on the schisandras in Jingyu and Antu counties and the cities of Ji'an and Hunchun in Jilin Province. Symptoms appeared on the apex, margin, and center of leaves. The infection initially manifested as pale brown, small, necrotic spots on the leaves. Subsequently, these lesions became grayish brown in the center and dark brown with slight protuberances at the margins. Finally, these lesions developed concentric rings with a clear boundary separating them from the healthy tissue, were round to elliptical or irregular in shape, and had a diameter of 3 to 5 mm. In severely infected leaves, these spots eventually covered the entire leaf. Black spots (pycnidia) were produced on the infected leaf tissues in a humid environment. Fungus from infected leaf tissues was isolated on potato dextrose agar. The cultures were initially pale brown and turned dark green with age. Embedded pycnidia were generally formed after 5 days. The pycnidia were agglutinating, globose to subglobose, and measured 60.0 to 212.0 × 33.6 to 268.0 μm. Abundant conidia (4.06 to 7.2 × 1.65 to 3.53 μm) exhibiting zero to three oil droplets were produced by an 8-day-old colony; these conidia were ovoid or ellipsoidal, colorless, and aseptate; they were similar to conidia of Phoma glomerata. The internal transcribed spacer (ITS) sequence of rDNA of the isolated pathogenic strain (PG11; GenBank Accession No. GU724511) had 100% identity to P. glomerata (GenBank Accession No. HM769279). Therefore, the pathogen was identified as P. glomerata (Corda) Wollenw. & Hochapfel on the basis of morphology and ITS sequence data. To validate Koch's postulates, schisandra leaves were spray inoculated with a 2.5 × 105 conidia/ml suspension of the isolated pathogen. An equal number of healthy plants were inoculated with sterile water (control). After inoculation, 10 plants were covered with plastic bags for 3 days and maintained in a growth chamber at 25°C. After 8 days, all inoculated plants showed symptoms identical to those observed on the schisandra leaves infected in the field, whereas the controls did not show any symptoms. Reisolation of the fungi from lesions of inoculated leaves confirmed that the causal agent was P. glomerata. Diseases caused by P. glomerata have been reported on some plants (1,2). However, to our knowledge, this is the first report of leaf spot disease caused by P. glomerata on S. chinensis in China as well as in the world. References: (1) J. S. Chohan et al. Trans. Br. Mycol. Soc. 75:509, 1980. (2) T. Thomidis et al. Eur. J. Plant Pathol. 131:171,2011.
41
Mikunthan, G. "First Report of Web Blotch of Peanut Caused by Phoma arachidicola in the Dry Zone of Sri Lanka." Plant Disease 81, no. 7 (July 1997): 832. http://dx.doi.org/10.1094/pdis.1997.81.7.832a.
Full textAbstract:
Foliar symptoms of web blotch were observed on some peanut cultivars (Arachis hypogaea L.) grown in the Kilinochchi district in the dry zone of Sri Lanka during October 1993 to January 1994, following heavy rains (mean relative humidity 79 to 85%, mean temperature 25 to 27°C). Severe symptoms appeared on peanut cultivars ICGS 11 and ICGS 121. Cultivar ICGS 11 belongs to the Spanish group (A. hypogaea subsp. fastigiata var. vulgaris) and ICGS 121 belongs to bunch type (A. hypogaea subsp. hypogaea var. hypogaea). Initial symptoms of small, irregular, brown to reddish brown lesions along the midrib of both young and old leaves were observed. Large, nearly circular tan or dark brown blotches appeared on the adaxial surface of the leaves. Older lesions became dried and cracked. Lesions on the abaxial surface were pale brown, and less pronounced. These observations correlate closely with those made by Taber (2). Severe defoliation was observed in the infected fields of Spanish cultivars. Phoma arachidicola Marasus, G. D. Pauer, & Boerema was consistently isolated from symptomatic tissue. Colonies on potato dextrose agar were at first creamy white, and flattened with little aerial growth. Colonies eventually turned dark brown with a wide appressed margin. All isolates produced pale to dark brown and globose pycnidia. Dark-colored, globose, beaked pseudothecia were also observed in cultures, as reported by Subrahmanyam et al. (1). Dark-colored, round, single-celled pycnidiospores measuring 4 to 9 × 2.5 to 4 µm were observed in culture. The fungus was inoculated onto the leaves of 10 healthy plants of each cultivar and another 10 plants were maintained as uninoculated controls. All plants were covered with polypropylene bags to increase the humidity. Plants inoculated with the fungus produced symptoms 7 to 9 days after inoculation similar to those observed in the field. None of the control plants showed any disease symptoms. The fungus was reisolated from the diseased leaf tissue. Microscopic examination confirmed the identity of the fungus and satisfied Koch's postulates. All cultivars were then grown under irrigation during February to May 1994 (mean relative humidity 60 to 70% and mean temperature 32 to 35°C). No disease symptoms were observed, indicating that the proliferation of P. arachidicola on Spanish cultivars was influenced when the crop establishment period coincided with low air temperature (25 to 27°C) and high relative humidity (79 to 85%). This is the first report of web blotch in Sri Lanka and its occurrence was confined to the dry zone areas of the country. References: (1) P. Subrahmanyam et al. 1994. Web blotch disease of groundnut. Inform. Bull. No. 43, ICRISAT; and Peanut Collaborat. Res. Support Prog. (2) R. A. Taber. Web blotch. Pages 9–10 in: Compendium of Peanut Diseases. D. M. Porter, D. H. Smith, and R. Rodrigues-Kabana, eds. American Phytopathological Society, St. Paul, MN, 1984.
42
Vladimirova, Sofya B. "Pragmatic Specifics of Color Designations of the Human Body in Forensic Medical Investigation." NSU Vestnik. Series: Linguistics and Intercultural Communication 18, no. 4 (2020): 58–68. http://dx.doi.org/10.25205/1818-7935-2020-18-4-58-68.
Full textAbstract:
This article is devoted to the pragmatic specifics of the color designations of the human body in the text of a forensic medical investigation. The forensic post-mortem investigation text includes data on external and internal research, special attention is paid to the designation of the color of the human body, its parts, organs, injuries and other phenomena discovered during the research, because these data can be important for determining the cause of death, time of death and resolution of other questions posed to the expert. A reliable color identification of these objects and their sufficient description in the text of the conclusion is one of the criteria for the completeness of the forensic medical examination. Texts of this type, despite their great social significance, are insufficiently studied with regard to pragmatics and rarely become objects of linguistic research. The purpose of this article is to identify pragmatic specifics of the selection of human bodies’ color designations in the text of a forensic medical investigation through their structural and semantic analysis. The main research methods are the continuous sampling method for highlighting color designations; quantitative analysis to single out the most frequent lexemes, structural and semantic analysis. Out of 20 texts of forensic medical expertise, with the help of continuous sampling we found 1173 color designations represented by 204 different lexemes. The following colors turned out to be the most frequent: темно-красный (dark red, 152), серый (gray, 79), желтоватый (yellowish, 45), сероватый (grayish, 39), белесоватый (whitish, 36), краснокоричневый and жёлтый (red-brown and yellow, 35 for each), серо-розовый (gray-pink, 31), бледно-серый (pale gray, 27), тёмный (dark, 23). These colors were most widely distributed: тёмно-красный (dark red, in 20 texts), желтоватый (yellowish, in 17 ones), белесоватый, серый and жёлтый (whitish, gray and yellow, in 16 ones), краснокоричневый (red-brown, in 15 ones), сероватый (grayish, in 14 ones), серо-розовый (gray-pink, in 12 ones), синюшный and бледный (cyanotic and pale, in 11 ones). Structural analysis showed the predominance of hue color designations over absolute ones; two- and three-component terms over single-component ones, and the widespread use of formants that specify the color intensity. The semantic analysis showed an insignificant number of color terms that have a metaphorical meaning, as well as complete absence of “authorisms” and stylistically colored color terms. Two main pragmatic intentions were established that characterize the selection of color terms in this type of text: on the one hand, it is due to the referent and the need to convey its color as accurately as possible with the lexical means of the Russian language, and on the other, the need to use only common lexemes.
43
Anastasi, Amanda. "The Page Turner." Massachusetts Review 57, no. 4 (2016): 734. http://dx.doi.org/10.1353/mar.2016.0119.
Full text
44
Aluţei, Alexandra Maria, Beniamin Vasile Chetran, Ion Lungu, and Dan Mândru. "Automatic Page Turner." Solid State Phenomena 166-167 (September 2010): 27–32. http://dx.doi.org/10.4028/www.scientific.net/ssp.166-167.27.
Full textAbstract:
This paper presents the development of an Assistive Technology representative product: an automatic page turner system, designed for persons with issues like multiple sclerosis, Parkinson’s disease and other various disabilities that involve the motor functions of the upper limbs. Firstly, the authors emphasize specific features of Assistive Technology and analyse the most important functional aspects concerning different types of page turner devices. The proposed page turner system is based on a four-bar mechanism. Design aspects from the constructive and functional points of view are exposed and the developed prototype is described.
45
Huerta-Espino, J., O. Constantinescu, C. Velásquez, S. A. Herrera-Foessel, and P. Figueroa-Lopez. "First Report of Ramularia cercosporelloides on Carthamus tinctorius in Northwestern Mexico." Plant Disease 90, no. 12 (December 2006): 1552. http://dx.doi.org/10.1094/pd-90-1552b.
Full textAbstract:
Severe yield losses caused by an unidentified fungal disease occurred on safflower in Sonora, Mexico from 2001 to 2006. Leaf spots were pale at the beginning and became sunken lesions, spots turned brown, and diseased tissue became necrotic. Under continuous presence of dew, new infections occurred and the number of lesions increased, coalesced, and eventually the entire leaf and plant turned brown and dried up. The fungus appears as a whitish mold covering the lesions. Observations with a dissecting microscope revealed fungal growth on both leaf surfaces. Spots had minute, gray-to-pink tufts emerging from the host tissues. Stromata were roughly spherical, 35 to 55 μm in diameter, developed under the epidermis near the edge of the spots from which conidiophores arose. Fascicles of conidiophores emerged through stomata from colorless or slightly yellowish stroma and were simple, colorless, or slightly yellowish, as much as 85 μm long and 2.5 to 3 μm wide, with a pigmented scar at the tip. Conidia, formed in chains at scar sites on conidiophores, were colorless, obclavate, 0 to 1 septate, approximately 24 to 32 μm long, and 4.5 to 7 μm wide at the broadest part with a pigmented scar either at the base or at both ends. On the basis of symptoms and fungal morphology, the pathogen was identified as Ramularia cercosporelloides U. Braun & Crous (=Cercosporella carthami) (1). Seven specimens were deposited at the Uppsala University Herbarium as Nos. UPS F-119998 to 120004. Conidia were transferred to water agar plates from symptomatic leaves after 8 days in a humid chamber. Ten single conidia were plated onto a Septoria tritici medium (4 g each of malt extract, yeast extract, and sucrose, and 18 g of agar per liter of water). Colonies of the fungus were white-to-light pink with irregular margins and very slow in growth. Inoculum was produced by transferring 2 ml of distilled water containing conidia onto petri plates filled with Septoria medium. Plates were incubated at 18°C for 12 days. Water suspension was amended with two drops of Tween 20 per liter of inoculum. Pathogenicity of five isolates was confirmed by spraying a suspension of 1.0 × 105 conidia/ml onto five pots of four direct-seeded adult plants of cv. S-518 per isolate. Plants were kept in a dew chamber (20°C) for 48 h under 16 h of darkness and 8 h of light and then in a greenhouse (20 to 24°C). After 2 weeks, leaves developed the characteristic spots, and R. cercosporelloides was isolated from symptomatic tissue. To our knowledge, this is the first report of R. cercosporelloides on safflower, not only in Mexico, but also on the American continent. Reference: (1) U. Braun. A monograph of Cercosporella, Ramularia and allied genera (Phytopathogenic Hyphomycetes). Vol 2. IHW-Verlag. Eching bei Munchen, 1998.
46
Reed, M. Ann. "Van cliburn's page turner." Psychological Perspectives 47, no. 1 (January 2004): 148–51. http://dx.doi.org/10.1080/00332920408407137.
Full text
47
Bardas, G. A., G. T. Tziros, and K. Tzavella-Klonari. "First Report of Ascochyta Leaf Spot Caused by Phoma exigua var. exigua on Common Bean in Greece." Plant Disease 92, no. 4 (April 2008): 653. http://dx.doi.org/10.1094/pdis-92-4-0653c.
Full textAbstract:
Common bean (Phaseolus vulgaris L.) is cultivated extensively in Greece for dry and fresh bean production. During 2005 and 2006, a disease with typical blight symptoms was observed occasionally on dark red kidney, brown kidney, and black bean plants in most bean-producing areas of Greece. It rarely was destructive unless the crop had been weakened by some unfavorable environmental conditions. Infected leaves had brown-to-black lesions that developed concentric zones 10 to 30 mm in diameter and also contained small, black pycnidia. Concentric dark gray-to-black lesions also appeared on branches, stems, nodes, and pods. Infected seeds turned brown to black. Plants sometimes showed defoliation and pod drop. The fungus was consistently isolated on potato dextrose agar from diseased leaves and pods and identified as Phoma exigua var. exigua Sutton and Waterstone on the basis of morphological characteristics of conidia and pycnidia (1,2). Spores were massed in pycnidia from which they were forced in long, pink tendrils under moist weather conditions. Conidia were cylindrical to oval, allantoid, hyaline, pale yellow to brown, usually one-celled, and 2 to 3 × 5 to 10 μm. To satisfy Koch's postulates, a conidial suspension (1 × 106 conidia per ml) of the fungus was sprayed onto leaves and stems of bean seedlings (first-leaf stage) (cv. Zargana Hrisoupolis). Both inoculated and control seedlings (inoculated with sterile water) were covered with plastic bags for 72 h in a greenhouse at 23°C. Inoculated plants showed characteristic symptoms of Ascochyta leaf spot 12 to 15 days after inoculation. The fungus was reisolated from lesions that developed on the leaves and stems of all inoculated plants. The pathogen is present worldwide on bean. To our knowledge, this is the first report of P. exigua var. exigua on common bean in Greece. References: (1) D. F. Farr et al. Fungal Databases. Systematic Botany and Mycology Laboratory. Online publication. ARS, USDA, 2007. (2) B. C. Sutton and J. M. Waterstone. Ascochyta phaseolorum. No. 81 in: Descriptions of Pathogenic Fungi and Bacteria. CMI/AAB, Kew, Surrey, England, 1966.
48
Saroj, A., A. Kumar, N. Qamar, M. Alam, H. N. Singh, and A. Khaliq. "First Report of Wet Rot of Withania somnifera Caused by Choanephora cucurbitarum in India." Plant Disease 96, no. 2 (February 2012): 293. http://dx.doi.org/10.1094/pdis-09-11-0801.
Full textAbstract:
Withania somnifera (Ashwagandha) is native to India and commercially cultivated for the production of root withanolides that have anticarcinogenic properties. A disease appeared on plantings of W. somnifera during the 2010 monsoon at the CIMAP and in adjoining areas of northern India. Symptoms first appeared as water-soaked lesions on leaves and stems that progressed to a wet rot. Mature lesions harbored black fructifications of the suspect pathogen. Pathogen isolations were done by placing pieces of infected tissues on potato dextrose agar. A fungus tentatively identified as a Choanephora sp. that produced white aerial mycelia that later turned pale yellow was consistently isolated from infected plant parts. Mycelia were hyaline and nonseptate. Sporangiophores bearing sporangiola were erect, hyaline, unbranched, apically dilated to form a clavate vesicle from which arose dichotomously branched distally clavate secondary vesicles. Sporangiola were indehiscent, ellipsoid, brown to dark brown with distinct longitudinal striations, and measured 12 to 20 × 6 to 12 μm. Sporangia were multispored, spherical, initially white to yellow and pale brown to dark brown at maturity, and measured 40 to 160 μm. Sporangiospores from sporangia were ellipsoid to broadly ellipsoid, brown to dark brown, indistinctly striate with fine hyaline polar appendages, and measured 16 to 20 × 8 to 12 μm. On the basis of the cultural as well as morphological characteristics and description in the monograph by Kirk (2), the fungus was identified as a Choanephora sp. The identification was also confirmed by IMTECH, Chandigarh, India with Accession No. MTCC-10731. The species was later characterized as Choanephora cucurbitarum (Berk. & Ravenel) Thaxt (GenBank Accession No. AB470642) by using universal primers ITS-1 and ITS-4. Its sequence comprising of 18S rRNA partial, complete ITS 1, 5.8S rRNA, ITS 2, and 28S rRNA partial was submitted to NCBI GenBank with Accession No. JN639861. Pathogenicity of the fungus was established on five healthy plants by artificial inoculation with spray of an aqueous spore suspension containing 106 spores/ml. Plants sprayed with sterile distilled water were used as controls. Both inoculated and control plants were kept in a humidity chamber (96%) for 3 days and thereafter placed in the glasshouse at 28 ± 2°C. Initial symptoms developed in 2 to 3 days while typical disease symptoms appeared on all the inoculated plants after 7 to 10 days. Control plants were free from infection. The reisolation from artificially infected plants again yielded a Choanephora sp., thus fulfilling Koch's postulates. W. somnifera cultivation has been affected by root rot and wilt caused by Fusarium solani and leaf spot caused by Alternaria dianthicola (3). The occurrence of a Choanephora sp. was reported on periwinkle, petunia (1), and Boerhavia diffusa (4). However, to our knowledge, incidence of this pathogen on W. somnifera has not been reported so far. Thus, wet rot of W. somnifera caused by C. cucurbitarum is a new report from India and worldwide. References: (1) G. E. Holcomb. Plant Dis. 87:751, 2003. (2) P. M. Kirk. Mycol. Pap. 152:1, 1984. (3) C. K. Maiti et al. Plant Dis. 91:467, 2007. (4) N. Singh et al. New Dis. Rep. 23:29, 2011.
49
Mahmodi, F., J. B. Kadir, M. Y. Wong, A. Nasehi, N. Soleimani, and A. Puteh. "First Report of Anthracnose Caused by Colletotrichum capsici on Bok Choy (Brassica chinensis) in Malaysia." Plant Disease 97, no. 5 (May 2013): 687. http://dx.doi.org/10.1094/pdis-09-12-0843-pdn.
Full textAbstract:
Bok choy (Brassica chinensis L.) is a temperate vegetable grown in the cool highland areas of Malaysia. In June 2010, vegetable growing areas of the Cameron Highlands, located in Pahang State, Malaysia, were surveyed for the prevalence of anthracnose disease caused by Colletotrichum species. Diseased samples were randomly collected from 12 infested fields. Anthracnose incidence on bok choy varied from 8 to 36% in different nursery fields. Disease symptoms initially appeared as small water-soaked spots scattered on the leaf petioles of young plants. As these spots increased in size, they developed irregular round spots that turned to sunken grayish brown lesions surrounded by brownish borders. When the lesions were numerous, leaves collapsed. Pale buff to salmon conidial mass and acervuli were observed on well-developed lesions. The acervuli diameter varied in size from 198 to 486 μm, averaging 278.5 μm. Morphological and cultural characteristics of the fungus were examined on potato dextrose agar incubated for 7 days at 25 ± 2°C under constant fluorescent light. Vegetative mycelia were hyaline, septate, branched, and 2 to 7 μm in diameter. The color of the fungal colonies was grayish brown. Conidia were hyaline, aseptate, falcate, apices acute, and 21.8 to 28.5 × 2.6 to 3.4 mm. Setae were pale brown to dark brown, 75 to 155 μm long, base cylindrical, and tapering towards the acute tip. Appressoria were solitary or in dense groups, light to dark brown, entire edge to lobed, roundish to clavate, 6.5 to 14 × 5.8 to 8.6 μm, averaging 9.2 × 6.8 μm, and had a L/W ratio of 1.35. Based on the keys outlined by Mordue 1971 (2) and Sutton 1980 (3), the characteristics of this fungus corresponded to Colletotrichum capsici. Sequence analysis of the ITS-rDNA obtained from the Malaysian strain CCM3 (GenBank Accession No. JQ685746) using primers ITS5 and ITS4 (1) when aligned with deposited sequences from GenBank revealed 99 to 100% sequence identity with C. capsici strains (DQ286158, JQ685754, DQ286156, GQ936210, and GQ369594). A representative strain CCM3 was used for pathogenicity testing. Four non-infected detached leaves of 2-week-old B. chinensis were surface-sterilized and inoculated by placing 10 μl of conidial suspension (106 conidia ml–1) using either the wound/drop or non-wound/drop method, and distilled water was used as a control (1). Leaves were incubated at 25°C, 98% RH. The experiment was repeated twice. Five days after inoculation, typical anthracnose symptoms with acervuli formation appeared on the surface of tissues inoculated with the spore suspension, but not on the water controls. A fungus with the characteristics of C. capsici was recovered from the lesions on the inoculated leaves. Anthracnose caused by C. capsici has been reported on different vegetable crops, but not on bok choy (3). To the best of our knowledge, this is the first report of C. capsici causing anthracnose on bok choy in Malaysia. References: (1) R. Ford et al. Aust. Plant Pathol. 33:559, 2004. (2) J. E. M. Mordue. CMI Description of Pathogenic Fungi and Bacteria. Commonwealth Mycol. Inst., Kew, UK. 1971. (3) B. C. Sutton. The Genus Glomerella and its anamorph Colletotrichum. CAB International, Wallingford, UK, 1992. (4) P. P. Than et al. Plant Pathol. 57:562, 2008.
50
Kwon, J. H., O. Choi, and J. Kim. "First Report of Kalanchoe Leaf Scorch Caused by Stemphylium xanthosomatis in Korea." Plant Disease 96, no. 2 (February 2012): 292. http://dx.doi.org/10.1094/pdis-05-11-0403.
Full textAbstract:
Kalanchoe (Kalanchoe blossfeldiana Poelln.) is widely cultivated in Korea as an ornamental houseplant and succulent garden plant because of its ease of propagation, low water requirements, and wide variety of flower colors. In August 2010, suspected nursery-stage kalanchoe leaf scorch was found at a grower's greenhouses located in Gimhae, Korea. In some greenhouses, 20 to 30%, and occasionally as much as 50%, of the plants were affected. Symptoms on kalanchoe include browning of the leaf margins and yellowing or darkening of tissues between the main leaf veins. As the disease progresses, affected leaves dried up, turned brown, and became brittle. A velvety, blackish olive mold formed on the surface of the dead tissue, followed by plant defoliation. Fresh leaf specimens were collected from infected plants and the causal pathogen was purified with a single-spore isolation technique and transferred onto potato dextrose agar (PDA). Colonies on PDA developed a gray or grayish brown, hairy, velvety mycelium that was mostly immersed and also formed conidia. Conidia were pale to mid brown, oblong, smooth or verruculose, with three to five transverse and one to two longitudinal septa in two to three transverse divisions, and 32 to 55 × 11 to 18 μm. Conidiophores were pale to mid brown, solitary or in fascicles, unbranched or occasionally branched, straight or flexuous, more or less cylindrical but enlarged slightly at one to three apical percurrent proliferations, septate, and 80 to 300 × 2 to 5 μm. A representative isolate of the pathogen was inoculated on kalanchoe leaves for pathogenicity testing. Cultures grown on PDA were flooded with sterile distilled water and after rubbing with an artist's paintbrush with hair bristles, the resulting suspensions were filtered through sterile cheesecloth. Conidial suspensions were adjusted to 2.5 × 104 conidia/ml with sterile distilled water. The leaves of five 1-month-old potted plants were wounded by applying pressure with forceps having serrated teeth, bruising the tissue. Wounded plants were sprayed with a conidial suspension until runoff. Five plants sprayed with sterile distilled water served as controls. The plants were maintained for 48 h at 25°C in a humidity chamber with 100% relative humidity and were then moved to a greenhouse. Symptoms similar to those observed in the farmer's greenhouse developed on wounded leaves within 9 days. The causal pathogen was reisolated from the lesions to prove Koch's postulates. To confirm the identity of the fungus, the complete internal transcribed spacer (ITS) rDNA and glyceraldehyde 3-phosphate dehydrogenase (gpd) gene were amplified and sequenced (1). Amplification of the ITS region generated a 579-bp sequence (GenBank Accession No. HQ840713) and gpd was 558 bp (GenBank Accession No. JF776462). The ITS and gpd sequences were 100% similar to the sequences of Stemphylium xanthosomatis (GenBank Accession Nos. AF442804 and AF443903, respectively). On the basis of symptoms, mycological characteristics, pathogenicity, and molecular data, this fungus was identified as S. xanthosomatis. The type culture of the fungus is stored at the Korean Agricultural Culture Collection (KACC 45812), National Academy of Agricultural Science, Korea. To our knowledge, this is the first report of leaf scorch caused by S. xanthosomatis on kalanchoe in Korea. Reference: (1) M. P. S. Câmara et al. Mycologia 94:660, 2002.