To see the other types of publications on this topic, follow the link: TWV 7:25.
Journal articles on the topic 'TWV 7:25'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'TWV 7:25.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Choquet, Élodie, Marshall D. Perrin, Christine H. Chen, Rémi Soummer, Laurent Pueyo, James B. Hagan, Elena Gofas-Salas, et al. "FIRST IMAGES OF DEBRIS DISKS AROUND TWA 7, TWA 25, HD 35650, AND HD 377." Astrophysical Journal 817, no. 1 (January 14, 2016): L2. http://dx.doi.org/10.3847/2041-8205/817/1/l2.
Full text
2
Kim, Young Woon, Jung Hyun Kwon, Eun Chung, Sung Won Lee, Jong-yul Lee, Jeong Won Jang, Kyu Won Chung, and Soon Woo Nam. "Short Term Virologic Efficacies of Telbivudine versus Entecavir against Hepatitis B-Related Hepatocellular Carcinoma." Gastroenterology Research and Practice 2015 (2015): 1–7. http://dx.doi.org/10.1155/2015/181065.
Full textAbstract:
Telbivudine has been reported to be more effective than lamivudine. However, because of the resistance rate to telbivudine (TLV), the current guidelines recommend entecavir (ETV) or tenofovir (TNV) as the first-line therapy for chronic hepatitis B. We investigated the short term virologic efficacy of TLV in comparison with ETV as the first-line agent of HBV suppression in HBV-related advanced HCC patients. A total of 86 consecutive patients with HBV-related HCC for whom antiviral treatment was initiated in Incheon St. Mary’s Hospital between 2010 and 2013 were analyzed. Virologic responses were investigated on the 4th, 12th, and 24th weeks of the antiviral therapies. In patients with advanced TNM stage cancer (stage 3 or 4) and poor liver function (Child-Pugh class B or C), the virologic response rates at weeks 12 and 24 were 25% (1/4) and 42.8% (3/7) in the TLV group and 33.3% (1/3) and 33.3% (1/3) in the ETV group, respectively (P=0.424,P=0.800). The short term efficacy of TLV was similar to that of ETV. Since TLV is highly cost-effective, it should be considered as a first-line antiviral agent in patients with advanced HCC, poor liver function, and short life expectancies.
3
Nicholson, B. A., G. Hussain, J.-F. Donati, D. Wright, C. P. Folsom, R. Wittenmyer, J. Okumura, and B. D. Carter. "The surface magnetic activity of the weak-line T Tauri stars TWA 7 and TWA 25." Monthly Notices of the Royal Astronomical Society 504, no. 2 (March 26, 2021): 2461–73. http://dx.doi.org/10.1093/mnras/stab879.
Full textAbstract:
ABSTRACT We present an analysis of spectropolarimetric observations of the low-mass weak-line T Tauri stars TWA 25 and TWA 7. The large-scale surface magnetic fields have been reconstructed for both stars using the technique of Zeeman Doppler imaging. Our surface maps reveal predominantly toroidal and non-axisymmetric fields for both stars. These maps reinforce the wide range of surface magnetic fields that have been recovered, particularly in pre-main sequence stars that have stopped accreting from the (now depleted) central regions of their discs. We reconstruct the large scale surface brightness distributions for both stars, and use these reconstructions to filter out the activity-induced radial velocity jitter, reducing the RMS of the radial velocity variations from 495 to 32 m s −1 for TWA 25, and from 127 to 36 m s −1 for TWA 7, ruling out the presence of close-in giant planets for both stars. The TWA 7 radial velocities provide an example of a case where the activity-induced radial velocity variations mimic a Keplerian signal that is uncorrelated with the spectral activity indices. This shows the usefulness of longitudinal magnetic field measurements in identifying activity-induced radial velocity variations.
4
Seydim, Atıf Can, Zeynep Banu Guzel-Seydim, Duygu Kumbul Doguc, M. Cagrı Savas, and Havva Nilgun Budak. "Effects of Grape Wine and Apple Cider Vinegar on Oxidative and Antioxidative Status in High Cholesterol-Fed Rats." Functional Foods in Health and Disease 6, no. 9 (September 30, 2016): 569. http://dx.doi.org/10.31989/ffhd.v6i9.285.
Full textAbstract:
Background: Oxidative stress is the result of an imbalance between the rates of free radical production and elimination via endogenous antioxidant mechanisms such as antioxidant enzymes; glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), catalase (CAT). Antioxidants widely available in fruits, vegetables, seeds have been possessed a broad spectrum of biological, pharmacological and therapeutic properties against oxidative stress. Consumption of fruits and vegetables are essentials much as their products such as fruit juices, wines and vinegars, which contain significant amount of polyphenolic compounds. Vinegar is produced mainly from different varieties of wine by two fermentation process, ethanol and acetic acid fermentations. Followed by wine production there are mainly two vinegar production methods. One is surface also known as traditional method. The second method is submerging technique involving submerged culture where the oxygenation has been greatly improved (industrial method).Objective: The aim of the study is to determine the effects of grape and apple cider vinegar consumption against oxidative stress in high cholesterol-fed rats.Methods: Fifty-four male, adult Wistar albino rats were included in the study. Rats were divided into six groups of nine. 1 mL of 2.5% cholesterol (at 5pm) and 1 mL of different vinegar samples (at 9 am) were administered daily for 7 weeks by oral gavage. Control-diet group (CNT) received 1mL of normal saline solution concurrently with the experiment groups. Rats were sacrificed at the end of the experiment and blood samples were collected. The erythrocyte samples were washed three times in normal saline (0.9%, v/w) and then hemolyzed with 2mL of cold bidistillated water. CAT activity was measured following the method of Aebi. MDA was determined by the double heating method of Draper and Hadley. GSH-Px activity was measured according to the method of Paglia and Valentine [19]. SOD activity was analyzed according to the method of Woolliams et al.[20] Both were analyzed in Beckmann Coulter AU 5800 autoanalyzer by using RANDOX kits (Randox Laboratories Ltd. Ardmore, Crumlin, UK). Vinegars were obtained after the grape and apple vinegar fermentations using surface culture method and industrial submerge methods. Grape and apple juices were immediately inoculated with Saccharomyces cerevisiae (0.02%) for ethanol fermentation for 30 day at 25°C. After the completion of the ethanol fermentation, acetic acid fermentation of wines was initiated with the addition of two-year aged vinegar (1:3 ratio) using surface technique at 25°C and continued for 60 days at 25°C.Vinegars produced by the industrial submerge method for 24 hours at 25°Cwere transported to theDepartment of Food Engineering laboratories from the Carl Kuhne Vinegar Plant located in Afyonkarahisar, Turkey. Total antioxidant activity of vinegar samples were measured by Oxygen Radical Absorbance Capacity (ORAC) and 2,2’-azinobis (3-ethlybenzthiazoline)-6-sulfonic acid (ABTS) methods.Results: Levels of CAT, GSH-Px, SOD in CHCNT group were significantly decreased while MDA levels were significantly increased when compared to CNT group. Levels of MDA which is the end-product of lipid peroxidation was significantly decreased in the apple cider vinegar administered groups (TAV and IAV) when compared to the CHCNT (P<0.05). MDA levels of grape wine vinegar administered groups were decreased (TGV, IGV), however the difference was not significant. GSH-Px levels were significantly increased in both TGV and TAV groups, which were fed with the vinegars produced by traditional surface methods (P=0.03, P=0.001 respectively) as compared to the CHCNT. GSH-Px levels of rats fed with vinegars produced with industrial submerge methods (IGV, IAV), showed no significant difference when compared to CHCNT group. SOD levels of TGV, IGV, TAV, IAV were significantly increased as compared to CHCNT group (p<0.05). TEAC and ORAC values of vinegar samples (TGV and TAV) produced with surface methods were higher than other samples. ORAC and TEAC values of TAV sample was 5.89 µmol trolox/ml and 5.5 mM, respectively.Conclusions: Present research showed that high cholesterol diet increased lipid peroxidation and consumed the antioxidant enzymes. Although the degree of the effect of vinegars on antioxidant enzyme activity differs, the use of vinegar especially the ones produced by surface culture methods have seem to have favorable effect in vivo. These findings are in concordance with the ORAC and TEAC values of vinegars.Keywords: Oxidative stress, grape vinegar, apple cider vinegar, glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), malondialdehyde (MDA), catalase (CAT)
5
Olofsson, J., R. G. van Holstein, A. Boccaletti, M. Janson, P. Thébault, R. Gratton, C. Lazzoni, et al. "Resolving faint structures in the debris disk around TWA 7." Astronomy & Astrophysics 617 (September 2018): A109. http://dx.doi.org/10.1051/0004-6361/201832583.
Full textAbstract:
Context. Debris disks are the intrinsic by-products of the star and planet formation processes. Most likely due to instrumental limitations and their natural faintness, little is known about debris disks around low mass stars, especially when it comes to spatially resolved observations. Aims. We present new VLT/SPHERE IRDIS dual-polarization imaging (DPI) observations in which we detect the dust ring around the M2 spectral type star TWA 7. Combined with additional angular differential imaging observations we aim at a fine characterization of the debris disk and setting constraints on the presence of low-mass planets. Methods. We modeled the SPHERE DPI observations and constrain the location of the small dust grains, as well as the spectral energy distribution of the debris disk, using the results inferred from the observations, and performed simple N-body simulations. Results. We find that the dust density distribution peaks at ~0.72′′ (25 au), with a very shallow outer power-law slope, and that the disk has an inclination of ~13° with a position angle of ~91° east of north. We also report low signal-to-noise ratio detections of an outer belt at a distance of ~1.5′′ (~52 au) from the star, of a spiral arm in the southern side of the star, and of a possible dusty clump at 0.11′′. These findings seem to persist over timescales of at least a year. Using the intensity images, we do not detect any planets in the close vicinity of the star, but the sensitivity reaches Jovian planet mass upper limits. We find that the SED is best reproduced with an inner disk at ~0.2′′ (~7 au) and another belt at 0.72′′ (25 au). Conclusions. We report the detections of several unexpected features in the disk around TWA 7. A yet undetected 100M⊕ planet with a semi-major axis at 20−30 au could possibly explain the outer belt as well as the spiral arm. We conclude that stellar winds are unlikely to be responsible for the spiral arm.
6
Custodio, Joseph M., Marshall Fordyce, William Garner, Mona Vimal, Kah Hiing J. Ling, Brian P. Kearney, and Srinivasan Ramanathan. "Pharmacokinetics and Safety of Tenofovir Alafenamide in HIV-Uninfected Subjects with Severe Renal Impairment." Antimicrobial Agents and Chemotherapy 60, no. 9 (May 23, 2016): 5135–40. http://dx.doi.org/10.1128/aac.00005-16.
Full textAbstract:
ABSTRACTTenofovir alafenamide (TAF) is an oral prodrug of tenofovir (TFV) that has greater stability in plasma than TFV disoproxil fumarate (TDF) and circulates as intact TAF, resulting in the direct and higher lymphatic loading of and exposure to TFV diphosphate, the active moiety. Unlike TFV, TAF is minimally eliminated in urine. The pharmacokinetics (PK) of TAF and TFV in HIV-uninfected subjects with severe renal impairment and matched healthy controls were evaluated. Subjects with severe renal impairment (RI; estimated glomerular filtration rate [eGFR], 15 to 29 ml/min) and controls (eGFR, ≥90 ml/min) matched for age, gender, and body mass index received a single dose of TAF at 25 mg. Blood and urine samples for TAF and TFV PK determinations were collected over 7 days postdosing, and subjects were followed up at 14 days. A total of 14 renally impaired subjects and 13 control subjects enrolled and completed the study. The TAF maximum observed concentration in plasma (Cmax) and the area under the concentration-versus-time curve (AUC) extrapolated to infinite time (AUCinf) were 79% and 92% higher, respectively, in subjects with severe RI than the controls, primarily due to higher absorption. The TFVCmaxand AUCinfwere 2.8-fold and 5.7-fold higher, respectively, in subjects with severe RI than the controls. In subjects with severe RI, TAF at 25 mg provided a TFV AUC 10 to 40% lower than that from historical TDF-based TFV exposures in subjects with normal renal function. There were no discontinuations due to adverse events. In subjects with severe RI receiving TAF at 25 mg, TAF exposures were higher than those for the controls; these differences are unlikely to be clinically meaningful. TFV exposures were higher than those for the controls but lower than the exposures in nonrenally impaired subjects on TDF-based regimens.
7
Chacon, Jose Ignacio, Ana Rosa Rubio Salvador(2), Nazaret Cordero Franco(1), Begona Martinez Carrasco (1), Sonia Alonso Soler(1), Laura Diaz Paniagua(1), Lourdes Fernandez Franco(1), et al. "Docetaxel-carboplatin-bevacizumab (TCV): A novel combination that promises a high activity in triple-negative breast cancer: A pilot study." Journal of Clinical Oncology 30, no. 15_suppl (May 20, 2012): e11543-e11543. http://dx.doi.org/10.1200/jco.2012.30.15_suppl.e11543.
Full textAbstract:
e11543 Background: Triple negative breast cancer (TNBC) is an anthracycline resistant subtype, for which there is no standard chemotherapy. Taxanes, platinum-derived drugs and bevacizumab all seem to be active drugs in this setting, but definitive data are still lacking. Our purpose is to report our experience with the combination Docetaxel-Carboplatin-Bevacizumab (TCV) in TNBC. Methods: We retrospectively analysed our database using medical claims for patients diagnosed with TNBC and treated with TCV in neoadjuvant (NAJ) or metastasic( MD), between July 1, 2009, and December 31, 2011. Informed consent was obtained from all patients. Results: 13 pts have received 86 TCV cycles, 8 in NAJ and 5 for MD. NAJ: Median age: 48(28-60) y. T3-T4 tumors: 62,5% . N+: 62.5%. All pts received 6 TCV cycles, except 1 pt, still on therapy. 5 (62.5%) pts received quadrantectomy, 2(25%) mastectomy as surgical treatment after TCV. One pt has not received surgery yet. Sentinel lymph node biopsy was done in 5/8 (62.5%) pts, the other 3 received axillary dissection for clinically N+ metastasis. After surgery, pathologic complete response (pCR) in breast in 6/7 pts (85.7%); in axillary nodes, pCR in 5/7 pts (71,4%). One has not been surgically evaluated yet. Median follow-up: 10 months (2-18). Only one pt has relapsed with cerebral metastasis. MD: Median age: 54.4 (40-71) y. 4 pts received TCV as first line, one as third line therapy. 3 pts obtained complete response, 2 partial responses, but both progressed in three months. Median follow-up: 14.4 months. Only one of these pts has died. Toxicity: Was mild, without any grade 3 or 4 toxic effect. Only one pt showed grade 2 hypertension after bevacizumab infusion. Neutropenia was not evaluable for use of G-CSF per protocol. Conclusions: Although this is a short series, it suggests that TCV may be a highly active combination in TNBC with a good tolerability profile. These data warrant continuing testing of this combination in TNBC.
8
BALOGUN, OLUSEGUN S., LEIXIN XU, TOHRU TERAOKA, and DAIJIRO HOSOKAWA. "Effects of single and double infections with Potato virus X and Tobacco mosaic virus on disease development, plant growth, and virus accumulation in tomato." Fitopatologia Brasileira 27, no. 3 (June 2002): 241–48. http://dx.doi.org/10.1590/s0100-41582002000300001.
Full textAbstract:
The tomato cv. Fukuju nº. 2 was used for studying the effect of single and double infections with Potato virus X (PVX) and Tobacco mosaic virus (TMV). Mixed infection resulted in a synergistic increase of disease severity, where more growth reduction was seen with simultaneous inoculations than with sequential inoculations at four-day intervals. At five and 12 days post-inoculation, the increased severity of the disease coincided with enhancement of virus accumulation in the rapidly expanding upper leaves. The PVX concentration in leaves nº 5 to 7 of doubly infected plants was three to six fold that of singly infected ones, as determined by DAS-ELISA. Mixed infection with the L strain led to higher enhancement of PVX than with the TMV-L11A strain. The concentration of TMV-L was lower in double infection and significantly higher than TMV-L11A in both singly and doubly infected plants. Analyses of the PVX ORF2 by Western blot and Northern hybridization revealed the pattern of accumulation of the 25 kDa protein and the RNAs, respectively, following those of the virion and coat protein. The strain TMV-L11A overcame the resistance gene in cv. GCR 237 (Tm-1). In the upper leaf nº. 8, the concentration of PVX was three times higher in plants with mixed infection than with L11A. The concentrations of the L and OM (TMV strains) in both singly and doubly infected plants were at very low levels, and the synergistic effect on PVX concentration and disease severity was not observed.
9
Torres Washima, Irene Lucía, Jennifer Paola Pacheco Rodríguez, Marlitt Elisa Ordoñez Arteaga, María Belén Vázquez Quezada, Javier Arturo López Rodríguez, and Diego Alejandro Córdova Ochoa. "Intervenciones de la aorta ascendente: Estudio transversal en dos Instituciones de Salud de la Ciudad de Cuenca, Ecuador." Revista Médica del Hospital José Carrasco Arteaga 12, no. 3 (November 30, 2020): 172–77. http://dx.doi.org/10.14410/2020.12.3.ao.25.
Full textAbstract:
BACKGROUND: The treatment of ascending aorta (AA) aneurysms has evolved over the years. The surgical technique for this pathology should always be chosen in favor of preserving native tissues, as much as possible. Aortic dilation can be secondary to other pathologies. There is an association with arterial hypertension, COPD, smoking, atherosclerosis, congestive heart failure, coronary heart disease, Marfan syndrome. The aim of this study was to characterize patients who underwent ascending aorta surgery in two medical centers in Cuenca- Ecuador, between January 2014 and August 2019. METHODS: Cross-Sectional descriptive and correlation study. The study population was formed by 23 patients undergoing an ascending aortic surgical intervention, in the city of Cuenca-Ecuador, at Hospital José Carrasco Arteaga or Clínica Santa Inés, from January 2014 to August 2019. Data was obtained from the patient’s medi-cal records. RESULTS: The age range went from 27 to 74 years with an average of 55.5 7 years. The most frequently found comorbidities were hypertension (56.5%) and type 2 diabetes (17.4%), 8.7% of the patients presented with Mar-fan syndrome. The most common diagnosis was ascending aortic aneurysm without significant valve damage (39%). 91% percent of the patients underwent surgery with the Bentall-De Bono technique. The majority of patients (52.2%) did not present any post-surgical complications. The mortality rate found in this population was 1.3 per 10 patients. CONCLUSIONS:Men were more frequently affected. The mean age was 55 years. The studied pathologies were heterogeneous, from SAA to primary or secondary aortic diseases. The main symptoms were angina and dyspnea; there was no significant association between clinical onset and mortality. The most frequent comor-bidities were Arterial Hypertension and type II Diabetes. We didn’t found any significant associations between complications and the other variables. The most common complication was bleeding that needed rintervention. Mortality decreased progressively since 2014. KEYWORDS: Aortic Diseases, Aortic Aneurysm, Aortic Valve, Cardiac Surgical Procedures.
10
Carvalho, Ruy Inacio Neiva de, and Flávio Zanette. "Dinâmica da dormência de gemas de macieira 'Imperial Gala' durante o outono e inverno em região de baixa ocorrência de frio." Revista Brasileira de Fruticultura 26, no. 1 (April 2004): 65–68. http://dx.doi.org/10.1590/s0100-29452004000100018.
Full textAbstract:
O objetivo deste trabalho foi determinar a dinâmica da dormência de gemas de um ano de macieira 'Imperial Gala' com ou sem frio suplementar durante o outono e o inverno, cultivadas em região de baixa ocorrência de frio. Os ramos foram coletados em Porto Amazonas-PR, em intervalos de 21 dias, de abril a agosto (19-04, 10-05, 31-05, 21-06, 12-07, 02-08 e 23-08) e receberam ou não tratamento com frio suplementar de 1.440 horas à temperatura de 4 a 7° C. A avaliação da dormência foi realizada pelo teste biológico de estacas de nós isolados (temperatura de 25° C e fotoperíodo de 16 horas) por meio dos parâmetros: tempo médio para brotação (TMB), velocidade de brotação (VB), taxa final de brotação (TF), taxa de brotações vigorosas (TBV) e tempo médio para aparecimento de folhas abertas (TMFA). A dormência mais intensa das gemas de um ano ocorreu em 12 de julho. A aplicação de 1.440 horas de frio suplementar de 4 a 7° C foi efetivo para a redução do tempo médio de brotação das gemas. A utilização da variável TBV nos testes de estacas de nós isolados foi uma importante forma de avaliação da capacidade real de desenvolvimento da gema, diminuindo-se a interferência do corte da estaca como estimulador de início de desenvolvimento.
11
CUNHA, ROSANA, MARCOS TAVARES, and JOEL BRAGA JR DE MENDONÇA. "Asteroidea (Echinodermata) from shallow-waters of the remote oceanic archipelago Trindade and Martin Vaz, southeastern Atlantic, with taxonomic and zoogeographical notes." Zootaxa 4742, no. 1 (February 19, 2020): 31–56. http://dx.doi.org/10.11646/zootaxa.4742.1.2.
Full textAbstract:
Trindade and Martin Vaz (TMV) is a highly isolated, oceanic volcanic archipelago located approximately 1200 km off the Brazilian coast and about 4200 km away from the nearest African coast. It has been almost 70 years since the first sea star, “Astropecten sp.”, was recorded from Trindade in 1951. In the following years (1955–1971; 2006) six sea star species were added to the archipelago’s fauna. After that period, however, research on shallow water echinoderms has not been conducted in TMV and no further sea star species have been recorded from there since. From 2012 to 2019, 263 daytime SCUBA diving and intertidal samplings conducted at TMV yielded 91 lots of sea stars in 7 species: Linckia guildingi Gray, 1840; Oreaster reticulatus (Linnaeus, 1758); Astropecten aff. antillensis Lütken, 1859; Copidaster lymani A. H. Clark, 1948; Luidia alternata alternata (Say, 1825); Mithrodia clavigera (Lamarck, 1816); and Ophidiaster guildingi Gray, 1840. The last five species in this list represent new records to the archipelago, with C. lymani also being the first record of the species in the southwestern Atlantic. Five shallow water species previously known from TMV have not been observed in the present survey: Asterinides folium (Lütken, 1860), Astropecten brasiliensis Müller & Troschel, 1842, Astropecten cingulatus Sladen, 1883, Linckia nodosa Perrier, 1875, and Ophidiaster alexandri Verrill, 1915. Twelve sea star species are currently known from shallow waters of TMV. A list of all sea star species known from shallow waters (intertidal down to 100 meters) of the tropical southern-central Atlantic oceanic archipelagoes and islands (Ascension, Cape Verde, Fernando de Noronha, Gulf of Guinea, Rocas Atoll, Saint Helena, Trindade and Martin Vaz) with their gross distribution in the Atlantic Ocean was compiled in order to explore the existence of patterns of geographic distribution for the shallow water sea star species in the tropical southern-central Atlantic oceanic islands. It has been found that 44% of the species from TMV are of western Atlantic affinity, 33% amphi-Atlantic, and 22% circumtropical in distribution. No endemic sea star species are known from TMV to date. The even more remote Ascension (ASC) and Saint Helena (STH) are more of a mosaic than TMV. The ASC and STH fauna consist of 8 and 11 sea star species, respectively. Their endemic component totals to 25% and 27%, respectively. STH has more amphi-Atlantic and eastern Atlantic sea star species (27% each) than ASC (25% and 12.5%, respectively). Twenty-five percent of the sea star species in ASC are circumtropical in distribution, whereas no circumtropical species have been found in STH. The western Atlantic (WA) component comparatively to the eastern Atlantic (EA) one is of minor significance in STH (18% versus 27%, respectively), whereas the WA and EA components contribute equally to the taxonomic composition in ASC (12.5% each). However, patterns of faunal affinities in both islands are actually taxon-dependent.
12
Bachir, Dora, Florence Parent, Laila Hajji, Jocelyn Inamo, Gylna Loko, Francois Lionnet, Françoise Driss, et al. "Prospective Multicentric Survey On Pulmonary Hypertension (PH) in Adults with Sickle Cell Disease." Blood 114, no. 22 (November 20, 2009): 572. http://dx.doi.org/10.1182/blood.v114.22.572.572.
Full textAbstract:
Abstract Abstract 572 Introduction : Pulmonary hypertension (PH) has emerged as life threatening complication in patients with sickle cell disease. It is usually diagnosed at echocardiography by estimating systolic Pulmonary Artery Pressure (PAP) through the measurement of a velocity of tricuspid regurgitation (TRV) > 2.5 m/s. Pulmonary Hypertension diagnosed as so could affect up to 30% of patients with sickle cell disease (SCD). However, according to most guidelines, PH is rather defined by measurement of mean PAP ≥ 25 mmHg at right heart catheterism. Whether measurement of TRV ≥ 2.5 m/s at echocardiography accurately identifies patients with PH in patients with SCD, has never been evaluated. We conducted a prospective multicentre study in 403 consecutive adult out-patients in stable clinical condition, recruited after informed consent, during 2 years (from Feb.2007 to March 2009) from 2 SCD referral centers in France (1 in Paris and 1 in Martinique). Follow -up was planned for 3 years. All patients had Doppler echocardiography, pulmonary function tests and 6 min walk test. RHC was systematically performed in case of TRV3 2.5m/sec. Results. Of the 385/403 patients (SS in 379, 6 Sb0thalassemia) with all data availabel, sex ratio 1.5 , mean age 34±10 yrs, 96 had TRV 3 2.5m/s (25 %) and underwent RHC. There was no PH in 72/96 with mPAp=19 ±3mmHg (false positive of echocardiography=75%). In 24 patients, m PAP was elevated (30 ± 0.4m/s). Mechanism of PH was: post-capillary PH in 13 patients (elevated pulmonary capillary wedge pressure) - hyperkinetic state in 5 patients (high cardiac output, normal pulmonary vascular resistance) - pre-capillary pulmonary arterial hypertension (PAH) in 6 patients (normal capillary wedge pressure, increased vascular resistance). Patients with a confirmed PH at RHC were significantly older (45 vs 33 yrs), had higher LDH, NT-Pro BNP, and a lower 6 min walk distance. There was no influence of long term treatment (hydroxyurea, chronic transfusion) on PH. During follow-up (mean=11 months), 3 patients died, all in the group of patients with TRV32.5 m/sec and confirmed PH at RHC (mPAP 3 25 mmHg). The 24 patients having confirmed PH with RHC display similar biological and hemodynamic profile to the 18/42 with TRV3 2.5m/sec among the 195 patients (132 SS,35SC,23S-Thalassemia b0or b+) of the Gladwin study(1), consenting to have RHC. The use of a higher cut-off value of TRV, 2.8 m/sec, decreases the false positive rate from 75% to 50%. However, 29% of patients with pulmonary hypertension (7/24) would have been undiagnosed. Conclusion PH confirmed by gold-standard technique (RHC) is relatively rare among SCD patients, with a prevalence of 24/385 (6%). PAH was present in only 6 patients (1.6%). In this population, a TRV 2.5m/s on Doppler echocardiography is inadequate to diagnose PH. The loose relationship found between TRV and pulmonary hypertension in patients with sickle cell disease does not support its use as a routine screening tool, whatever the cut-off used. Although PH on RHC was generally modest, PH seems to be an important prognostic factor. The large difference on mortality compared to previous studies will be discussed. Disclosures: No relevant conflicts of interest to declare.
13
Andreeva, E. F., and N. D. Savenkova. "Course of autosomal dominant and autosomal recessive polycystic kidney disease (ADPKD and ARPKD) wich detected in prenatal, neonatal and infant periods in children." Nephrology (Saint-Petersburg) 23, no. 5 (August 8, 2019): 77–87. http://dx.doi.org/10.24884/1561-6274-2019-23-5-77-87.
Full textAbstract:
THE AIM: to characterize the features of the course of autosomal dominant (ADPKD) and autosomal recessive (ARPKD) polycystic kidney disease detected in the prenatal, neonatal and thoracic periods.PATIENTS AND METHODS: ADP was diagnosed in 28 and ARPP in 12 of 40 children and adolescents. The dynamics of the diameter of renal cysts (mm), total kidney volume (TKV, cm3) by ultrasound were evaluated; Constructed trend lines for average TKV and diameter of renal cysts. The glomerular filtration rate is determined by the Schwartz formula. Liver fibrosis was detected by ultrasound / MRI / CT / biopsy.RESULTS: ADPKD was detected prenatally and during the first year of life in 19.1 %, ARPKD in 70.6 %. Stable arterial hypertension was diagnosed with an ADPKD with “very early detection” in 7 % (among adolescents), with ARPKD in 100 % (under 3 years of age). The diameter of the renal cysts increases with ADPKD. Renal cysts are multiple, bilateral since birth with ARPKD, the diameter of the cysts does not increase. TKV increased at birth in 3.6 % of children with ADPKD, in 100 % with ARPKD. The trend line of average TKV with ADPKD is exponential, with ARPKD – linear. Extrarenal location of cysts was diagnosed with ADPKD in 3.6 % (in the testes), with ARPKD in 67 % (in the liver). Liver fibrosis with portal hypertension syndrome was detected in children with ARPKD in 33.3 %; performed ligation of the veins of the esophagus. Acute kidney damage was found in newborns with ADPKD in 3.6 %, with ARPKD in 33.3 %. Fatal outcome was ascertained in 3 (25 %) children with ARPKD. In the follow-up, the outcome in HBPS3 is in 2 children with ADPKD and 3 children with ARPP, in HBPS4 in 1 child with ARPKD.CONCLUSION: features of the course of ADPKD and ARPKD revealed in the prenatal, neonatal and thoracic periods are shown.
14
Li, X. D., Y. Q. Li, and H. G. Wang. "Epidemic of Potato virus Y and Cucumber mosaic virus in Henan Province Tobacco." Plant Disease 85, no. 4 (April 2001): 447. http://dx.doi.org/10.1094/pdis.2001.85.4.447c.
Full textAbstract:
Flue-cured tobacco is an important crop in Henan Province, China. During the 2000 growing season, many tobacco plants showed various degrees of mottling, mosaic, vein clearing, or vein necrosis in most of the counties. Some plants even died at an early stage of growth. A survey was conducted in May-June in several tobacco-growing counties, and the incidence of symptomatic plants in individual fields ranged from 10 to 85%. The most widely planted tobacco varieties, NC89, K326, and K346, were highly susceptible. Symptomatic plants were collected from Jiaxian and Xiangcheng counties and samples were tested by enzyme-linked immunosorbent assay for Tobacco mosaic virus (TMV), Cucumber mosaic virus (CMV), Potato virus Y (PVY), and Potato virus X (PVX). Of 65 samples tested, 21 were positive for only PVY, 16 positive for only CMV, one each was positive for only TMV or PVX. Nineteen samples were doubly infected with various combinations of these viruses and six were infected with combinations of three viruses. The causal agent(s) in the remaining sample could not be determined. In total, CMV was detected in 40 samples, PVY in 38, PVX in 10, and TMV in 7 samples. TMV and CMV used to be the most important viruses and PVY occurred only rarely. But PVY has become prevalent in Henan and in neighboring Shandong province (2). CMV and TMV were reported to be the most prevalent viruses in Shanxi (1) and Fujian Provinces (3). Because resistant varieties are not available, and mixed infections are more common, the results presented here explain why huge damage is occurring in tobacco crops in recent years. Some varieties are partially resistant to TMV and CMV but the varieties commonly grown are highly susceptible to PVY. Therefore, breeding for resistance to viruses, especially to PVY, is urgent to control the occurrence of tobacco viral diseases. References: (1) J. L. Cheng et al. Acta Tabacaria Sin. 4:43, 1998. (2) J. B. Wang et al. Chinese Tobacco Sci. 1:26, 1998. (3) L. H. Xie et al. Acta Tabacaria Sin. 2:25, 1994.
15
Gudmestad, N. C., I. Mallik, J. S. Pasche, and J. M. Crosslin. "First Report of Tobacco rattle virus Causing Corky Ringspot in Potatoes Grown in Minnesota and Wisconsin." Plant Disease 92, no. 8 (August 2008): 1254. http://dx.doi.org/10.1094/pdis-92-8-1254c.
Full textAbstract:
In July 2007, potato tubers cv. Russet Burbank (RB) with necrotic arcs and spots were detected in three fields in Buffalo County, Wisconsin and one field in Benson County, Minnesota. Umatilla Russet (UR) potatoes harvested from the west half of a field in Swift County, MN had similar, but visually distinct necrotic lesions. Portions of one field in Minnesota were abandoned, and the stored potato crop from two fields in Wisconsin was rejected by processors, representing a total crop loss due to tuber necrosis. Tuber symptoms displayed in both cultivars resembled those described for corky ringspot caused by Tobacco rattle virus (TRV) (4). Total RNA was isolated from necrotic tuber tissue crushed in liquid nitrogen and extracted using the Total RNA Isolation Kit (Promega Corp., Madison, WI). These extracts were tested for the presence of TRV by reverse transcription (RT)-PCR using primers complementary to nucleotides 6555 to 6575 and identical to nucleotides 6113 to 6132 within the 3′ terminal open reading frame of TRV RNA-1 (3). The expected 463-bp fragments were amplified from RB tubers. Nucleotide sequences from a Wisconsin and Minnesota isolate (GenBank Accession Nos. EU569290 and EU569291, respectively) were 99 to 100% identical to the corresponding region in a published TRV sequence (GenBank Accession No. AF055912). A 396-bp fragment was amplified from UR tubers and sequence data (GenBank Accession No. EU569292) indicated a unique 63 nucleotide sequence was substituted for a 129 nucleotide sequence spanning residues 227 to 357 of the 463-bp amplicon from the RB TRV isolates. Seven fragments were sequenced from different UR tubers and the 396-bp fragment was identical among them. The sequence outside the substituted region had 92% identity to the published TRV sequence. Amplification of the full-length TRV RNA2 using primers 179/180 located in the 5′ and 3′ untranslated regions (2) was successful for 28 and 0% of the RB and UR samples, respectively, suggesting that the RNA2 is not present in these strains or has undergone significant mutation. TRV-infected sap from both potato cultivars was mechanically transmitted to tobacco cv. Samsun NN and these plants subsequently tested positive for TRV by ELISA using ATCC antiserum PVAS 820. Ninety tubers exhibiting mild to severe symptoms of TRV were planted in the greenhouse. Each tuber was bisected laterally; necrotic tissue was removed from one half of the tuber and tested for the presence of TRV using RT-PCR protocols described above for RNA1. The remaining half was bisected horizontally and both sections were planted. Foliage from each emerged plant was subsequently also tested by RT-PCR for TRV RNA1. All RB tubers from Wisconsin tested positive for TRV, but only 7 of 24 emerged plants tested positive. Only 72% of the UR tubers and 4 of 25 emerged plants tested positive. TRV has been confirmed in California, Colorado, Florida, Idaho, Michigan (1), Oregon, and Washington. To our knowledge, this is the first report of corky ringspot in potato caused by TRV in Minnesota and Wisconsin. References: (1) W. W. Kirk et al. Plant Dis. 92:485, 2008. (2) S. A. MacFarlane. J. Virol. Methods. 56:91, 1996. (3) D. J. Robinson. J. Virol. Methods 40:57, 1992. (4) S. A. Slack. Tobacco rattle virus. Page 71 in: Compendium of Potato Diseases. 2nd ed. W. R. Stevenson et al., eds. The American Phytopathological Society, St. Paul, MN, 2001.
16
Vecchia, AD, JD Fleck, M. Kluge, J. Comerlato, B. Bergamaschi, RB Luz, TS Arantes, JVS Silva, MR Thewes, and FR Spilki. "Assessment of enteric viruses in a sewage treatment plant located in Porto Alegre, southern Brazil." Brazilian Journal of Biology 72, no. 4 (November 2012): 839–46. http://dx.doi.org/10.1590/s1519-69842012000500009.
Full textAbstract:
In order to verify the microbial quality of the influents and effluents of one STP from southern Brazil, an eight-month survey was conducted to examine the presence of total and fecal coliforms and of adenovirus (HAdV), enterovirus (EV), genogroup A rotaviruses (GARV) and Torque teno virus (TTV), in treated effluent samples from São João/Navegantes STP, Porto Alegre (Brazil). A total of 16 samples were collected, eight of influent (raw sewage, prior to treatment), and the other eight of the effluent (post-treatment sewage). Total and fecal coliform levels ranging from 3.6 × 10(4) to 4.4 × 10(7) MPN/100 mL and 2.9 × 10³ to 1.7 × 10(7) MPN/100 mL, were detected in all samples. In raw sewage, HAdV (25%) and GARV (28.6%) viral genomes were detected. The analysis of effluent samples revealed the presence of HAdV (50%), EV (37.5%), and TTV (12.5%) genomic fragments. All samples, regardless of the month analysed, presented detection of a least one virus genus, except for in April. Higher virus detection rates were observed in treated sewage samples (62.5%), and in 80% of them (effluent positive samples) HAdV was detected. Results showed that improvements in sewage monitoring and treatment processes are necessary to reduce the viral and bacterial load on the environment in southern Brazil. To the knowledge of the authors, this is the first study showing the monitoring of viral genomes in influent and effluent samples from a STP located in Porto Alegre (Rio Grande do Sul, Brazil), southern Brazil.
17
Biemond, Bart J., Tim R. de Back, Charlotte F. J. Van Tuijn, Erfan Nur, and Berto J. Bouma. "The High Output State of Sickle Cell Patients: Associations with Anemia-Related Organ Damage." Blood 132, Supplement 1 (November 29, 2018): 3661. http://dx.doi.org/10.1182/blood-2018-99-117501.
Full textAbstract:
Abstract Introduction: As longevity of sickle cell disease (SCD) patients increases, chronic organ damage becomes more prevalent. Tricuspid regurgitation velocity (TRV) ≥2.5 m/sec) has long been considered a reliable indicator of pulmonary hypertension (PH). However, studies using right heart catherization confirmed PH in only 25% of patients with TRV elevation, despite the independent association of an elevated TRV with mortality. Since TRV elevation is also associated with anemia and cardiac remodeling on trans-thoracic echocardiography (TTE), we hypothesized that an elevated TRV may also identify SCD patients with a hyperdynamic circulation due to severe anemia, putting them at higher risk for anemia-related organ damage and early mortality. We aimed to determine the associations between TRV elevation and other high output parameters on TTE with anemia-related organ damage and to assess what echocardiographic parameters predict anemia-related organ damage and mortality. Methods: In this retrospective, longitudinal study, SCD patients were followed from the oldest TTE onwards. At baseline and after follow-up, TTE parameters of cardiac function (including TRV and signs of volume and pressure overload), anemia-related organ damage (microalbuminuria, renal failure, stroke, leg ulcers, priapism, diastolic dysfunction) and mortality were assessed. Logistic and cox regression analyses were applied to analyze associations between baseline echocardiographic findings and laboratory results with development of anemia-related organ damage during follow-up to identify predictors of organ damage. Results: In total 254 patients were included in the study cohort. The mean follow-up was 6.0 years (4.0-8.0 yr). Elevated TRV was found at baseline in 58/254 (22.8%) patients versus 196/254 (77.2%) patients with a normal TRV. Patients with an elevated TRV had an increased cardiac output (59 dL/min vs. 52 dL/min; P <0.01), E-wave velocity (104 cm/sec vs. 94 cm/sec; P=.03), septal E/e'-ratio (9.2 vs. 7.9; P=.02), left ventricular (LV) mass index (111 g/m2 vs. 94 g/m2; P <0.01) and left atrial (LA) volume index (50 g/m2 vs. 39 g/m2; P <0.01) compared to patients with a normal TRV, which remained unchanged during follow-up. At baseline and upon follow up microalbuminuria (28% vs. 15%; P 0.03) and renal failure (7% vs. 0%; P <0.01) were more prevalent in patients with TRV elevation as compared to patients without TRV elevation. The composite incidence of new forms of anemia-related organ damage after follow-up was higher in patients with an elevated TRV (45% vs. 27%; P 0.02). An elevated LV mass index (representing pressure overload) and septal E/e'-ratio (representing volume overload) were associated with TRV and a higher prevalence of anemia-related organ damage at baseline, but not with new organ damage upon follow-up or mortality. Predictors of organ damage after follow-up were hemoglobin level (OR 0.7 [0.5 - 0.9]; P <0.01) and age (OR 3.1 [1.7 - 5.5]; P <0.01) and new organ damage was predicted by lactate dehydrogenase (LDH) (OR 1.5 [1.1-2.0]; P=.02) and age (OR 2.0 [1.3 - 3.0]; P <0.01). Conclusion: A high output state in SCD patients is associated with an elevated TRV and anemia-related organ damage, in particular nephropathy, mainly as a consequence of severe anemia and increasing age. These associations may better explain early mortality in these patients despite the fact that only a limited part of these patients do have pulmonary hypertension. Patients with an elevated TRV or other signs of a high output state are at risk of anemia-related organ damage (in particular nephropathy) and should be monitored closely. Early administration of available treatment modalities should be considered. Disclosures No relevant conflicts of interest to declare.
18
Mokra, V., B. Gotzova, V. Bezdekova, P. Dedic, and J. Ptacek. "First Report of Tobacco streak virus on Dahlia in the Czech Republic." Plant Disease 92, no. 3 (March 2008): 484. http://dx.doi.org/10.1094/pdis-92-3-0484b.
Full textAbstract:
Dahlia is an important ornamental crop in the Czech Republic where they have been grown for more than 150 years. New dahlia cultivars have been selected by Czech plant breeders. Virus diseases, including mosaic and stunt caused mostly by Dahlia mosaic virus, have been a problem. From 2003 to 2005, color breaking was observed in several dahlia cultivars of foreign and Czech origin. White stripes in blossoms were most frequently expressed in the second half of the flowering season. No symptoms are visible in flowers of white and yellow cultivars. It was difficult to characterize symptoms on leaves because most cultivars were infected simultaneously by Dahlia mosaic virus. Sap inoculations of Chenopodium quinoa produced local lesions after 5 to 7 days, followed by systemic chlorosis, necrosis of younger leaves, and death of the shoot apex, indicating possible Tobacco streak virus (TSV) infection (2). Spherical particles (25 to 30 nm) were observed in leaf-dip preparations of samples from experimentally infected C. quinoa plants and analyzed by using transmission electron microscopy. These particles became decorated when using immunoelectron microscopy with TSV IgG (Bioreba, Reinach, Switzerland and Neogen, Ayrshire, Scotland). Samples of 80 dahlia cultivars were tested for TSV infection by ELISA using commercially available kits (Bioreba and Neogen). Most of the samples were grown in a collection of dahlia cultivars of Czech and foreign origin and some were obtained from growers in the Czech Republic. Fifty six dahlia cultivars were shown to be TSV infected. ELISA also indicated a higher concentration of the virus in flowers. The identity of the virus isolated from symptomatic plants was confirmed by reverse transcription (RT)-PCR using total RNA extraction from symptomatic plants. RT-PCR (4), using a primer pair (1) derived from the coat protein gene sequence of TSV (3), was followed by electrophoresis on 1.0% agarose gels. Products of the predicted size (approximately 700 bp) were found in naturally infected dahlia plants (n = 10), systemically infected host plants C. quinoa (n = 10), and symptomatic Nicotina megalosiphon (n = 10) that scored as TSV positive by ELISA. No bands of this size were seen in negative controls. To our knowledge, this is the first detection of TSV in the Czech Republic. References: (1) A. I. Bhat et al. Arch. Virol. 147:651, 2002. (2) A. A. Brunt Plant Pathol. 17:119, 1968. (3) B. J. C. Cornelissen et al. Nucleic Acids Res.12:2427, 1984. (4) S. S. Pappu et al. J. Virol. Methods 4:9, 1993.
19
Hanson, Anne-Marie, J. Roger Harris, Robert Wright, Alex Niemiera, and Naraine Persaud. "Water Content of a Pine-bark Growing Substrate in a Drying Mineral Soil." HortScience 39, no. 3 (June 2004): 591–94. http://dx.doi.org/10.21273/hortsci.39.3.591.
Full textAbstract:
Newly transplanted container-grown landscape plants are reported to require very frequent irrigation. However, container nurseries in the U.S. commonly use growing substrates that are mostly bark, even though the contribution of bark-based growing substrates to water relations of transplanted root balls is unknown. Therefore, a field experiment was undertaken to determine water relations of a pine-bark substrate (container removed) within a drying mineral soil over a three week period. A range of common production container sizes—3.7 L (#1), 7.5 L (#2), 21.9 L (#7), 50.6 L (#15), and 104.5 L (#25)—was used. The fraction of substrate volume that is water [total volumetric water (TVW)] within the top and middle zones of substrate was compared to TVW at corresponding depths of adjacent mineral soil. The fraction of substrate and soil volume that is plant-available water [plant-available volumetric water (PAVW)] was calculated by subtracting the fraction of substrate or soil volume below where water is unavailable to most plants (measured with pressure plates) [plant-unavailable volumetric water (PUVW)] from each TVW measurement. The pine-bark substrate had a PUVW of 0.32 compared to a PUVW of 0.06 for soil. Top sections of substrate dried to near zero PAVW 6 days after irrigation for all containers. Larger container sizes maintained higher PAVW in middle sections than smaller container sizes, and PAVW was always higher in the adjacent soil than in the embedded substrate. Overall, very little PAVW is held by the embedded pine-bark growing substrate, suggesting the need for container substrates with greater water retention once transplanted to mineral soils.
20
Gendre, Renato. "Nota Gotica." Linguistica 42, no. 1 (December 1, 2002): 5–7. http://dx.doi.org/10.4312/linguistica.42.1.5-7.
Full textAbstract:
Dalla documentazione presentata, ancorché in modo non completo, si può constatare che ogni qual volta il testo greco presenta i1 verbo nella posizione 'in incastro', 2 anche in quello gotico troviamo la stessa situazione. E benché crediamo a una sostanziale dipendenza dal greco dalla prassi sintattica gotica, 3 tuttavia riteniamo che non si possa del tutto escludere di trovarsi in presenza di uno stesso tratto sintattico, cioé di uno stesso modo di distribuire l'informazione, secondo un preciso ordine dei costituenti di frase, di origine indoeuropea. La "spezzatura di ciò che secondo il nostro sentimento linguistico è unito [ ... ] è comune sia tra i Greci che tra i Latini e gli Indiani4 e si trova in tracce ben riconoscibili anche nell'epica germanica".5 Purtroppo, come già G. Bonfante, anche noi pur "scandagliando l'epopea germanica [non abbiamo] trovato nulla in questo senso".6 La presenza sicura di questo tratto nel gotico però e, per chi come noi gli dà valore, l 'uso della tmesi 7 in testi epici germanici 8 sono 1í ad avvalorare l'ipotesi che la posizione 'in incastro' del verbo rappresenta "il modo più antico, facilmente c omprensibile dal p unto di v ista psicologico, di ordinare le paro le n ella frase idg". 9 È ben vero che il passo del Vangelo di Luca (2, 25) "7tveuμa. Tiv &ytov E7t' a.u't6v", reso in gotico "ahma weihs was ana imma", sembrerebbe opporsi a quanto è stato appena affermato. Ma cosí non è. Infatti, "il ne faut pas perdre de vue que Wulfila a suivi un manuscrit grec du type de *K ou *Kt, mais que la version gotique présente des leçons propre à 1cxo5" .1 O E molti manoscritti appartenenti al 'Ti po I' 11 riportano la lezione "7tveuμa. &ytov Tiv". 12 Pertanto, l'unica conclusione che da questo esempio si deve trarre è che il grande Vescovo dei Goti abbia avuto sotto gli occhi un testo di questa ultima famiglia e, come è nel suo stile, ne sia stato condizionato.
21
Castro, Oswaldo, Gregory Kato, Vandana Sachdev, Roberto Machado, Inez Ernst, Wynona A. Coles, James S. Nichols, Lori A. Hunter, and Mark T. Gladwin. "The Sickle Cell-Pulmonary Hypertension Screening Study: ECHO Findings at Two-Years of Follow Up." Blood 106, no. 11 (November 16, 2005): 314. http://dx.doi.org/10.1182/blood.v106.11.314.314.
Full textAbstract:
Abstract In a prospective study started in 2001 echocardiography (ECHO) was used to screen 195 unselected adult sickle cell patients for pulmonary hypertension (PHTN). The prevalence of PHTN [tricuspid regurgitant jet velocity (TRV) of 2.5 m/sec or higher, corresponding to a pulmonary artery systolic pressure (PAs) of at least 35 mm Hg] was 32 %. Markers of hemolysis (low Hb, and high reticulocytes and LDH) were associated with PHTN risk. Although the pulmonary pressures in sickle-related PHTN were not as high as in other forms of PHTN, they were predictive of short survival (NEJM2004;350:886). We now report the TRV results in 113 patients who had repeat ECHO exams at 2.1 years (range 1.2–4.1 y) after study enrollment. Their mean age was 36.2 ± 10.3 y and 59 % were female. Their hemoglobin types were: SS, 77.7 %; SC, 14.3 %; Sickle-thal.+, 6.3 %; and Sickle-thal.0, 1.8 %. At baseline, 40 patients had PHTN (mean TRV 2.75 m/sec) and their mean TRV at the 2 y follow up was 2.71 m/sec (p=0.45). In 6 subjects the TRV decreased to normal values from baselines of 2.5 – 3 m/sec. Nevertheless, the mortality of the patients diagnosed with PHTN at baseline currently stands at 40% at 40 months of follow-up. Seventy-three patients did not have PHTN at enrollment (mean TRV 2.0 m/sec) and as a group their TRV at the 2 y follow up had not changed significantly (mean 2.1, p=0.1). However, 11 of the 73 patients (15.1%) with initially normal TRV developed PHTN at 2 years (mean TRV 2.70, range 2.5–3.5 m/sec). The table shows that age, sex, Hb type, Hb F %, and hydroxyurea treatment of the patients who developed PHTN at the 2 y follow up were not significantly different from those who did not. However, patients who developed PHTN were significantly more anemic, had higher reticulocyte counts, and higher serum ferritin values. A trend toward an increased bilirubin and LDH was observed. Hence, hemolysis probably played a pathogenetic role in these patients’ increased pulmonary pressures, as is also postulated for sickle patients who had PHTN at baseline. These preliminary results suggest that the incidence of PHTN in adult sickle patients could be as high as 7 % per year and that ECHO screening of these patients every two years is probably indicated. No PHTN PHTN P value N 62 11 Mean age, y (±SD) 34.1 ± 8.9 34.6 ± 13.4 0.85 Sex (% female) 56 64 0.75 Non-SS (%) 27 18 0.5 On hydroxyurea (%) 41 25 0.5 Hb (g/dl, mean±SD) 9.98 ± 1.74 8.68 ± 1.91 0.04 Hb F (%,mean±SD) 7.9 ± 6.8 7.5 ± 7.4 0.869 Abs. Retics (x1000/mm3, mean±SD) 205 ± 107 288 ± 151 0.045 LDH (U/L, mean±SD) 286 ± 107 359 ± 179 0.09 Bilirubin (mg/dl, mean±SD) 2.5 ± 1.88 3.7 ± 2.58 0.10 Ferritin (mg/L, mean±SD) 632 ± 925 1439 ± 1849 0.046 Creatinine (mg/dl, mean±SD) 0.76 ± 0.23 0.69 ± 0.25 0.36
22
Mehan, V. K., D. McDonald, and N. Ramakrishna. "Varietal Resistance in Peanut to Aflatoxin Production1." Peanut Science 13, no. 1 (January 1, 1986): 7–10. http://dx.doi.org/10.3146/i0095-3679-13-1-3.
Full textAbstract:
Abstract Rehydrated, mature, undamaged seed of 502 peanut (Arachis hypogaea L.) genotypes were scarified, inoculated with an aflatoxigenic strain of Aspergillus flavus Link, and tested for aflatoxin B1 production after incubation at 25 C for 10 days. All genotypes supported production of aflatoxin B1 but significant genotypic differences in levels of aflatoxin B1 production were found. Genotypes U 4–7–5 and VRR 245 supported the lowest levels of aflatoxin B1 (< 10 μg/g seed), whereas the commonly grown Indian cultivar TMV 2 supported production of aflatoxin B1 at levels of over 150 μg/g seed. Eight genotypes with low, moderate or high capacity to support aflatoxin B1 production were further tested using seed from one rainy season crop, and two irrigated postrainy season crops. Genotypic differences in levels of aflatoxin B1 production were consistent over seasons. Production levels were slightly lower in seed from the rainy season crop than in seed from the two postrainy season crops.
23
Carvalho, Ruy Inacio Neiva de, and Flávio Zanette. "Dinâmica da dormência de gemas de dois anos de macieira 'Imperial Gala' em região de baixa ocorrência de frio." Revista Brasileira de Fruticultura 26, no. 3 (December 2004): 392–94. http://dx.doi.org/10.1590/s0100-29452004000300005.
Full textAbstract:
O objetivo deste trabalho foi determinar a dinâmica da dormência de gemas em ramos de dois anos de macieira 'Imperial Gala' com ou sem frio suplementar durante o outono e inverno, cultivadas em Porto Amazonas - PR, região de baixa ocorrência de frio. Os ramos foram coletados em intervalos de 21 dias, de abril a agosto (19-04, 10-05, 31-05, 21-06, 12-07, 02-08 e 23-08) e receberam ou não tratamento com frio suplementar de 1.440 horas, à temperatura de 4 a 7° C. A avaliação da dormência foi realizada pelo teste biológico de estacas de nós isolados (temperatura de 25° C e fotoperíodo de 16 horas) por meio dos parâmetros: tempo médio para brotação (TMB), velocidade de brotação (VB), taxa final de brotação (TF), taxa de brotações vigorosas (TBV) e tempo médio para aparecimento de folhas abertas (TMFA). A dormência mais intensa de gemas de dois anos ocorre no final de maio, com oscilações até o início de agosto. A aplicação de 1.440 horas de frio suplementar de 4 a 7° C altera a dinâmica da dormência das gemas de dois anos, reduzindo o seu tempo médio de brotação. Uma vez propiciada a brotação de gemas não-dormentes de dois anos, as mesmas possuem boa capacidade para se desenvolver.
24
Sako, Takashi. "Hadronic interaction studied by TA." EPJ Web of Conferences 210 (2019): 02003. http://dx.doi.org/10.1051/epjconf/201921002003.
Full textAbstract:
Two studies by the Telescope Array group related to the hadronic interaction observed with Extensive Air Showers are reviewed. (1) Inelastic p-air cross section $ \sigma _{p - air}^{inel} = 567.0 \pm 70.5\,[{\rm{stat]}}_{ - 25}^{ + 29} [{\rm{sys}}]\,{\rm{mb}} $ and total p-p cross section $ \sigma _{p - p}^{tot} = 170_{ - 44}^{ + 48} [{\rm{stat}}]_{ - 17}^{ + 19} [{\rm{sys}}]\,{\rm{mb}} $ were determined using the 5 years of TA hybrid data with one of the 3 FD stations. These results at the highest energy $ \sqrt {S_{NN} } = 95\,{\rm{TeV}} $ showed good agreements with the extrapolation from the previous measurements and model predictions. (2) The signal sizes of SD were compared between data and MC using 7 years of TA SD data in the energy range from 1018.8 eV to 1019.2 eV. It was found that the data/MC ratios exceed unity and the deviation becomes larger when the expected fraction of muon signal, defined as muon purity P, is higher. The results support the muon excess (with respect to MC) problem reported by the previous observations.
25
Garufi, C., F. R. Spinelli, S. Mancuso, F. Ceccarelli, and F. Conti. "AB0704 TELEMEDICINE AT THE TIME OF COVID-19: THE EXPERIENCE WITH RA PATIENTS TREATED WITH JAK-INHIBITORS." Annals of the Rheumatic Diseases 80, Suppl 1 (May 19, 2021): 1384.1–1384. http://dx.doi.org/10.1136/annrheumdis-2021-eular.3892.
Full textAbstract:
Background:The spread of COVID-19, the lockdown, the limited access to care reevaluated the role of tele-consultation and self-assessment.Objectives:Our aim was to evaluate in a cohort of Rheumatoid Arthritis (RA) patients treated with JAK-inhibitors (JAKi): the self-assessed disease activity during lockdown, the lockdown impact on fatigue, anxiety, depression and the prevalence of Covid-19.Methods:We enrolled RA patients treated with baricitinib or tofacitinib. At baseline (BL) and follow-up we collected: patients’ demographic data, composite disease activity indices (CDAI, DAS28CRP), global assessment (PGA), pain visual analogue scale (VAS), FACIT (functional assessment of chronic illness therapy) and a self-rating scale for disease impact on anxiety and depression (Zung-A/D). Patients were instructed on how to perform self-assessment through video-material and fulfilled the online form of “Rheumatoid Arthritis Impact of Disease” (RAID)1 and “RA Disease Activity Index” (RADAI). To capture the pandemic effect, we compared patients in different status (remission, low, moderate and high-disease activity) at the last in-person visit (preCoV) through the DAS28CRP and CDAI, to the tele-health visit (THV), measured by the RAID. BL and pre-CoV ZUNG-A, ZUNG-D, FACIT questionnaires were compared with the online results during the pandemic. Exposure, tests and symptoms of Covid-19 were recorded. Data were expressed as mean±standard deviation or median(IQR) according to distribution.Results:Twenty patients (median age 58.2±11.9 and mean disease duration 153.5 ± 112.7 months) were treated with tofacitinib and 27 with baricitinib. The median time-lapse between the pre-CoV visit and the THV was 12 (IQR 4) weeks. DAS28CRP and CDAI significantly decreased from BL to pre-CoV visit. During the last in-person visit, 21 patients (48.83%) were in remission, 9 (20.93%) in low disease activity; according to the RAID, 15 (31.91%) and 7 (14.89%) patients were respectively in remission and low disease activity during the THV (Table A). PGA and pain significantly decreased from BL to pre-Cov visit but worsened during the lockdown (Table A). FACIT remaining stable during THV. At THV, we detected a significant improvement of anxiety from BL (Zung-A) and a tendency to lower depression scores compared to BL (Table A). JAKi showed a good safety profile considering Covid-19 symptoms, none of the patients was diagnosed with SarsCoV2 infection.Conclusion:This is the first study on virtual assessment in RA patients treated with JAKi. The unique social experiment of the pandemic impaired the clinical response already achieved before the lockdown, without a collateral worseling of FACIT, anxiety and depression.References:[1]Gossec L, et al. Ann Rheum Dis. 2009[2]Stucki G, et al. Arthritis Rheum. 1995Table A.DAS28, CDAI, RAID scores and patient-reported outcomes assessment at baseline and during the follow-upBLpre-CoVTHVDISEASE ACTIVITYN (%)N (%)N (%)REMISSIONDAS280 (0%)21 (48.8%)CDAI0 (0%)10 (22.7%)RAID15 (31.9%)LOW DISEASEDAS281(2.1%)9 (20.9%)CDAI7(14.8%)23 (52.2%)RAID7 (14.9%)MODERATEDAS2833 (70.2%)12 (27.9%)CDAI17 (37.1%)8 (18.1%)RAID13 (27.6%)HIGHDAS2813 (27.6%)1 (2.3%)CDAI23 (48.9%)3 (6.8%)RAID12 (25.5%)GH70 (30)20 (49.5)*45 (45)*#Pain70 (28)25 (45.5)*40 (48.5)*#Zung A37 (9)37 (10.2)35 (14)*Zung-D39 (17)39 (13)*38 (12)FACIT11.5 (17.2)8 (19.5)7(15)* p≤0.001 vs BL# p ≤0.04vs preCoVData expressed as median (IQR)Disclosure of Interests:Cristina Garufi: None declared, Francesca Romana Spinelli Speakers bureau: Abbvie, Eli Lilly, Consultant of: Gilead/Galapagos, Eli Lilly, Grant/research support from: Pfizer, Silvia Mancuso: None declared, Fulvia Ceccarelli: None declared, Fabrizio Conti Speakers bureau: Abbvie, Eli Lilly, Sanofi, Pfizer, Consultant of: Gilead/Galapagos
26
CARVALHO, Ruy Inacio Neiva de, Luiz Antonio BIASI, Flávio ZANETTE, José Carlos RENDOKE, Jean Magnus SANTOS, and Gabriely Pinto PEREIRA. "DINÂMICA DA DORMÊNCIA DE GEMAS DE CAQUIZEIRO ‘FUYU’ EM REGIÃO DE BAIXA OCORRÊNCIA DE FRIO." Scientia Agraria 11, no. 1 (February 28, 2010): 057. http://dx.doi.org/10.5380/rsa.v11i1.16077.
Full textAbstract:
O objetivo da pesquisa foi determinar a dinâmica da dormência de gemas em caquizeiros cv. Fuyu durante o outono e inverno em região de baixa ocorrência de frio. Os ramos foram coletados em 10 datas no período de abril a agosto de 2007 e 2008 em um pomar do município de Fazenda Rio Grande, Paraná. Na última coleta, um grupo adicional de ramos foi coletado e mantido em refrigerador (4 a 7 °C) por 672 h. A intensidade de dormência foi avaliada pelo teste biológico de estacas de nós isolados realizado a temperatura de 25 °C e fotoperíodo de 16 h, por meio dos parâmetros tempo médio para brotação (TMB), taxa final de brotação (TF), tempo médio para aparecimento de folhas abertas (TMFA), taxa de brotações vigorosas (TBV) e velocidade de brotação (VB). O delineamento experimental adotado foi o completamente casualizado com 11 tratamentos, quatro repetições e dez estacas por parcela. Os dois anos de avaliação foram analisados individualmente. A endodormência mais intensa do caquizeiro ‘Fuyu’ ocorre no período compreendido entre a metade de maio e o início de junho em região de baixa ocorrência de frio.
27
Kwon, Woon-Seong, Suresh Ramalingam, Xin Wu, Liam Madden, C. Y. Huang, Hung-Hsien Chang, Chi-Hsin Chiu, Steve Chiu, and Stephen Chen. "Cost Effective and High Performance 28nm FPGA with New Disruptive Silicon-Less Interconnect Technology (SLIT)." International Symposium on Microelectronics 2014, no. 1 (October 1, 2014): 000599–605. http://dx.doi.org/10.4071/isom-wp11.
Full textAbstract:
This paper introduces the first comprehensive demonstration of new disruptive innovation technology comprising multiple Xilinx patent-pending innovations for highly cost effective and high performance Xilinx FPGA, which is so called stack silicon-less interconnect technology (SLIT) that provides the equivalent high-bandwidth connectivity and routing design-rule as stack silicon interconnect (SSI) technology at a cost-effective manner. We have successfully demonstrated the overall process integration and functions of our new SLIT-employed package using Virtex® -7 2000T FPGA product. Chip-to-Wafer stacking, wafer level flux cleaning, micro-bump underfilling, mold encapsulation are newly developed. Of all technology elements, both full silicon etching with high etch selectivity to dielectric/fast etch rate and wafer warpage management after full silicon etching are most crucial elements to realize the SLIT technology. In order to manage the wafer warpage after full Si removal, a couple of knobs are identified and employed such as top reinforcement layer, micro-bump underfill properties tuning, die thickness/die-to-die space/total thickness adjustments. It's also discussed in the paper how the wafer warpage behaves and how the wafer warpge is managed. New SLIT module shows excellent warpage characteristics of only −30 μm ~ −40 μm at room temperature for 25 mm × 31 mm in size and +20 μm ~ +25 μm at reflow temperature. Thermal simulation results shows that thermal resistance of new SLIT package is almost comparable to that of standard 2000T FCBGA package using TSV interposer with standard heat sink configuration and air wind condition. The reliability assessment is now under the study.
28
Říha, J., and J. Vejnar. "Comparison of two vitrification methods for cryopreservation of porcine embryos." Czech Journal of Animal Science 49, No. 5 (December 12, 2011): 183–89. http://dx.doi.org/10.17221/4298-cjas.
Full textAbstract:
The aim of this study was to compare two vitrification methods of porcine perihatching blastocysts with regard to the success of transfer of these embryos to the recipients. Expanded, hatching, or hatched blastocysts were recovered post mortem from superovulated donors in 5.5 to 6.0 days after artificial insemination of donor gilts with homospermic doses. In protocol VS I, the embryos in perihatching developmental stage were equilibrated in a culture medium H-MEMD with 10% v/v of glycerol (1.37M solution of glycerol in medium) for 10 min and placed in a vitrification medium for 1.5 min max. (vitrification medium contained 50% v/v 2M sucrose in tridistilled water, 30% v/v of glycerol, and 20% v/v of foetal calf serum – FCS). Then they were dropped with micropipette and stored in liquid nitrogen vapour. For protocol VS II, we used H-MEMD culture medium supplemented with 20% v/v of FCS, 25% v/v ethylene glycol, and 25% v/v dimethyl sulphoxide (DMSO). Embryos were equilibrated for 10 min in a mixture of the vitrification medium and culture medium (1 : 1), and were kept in the vitrification medium for 1.5 minutes. Then they were dropped with micropipette and stored in liquid nitrogen vapour. Embryos were thawed by immersing the drop with the embryo in H-MEMD culture medium with 0.8M sucrose for 10 minutes. After thawing and washing in the medium with sucrose, all embryos were washed three times in a fresh medium and prepared for transfer. Recipients were synchronized either using Regumate-feeding followed by treatment with PMSG and HCG (gilts) or using piglet weaning (sows – 1st and 2nd parity). Recipients showing standing heat at the time of donor insemination were used for laparoscopic and non-surgical ET on day 5.5–6.0 of the cycle. The fraction of viable embryo vitrified under VS I or VS II protocol was 85% and 80%, compared to 95% in control fresh embryos (P > 0.05). Pregnancy of recipients was 57.3% (5/7), 67.0% (4/6) for VS I or VS II group and 42.7% (10/23) for control (P < 0.001). We can conclude on the basis of our data that both protocols for vitrification yielded similar results and can be used for cryopreservation of porcine embryos.
29
Morris, Claudia R., Jung H. Suh, Sandra Larkin, D. Anton Bland, Adam Odhiambo, Martin H. Steinberg, Elliott P. Vichinsky, et al. "Erythrocyte Glutathione Depletion Is Associated with Severity of Anemia and Pulmonary Hypertension in Patients with Sickle Cell Disease." Blood 108, no. 11 (November 16, 2006): 788. http://dx.doi.org/10.1182/blood.v108.11.788.788.
Full textAbstract:
Abstract Background: Glutathione (GSH) is the most abundant intracellular non-protein thiol and is an anti-oxidant present in high millimolar concentration in erythrocytes. Additionally, GSH plays an important role in signal transduction, gene expression, apoptosis, protein glutathionylation, nitric oxide metabolism, and is the principal thiol redox buffer in erythrocytes. We hypothesized that, in sickle cell disease (SCD), GSH deficiency contributes to oxidative stress and pre-disposes the sickle erythrocyte to hemolysis. Methods: A sensitive liquid chromatography coupled to tandem mass spectrometric technique was used to examine the availability of GSH and its precursors (glutamate, cysteine, glycine and glutamine) in plasma and within the erythrocytes of 25 patients with SCD and 7 ethnically-matched normal volunteers. Given the association of hemolysis with pulmonary artery hypertension (PAH) in this population, tricuspid regurgitant jet velocity (TRV) by Doppler echocardiography was also determined in all patients. Results: Despite an increase in the amino acid precursors of GSH in the plasma of SCD patients compared with controls, total plasma GSH was significantly decreased (2.8 ± 1.5 vs. 4.1 ± 2.1 mM, p<0.05, SCD vs. controls). Additionally, a striking 61% depletion of GSH was found within the erythrocytes of SCD patients compared with normal volunteers (308.1 ± 112 vs. 790.8 ± 292 mM, p<0.0001). Erythrocyte glutamine concentrations were also decreased in SCD patients compared with controls (404.6 ± 252 vs. 1061 ± 277 mM, p<0.0001), while cysteine, glycine and glutamate levels trend higher. This indicates a potential loss of GSH synthesis capacity in SCD patients. The degree of erythrocyte GSH depletion correlated strongly with TRV (r = −0.64, p<0.0001), which is of significant clinical interest given the increased mortality risk of PAH in patients with SCD. While erythrocyte glutamine concentration also correlated inversely with TRV (r = −0.59, p < 0.001), erythrocyte glutamate and cysteine levels as well as plasma GSH and its precursors were not associated with TRV. Erythrocyte GSH depletion strongly associated with hematocrit (r = 0.60, p<0.001), suggesting a link to chronic anemia. Plasma arginase concentration strongly correlated with plasma-free Hb (r=0.83, p<0.0001) and inversely correlated with erythrocyte GSH (r=−0.41, p=0.02), linking lower erythrocyte GSH levels to increased red cell derived plasma arginase and therefore potentially an increased risk of mortality in SCD & PAH as we have previously reported (Morris et al, JAMA 2005). Conclusions: Lower levels of erythrocyte GSH may contribute to the development of PAH possibly by exacerbating oxidative stress and triggering hemolysis, resulting in release of erythrocyte arginase and dysregulation of arginine and NO metabolism. The role of GSH metabolism in the pathophysiology of SCD and its link to PAH warrants further investigation.
30
Becker Tjus, J. "Neutrinos from colliding wind binaries: future prospects for PINGU and ORCA." ASTRA Proceedings 1 (May 21, 2014): 7–11. http://dx.doi.org/10.5194/ap-1-7-2014.
Full textAbstract:
Abstract. Massive stars play an important role in explaining the cosmic ray spectrum below the knee, possibly even up to the ankle, i.e. up to energies of 1015 or 1018.5 eV, respectively. In particular, Supernova Remnants are discussed as one of the main candidates to explain the cosmic ray spectrum. Even before their violent deaths, during the stars' regular life times, cosmic rays can be accelerated in wind environments. High-energy gamma-ray measurements indicate hadronic acceleration binary systems, leading to both periodic gamma-ray emission from binaries like LSI + 60 303 and continuous emission from colliding wind environments like η-Carinae. The detection of neutrinos and photons from hadronic interactions are one of the most promising methods to identify particle acceleration sites. In this paper, future prospects to detect neutrinos from colliding wind environments in massive stars are investigated. In particular, the seven most promising candidates for emission from colliding wind binaries are investigated to provide an estimate of the signal strength. The expected signal of a single source is about a factor of 5–10 below the current IceCube sensitivity and it is therefore not accessible at the moment. What is discussed in addition is future the possibility to measure low-energy neutrino sources with detectors like PINGU and ORCA: the minimum of the atmospheric neutrino flux at around 25 GeV from neutrino oscillations provides an opportunity to reduce the background and increase the significance to searches for GeV–TeV neutrino sources. This paper presents the first idea, detailed studies including the detector's effective areas will be necessary in the future to test the feasibility of such an approach.
31
Cherif, Honar, Martin Hoglund, and Karlis Pauksens. "Influenza A H1N1 2009 Vaccine in Patients with Hematological Diseases: Good Safety and Immunogenicity Even in Heavily Chemotherapy-Treated Patients." Blood 120, no. 21 (November 16, 2012): 1054. http://dx.doi.org/10.1182/blood.v120.21.1054.1054.
Full textAbstract:
Abstract Abstract 1054 Background: Patients with hematological malignancies are more susceptible for viral infections including influenza, which may be associated with prolonged illness, increased morbidity and mortality. In 2009, the World Health Organization classified the novel influenza A(H1N1) virus as pandemic. The impact of this viral infection in patients (pts) with hematological disorders was unknown, and there were concerns about the risk of serious complications. In Sweden, institutional guidelines recommended two doses of the AS03-adjuvanted inactivated H1N1 split vaccine Pandemrix™ from GlaxoSmithKline in these pts. Aims: Prospectively determine the safety, immunogenicity, and clinical efficacy of influenza A (H1N1) 2009 vaccination in patients with hematological diseases. Compare the immunological response to that obtained by the trivalent seasonal influenza vaccine (TIV). Patients and methods: 31 pts were included (myeloma 9, CLL 5, AML 6, ALL 2, CML 2, others 5), out of which 13 had undergone hematopoietic stem cell transplantation (HSCT). All received influenza A(H1N1) 2009 vaccine at day 0, and 28, and the majority (n=25) seasonal influenza vaccine at day 56. Serum for antibody analyses by validated HI-assays was taken at day 0, 28, 56 and 86 and at 1 year. The response to vaccination (seroconversion) was defined as at least a four-fold increase in antibody titer after vaccination or, in case prevaccination HI-titer was < 10, a post-vaccination titer of HI > 40 or greater. Considering that the HI-assay for influenza B differed from the A strains only the seroconversion rate was considered for the influenza B. Results: The A (H1N1) vaccine was well tolerated and no severe adverse events were reported. At day 28, a total of 16(52%) patients had protective levels of antibodies to A (H1N1) 2009 and 15(48%) had a seroconversion response. After the second dose of the vaccine, 25(81%) reached both protective levels of antibodies and seroconversion. At 1 year, protective levels of antibodies against A (H1N1) 2009 remained in 56% of responding patients. Seroconversion response was observed in 9/13 patients who had undergone HSCT, including 5/9 pts who had been transplanted within1–5 months, as well as in all (n=9) pts with myeloma having advanced disease and/or ongoing intense treatment. Following vaccination with TIV and evaluated at day 86, protective antibody levels and seroconversion response against A/Brisbane/59/2007 H1N1-like virus were detected in 10(40%) respective 7(28%), and against A/Uruguay/10/2007/H3N2-like virus in 14(56%) respective 10(40%). As for B/Brisbane/60/2008-like virus, seroconversion response was found in 5(20%) of all pts. Response to the pandemic influenza A (H1N1) 2009 vaccine was better than that to the three TIV strains (p<0.001, p<0.009 and p<0.001 respectively). Conclusion: A substantial proportion of patients with hematological malignancies including even heavily treated Myeloma and HSCT patients mounted a good response to the adjuvanted influenza A (H1N1) 2009 vaccine. This vaccine was well tolerated and had a significantly better immunogenicity than that of the non-adjuvanted seasonal influenza vaccine. Disclosures: Cherif: GSK: Research Funding. Pauksens:GSK: Research Funding.
32
Ponsart, C., H. Quinton, A. Rohou, J. Kelhembo, G. Bourgoin, and P. Humblot. "191 INFLUENCE OF THE DIFFERENT TIME COMPONENTS BETWEEN FLUSHING AND TRANSFER ON PREGNANCY RATES OF FROZEN CATTLE EMBRYOS." Reproduction, Fertility and Development 18, no. 2 (2006): 203. http://dx.doi.org/10.1071/rdv18n2ab191.
Full textAbstract:
Previous studies have shown that the time between flushing and freezing of bovine embryos can influence pregnancy rates (PRs) following embryo transfer (ET). The aim of this study was to determine which time components can influence ET results. Time components between flushing of a superovulated donor and freezing of the collected embryos were investigated under field conditions. Embryos were frozen in 1.5 M ethylene glycol (EG) for direct transfer. During January 2003, ET technicians (EmbryoTop, Rennes cedex, France) recorded systematically times corresponding to each step comprising the time spent in vitro (TIV) from 153 recovery sessions (RS) with freezing: end of flushing, beginning and end of search of embryos, start of equilibration in EG, beginning and end of straw loading, introduction to −7°C in the freezer, and seeding. Numbers of donor cows and ET technicians doing the freezing (n = 5) were noted for each RS. Embryo (stage, quality) and recipient (breed, parity) characteristics were also noted. A total of 548 frozen embryos were transferred and PRs were assessed. Variability of time components was investigated (Bourgoin et al. 2004 Reprod. Fertil. Dev. 16, 207). The influence of time components and other variation factors was tested on PRs (t-tests and chi-square analysis). The TIV averaged 210 ± 80 min and did not influence PR (≤4 h = 51.9% (n = 393) vs. >4 h = 55.5% (n = 155); P > 0.05), as well as duration of flushing (32 ± 8 min), interval between end of flushing and search (31 ± 27 min), duration of search (45 ± 25 min) and interval between end of search and beginning of freezing (101 ± 63 min). Only significant factors were kept for further analysis. The effects of recipient parity, number of donor cows per RS, and interval between introduction of straw to −7°C, and seeding were tested in a multivariate logistic model. PR varied strongly with parity of recipient (+25% in heifers vs. cows; P = 0.001). PRs were higher when the interval between straw introduction in the freezer and seeding lasted at least 5 min (2–4 min = 48.0% (n = 254) vs. 5–8 min = 57.1% (n = 294); P = 0.009). Time and operator effects were confounded. Overall PR results for the two technicians who used mostly 2–4 min intervals averaged 47% (operator values = 35.6, 48.9, and 54.5) whereas PRs were 54.9 and 60.5% for those waiting 5 min or more before inducing seeding (n = 2). PRs were higher when at least two donor cows were collected per RS (1 donor cow = 49% (n = 259) vs. ≥2 donor cows = 56.4% (n = 289); P = 0.003). This was not in agreement with previous observations in fresh embryos (Bourgoin et al. 2004). However, the number of donor cows strongly influenced the number of viable embryos per RS (1 donor cow = 11 ± 5 vs. ≥2 donor cows = 18 ± 8.5; P < 0.05) and could permit the choice of more embryos to be frozen. These results show that good PR may be achieved with a delay of several hours between flushing and freezing, when heifers are used as recipients. Moreover, confirmed from higher numbers of operators, these data show that it is better to wait at least 5 min to achieve equilibration of the embryo before seeding.
33
Rubtsov, V. V., M. Cole, J. V. Wertsch, A. G. Asmolov, V. T. Kudryavcev, N. N. Nechaev, V. A. Lektorsky, et al. "Human Development and the Creative Potential of Culture (Roundtable of the methodological seminar supervised by V.V. Rubtsov and B.D. Elkonin)." Cultural-Historical Psychology 14, no. 4 (2018): 41–51. http://dx.doi.org/10.17759/chp.2018140406.
Full textAbstract:
On May 25, 2018 the Moscow State University of Psychology and Education hosted a methodological seminar “Human Development and the Creative Potential of Culture” (supervised by V.V. Rubtsov and B.D. Elkonin) that was dedicated to the 80th birthday of the renowned American psychologist professor Michael Cole, the disciple of A.R. Luria and the successor of the cultural-historical and activity approaches in psychology. Michael Cole has and continues to put a lot of effort into the internationalization and development of these acknowledged Russian approaches all over the world. The seminar was organized by the Cultural-Historical Psychology journal and the International UNESCO Chair of Cultural-Historical Psychology of Childhood (MSUPE). The issues discussed in the seminar included: 1. Understanding culture: from the environment to the origins of human development; 2. Cultural-historical psychology: the language of mutual understanding and the creative tool in science and education; 3. The diversity of cultural mediation of human activity in the modern world; 4. Cultural-activity approach as an interdisciplinary project; 5. Psychology and sociocultural practices of human development; 6. From joint activity towards co-creation of culture; 7. Imagination: the ‘third’ eye of culture. Among the participants of the seminar were Russian researchers V.V. Rubtsov, A.A. Margolis, A.G. Asmolov, V.T. Kudryavtsev, N.N. Nechaev, V.A. Lektorsky, T.V. Akhutina, Zh.M. Glozman, M.V. Falikman, B.D. Elkonin, V.A. Guruzhapov as well as M. Cole himself and his friend and colleague J.Wertsch (both participating online). The paper presents the full text of the discussion.
34
Niss, Omar, Michael D. Taylor, Robert Fleck, Tarek Alsaied, Jeffrey Towbin, Punam Malik, and Charles T. Quinn. "Diffuse Myocardial Fibrosis Is a Common Feature of Sickle Cell Anemia That Is Associated with Diastolic Dysfunction and Restrictive Cardiac Physiology." Blood 128, no. 22 (December 2, 2016): 8. http://dx.doi.org/10.1182/blood.v128.22.8.8.
Full textAbstract:
Abstract Background: We have recently shown that the cardiomyopathy of sickle cell anemia (SCA) is characterized by restrictive physiology (diastolic dysfunction, left atrial [LA] enlargement and normal systolic function) superimposed on hyperdynamic features (left ventricular [LV] enlargement and eccentric hypertrophy) (JACC Cardiovasc Imaging 9:244-253;2016; PNAS 2016 in press). Similar to other restrictive cardiomyopathies, SCA-related cardiomyopathy may lead to mild, secondary pulmonary hypertension (PH) with elevated tricuspid regurgitant jet velocity (TRV), and can be complicated by arrhythmias and sudden death. Diastolic dysfunction is the principal pathology leading to restrictive physiology. Myocardial fibrosis is a common cause of non-SCA restrictive physiology, but the cause of the diastolic dysfunction that underlies SCA-related cardiomyopathy is undetermined. Focal fibrosis, as detected by late gadolinium enhancement (LGE) on cardiac magnetic resonance imaging (CMR), is rare in SCA. However, diffuse myocardial fibrosis, which is not detected by LGE, has not been studied before in SCA. Therefore, we aimed to detect myocardial fibrosis in SCA using a novel CMR T1-mapping technique to quantify the myocardial extracellular volume (ECV) fraction, which correlates with histologic diffuse fibrosis. Methods: We conducted a prospective study of children and adults with SCA (NCT02410811) who underwent CMR, echocardiography, and laboratory testing (including N-terminal pro-brain type natriuretic peptide [NT-proBNP], a marker of ventricular stress). ECV was measured from pre- and post-gadolinium T1 maps using a modified Look-Locker inversion recovery (MOLLI) sequence. Chamber sizes and cardiac performance were evaluated using CMR, while TRV and diastolic parameters were measured by echocardiography. Results: Twenty-five patients with a median age of 19 years (range 6-61 years) were evaluated. ECV was increased in all SCA patients (mean 44 ± 8% vs. 25 ± 3% in normal subjects, P<0.001). One patient had focal fibrosis by LGE and one had systolic dysfunction. Among patients with normal systolic function, 17 patients (71%) had diastolic abnormalities and 7 (29%) had normal diastolic function. Seven out of 17 patients with diastolic abnormalities (29% of the total group) met the definition of diastolic dysfunction, and 10 had inconclusive classification. Patients with diastolic dysfunction had significantly higher ECV (49 ± 7% vs 37 ± 4%, P=0.01; Panel A), NT-proBNP (191 ± 261 vs. 33 ± 33 pg/mL, P=0.04; Panel B), and lower hemoglobin (8.4±0.3 vs.10.9±1.4 g/dL, P=0.004, Panel C) compared to patients with normal diastolic function. Systolic function was similar in both groups (LV ejection fraction 61 ± 4% vs. 62 ± 3.4%, P=0.86). In patients with higher ECV (³40%), LV diastolic abnormalities were more common (99% vs 33%, P=0.003) and LA volume index was significantly increased (57 ± 11 vs. 46 ± 12 mL/m2, P=0.04) compared to patients with ECV <40%. Increased ECV was associated with anemia (R=-0.46, P=0.03; Panel D) and elevated NT-proBNP (R=0.62, P=0.001; Panel E), but not with LV ejection fraction (P=0.66; Panel F), LV mass (P=0.92) or TRV (P=0.65). Conclusions: ECV is markedly elevated in SCA, indicating the presence of significant diffuse myocardial fibrosis in all patients studied. High ECV is associated with more severe anemia, diastolic dysfunction, and high NT-proBNP. Diffuse myocardial fibrosis is a novel process underlying diastolic dysfunction and SCA-related cardiomyopathy, the features of which may be mistaken for pulmonary arterial hypertension. Identifying and therapeutically targeting the root-cause of myocardial fibrosis, or interrupting the development of myocardial fibrosis, should be studied to mitigate cardiopulmonary disease and decrease early mortality in SCA. Figure. Figure. Disclosures Quinn: Silver Lake Research Corporation: Consultancy; Eli Lilly: Research Funding; Amgen: Research Funding.
35
Mian, Hira S., Kevin H. M. Kuo, Vicki N. Wang, Richard Ward, and Susanna Mak. "Characterization Of Pulmonary Compliance In Sickle Cell Patients Revealed Wide Variability." Blood 122, no. 21 (November 15, 2013): 989. http://dx.doi.org/10.1182/blood.v122.21.989.989.
Full textAbstract:
Abstract Abnormalities of pulmonary circulation as a complication of sickle cell disease (SCD) have gained considerable attention recently. Recent studies have indicated that a tricuspid regurgitation velocity (TRV) of greater than 2.5 m/s is associated with a higher risk for early mortality, but has a poor predictive value for pulmonary hypertension (PH). In patients who do develop PH, focus has been on identifying abnormal increases in pulmonary vascular resistance (PVR) and its afterload effect on the right ventricle (RV). However, this is a relatively late finding in any pulmonary vasculopathy, and is an even more uncommon finding in SCD. Pulmonary compliance (Cp) is another physiologic parameter that indexes the pulsatile load of the RV, and is also an important contributor to RV afterload. It is thought that although Cp-PVR coupling remains constant due to the intrinsic properties of pulmonary vasculature, a decrease in Cp may be observed prior to any increase in PVR during the early development of PH. The objective of this study was to examine the range of Cp in a SCD cohort with an elevated TRV and the relationship of Cp to other hemodynamic and clinical characteristics. A retrospective observational cohort study was conducted consisting of 22 adult consecutive SCD patients (HbSS, HbS/β0thalassemia, HbSC) with a RV systolic pressure of greater than 40 mmHg, TRV of ≥ 2.8 m/s or symptoms/signs of heart failure who underwent right heart catheterization between January 2009 and July 2012. Eight age- and gender-matched normal controls (healthy patients with no PH) and eleven PAH controls (patients with known non-SCD pulmonary arterial hypertension) were also included. Cp was calculated as stroke volume (SV) divided by pulmonary artery pulse pressure (PP). PVR was calculated as mean pulmonary artery pressure (mPAP) minus mean pulmonary capillary wedge pressure (PCWP mean) divided by cardiac output x 80. PH was defined as having a mPAP ≥ 25 mmHg. Patients were further classified as pulmonary arterial hypertension (pre-capillary PH) if PCWP mean was ≤ 15 mmHg and pulmonary venous hypertension (post-capillary PH) if PCWP mean was > 15 mmHg. The SCD population without PH was divided a prioriinto two groups based on the median Cp: Low Cp (Cp < 7) and High (Cp ≥ 7) with 10 subjects in each group. In our cohort, as anticipated, there was a low prevalence of patients who met the formal criteria of PH (2/22, 9%). SCD patients, regardless of the PH diagnosis, were found to have an overall higher and wider distribution of Cp value when compared to normal and PAH control groups (6.8 ± 2.6 vs. 4.7 ± 1.6 vs. 1.4 ± 0.6 mL/mmHg in the SCD, normal cohort and PAH control group respectively P < 0.001, Figure 1). Subgroup analysis of High and Low Cp groups without PH revealed no differences in baseline characteristics (age, body mass index, genotype, hydroxyurea use), laboratory values (hemoglobin, fetal hemoglobin fraction, reticulocyte count, total bilirubin and creatinine) or sickle cell-related complications (frequency of acute chest syndrome, leg ulcers, priapism, painful vaso-occlusive crises). The following hemodynamic variables were found to be different between the High Cp and Low Cp group respectively: mean RA pressure (1.8 ± 2.1 vs. 4.9 ± 3.1 mmHg, P = 0.0175), mPAP (12.3 ± 2.1 vs. 17.5 ± 5.3 mmHg, P = 0.0095), PCWP mean (6.3 ± 2.5 vs. 10.4 ± 4.9 mmHg, P = 0.0321) and PP (13.0 ± 2.6 vs. 21.3 ± 7.6 mmHg, P = 0.0044). The Cp-PVR coupling demonstrated in the wider PH literature was preserved in our cohort with non-PH SCD patients distributed largely along left upper corner of the curve with higher Cp values and the PH SCD patients in the left lower corner (Figure 2). In summary, we have shown that pulmonary compliance in our cohort of SCD patients is higher and has a greater variation than age- and gender-matched normal healthy and PAH controls. Furthermore, regardless of the PH status, SCD patients with elevated TRV lie along a continuum of Cp-PVR curve demonstrating the wide range of hemodynamic derangements and effect on RV load. Cp may provide an alternative model for understanding these early hemodynamic changes in the right ventricular-pulmonary arterial circulatory unit in SCD patients and warrants further exploration.Figure 1Pulmonary Compliance (Cp) of SCD patients in comparison to age and gender matched normal and PAH controlsFigure 1. Pulmonary Compliance (Cp) of SCD patients in comparison to age and gender matched normal and PAH controlsFigure 2Pulmonary Compliance (Cp) and Pulmonary Vascular Resistance (PVR) coupling in SCD, normal and PAH control patientsFigure 2. Pulmonary Compliance (Cp) and Pulmonary Vascular Resistance (PVR) coupling in SCD, normal and PAH control patients Disclosures: No relevant conflicts of interest to declare.
36
Orlova, N. A., T. V. Gavrilova, and N. A. Sobyanin. "Characteristics of eye injuries in urgently hospitalized adults in the Perm region." EYE GLAZ 22, no. 3(131) (October 3, 2020): 19–22. http://dx.doi.org/10.33791/2222-4408-2020-3-19-22.
Full textAbstract:
A retrospective analysis of 136 medical histories of patients with eye injuries who applied to the city and regional centers of emergency ophthalmological care and were hospitalized in two specialized ophthalmological departments during one calendar year was carried out. 89% of patients were men, 11% were women; 20% contacted hospitals in winter, 21% – in spring, 30% – in summer and 29% – in autumn. Out of 139 injured eyes, 50% were wounded, 40% were contused, 10% had burns. In cases of eye injuries, 7 (10%) were injuries of the appendages of the eye, 57 (81%) were penetrating injuries, 66% were corneal injuries, 25% – scleral injuries, 9% – corneal-scleral injuries, all of which were severe; 3% – non-penetrating injuries of the cornea, 6% – penetrating injuries of the orbit. Among 56 contused eyes, appendages of the eye were damaged in 4 (7%) eyes, all of them were of 2nd degree of severity. Eyeball damage was diagnosed in 35 (63%) eyes: 17 were of 2nd degree of severity, 15 – of 3rd degree of severity, 3 – of 4th degree of severity. Multisystem injuries of the eyeball and appendages of the eye were diagnosed in 17 (30%) eyes. Corneal, conjunctival and eyelid burns of the 2nd degree were diagnosed in 9 eyes, while burns of the 3rd degree were diagnosed in 4 eyes. All cases were chemical burns. 87% cases were civilian injuries, 11.5% were work injuries, while 1.5% were caused by criminal actions. In 2 eyes with non-penetrating corneal injuries, the visual acuity increased after discharge from hospital. Out of 57 eyes with penetrating injuries, the visual acuity increased in 34 eyes and decreased in 8 eyes; in 3 cases of visual acuity decrease, an ophthalmectomy was performed; in 15 eyes the visual acuity remained unchanged. In cases of contusion of the eyeball, out of 52 eyes the visual acuity increased in 39, decreased in 1 eye and remained unchanged in 12 eyes. In cases of burns, out of 13 eyes the visual acuity increased in 10 eyes and remained unchanged in 2 eyes. One patient underwent a blepharorrhaphy.Conflict of interest: Gavrilova T.V. is the member of the editorial board of the journal and has been recused from review process and from making decision regarding acceptance of this article.
37
Cohen, Alice J., and Chaim Tuckman-Vernon. "Association of Pulmonary Hypertension with Sickle Cell Disease Subtypes." Blood 112, no. 11 (November 16, 2008): 4824. http://dx.doi.org/10.1182/blood.v112.11.4824.4824.
Full textAbstract:
Abstract Pulmonary hypertension (PH) is a common complication of sickle cell disease (SD) and a significant cause of morbidity and mortality. PH, measured by Doppler echocardiography and defined as a tricuspid regurgitant jet velocity (TRV) > 2.5 m per second (m/s), is hypothesized to be related to the chronic hemolytic anemia of SD, but causality is unproven. If so, the presence of hemoglobin C, which reduces hemolysis, would be expected to have a reduced likelihood of PH. This study reviewed the prevalence of PH in 3 categories of patients with SD: homozygous S (SS), sickle-beta thalassemia (SB), and SC. Methods: Sickle cell disease patients registered at a state funded community comprehensive care adult sickle cell center were routinely screened for PH by Doppler echocardiography. The presence of PH, the incidence of a related complication, acute chest syndrome (ACS), and baseline hemoglobin (hgb) were reviewed. Results: 16 patients with SC type, 30 with SS and 39 with SB disease underwent screening. The prevalence of PH, ACS and hgb are listed in the table below. Conclusion: SC patients have PH and ACS similar to patients with SS and SB patients. These patients have higher baseline hemoglobin and may have hyperviscosity as a cause of PH and ACS as opposed to hemolytic anemia. Further study of PH and ACS in SC patients is warranted. SC SS SB p value PH 6/16 (38%) 12/40 (40%) 11/39 (28%) p= NS ACS 7/16 (44%) 10/30 (33%) 19/39 (49%) p=NS PH + ACS 4/16 (25%) 5/30 (17%) 4/39 (10%) p=NS ACS in PH patients 4/6 (67%) 5/12 (42%) 4/11 (36%) p-=NS Hgb 10.8 7.89 8.57 p=0.000
38
Gustafsson, Britt, Rubin Johanna, Peter Priftakis, Geraldine Giraud, Torbjorn Ramqvist, and Tina Dalianis. "Human Polyomaviruses Were Not Detected in Cerebrospinal Fluid of Patients with Neurological Complications After Hematopoetic Stem Cell Transplantation." Blood 120, no. 21 (November 16, 2012): 4503. http://dx.doi.org/10.1182/blood.v120.21.4503.4503.
Full textAbstract:
Abstract Abstract 4503 Neurological complications after allogenetic hematopoetic stem cell transplantation (HSCT) are associated with increased mortality. Reactivation of JC-virus (JCV), a well-known human polyomavirus (HPyV) can be associated with progressive multifocal leukoencephalopathy (PML) after HSCT. Knowledge of whether reactivation of the newly discovered HPyVs KIPyV, WUPyV, Merkel cell PyV (MCV), HPyV 6, HPyV7, trichodysplasia spinulosa PyV (TSV) and HPyV9 is associated to neurological complications after HSCT is however limited. Cerebrospinal fluid (CSF) from 32 HSCT patients with neurological symptoms was therefore analyzed for presence of the above HPyVs including BK-virus (BKV), JCV, and primate PyVs lymphotropic PyV (LPV) and Simian Virus 40 (SV40), but found negative by PCR for all these PyVs. Introduction The incidence of neurological complications after HSCT is up to 15% and related to increased mortality. Risk factors are e.g. busulfan (Bu), electrolyte disturbances, low platelet count, high blood pressure, ciklosporin toxicity and viral reactivation, of which HPyV JCV is one. 2007–2008, three new HPyVs were described: KIPyV, WUPyV, both found in nasopharyngeal aspirates and Merkel cell PyV (MCV), detected in Merkel Cell Carcinoma, a skin cancer detected in elderly persons or in immunocompromized persons. We earlier examined for these three HPyVs in CSFs of 20 patients with neurological complications after HSCT, but they were all negative by PCR. From 2009 and on, another five HPyVs (HPV6, HPV7, TSV and HPyV9) were detected, and to possibly find whether these PyVs were responsible for neurological conditions in patients having undergone HSCT, we have extended our study and analyzed CSF from 32 patients who presented with neurological complications after HSCT for all known HPyVs. Patients, Material and Methods Patients From January 1st 2000 to April 20th 2011 843 patients underwent HSCT at the Centre for Allogenic Stemcell Transplantation, Karolinska University Hospital Huddinge, Sweden. Of these patients, 65 suffered from neurological symptoms and 32 had sufficient amounts of CSF for further analysis. Mean age was 38 years (1–63). The female/male ratio was 13/19. 15 patients received stem cell from a matched unrelated donor, 3 from cord blood and 6 from siblings. 20/32 patients had Bu in the conditioning therapy, 7 received TBI and 5 patients got other conditioning therapy. Multiplex PCR analysis A PCR detecting the presently known 9 HPyVs, including, BKV, JCV, KIPyV, WUPyV, MCV, HPyV6, 7, TSV and HPyV9 as well as the primate LPV and SV40 was developed and used for the analysis. The PCR was initiated with denaturation of CSFs (10 μl) for 9 min at 94°. DNA was extracted from 5 μl CSF/sample using 2×Qiagen Multiplex PCR Master Mix and a PCR protocol containing 15 min in 94°C for denaturation 94°C 15 min followed by 40 cycles with 94°C 20 sec, 50°C, 1 min 30 sec, 71°C 1 min 20 sec and ended with 71°C for 4 min. PyVs amplicons were identified using bead based multiplex analysis with a MagPix system from Luminex. The assay could detect all 11 viruses with a sensitivity of <10 copies/sample. Results and Discussion Among the 32 HSCT patients with neurological symptoms, the most frequent were headache and fever, (41%), followed by seizures (25%) and confusions/hallucinations (16%). At the end of the study period 16/32 patients with a mean follow up time of 3.5 years had survived. Because HyPV reactivation is increased in immunocompromised patients, neurological signs due to reactivation of these viruses are more likely to occur. Despite neurological symptoms, no DNA from the known 9 HPyVs or from LPV or SV40 was detected by the Luminex multiplex based assay in any of the 32 CSF samples. The detection assay used, with detection limits of between 5–10 copies of the respective viruses, should be sensitive enough to detect viral DNA if the corresponding virus was responsible for neurological disease. Many episodes of neurological complications after HSCT are still not given a diagnosis. Our negative finding emphasizes the need for a broader search for causes, especially when new treatment options are becoming available. Disclosures: No relevant conflicts of interest to declare.
39
Singer, Sylvia Titi, Howard Rosenfeld, and Elliott Vichinsky. "Pulmonary Hypertension in Thalassemia: Association with Platelet Activation and Hypercoagulable State." Blood 104, no. 11 (November 16, 2004): 3618. http://dx.doi.org/10.1182/blood.v104.11.3618.3618.
Full textAbstract:
Abstract Pulmonary hypertension (PHT) is a serious, under diagnosed, potentially fatal complication, reported mostly in non-transfused adult thalassemia intermedia (TI) and fewer thalassemia major (TM) patients. Even a mild PHT can further impair cardiac function in these patients with a frequent left heart disease. Yet, understanding of the pathogenesis, early detection and treatment of established PHT are inadequate. Previous reports and autopsies in patients with PHT, suggest thrombotic obstruction of pulmonary arteries, more so in splenectomized non-transfused TI patients. 25 patients, 7 TI and 18 transfused TM patients ages 10 to 47 years (mean 26±10 years) were screened for PHT by Doppler echocardiogram. A right ventricular (RV) pressure of 25mmHg or higher, corresponding to 2.5meter/second (m/sec) tricuspid jet velocity (TJV) was used as the threshold for presence of increased pulmonary artery pressure indicating PHT. In order to determine that hypercoagulability has an important role in the pathogenesis and progression of PHT, we evaluated specific markers of platelet activation and hypercoagulability and their association with PHT. We measured P-selectin levels, a marker for platelet activation; thrombin-anti thrombin III (TAT), indicating increased thrombin generation; abnormal fibrinolysis as indicated by plasminogen activator inhibitor-1 (PAI-1) and by elevated d-dimers, and vWF:Ag a marker for endothelial cell activation/platelet adhesion. PHT was found in seventeen out of twenty five patients (68%). Mean pulmonary artery pressure was 39.8±5.4mmHg (range 33–53mmHg), corresponding to a TJV of 2.5 to 3.6 m/sec. The remaining 8 patients had only trace or no tricuspid regurgitation. PHT was strongly associated with prior splenectomy, noted in 16 of the 17 patients, and was more severe in older patients: 7/17 (41%) with a pressure of ≥40mmHg, were over 30 years old. Surprisingly, a high proportion of patients 10/17 (58%), was on regular transfusions. Elevated P-selectin levels were significantly associated with PHT (p<0.0001) and higher in non-transfused TI patients (67.8±13 ng/ml) compare to transfused ones (47±19 ng/ml). Elevated P slectin and PHT were associated with absence of spleen. TAT Levels were higher in patients with PHT at 16±33μg/L, compare to those with normal pulmonary artery pressure 13±6μg/L (nl <4μg/L). Increased fibrinolysis was not associated with PHT as indicated by normal PAI-1 activity (mean 13.2±3.9) and non elevated d-dimers values. There was a trend of elevated vWF:Ag levels among patients with PHT; 128±35% Vs 100±12% (nl 50-150%). Our data shows a high prevalence of mild to moderate PHT in adult thalassemia patients, even in the ones on regular transfusions, implying that regular transfusions do not prevent but rather attenuate the progression of increased pulmonary pressure. The impact of even modest PHT is crucial in these patients who have a limited ability to tolerate cardiac dysfunction due to other cardiac and systemic manifestations of their disease. This preliminary data confirms the presence of platelet activation and a procoagulant state in patients with PHT, correlating with prior splenectomy, and suggests that endothelial disruption is involved in the pathogenesis. Moreover, P-selectin, a marker of platelet activation and a direct inducer of procoagulant activity, proved to be a sensitive marker for the presence of PHT. Future interventional studies with direct P-selectin inhibitors may be an effective treatment modality.
40
Erdogan, M., B. Kilickiran Avci, C. Ebren, Y. Ersoy, Z. Ongen, G. Ongen, V. Hamuryudan, and G. Hatemi. "FRI0237 COMPARISON OF DIFFERENT PULMONARY HYPERTENSION SCREENING ALGORITHMS IN PATIENTS WITH SYSTEMIC SCLEROSIS." Annals of the Rheumatic Diseases 79, Suppl 1 (June 2020): 702.1–703. http://dx.doi.org/10.1136/annrheumdis-2020-eular.3826.
Full textAbstract:
Background:Pulmonary hypertension (PH) is an important cause of morbidity and mortality in patients with systemic sclerosis (SSc). Different screening algorithms have been proposed for identifying patients who have a high probability of PH and require right heart catheterization (RHC), which is the gold standard for diagnosing PH.Objectives:To compare the performance of PH screening algorithms in our patients with SSc.Methods:Sixty-nine consecutive pts fulfilling ACR/EULAR 2013 SSc criteria have been screened for PH until now, using the 2015 ESC/ERS, DETECT and ASIG algorithms. Pulmonary function tests (PFT), diffusing capacity of the lung for carbon monoxide (DLCO), trans-thoracic echocardiography, serum NT-proBNP and uric acid assay and high-resolution computed tomography (HRCT) were performed as needed. Patients with known PH, severe interstitial lung disease and severe left ventricular dysfunction (LVD) were not included. RHC was performed in all patients with positive screening according to any one of the screening algorithms. Pts with PH were classified according to the updated PH classification criteria. Sensitivity and specificity of the 3 screening algorithms were evaluated according to the established cut-off value of 25 mmHg for mean systolic pulmonary artery pressure and for the recently proposed cut-off value of 20 mmHg.Results:Among the 69 SSc pts, 27 were excluded due to ILD(n=6), LVD(n=6), already diagnosed PH(n=4) no measurable TRV(n=5), lung cancer (n=2), pulmonary embolism (n=1) and nephrotic syndrome (n=1). Among the remaining 42 patients, 17 required RHC according to at least one of the screening algorithms (Table 1). Number of patients who had suspected pulmonary hypertension and required RHC according to ESC/ERS 2015, DETECT and ASIG were 7 (%17), 13 (%31), and 12 (%29) respectively (Figure 1). Among the 17 pts. who had RHC, PH was present in 3 pts according to the 25-mmHg cut-off (Group 2 in 2, Group 3 in 1) and in 9 pts according to the 20-mmHg cut-off (Group 1 in 5, Group 2 in 3, Group 3 in 1). The sensitivity and specificities were presented in Table 2. ASIG and DETECT had better sensitivity for 25-mmHg cut-off and was better with ASIG for 20 mmHg cut-off. The specificity was better with ESC/ERS for both cut-off values.Conclusion:The ASIG algorithm has a better sensitivity and ESC/ERS algorithm has a better specificity for detecting PH in patients with SSc. A limitation of this study was that RHC was not performed in patients who did not fulfill criteria according to any of the screening algorithms. The sensitivities may be lower than what we propose if there are patients with PH who are asymptomatic and not captured with any of the algorithms.Disclosure of Interests:Mustafa Erdogan: None declared, Burcak Kilickiran Avci: None declared, Cansu Ebren: None declared, Yagmur Ersoy: None declared, Zeki Ongen: None declared, Gul Ongen: None declared, Vedat Hamuryudan Speakers bureau: Pfizer, AbbVie, Amgen, MSD, Novartis, UCB, Gulen Hatemi Grant/research support from: BMS, Celgene Corporation, Silk Road Therapeutics – grant/research support, Consultant of: Bayer, Eli Lilly – consultant, Speakers bureau: AbbVie, Mustafa Nevzat, Novartis, UCB – speaker
41
Grigorieva, N. Yu, M. O. Samolyuk, T. V. Sheshina, N. B. Koroleva, and T. V. Koroleva. "How to improve the effectiveness of combination therapy of arterial hypertension in patients with concomitant chronic obstructive pulmonary disease?" Russian Medical Inquiry 4, no. 7 (2020): 418–24. http://dx.doi.org/10.32364/2587-6821-2020-4-7-418-424.
Full textAbstract:
Aim: to conduct a comparative assessment of the hypotensive effect, as well as the effect on endothelial function, oxidative stress, and pulmonary artery pressure of chlorthalidone and hydrochlorothiazide as part of combined antihypertensive therapy in patients with arterial hypertension (AH) in combination with chronic obstructive pulmonary disease (COPD).Patients and Methods: the prospective study included 66 patients divided into two groups. As the main antihypertensive therapy, group 1 was prescribed with a combination of azilsartan medoxomil 40 mg and chlortalidone 12.5 mg as a fixed combination of Edarbi® CLO. Group 2 received a free combination of azilsartan medoxomil 40 mg (Edarbi®) and hydrochlorothiazide 12.5 mg. All patients underwent 24-hour blood pressure monitoring: (ABPM), echodopplercardiography, endothelium-dependent vasodilation, lipid peroxidation (LPO), nitric oxide metabolites, and endothelin-1 levels at baseline and after 6 months of treatment. Results: target blood pressure values (<130/80 mm Hg) were achieved in 91% of patients in group 1, and 51.5% in group 2 after 1 month of the study. After 6 months of treatment, all patients in both groups reached the target BP values, but in group 2, the dose of hydrochlorothiazide had to be increased to 25 mg. According to the ABPM data, after 6 months of treatment, group 1 showed a decrease in the morning surge in SBP by 7.0±2.1% and DBP by 10±7.3%. There was also an increase in the number of patients with the daily profile of «dipper» type to 78.8%. In group 2, there was a decrease in the morning surge in SBP by 6.3±5.9% and DBP by 4.8±4.6% after 6 months of treatment. There was an increase in the number of patients with the daily profile of «dipper» type to 36.4%. After 6 months of treatment, there was more pronounced improvement in laboratory parameters of group 1 characterizing endothelial dysfunction and oxidative stress. Statistically significant results were obtained for conjugated trienes, NO2, S, Imax, and endothelin-1 when comparing groups 1 and 2.Conclusion: treatment of AH in patients with concomitant COPD in the form of a fixed combination of azilsartan medoxomil and chlorthalidone versus free combination of azilsartan medoxomil with hydrochlorothiazide has a more pronounced antihypertensive effect, positively affecting the daily BP profile, pulmonary artery pressure, endothelial function and lipid peroxidation processes after 6 months of treatment.KEYWORDS: arterial hypertension, chronic obstructive pulmonary disease, endothelial dysfunction, lipid peroxidation, azilsartan medoxomil, chlorthalidone.FOR CITATION: Grigorieva N.Yu., Samolyuk M.O., Sheshina T.V. et al. How to improve the effectiveness of combination therapy of arterial hypertension in patients with concomitant chronic obstructive pulmonary disease? Russian Medical Inquiry. 2020;4(7):418–424. DOI: 10.32364/2587-6821-2020-4-7-418-424.
42
Halphen, Isabelle, Caroline Elie, Valentine Brousse, Muriel Le Bourgeois, Damien Bonnet, and Mariane De Montalembert. "Children with Sickle Cell Anemia Experience Severe Oxygen Desaturation During Night and After Six-Minute Walk Distance Test." Blood 120, no. 21 (November 16, 2012): 4766. http://dx.doi.org/10.1182/blood.v120.21.4766.4766.
Full textAbstract:
Abstract Abstract 4766 Background: Respiratory complications are the first causes of death among adult patients with sickle cell anemia (SCA). Finding risk factors for children is important. We study clinical, biological, respiratory and heart parameters, as well as exercise and sleep oxygen saturation in SCA children. Patients and Methods: We conducted a prospective study in homozygous SS or S/beta 0 thalassemic children. A chronic transfusion program was an exclusion criterion. We recorded the number of vaso-occlusive crises (VOC) the year before and after inclusion, past history of acute chest syndrome (ACS), hydroxyurea treatment, tonsils size, baseline heart rate and blood pressure, baseline hemoglobin (Hb), reticulocytes, fetal Hb levels, leukocytes and platelets counts, total bilirubin, aspartate aminotransferase (AST), lactate deshydrogenase (LDH). All patients underwent respiratory function testing (RFT), echocardiography assessing tricuspid regurgitation velocity jet (TRV). We measured daytime oxygen saturation using a Radical Masimo set ® pulse oximeter. All patients underwent a non-encouraged six-minute walk test (6MWT). Nocturnal pulse oximetry was recorded using a Nonin ® device during 3 consecutive nights for 30 patients. We considered the average night-time oxygen saturation and the percentage of sleep time with oxygen saturation less than 90%. Statistical analysis was conducted using the Fisher exact test for categorical variables and the Wilcoxon test for continuous variables. Results: Forty-two unselected SCA children were enrolled. Three patients were secondarily excluded because the echocardiography revealed asymptomatic cardiac anomalies (two pulmonary valve stenosis and one persistent arterial canal). In the remaining 39 patients, 38 were SS and one was S/beta 0 thalassemic. Median age was 10.8 years (range 5.7–17); 25 patients were females (64%). The median number of VOC was 0 the year before inclusion (range 0–6), and 0 the year after (range 0–7). Fifteen patients (38%) had displayed at least one ACS. Nine patients (23%) were receiving hydroxyurea treatment. Sixteen patients (43%) had tonsillitis enlargement. Median basal heart rate was 97 bpm (range 75–122). Mean systolic blood pressure was 107 ± 11.3 mm Hg and mean diastolic blood pressure was 64 ± 6.6 mm Hg. Mean Hb was 7.9 ± 1.2 g/dL, mean reticulocyte count was 236 ± 82 Giga/L, median HbF was 9.2 % (range 0.8–28), mean leukocyte count was 11.1 ± 3.2 Giga/L, mean platelet count was 407 ± 132 Giga/L. Median total bilirubin, AST, and LDH were, respectively, 41.5 mg/dL (range 13–163), 62 UI/l (range 35–132), and 1421 UI/l (range 618–1893) (normal range for LDH in our lab 125–243). Fifteen patients (38.5%) had abnormal RFT: 4 had obstructive pattern, 3 had restrictive pattern, and 3 had both. Left ventricular diastolic function was normal for all patients. Six patients had a TRV above 2.6 m/s. Median daytime oxygen saturation was 97 % (range 89–100). One patient had a daytime saturation below 92%. Median nocturnal oxygen saturation was 94.7 % (range 87.7–99.5). Ten patients (33%) displayed average night-time saturation below 92%. Eleven patients (37%) spent more than 10% of their sleep time with oxygen saturation below 90%. Mean six-minute walk distance (6MWD) was 547 ± 99 m. After the 6MWT, 14 patients (35%) had an oxygen saturation below 92%. Median difference in oxygen saturation before and after the test was 2% (range −57, +2). Nocturnal hypoxemia was not associated with age, gender, tonsils size, hydroxyurea treatment, past history of ACS, RFT pattern, number of VOC, leukocytes, platelets, LDH, bilirubin nor AST. It was associated with Hb level (7.2±1.2 g/dL if nocturnal hypoxemia vs 8.4±1.1, p=0.02), daytime oxygen saturation (94% [range 92–99] if nocturnal hypoxemia vs 98% [range 89–100], p=0.03), and oxygen saturation after 6MWT (91% [range 40–99] if nocturnal hypoxemia vs 96% [range 79–100], p=0.03). Children with a TRV above 2.6m/s had a significantly lower Hb level (7.4 g/dL [6.4–8.1] vs 8.5 [6.5–10.6]). Conclusions: Our study emphasizes the frequency of night-time oxygen desaturation in SCA children. It shows that a simple effort can induce a significant decrease in oxygen saturation. The consequences of hypoxemia are difficult to assess given the small sample size. One can hypothesize that hypoxemia and hypoxia/reoxygenation cycles both contribute to the pathophysiology of the disease through inflammation and vascular injury. Disclosures: No relevant conflicts of interest to declare.
43
Crosslin, J. M., and L. L. Hamlin. "First Report of Impatiens necrotic spot virus Infecting Greenhouse-Grown Potatoes in Washington State." Plant Disease 94, no. 12 (December 2010): 1507. http://dx.doi.org/10.1094/pdis-07-10-0542.
Full textAbstract:
In April and May 2010, leaves on approximately one-half of 200 potato (Solanum tuberosum L. cv. Atlantic) plants, 20 to 25 cm high, grown from prenuclear minitubers in greenhouses located at the USDA-ARS facility in Prosser, WA exhibited necrotic spots similar to those produced by the early blight pathogen, Alternaria solani. Fungicide sprays did not reduce incidence of the symptoms. Observations associated the symptoms with thrips feeding damage so plants were tested for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) with ImmunoStrips from Agdia, Inc (Elkhart, IN). Three of three, two of two, and two of two symptomatic plants from three greenhouses were positive for INSV and negative for TSWV. Two symptomless plants tested negative. Four of four symptomatic and zero of two symptomless plants were positive by reverse transcription (RT)-PCR with INSV specific primers (forward: 5′ TAACACAACACAAAGCAAACC 3′ and reverse: 5′ CCAAATACTACTTTAACCGCA 3′) (4). The 906-bp amplicon from one sample was cloned and three clones were sequenced. The three clones were 99.7% identical, and BLAST analysis of the consensus sequence (GenBank Accession No. HM802206) showed 99% identity to INSV accessions D00914 and X66972, and 98% identity to other INSV isolates. The isolate, designated INSV pot 1, was mechanically inoculated to one plant of potato cv. GemStar and produced local, spreading necrotic lesions. The virus did not go systemic, as determined by RT-PCR of upper leaves 30 days after inoculation. The local necrotic lesions on GemStar were positive for INSV by ImmunoStrips and RT-PCR. The original source of the INSV inoculum is unknown. However, hairy nightshade (Solanum sarrachoides Sendtn.) and plantain (Plantago major L.) weeds in an ornamental planting near one of the affected greenhouses tested positive for INSV by ImmunoStrips. The nightshade showed obvious thrips feeding damage but no obvious virus symptoms while the plantain showed less thrips feeding damage but distinct necrotic rings. Subsequently, two of two symptomatic potato plants of cv. Desiree in another greenhouse near the initial site tested INSV positive with the ImmunoStrips. In addition to the necrotic lesions on leaves observed in cv. Atlantic, these plants also showed necrosis of petioles and stems. INSV is transmitted by a number of species of thrips, but the western flower thrips (Frankliniella occidentalis Perg.) is considered the most important under greenhouse conditions. The species of thrips in the affected greenhouses was not determined before all materials were discarded. Both INSV and the thrips vector have large host ranges including many crops and weeds, and have become increasingly important in recent years (1,2). INSV was reported on greenhouse-grown potatoes in New York in 2005 (3). These findings indicate INSV can be a major problem in greenhouse potatoes, whether for research purposes or production of virus-free minitubers destined for field plantings. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) K. L. Perry et al. Plant Dis. 89:340, 2005. (4) K. Tanina et al. Jpn. J. Phytopathol. 67:42, 2001. ERRATUM: A correction was made to this Disease Note on September 7, 2012. The forward and reverse INSV specific primer sequences were corrected.
44
Lemez, Petr. "Near-Tetraploidy in Childhood Acute Lymphoblastic Leukemias Does Not Adversely Affect Prognosis: An EGIL Retrospective Study On 36 Cases Petr Lemez, Andishe Attarbaschi, Marie-Christine Bene, Yves Bertrand, Gian-Luigi Castoldi, Erik Forestier, Richard Garand, Oskar A. Haas, Emmanuelle Homolle, Sandrine Kagialis-Girard, Wolf-Dieter Ludwig, Estella Matutes, Marie-Pierre Pages, Winfried Pickl, Anna Porwit, Alberto Orfao, Jan Stary, Herbert Strobl, Pascaline Talmant, Mars B. Van't Veer, Zuzana Zemanova, for the European Group for the Immunological Characterization of Leukaemias (EGIL). (Introduced by Jaroslav Jelinek) Dept. of Hematology, Hosp. Jihlava, Jihlava, Czech Rep." Blood 114, no. 22 (November 20, 2009): 1585. http://dx.doi.org/10.1182/blood.v114.22.1585.1585.
Full textAbstract:
Abstract Abstract 1585 Poster Board I-611 The first larger study on near-tetraploid (metaphases with 80∼104 chromosomes) acute lymphoblastic leukemias (NT-ALL) described 20 children: 9 of the T-lineage (T-ALL) and 11 of the B-cell precursors (BCP-ALL), and concluded that: “NT-ALL represented a unique subgroup of ALL, characterized by preponderance of T-cell immunophenotype, specific morphologic features, and possibly a poorer prognosis” (Pui et al, Blood 1990;76:590). The aim of our study was to enlarge the limited knowledge on these rarely occurring NT-ALL. The EGIL collected retrospectively laboratory and clinical data of 36 children (under the age of 18 years) with NT-ALL from 6 European countries diagnosed and treated in international studies between 1992 and 2008. Bone marrow blasts of all 36 children were negative for peroxidase. Immunophenotyping of leukemic blasts showed that 10 cases were diagnosed as T-ALL and 26 cases as BCP-ALL. In 4 cases aberrant near-diploid metaphases were simultaneously present. At least a single normal metaphase was found in 27 cases. Leukemic blasts of all patients were BCR/ABL1 negative. T-ALL was diagnosed in 7 boys and three girls of a median age 11.9 (3.6 – 17.5) years. CNS infiltration was found in one child. Heterogeneity of NT-T-ALL cases was apparent with immunophenotyping because they belonged to all 4 EGIL categories: TI or TII were each diagnosed in two cases; TIII or TIV each in three cases. Their blasts were negative for HLA-DR in all 10 cases and for CD34 in all 6 examined cases. Cytogenetic examinations revealed different structural abnormalities in 6 cases. All 10 cases achieved complete remission (CR) after induction chemotherapy and 8 are remaining in the 1st CR, exhibiting event-free survival (EFS) 80 % with a median follow-up of 37+ months. One case died of septic shock in pancytopenia after his 3rd consolidation therapy and survived only 7 months. Another case relapsed in the bone marrow and maxilla after 25 months. He reached the 2nd CR with chemotherapy and is alive after unrelated HLA-identical stem cell transplantation (SCT) for 14 months. Survival of NT-T-ALL cases has been favorable - 90 % with a median of 41 (7-120) months. NT-BCP-ALL was further divided according to the cytogenetic and molecular results into 4 categories. ETV6/RUNX1 positive BCP-ALL was diagnosed in 7 boys and 5 girls with a median age of 7.0 (3.3-15.5) years. Immunophenotyping of bone marrow blasts lead to the diagnosis of EGIL categories BII in 10 cases and BIII in two. Blasts from all cases were positive for HLA-DR and for CD34 in 8 of 9 cases. All these 12 cases have achieved CR after induction chemotherapy and are alive in the 1st CR for 18-147 (median 65) months. Twelve cases of ETV6/RUNX1 negative BCP-ALL fall to at least two categories: two cases exhibited simultaneously hypodiploid metaphases with NT ones, 10 cases had only NT metaphases. These 10 cases were 6 boys and 4 girls with a median age of 9.5 (4.4-14.5) years and WBC 0.9-13.0 × 109/l. Immunophenotyping of blasts established the diagnosis of BII in 9 cases and BIII in one. All tested cases were positive for HLA-DR and CD34, three expressed CD2 antigen. All these cases reached CR after induction chemotherapy and are remaining in the 1st CR for 12-155 (median 73) months. Hypodiploid ETV6/RUNX1 negative BII BCP-ALL was diagnosed in two girls. One with a karyotype of 44 chromosomes relapsed after 37 months and died of infection in the 2nd CR after unrelated allogeneic SCT. The other with 45 chromosomes reached CR and is remaining in CR for 7 months. Leukemic blasts of two boys, 9.5 year-old, with BII NT-BCP-ALL were not examined for ETV6/RUNX1. One is in the 1st CR for 82 months. Another relapsed twice after 6 and 11 years. He underwent cord blood SCT in the 3rd CR and died 2.5 months later of cerebral toxoplasmosis. In summary, our data show immunophenotypic, cytogenetic, and molecular heterogeneity of childhood NT-ALL. In contrast to previous reports, we observed favorable prognosis of NT-ALL patients after current more intensive induction and consolidation chemotherapy. Near-tetraploidy did not deteriorate prognosis of childhood NT-ALL cases across different immunophenotypic, cytogenetic and molecular ALL types. Supported by grants MSM0021620813, MZOVFN2005. Disclosures No relevant conflicts of interest to declare.
45
Melikyan, Anait L., Elena I. Pustovaya, Elena M. Volodicheva, Tamara I. Kolosheinova, Marina V. Kalinina, Ekaterina N. Zotina, Ilya N. Kontievskiy, et al. "Incidence of Primary Immune Thrombocytopenia (ITP) in Adults in One Region of Russia." Blood 128, no. 22 (December 2, 2016): 4941. http://dx.doi.org/10.1182/blood.v128.22.4941.4941.
Full textAbstract:
Abstract Introduction. Primary immune thrombocytopenia is a rare disease1. The incidence of ITP is not well estimated in Russia and worldwide. In adults it varies from 1,6 to 3,9/100 000 person-years2-3. The gender and age-associated results are discussed and differ in several investigations4-6. Study objectives: evaluation of the incidence of primary immune thrombocytopenia in adults in one region of Russia Patients and methods. The data source is the Registry of the patients with primary ITP in Russia. 272 adult patients: 77 males (28%) and 195 females (72%), age from 16 to 89 years (median 44 years) with ITP (ICD-10 code D69.3), newly diagnosed cases during the period from 12 Jan 2014 to 24 May 2016. Results. 221 (81%) cases were newly diagnosed in 12 regions of Russia in which registration was performed most actively - more than 5 cases for the duration of the study. But only one region was selected for the first evaluation of epidemiological characteristics because of the number of reasons. There is one hematological central clinic in this region in which diagnosis of ITP can be verified and patients with ITP are treated and monitored most properly. The early started and fully performed registration process can be regarded as covered most part of region population in this target region. 86 cases (27 male, 59 female) were registered in the target region. The gender-age distribution was following: male: age <41 = 10 (37%), age <41-60 = 7 (26%), age >60 = 10 (37%); female: age <29 = 10 (49%), age <41-60 = 15 (25%), age >60 = 15 (25%). The estimated incidence rate in the target region is shown in table 1. The estimated incidence rates in gender-age strata in the target region are demonstrated in table 2. Conclusion. Overall ITP incidence in one region of Russia is 3.20/100 000 person-years. It is compatible to the incidence in other European countries. Our data demonstrate the rise of incidence rate in males with age and its decrease with age in female population. Literature. 1) Rodeghiero F., Stasi R., Gernsheimer T., Michel M., Provan D., Arnold D.M., et al. Standardization of terminology, definitions and outcome criteria in immune thrombocytopenic purpura of adults and children: report from international working group. Blood. 2009; 113(11): 2386--93. doi: 10.1182/blood-2008-07-162503. 2) Terrell DR, Beebe LA, Vesely SK, Neas BR, Segal JB, George JN. The incidence of immune thrombocytopenic purpura in children and adults: A critical review of published reports. Am J Hematol. 2010; 85(3): 174-180. 3) Moulis G, Palmaro A, Montastruc J-L, Godeau B, Lapeyre-Mestre M, Sailler L. Epidemiology of incident immune thrombocytopenia: a natiowide population-based study in France. Blood. 2014; 124(22): 3308-3315. 4) Segal JB, Powe NR. Prevalence of immune thrombocytopenia: analyses of administrative data. J Thromb Haemost 2006; 4: 2377-83 5) Schoonen WM, Kucera G, Coelson J, et al. Epidemiology of immune thrombocytopenic purpura in the General Practise Research Database. Br J Haematol 2009; 145(2): 235-244. 6) Lisukov I.A., Maschan A.A., Shamardina A.V., Chagorova T.V., Davydkin I.L., Sycheva T.M., et al. Immune thrombocytopenia: clinical manifestations and response to therapy. Intermediate analysis of data of the Russian register of patients with primary immune thrombocytopenia and review of literature. Oncogematologiya. 2013; 2: 61--9]. Disclosures No relevant conflicts of interest to declare.
46
Ling, Roger. "Hellenistic paintings in Italy and Sicily - G. F. LA TORRE e M. TORELLI (a cura di), PITTURA ELLENISTICA IN ITALIA E IN SICILIA. LINGUAGGI E TRADIZIONI. Atti del Convegno di Studi (Messina, 24-25 settembre 2009) (Archaeologica 163; Giorgio Bretschneider Editore, Roma 2011). Pp. xiii + 603, figg. 185, tav. a colore 42. ISSN 0391-9293; ISBN 978 88 7689 254 7. EUR. 189." Journal of Roman Archaeology 26 (2013): 500–503. http://dx.doi.org/10.1017/s1047759413000330.
Full text
47
Tinivella, F., E. Dani, G. Minuto, and A. Minuto. "First Report of Sydowia polyspora on Aleppo Pine (Pinus halepensis) in Italy." Plant Disease 98, no. 2 (February 2014): 281. http://dx.doi.org/10.1094/pdis-06-13-0658-pdn.
Full textAbstract:
Pinus halepensis Mill. is a pine native to the Mediterranean region that is generally located from sea level up to an altitude of 200 meters. In July 2012, extensive leaf yellowing and scorching were observed on the foliage of two specimens of P. halepensis in a public park of Alassio municipality, Liguria region (northern Italy). Diseased needles showed chlorotic and reddish brown colored areas that were randomly distributed among healthy needles. In order to isolate the potential pathogen, diseased needle tissues were surface sterilized for 1 min in 1% NaOCl and plated onto potato dextrose agar (PDA) amended with 100 ppm of streptomycin sulfate. After 7 to 10 days, a brown to dark green mycelium slowly developed on the PDA. From the mycelium, single cell conidia averaging 7.0 (4.7 to 12.2) × 2.9 (2.4 to 5.4) μm (n = 50) were produced. The internal transcribed spacer (ITS) region of rDNA was amplified using primers ITS1f/ITS4 and sequenced. A BLAST (1) search yielded 100% of maximum identity with Sydowia polyspora (Bref. & Tav.) E. Müller for ITS1f and ITS4. Pathogenicity was confirmed by inoculating 15 3-year-old plants (approximately 5 months after bud break) of P. halepensis grown singly in 8-cm diameter pots and maintained in greenhouse. Twelve of 15 plants were wounded by gently rubbing needles together. Five non-inoculated plants, with wounded and non-wounded branches, were kept as controls. Inoculations were carried out at 16.5 to 18.5°C. A suspension of S. polyspora conidia was made by adding 1 to 2 ml sterile water to the spore mass on 1-month-old PDA cultures in 9-cm petri dishes. Inoculum (107 spores/ml) was applied on the needles with a soft paint brush. After inoculation plants were covered with polythene bags for 5 days, kept at temperatures ranging from 5.5 to 26.4°C (average 14.5°C), and watered as needed. The inoculation trial was repeated once. All inoculated plants, both wounded and non-wounded, developed leaf yellowing and browning since the fifth day after inoculation in both inoculation tests, while control plants remained symptomless. After 15 days from first symptom appearance, S. polyspora was re-isolated from the needles of inoculated plants according to the procedure already described. S. polyspora is associated with current season needle necrosis (CSNN) on various conifer species. P. halepensis was reported in Spain to be a susceptible host (2) and S. polyspora has been isolated from infected tissues of fir (Abies spp.) (3). To our knowledge, this is the first report of S. polyspora on P. halepensis in Italy. Control of the pathogen with fungicides was ineffective on fir species, while application of very high rates of calcium chloride during shoot elongation was able to reduce the severity of CSNN (3). In forest areas, municipality gardens, and parks, effective management strategies have not yet been developed. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) L. Botella et al. Fungal Diversity 40:1, 2010. (3) V. Talgø et al. Fungal Biol. 114:545, 2010.
48
Anjali, Anjali, and Manisha Sabharwal. "Perceived Barriers of Young Adults for Participation in Physical Activity." Current Research in Nutrition and Food Science Journal 6, no. 2 (August 25, 2018): 437–49. http://dx.doi.org/10.12944/crnfsj.6.2.18.
Full textAbstract:
This study aimed to explore the perceived barriers to physical activity among college students Study Design: Qualitative research design Eight focus group discussions on 67 college students aged 18-24 years (48 females, 19 males) was conducted on College premises. Data were analysed using inductive approach. Participants identified a number of obstacles to physical activity. Perceived barriers emerged from the analysis of the data addressed the different dimensions of the socio-ecological framework. The result indicated that the young adults perceived substantial amount of personal, social and environmental factors as barriers such as time constraint, tiredness, stress, family control, safety issues and much more. Understanding the barriers and overcoming the barriers at this stage will be valuable. Health professionals and researchers can use this information to design and implement interventions, strategies and policies to promote the participation in physical activity. This further can help the students to deal with those barriers and can help to instil the habit of regular physical activity in the later adult years.
49
Zhu, Yuanjia, Andrea Hanick, Mariah Wright, John Barnard, Eric E. Roselli, and David R. Van Wagoner. "Abstract 244: Differential mRNA Expressions in Thoracic Aortic Aneurysm in Patients with Bicuspid and Tricuspid Aortic Valve." Circulation Research 119, suppl_1 (July 22, 2016). http://dx.doi.org/10.1161/res.119.suppl_1.244.
Full textAbstract:
Objective: Bicuspid aortic valve (BAV), the most common congenital heart condition, is frequently associated with thoracic aortic aneurysm (TAA). Aortic mRNA expression patterns in BAV patients and expression differences between BAV and tricuspid aortic valve (TAV) patients are unclear. We sought to compare mRNA expressions in TAA in patients with BAV and TAV. Methods and Results: Ascending aorta tissue was obtained from 58 aortic aneurysm repair patients (31 BAV, 27 TAV) and from 8 heart transplant donors. Illumina Human HT-12v4 microarrays were used to assess mRNA expression. After standard QC and filtering, probes were analyzed using multivariable linear regression analysis, adjusting for age, gender, medication use (beta blockers, ACE-Is, ARBs), and 10 surrogate variables. Ingenuity Pathway Analysis (IPA) was used to identify pathways and top regulator effect networks that were differentially expressed in BAV vs. TAV and BAV vs. donors. In BAV vs. TAV, MMP9, ESM1 and IL1B were downregulated 0.63, 0.74 and 0.77 fold, whereas COMP was upregulated 2.29 fold (p < 0.05 for all). In BAV vs. donors, IL1R2, MCEMP1, IL18RAP and ACAN were downregulated 0.66, 0.2, 0.2 and 0.05 fold, while ADAMTS8, CCL21 and CIDEA were upregulated 6.97, 6.24 and 4.65 fold (p < 0.0001). IPA analysis showed P53 as the top upstream regulator for both BAV vs. TAV (p = 1.9e-8) and BAV vs. donors (p = 2.3e-25). IRF7, which protects against angiotensin II-induced hypertrophy in cardiomyocytes, was also a significant upstream regulator for BAV vs. TAV (p = 3.6e-7). Additionally, miR-124-3p in BAV vs. TAV (p = 6.3e-7) and BAV vs. donors (p = 1.7e-22), as well as miR-96-5p in BAV vs. TAV (p = 4e-7) were predicted significant upstream regulators. Immune response was shown to be the top regulator effect network in BAV vs. TAV, whereas perivascular fibrosis was shown to be an important regulator effect network in BAV vs. donors. Cell stress pathways were also activated in BAV vs. donors. Conclusions: Distinct pathways and regulator effect networks exist in TAA with BAV or TAV. TAV associated TAA is more associated with inflammatory responses, while BAV aortopathy is more associated with extracellular matrix remodelling and cell stress. MiRs may also play an important role in BAV aortopathy.
50
Koh, June-Young, Euiseok Jung, Hyun Woo Goo, Seong-Chul Kim, Dae Yeon Kim, Jung-Man Namgoong, Byong Sop Lee, Ki-Soo Kim, and Ellen Ai-Rhan Kim. "Functional and structural evaluation in the lungs of children with repaired congenital diaphragmatic hernia." BMC Pediatrics 21, no. 1 (March 11, 2021). http://dx.doi.org/10.1186/s12887-021-02586-3.
Full textAbstract:
Abstract Background To evaluate the long-term functional and structural pulmonary development in children with repaired congenital diaphragmatic hernia (CDH) and to identify the associated perinatal-neonatal risk factors. Methods Children with repaired CDH through corrective surgery who were born at gestational age ≥ 35 weeks were included in this analysis. Those who were followed for at least 5 years were subjected to spirometry and chest computed tomography for evaluation of their functional and structural growth. Main bronchus diameters and lung volumes (total, left/right) were measured. According to total lung volume (TLV) relative to body surface area, children were grouped into TLV ≥ 50 group and TLV < 50 group and the associations with perinatal-neonatal factors were analyzed. Results Of the 28 children (mean age, 6.2 ± 0.2 years) with left-sided CDH, 7 (25%) had abnormal pulmonary function, of whom 6 (87%) showed restrictive patterns. All pulmonary functions except FEF25–75% were worse than those in matched healthy control group. Worse pulmonary function was significantly associated with small head and abdominal circumferences at birth. The mean TLV was 1339.1 ± 363.9 mL and LLV/TLV was 47.9 ± 2.5 mL. Children with abnormal pulmonary function were more likely to have smaller lung volumes. In multivariate analysis, abdominal circumference at birth was significantly associated with abnormal lung volume. Conclusions A quarter of children with repaired CDH showed abnormal pulmonary function. Small abdominal circumference at birth was associated with abnormal pulmonary function and lower TLV.