To see the other types of publications on this topic, follow the link: Viability of ascospores.
Journal articles on the topic 'Viability of ascospores'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 32 journal articles for your research on the topic 'Viability of ascospores.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Heckert, Stephanie, Jay W. Pscheidt, and Jeff K. Stone. "A Quick and Simple Method to Evaluate Anisogramma anomala Ascospore Viability." Plant Health Progress 14, no. 1 (January 2013): 22. http://dx.doi.org/10.1094/php-2013-0509-09-rs.
Full textAbstract:
Viability of ascospores of Anisogramma anomala, cause of eastern filbert blight on European hazelnut, was assessed using the vital stain trypan blue (working solution of 0.05% in lactoglycerol). Viable ascospores only had faint blue staining around their cell walls while non-viable ascospores absorbed the stain and turned dark blue. The number of viable (non-stained) ascospores as determined by trypan blue was similar to the proportion of ascospores germinating on culture media. Viability of field collected ascospores from rainwater spore traps ranged from 41 to 68%. Disease incidence of hazelnut seedlings was more closely related to differences in ascospore abundance than to differences in ascospore viability. Accepted for publication 3 January 2013. Published 9 May 2013.
2
Grove, G. G. "Perennation of Uncinula necator in Vineyards of Eastern Washington." Plant Disease 88, no. 3 (March 2004): 242–47. http://dx.doi.org/10.1094/pdis.2004.88.3.242.
Full textAbstract:
Studies on the mode of perennation of Uncinula necator in Eastern Washington were conducted over a 4-year period. Evidence of perennation of U. necator in infected dormant buds was not evident during vineyard surveys conducted over the period. Cleistothecia retrieved from bark fissures and senesced leaves contained viable ascospores at bud burst and later. The proportion of cleistothecia retrieved from bark that contained viable ascospores at bud burst ranged from 0.19 to 0.48, 0.09 to 0.72, 0.18 to 0.22, and 0.48 to 0.67 in 1998, 1999, 2000, and 2001, respectively. Viability of cleistothecia retrieved from senesced leaves in two vineyards at bud burst was 0.41 and 0.40 in 1998 and was 0.5 and 0.4 in 1999. Ascospore release in lab studies occurred from the late-dormant stage through the prebloom and (in some cases) the bloom stages. The initial ascosporic infection of Chardonnay leaves began at the late-dormant stage; colony numbers then declined through the prebloom and bloom stages. In vineyard studies, ascospores were trapped as late as 70 days after bud burst during rain events of 3.9 to 9.6 mm. Detection of ascospores in vineyard air preceded the initial occurrence of powdery mildew symptoms and signs and the occurrence of conidia in volumetric spore traps by several days. Cleistothecia are the only known source of primary inoculum in the grape-production regions of Eastern Washington.
3
Fisher, B. M., L. Frijters, and R. W. A. Scheper. "Effect of temperature on spore viability of Neonectria ditissima." New Zealand Plant Protection 68 (January 8, 2015): 452. http://dx.doi.org/10.30843/nzpp.2015.68.5866.
Full textAbstract:
The fungus Neonectria ditissima causes European canker on apple and pear trees in temperate regions The thermal death point of ascospores and conidia of this pathogen is unknown In this study ascospores and conidia were exposed to six temperatures between 20C and 50C for seven time intervals between 5 min and 24 h The viability of the spore suspensions was determined by germination on slides and growth on potato dextrose agar Temperatures up to 30C did not reduce spore viability Exposure to 35C for 24 h reduced conidial and ascospore germination by 92 and 85 respectively At 40C and 45C spore viability was reduced after 5 min declining rapidly with increasing exposure times No spores germinated after 5 min at 50C This study suggests that 15 min dips in 45C water may kill surface spore contamination of budwood prior to grafting Budwoodbased validation studies are now recommended
4
Crane, Patricia E., Anna J. M. Hopkins, Margaret A. Dick, and Lindsay S. Bulman. "Behaviour of Neonectria fuckeliana causing a pine canker disease in New Zealand." Canadian Journal of Forest Research 39, no. 11 (November 2009): 2119–28. http://dx.doi.org/10.1139/x09-133.
Full textAbstract:
Neonectria fuckeliana (C. Booth) Castl. & Rossman is known to be associated with a stem canker disease of Pinus radiata D. Don in New Zealand plantation forests. Although N. fuckeliana has been previously recorded as a wound invader or weak pathogen of Picea and Abies species in the Northern Hemisphere, little is currently known about the basic biology of the fungus. This paper outlines early investigations into the spore production and dispersal of N. fuckeliana in New Zealand. Perithecia of N. fuckeliana occur frequently on pruned stubs and on the surface of cankers, and ascospores appear to be the primary means of dispersal for this fungus in New Zealand. Both field collections and spore trapping show that mature perithecia contain viable ascospores in all seasons, and spores are ejected and dispersed using moisture. The conidial phases are rarely found in the field. Optimum temperature for both growth of mycelium and ascospore germination was between 15 and 25 °C. Some spore germination occurred at temperatures as low as 5 °C, but above 25 °C spore germination was abnormal. Ascospores and perithecia favoured storage in lower temperatures: overall, ascospores from perithecia stored at room temperature gradually lost their viability, whereas those stored at 4 and –8 °C maintained their viability over an 18 month period.
5
Sanderson, P. G. "Collection, Viability, and Storage of Ascospores ofMonilinia oxycocci." Phytopathology 82, no. 2 (1992): 160. http://dx.doi.org/10.1094/phyto-82-160.
Full text
6
Heckert, S., J. W. Pscheidt, and S. A. Cluskey. "Disease Incidence and Ascospore Dispersal from Cut Hazelnut Branches Colonized by Anisogramma anomala." Plant Disease 98, no. 6 (June 2014): 834–38. http://dx.doi.org/10.1094/pdis-06-13-0631-re.
Full textAbstract:
Hazelnut branches bearing stromata of Anisogramma anomala cut in December (2009 and 2010) were compared with branches cut prior to bud break in March to investigate these sources of inoculum. Branches were placed into brush piles (sources). Spore traps and potted hazelnut trees were placed adjacent to each source, 6.4 m upwind and downwind, and 20 m downwind from each source. Significantly more ascospores were detected near sources of branches cut in March compared with December in 2010 however, no differences were detected between pruning treatments in 2011. Ascospore viability, as assessed by trypan blue stain, averaged 50% for both pruning times each season. Significantly more ascospores were detected 6.4 m downwind compared with 6.4 m upwind or 20 m downwind of a source both years. All potted trees exposed to branches from both pruning treatments within sources became diseased both years. The proportion of potted trees that became infected was greater for the downwind group than the upwind for both years, suggesting that ascospores were dispersed beyond the rain splash dispersal range of sources. Ascospores from diseased branches pruned in December or March remained viable, infectious and were dispersed at least 20 m downwind.
7
Kim, Min-Ju, Mi-Kyung Lee, Huy Quang Pham, Myeong Ju Gu, Bohan Zhu, Sung-Hun Son, Dongyup Hahn, et al. "The velvet Regulator VosA Governs Survival and Secondary Metabolism of Sexual Spores in Aspergillus nidulans." Genes 11, no. 1 (January 16, 2020): 103. http://dx.doi.org/10.3390/genes11010103.
Full textAbstract:
The velvet regulator VosA plays a pivotal role in asexual sporulation in the model filamentous fungus Aspergillus nidulans. In the present study, we characterize the roles of VosA in sexual spores (ascospores) in A. nidulans. During ascospore maturation, the deletion of vosA causes a rapid decrease in spore viability. The absence of vosA also results in a lack of trehalose biogenesis and decreased tolerance of ascospores to thermal and oxidative stresses. RNA-seq-based genome-wide expression analysis demonstrated that the loss of vosA leads to elevated expression of sterigmatocystin (ST) biosynthetic genes and a slight increase in ST production in ascospores. Moreover, the deletion of vosA causes upregulation of additional gene clusters associated with the biosynthesis of other secondary metabolites, including asperthecin, microperfuranone, and monodictyphenone. On the other hand, the lack of vosA results in the downregulation of various genes involved in primary metabolism. In addition, vosA deletion alters mRNA levels of genes associated with the cell wall integrity and trehalose biosynthesis. Overall, these results demonstrate that the velvet regulator VosA plays a key role in the maturation and the cellular and metabolic integrity of sexual spores in A. nidulans.
8
Raju, N. B., and D. D. Perkins. "Expression of meiotic drive elements Spore killer-2 and Spore killer-3 in asci of Neurospora tetrasperma." Genetics 129, no. 1 (September 1, 1991): 25–37. http://dx.doi.org/10.1093/genetics/129.1.25.
Full textAbstract:
Abstract It was shown previously that when a chromosomal Spore killer factor is heterozygous in Neurospora species with eight-spored asci, the four sensitive ascospores in each ascus die and the four survivors are all killers. Sk-2K and Sk-3K are nonrecombining haplotypes that segregate with the centromere of linkage group III. No killing occurs when either one of these killers is homozygous, but each is sensitive to killing by the other in crosses of Sk-2K x Sk-3K. In the present study, Sk-2K and Sk-3K were transferred by recurrent backcrosses from the eight-spored species Neurospora crassa into Neurospora tetrasperma, a pseudohomothallic species which normally makes asci with four large spores, each heterokaryotic for mating type and for any other centromere-linked genes that are heterozygous in the cross. The action of Sk-2K and Sk-3K in N. tetrasperma is that predicted from their behavior in eight-spored species. A sensitive nucleus is protected from killing if it is enclosed in the same ascospore with a killer nucleus. Crosses of Sk-2K x Sk-2S, Sk-3K x Sk-3S, and Sk-sK x Sk-3K all produce four-spored asci that are wild type in appearance, with the ascospores heterokaryotic and viable. The Eight-spore gene E, which shows variable penetrance, was used to obtain N. tetrasperma asci in which two to eight spores are small and homokaryotic. When killer and sensitive alleles are segregating in the presence of E, only those ascospores that contain a killer allele survive. Half of the small ascospores are killed. In crosses of Sk-2K x Sk-3K (with E heterozygous), effectively all small ascospores are killed. The ability of N. tetrasperma to carry killer elements in cryptic condition suggests a possible role for Spore killers in the origin of pseudohomothallism, with adoption of the four-spored mode restoring ascospore viability of crosses in which killing would otherwise occur.
9
Harikrishnan, R., and L. E. del Río. "Influence of Temperature, Relative Humidity, Ascospore Concentration, and Length of Drying of Colonized Dry Bean Flowers on White Mold Development." Plant Disease 90, no. 7 (July 2006): 946–50. http://dx.doi.org/10.1094/pd-90-0946.
Full textAbstract:
Growth chamber studies were conducted using rehydrated dry bean (Phaseolus vulgaris) flowers (RDBF) to assess the influence of temperature (18 and 22°C), relative humidity (RH; 25 and 90%), and ascospore concentrations (102, 103, and 104 ascospores/ml) on white mold incidence in dry bean. Additional studies were carried out to determine the influence of inoculum type (ascospore and mycelium) and to estimate the effect of duration of drying of colonized RDBF on viability of Sclerotinia sclerotiorum and white mold incidence. There was a linear increase in white mold incidence with increase in ascospore concentration but neither temperature nor RH levels significantly affected disease development. In the inoculum type study, both temperature and RH levels significantly affected white mold incidence; however, neither ascospore nor mycelial inocula had a significant effect on white mold incidence. Drying colonized RDBF for up to 96 h did not affect S. sclerotiorum viability; but the amount of white mold incidence depended more on post-inoculation RH and drying duration than on the temperatures tested. Colonized RDBF dried for 96 h took approximately three times longer to achieve 100% white mold incidence compared with colonized RDBF dried for 24 h. These results suggest the potential for greater white mold development with higher ascospore availability and the potential of dry S. sclerotiorum-colonized dry bean flowers as a viable inoculum source.
10
Barua, Papori, Ming Pei You, Kirsty L. Bayliss, Vincent Lanoiselet, and Martin J. Barbetti. "Inert Materials as Long-Term Carriers and Disseminators of Viable Leptosphaeria maculans Ascospores and Wider Implications for Ascomycete Pathogens." Plant Disease 102, no. 4 (April 2018): 720–26. http://dx.doi.org/10.1094/pdis-08-17-1324-re.
Full textAbstract:
The viability of ascospores of the Phoma stem canker (blackleg) pathogen, Leptosphaeria maculans, was tested on a range of carrier materials, including metals, fabrics, woods, and plastics, and under different temperature conditions of 23 and 4, 36 and 14, and 45 and 15°C day and night, respectively. At 23 and 4°C (day and night, respectively), ascospores remained viable for up to 240 days on Tasmanian oak (Eucalyptus regnans) and pine wood (Pinus radiata). At 36 and 14°C (day and night, respectively), ascospores remained viable on pine wood for up to 180 days. At 45 and 15°C (day and night, respectively), ascospores remained viable up to 60 days on jute. There were also significant differences (P < 0.001) between carrier materials in their abilities to retain ascospores following washing. At least 30% of intact ascospores recovered from inert carrier materials were able to germinate on artificial growth media within 48 h of recovery and some ascospores were still viable after 240 days. These findings confirm that L. maculans ascospores remain viable for a much longer time in the absence of a host than previously considered. This demonstrates the importance of inert materials as long-term and long-distance carriers of viable L. maculans ascospores, and highlights their potential role for spread of L. maculans races to new regions and countries via farming equipment, clothing, and other associated materials. Local, national, and international biosecurity agencies need to be aware that the risks of spread of ascomycete plant, animal, and human pathogens via inert materials are significantly greater than currently assessed.
11
Gilbert, J., S. M. Woods, and U. Kromer. "Germination of Ascospores of Gibberella zeae After Exposure to Various Levels of Relative Humidity and Temperature." Phytopathology® 98, no. 5 (May 2008): 504–8. http://dx.doi.org/10.1094/phyto-98-5-0504.
Full textAbstract:
Fusarium head blight (FHB) is one of the most important cereal diseases in the world and has caused major losses to the grain industry. The principal pathogen causing FHB in North America is Gibberella zeae (anamorph Fusarium graminearum). Information on survival and the conditions under which ascospores remain viable once released from perithecia may assist in refining disease forecasting models. This study measured germination of ascospores after exposure to different temperatures, 15, 20, and 30°C, and levels of relative humidity (RH), 30, 60, and 90% for 4, 24, or 48 h periods. Viability was tested by germination on water agar. Germination rates fell with increasing temperatures at all observation times and at all humidity levels. At 15 and 20°C after 48 h, germination ranged from 74 to 85%, and 52 to 72%, respectively. At 30°C, germination ranged from 36 to 59% after 24 h and from 13 to 47% after 48 h. Germination was highest at 90% RH, except at 30°C after 48 h, and lowest at 60% RH. Successful germination, even under extreme conditions, suggests that ascospores are sufficiently robust to constitute a source of inoculum under most environmental conditions encountered during the growing season.
12
Jacobsen, B., M. R. Johnston, and H. C. Weltzien. "Occurrence of the Perfect Stage of Powdery Mildew of Sugar Beets in Southern Montana in 2003." Plant Disease 89, no. 12 (December 2005): 1362. http://dx.doi.org/10.1094/pd-89-1362b.
Full textAbstract:
Wide spread powdery mildew infections on sugar beets were observed at the Southern Agricultural Experiment Station in Huntley, MT during September, 2003. Throughout the area, lower leaves were frequently heavily covered by the vegetative stage of the fungus with plants at the edge of the field having clearly visible abundant mature (black) and immature (brown) globose ascocarps on the leaf surfaces and stems. The fruiting structures had mostly branched appendages and were imbedded in the superficial mycelium. Their diameter ranged from 70 to 100 μm. Each ascocarp contained five to eight asci with one to four ascospores (mostly three) per ascus. Elliptical ascospores were hyaline and measured 20 to 25 μm long and 12 to 20 μm wide. On the basis of the descriptions given for isolates from Idaho and Colorado (1) and the usage of Erysiphe polygoni DC for powdery mildew on sugar beet in the United States, this isolate may be classified as E. polygoni DC. However, measurements taken show that ascocarps, asci, and ascospores also fall within the range of E. betae (Vanha) Weltz. as described by Weltzien (2). We strongly suggest that these species be compared by using rDNA analysis of the ITS region to determine whether they are separate species. If survival of the ascocarps and the viability and pathogenicity of the ascospores can be confirmed, epidemics of sugar beet powdery mildew could be understood as local and regional events that are not dependant on long distance dispersal of conidiospores. The occurrence of the perfect stage also could lead to the more frequent appearance of new races through genetic recombination. References: (1) J. J Gallian and L. E. Hanson. Plant Dis. 87:200, 2003. (2) H. C. Weltzien. Phytopathol. Z. 47:123, 1963.
13
Washington, J. R., J. Cruz, F. Lopez, and M. Fajardo. "Infection Studies of Mycosphaerella fijiensis on Banana and the Control of Black Sigatoka with Chlorothalonil." Plant Disease 82, no. 11 (November 1998): 1185–90. http://dx.doi.org/10.1094/pdis.1998.82.11.1185.
Full textAbstract:
Infection studies with Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana (Musa AAA), demonstrated that the abaxial leaf surface is the primary infection site. Inoculation of banana plants with M. fijiensis ascospores on the abaxial surface of young leaves resulted in disease symptoms in 100% of the leaves inoculated within 18 to 30 days; whereas only 5% of the leaves inoculated on the adaxial surface showed black Sigatoka symptoms within 10 weeks. Disease symptoms appeared more rapidly on the new, emerging leaves than on the first and second fully expanded leaves. Application of chlorothalonil (1.08 kg a.i. ha-1) to the abaxial surface of emerging leaves resulted in 99 to 100% disease control in the treated area. When the emerging leaf was not sprayed until fully expanded, disease control was reduced to 76 to 80%. Application of chlorothalonil to the adaxial surface of banana leaves had little or no impact on disease control. Chlorothalonil arrested hyphal growth when applied to banana leaves after ascospores had already germinated and reduced the rate of lesion expansion when applied to the abaxial leaf surface after symptom appearance. Chlorothalonil was less effective than systemic fungicides in reducing production of M. fijiensis pseudothecia in infected tissue. When systemic and protectant fungicides were applied to infected leaf tissue, none of the fungicides affected the viability of ascospores that were discharged from pseudothecia produced in that tissue. For successful control of black Sigatoka with chlorothalonil, deposition of the fungicide on the abaxial leaf surface is essential.
14
Klapholz, Sue, Candace S. Waddell, and Rochelle Easton Esposito. "THE ROLE OF THE SPO11 GENE IN MEIOTIC RECOMBINATION IN YEAST." Genetics 110, no. 2 (June 1, 1985): 187–216. http://dx.doi.org/10.1093/genetics/110.2.187.
Full textAbstract:
ABSTRACT Several complementary experimental approaches were used to demonstrate that the SPO11 gene is specifically required for meiotic recombination. First, sporulating cultures of spo11-1 mutant diploids were examined for landmark biochemical, cytological and genetic events of meiosis and ascosporogenesis. Cells entered sporulation with high efficiency and showed a near-doubling of DNA content. Synaptonemal complexes, hallmarks of intimate homologous pairing, and polycomplex structures appeared during meiotic prophase. Although spontaneous mitotic intra- and intergenic recombination occurred at normal levels, no meiotic recombination was observed. Whereas greater than 50% of cells completed both meiotic divisions, packaging of the four meiotic products into mature ascospores took place in only a small subset of asci. Haploidization occurred in less than 1% of viable colony-forming units. Second, the Rec- meiotic defect conferred by spo11-1 was confirmed by dyad analysis of spores derived from spo13-1 single-division meiosis in which recombination is not a requirement for viable ascospore production. Diploids homozygous for the spo13-1 mutation undergo meiotic levels of exchange followed by a single predominantly equational division and form asci containing two near-diploid spores. With the introduction of the spo11-1 mutation, high spore viability was retained, whereas intergenic recombination was reduced by more than 100-fold.
15
Pfender, W. F., and S. C. Alderman. "Evaluation of Postharvest Burning and Fungicides to Reduce the Polyetic Rate of Increase of Choke Disease in Orchardgrass Seed Production." Plant Disease 87, no. 4 (April 2003): 375–79. http://dx.doi.org/10.1094/pdis.2003.87.4.375.
Full textAbstract:
Epichloë typhina, causal agent of choke disease, is detrimental to orchardgrass seed production. The fungus grows systemically, persists indefinitely as an endophyte within the perennial host, and produces a stroma bearing conidia and ascospores at the time of host flowering. The ascospores or conidia are thought to infect plants through the cut ends of tillers after swathing at harvest. The objective of this study was to evaluate the potential of systemic fungicides and postharvest treatments (burning and reclipping) to reduce the rate of increase of choke disease among plants. The fungicides propiconazole and azoxystrobin reduced germination of conidia of E. typhina in vitro, but had no effect on development of stroma or viability of conidia produced on infected plants. In field tests, fungicides applied to the cut ends of tillers after harvest were ineffective at reducing the rate of increase in disease. Likewise, reclipping of orchardgrass stubble after harvest, in an attempt to remove incipient infections in the tillers, did not reduce the rate of disease increase in the stand. However, propane-assisted burning of postharvest stubble did reduce the polyetic epidemic rate to 2.7% per year, compared with approximately 9.2% per year in plots receiving the fungicide, reclipping, or control treatments. The results suggest that postharvest burning may be useful in controlling choke disease and raise the possibility that there are infection courts other than the pith of cut reproductive tillers.
16
Rincón, Sergio A., Beatriz Santos, and Pilar Pérez. "Fission Yeast Rho5p GTPase Is a Functional Paralogue of Rho1p That Plays a Role in Survival of Spores and Stationary-Phase Cells." Eukaryotic Cell 5, no. 3 (March 2006): 435–46. http://dx.doi.org/10.1128/ec.5.3.435-446.2006.
Full textAbstract:
ABSTRACT The Rho GTPase family and their effectors are key regulators involved in many eukaryotic cell functions related to actin organization and polarity establishment. Schizosaccharomyces pombe Rho1p is essential, directly activates the (1,3)-β-d-glucan synthase, and participates in regulation of cell wall growth and morphogenesis. Here we describe the characterization of the fission yeast Rho5p GTPase, highly homologous to Rho1p, sharing 86% identity and 95% similarity. Overexpression of the hyperactive allele rho5-G15V causes a morphological effect similar to that of rho1-G15V, but the penetrance is significantly lower, and overexpression of the dominant-negative allele rho5-T20N causes lysis like that of rho1-T20N. Importantly, overexpression of rho5 + but no other rho genes is able to rescue the lethality of rho1Δ cells. Shutoff experiments indicated that Rho5p can replace Rho1p, but it is not as effective in maintaining cell wall integrity or actin organization. rho5 + expression is hardly detected during log-phase growth but is induced under nutritional starvation conditions. rho5Δ cells are viable and do not display any defects during logarithmic growth. However, when rho1 + expression is repressed during stationary phase, rho5Δ cells display reduced viability. Ascospores lacking Rho5p are less resistant to heat or lytic enzymes than wild-type spores. Moreover, h90 mutant strains carrying the hyperactive rho5-G15V or the dominant-negative rho5-T20N alleles display severe ascospore formation defects. These results suggest that Rho5p functions in a way similar to, but less efficient than, Rho1p, plays a nonessential role during stationary phase, and participates in the spore wall formation.
17
Arratia-Quijada, Jenny, Olivia Sánchez, Claudio Scazzocchio, and Jesús Aguirre. "FlbD, a Myb Transcription Factor of Aspergillus nidulans, Is Uniquely Involved in both Asexual and Sexual Differentiation." Eukaryotic Cell 11, no. 9 (July 13, 2012): 1132–42. http://dx.doi.org/10.1128/ec.00101-12.
Full textAbstract:
ABSTRACTIn the fungusAspergillus nidulans, inactivation of theflbAto-E,fluG,fluF, andtmpAgenes results in similar phenotypes, characterized by a delay in conidiophore and asexual spore production.flbBto-Dencode transcription factors needed for proper expression of thebrlAgene, which is essential for asexual development. However, recent evidence indicates that FlbB and FlbE also have nontranscriptional functions. Here we show thatfluF1is an allele offlbDwhich results in an R47P substitution. Amino acids C46 and R47 are highly conserved in FlbD and many other Myb proteins, and C46 has been proposed to mediate redox regulation. Comparison of ΔflbDandflbDR47Pmutants uncovered a new and specific role forflbDduring sexual development. WhileflbDR47Pmutants retain partial function during conidiation, bothΔflbDandflbDR47Pmutants are unable to develop the peridium, a specialized external tissue that differentiates during fruiting body formation and ends up surrounding the sexual spores. This function, unique among otherfluffygenes, does not affect the viability of the naked ascospores produced by mutant strains. Notably, ascospore development in these mutants is still dependent on the NADPH oxidase NoxA. We generated R47K, C46D, C46S, and C46A mutant alleles and evaluated their effects on asexual and sexual development. Conidiation defects were most severe inΔflbDmutants and stronger in R47P, C46D, and C46S strains than in R47K strains. In contrast, mutants carrying theflbDC46Aallele exhibited conidiation defects in liquid culture only under nitrogen starvation conditions. The R47K, R47P, C46D, and C46S mutants failed to develop any peridial tissue, while theflbDC46Astrain showed normal peridium development and increased cleistothecium formation. Our results show that FlbD regulates both asexual and sexual differentiation, suggesting that both processes require FlbD DNA binding activity and that FlbD is involved in the response to nitrogen starvation.
18
Molnar, T. J., J. Capik, S. Zhao, and N. Zhang. "First Report of Eastern Filbert Blight on Corylus avellana ‘Gasaway’ and ‘VR20-11’ Caused by Anisogramma anomala in New Jersey." Plant Disease 94, no. 10 (October 2010): 1265. http://dx.doi.org/10.1094/pdis-06-10-0445.
Full textAbstract:
Eastern filbert blight (EFB) is a serious disease of European hazelnut, Corylus avellana L., which causes economic losses in Oregon (OR) where 99% of the U.S. crop is produced. The causal organism, Anisogramma anomala (Peck) E. Müller, is native east of the Rocky Mountains where it is found in association with C. americana Marshall. While C. americana is tolerant, EFB causes cankering, branch dieback, and death of C. avellana (3). EFB was first discovered in Washington State in the late 1960s (1). Since then, it has spread throughout the Willamette Valley of OR. In OR, ‘Gasaway’, an obsolete pollinizer, shows complete resistance to EFB, conferred by a dominant allele at a single locus (4). ‘Gasaway’ has been widely used in breeding at Oregon State University (OSU) to develop resistant cultivars that are used in most new orchards. In January 2008, cankers containing rows of dark brown elliptical stroma, characteristic of EFB, were first observed on more than 25 trees of ‘Gasaway’ growing at the Rutgers University research farms in Adelphia and North Brunswick, NJ. At that time, cankers were also found on 18 trees of ‘VR20-11’ growing on the research farms. ‘VR20-11,’ an offspring of ‘Gasaway’ that carries the same resistance gene, was released by OSU for use as a pollinizer for ‘Barcelona’, an EFB-susceptible but widely grown cultivar in OR. Additional cankers were observed on the New Jersey trees in January 2009 and 2010. To our knowledge, this is the first report of EFB on either cultivar under field conditions. The cankers are smaller than those on susceptible cultivars. Of 61 cankers on 10 trees of ‘Gasaway’, the average length was 11 cm with a range of 4 to 42 cm. Canker lengths on susceptible trees are typically 20 to 100 cm. The cankers appear otherwise alike with stromata, 2 to 4 × 2 mm, up to 2 mm high; perithecia upright, in the lower part of stroma; asci ellipsoid, 35 to 45 × 9 to 12 μm; and ascospores 8 to 11 × 4 to 5.5 μm, hyaline, smooth, ellipsoid, 2-celled, with the lower cell very short (1 to 1.5 μm long and wide). Genomic DNA was isolated from ascospores excised from cankers of ‘Gasaway’ and ‘VR20-11’. ITS1F and ITS2 primers were used to amplify and sequence the internal transcribed spacer 1 region (ITS1) of the rRNA genes (GenBank Accession Nos. HM565133 and HM565132). BLAST analysis of the 238-bp segments showed 99% homology with a sequence of A. anomala (EU683064). Phylogenetic analysis also confirmed that the two isolates are A. anomala. To test viability, ‘Gasaway’ cankers were excised and ascospore suspensions (1 × 106 spores ml–1) were applied to 15 trees of susceptible ‘Barcelona’ in March 2008 following the protocol of Johnson et al. (2). In December 2009, 12 of 15 inoculated trees expressed EFB. ‘Gasaway’ has shown no signs or symptoms of infection by A. anomala over several decades of exposure in OR, which is believed to have a limited diversity of the fungus due to a single-point introduction. Our findings suggest quarantine efforts must be bolstered to prevent further introductions of A. anomala into the Pacific Northwest to protect the viability of the U.S hazelnut industry. References: (1) A. D. Davison and R. M. Davidson, Jr. Plant Dis. Rep. 57:522, 1973. (2) K. B. Johnson et al. Phytopathology 84:1465, 1994. (3) K. B. Johnson and J. N. Pinkerton. Eastern filbert blight. Page 44 in: Compendium of Nut Crop Diseases in Temperate Zones. B. L. Teviotdale et al., eds. The American Phytopathological Society. St. Paul, MN. 2002. (4) S. A. Mehlenbacher et al. HortScience 26:410, 1991.
19
Cortesi, Paolo, M. Bisiach, M. Ricciolini, and David M. Gadoury. "Cleistothecia of Uncinula necator—An Additional Source of Inoculum in Italian Vineyards." Plant Disease 81, no. 8 (August 1997): 922–26. http://dx.doi.org/10.1094/pdis.1997.81.8.922.
Full textAbstract:
Density and viability of populations of cleistothecia of Uncinula necator from bark, leaves, and soil were determined in three vineyards in the Florence and Siena provinces of Tuscany for 3 years. A higher density of cleistothecia was found on fallen leaves than on bark. However, the percentage of viable cleistothecia was higher on bark. No viable cleistothecia were recovered from soil. U. necator overwintered as mycelium in dormant infected buds, which gave rise to flag shoots, only in Santa Cristina, where 20 and 92 flag shoots per hectare were detected before bloom in 1994 and 1995, respectively. Disease incidence and severity increased similarly at Corti, Fornace, and at Santa Cristina, although powdery mildew epidemics started from ascospores only in Corti and Fornace, whereas flag shoots were present at Santa Cristina. Cleistothecia were formed in autumn in both 1994 and 1995, and their dispersal started in late September to mid-October, with the maximum number of cleistothecia trapped in funnels during the second half of October. Cleistothecia appear to function as the sole source of primary inoculum for grape powdery mildew in some Italian vineyards and serve as additional sources of inoculum where the pathogen also overwinters in infected buds. In Australia but not in New York, the pathogen also overwinters as cleistothecia on fallen leaves.
20
Kirk, K. E., and N. R. Morris. "Either alpha-tubulin isogene product is sufficient for microtubule function during all stages of growth and differentiation in Aspergillus nidulans." Molecular and Cellular Biology 13, no. 8 (August 1993): 4465–76. http://dx.doi.org/10.1128/mcb.13.8.4465.
Full textAbstract:
The filamentous fungus Aspergillus nidulans has two genes encoding alpha-tubulin, tubA and tubB, which are differentially required at distinct stages during the life cycle. The tubA gene is required during vegetative growth for mitosis and nuclear migration (B. R. Oakley, C. E. Oakley, and J. E. Rinehart, Mol. Gen. Genet. 208:135-144, 1987; P. Doshi, C. A. Bossie, J. H. Doonan, G. S. May, and N. R. Morris, Mol. Gen. Genet. 225:129-141, 1991). The tubB gene is not required for any detectable aspect of vegetative growth or asexual reproduction but is essential during sexual development prior to the first meiotic division (K. E. Kirk and N. R. Morris, Genes Dev. 5:2014-2023, 1991). In this study, we determined whether the role of each alpha-tubulin gene is to provide a specific isotype necessary for a particular microtubule function or whether either alpha-tubulin isotype, if present in sufficient quantities, can participate effectively in all types of microtubule. Strains carrying a deletion allele of tubB (tubB delta) produce no ascospores from a cross. When one copy of a plasmid containing the region upstream of the tubB gene fused to the tubA coding region was integrated into a tubB delta strain, ascosporogenesis proceeded beyond the tubB delta block and resulted in the formation of sexual spores. However, irregular numbers of spores formed in some asci during development, and the ascospores had greatly diminished viability and aberrant morphologies. These defects were nearly corrected when two additional copies of the tubA coding region were integrated into the tubB delta strain. These results indicate that the tubA alpha-tubulin isotype can form functional microtubules during sexual development in the absence of tubB protein. In a reciprocal set of experiments, we examined whether upregulation of tubB can complement the tubA4 mutation, which causes supersensitivity to benomyl during vegetative growth. When tubA4 strains integrated a plasmid containing an alcohol-inducible promoter joined to the tubB coding region and subsequently overexpressed the tubB isotype, the benomyl supersensitivity normally caused by the tubA4 allele was relieved. These results indicate that when enough tubB alpha-tubulin is supplied, strains lacking functional tubA isotype can still form microtubules which effectively carry out mitosis and nuclear migration.
21
Kirk, K. E., and N. R. Morris. "Either alpha-tubulin isogene product is sufficient for microtubule function during all stages of growth and differentiation in Aspergillus nidulans." Molecular and Cellular Biology 13, no. 8 (August 1993): 4465–76. http://dx.doi.org/10.1128/mcb.13.8.4465-4476.1993.
Full textAbstract:
The filamentous fungus Aspergillus nidulans has two genes encoding alpha-tubulin, tubA and tubB, which are differentially required at distinct stages during the life cycle. The tubA gene is required during vegetative growth for mitosis and nuclear migration (B. R. Oakley, C. E. Oakley, and J. E. Rinehart, Mol. Gen. Genet. 208:135-144, 1987; P. Doshi, C. A. Bossie, J. H. Doonan, G. S. May, and N. R. Morris, Mol. Gen. Genet. 225:129-141, 1991). The tubB gene is not required for any detectable aspect of vegetative growth or asexual reproduction but is essential during sexual development prior to the first meiotic division (K. E. Kirk and N. R. Morris, Genes Dev. 5:2014-2023, 1991). In this study, we determined whether the role of each alpha-tubulin gene is to provide a specific isotype necessary for a particular microtubule function or whether either alpha-tubulin isotype, if present in sufficient quantities, can participate effectively in all types of microtubule. Strains carrying a deletion allele of tubB (tubB delta) produce no ascospores from a cross. When one copy of a plasmid containing the region upstream of the tubB gene fused to the tubA coding region was integrated into a tubB delta strain, ascosporogenesis proceeded beyond the tubB delta block and resulted in the formation of sexual spores. However, irregular numbers of spores formed in some asci during development, and the ascospores had greatly diminished viability and aberrant morphologies. These defects were nearly corrected when two additional copies of the tubA coding region were integrated into the tubB delta strain. These results indicate that the tubA alpha-tubulin isotype can form functional microtubules during sexual development in the absence of tubB protein. In a reciprocal set of experiments, we examined whether upregulation of tubB can complement the tubA4 mutation, which causes supersensitivity to benomyl during vegetative growth. When tubA4 strains integrated a plasmid containing an alcohol-inducible promoter joined to the tubB coding region and subsequently overexpressed the tubB isotype, the benomyl supersensitivity normally caused by the tubA4 allele was relieved. These results indicate that when enough tubB alpha-tubulin is supplied, strains lacking functional tubA isotype can still form microtubules which effectively carry out mitosis and nuclear migration.
22
Wilson, Charles L., Jose M. Solar, Ahmed El Ghaouth, and Deborah R. Fravel. "Benzaldehyde as a Soil Fumigant, and an Apparatus for Rapid Fumigant Evaluation." HortScience 34, no. 4 (July 1999): 681–85. http://dx.doi.org/10.21273/hortsci.34.4.681.
Full textAbstract:
An apparatus was developed for the rapid and facile evaluation of soil fumigants in a controlled manner using small volumes of soil. The apparatus consisted of a manifold to which were attached six canisters containing a loamy sand soil (adjusted to –100 kPa soil water potential). The soil was infested with either conidia of Fusarium oxysporum or Trichoderma harzianum; sclerotia of Sclerotinia minor; ascospores of Talaromyces flavus; vermiculite colonized with Pythium aphanidermatum; or beet (Beta vulgaris L., cv. Detroit Red) seed colonized with Rhizoctonia solani. Using nitrogen gas (N2) as a carrier gas, either N2 or N2 plus benzaldehyde was passed continuously through the soil for 24, 48, or 72 hours. At all three exposure times, benzaldehyde + N2 reduced viability of R. solani and S. minor, and reduced populations of P. aphanidermatum and T. harzianum. Populations of F. oxysporum were reduced after 48 and 72 hours of exposure to benzaldehyde, whereas populations of T. flavus were reduced only after 72 hours of exposure. Fumigation with benzaldehyde + N2 for 24 hours did not affect soil pH 1 week after exposure, but fumigation for 48 or 72 hours temporarily lowered pH from an average of 6.86 to 5.57 and 5.32, respectively. The biocontrol fungus, T. flavus, was less sensitive to benzaldehyde than the pathogens or the biocontrol fungus, T. harzianum. Thus, combining T. flavus with benzaldehyde to enhance biocontrol may be possible.
23
Kim, Hyojeong, and Mary Anne Nelson. "Molecular and Functional Analyses of poi-2, a Novel Gene Highly Expressed in Sexual and Perithecial Tissues of Neurospora crassa." Eukaryotic Cell 4, no. 5 (May 2005): 900–910. http://dx.doi.org/10.1128/ec.4.5.900-910.2005.
Full textAbstract:
ABSTRACT The poi-2 gene is highly and specifically expressed in starved and sexual tissues of the filamentous fungus Neurospora crassa. It encodes a 27-kDa protein, as shown by in vitro transcription and translation. The POI2 protein contains a hydrophobic signal sequence at the amino terminus followed by novel 16 tandem repeats of 13 to 14 amino acid residues; all repeats are separated by Kex2 processing sites. Repeat-induced point mutation (RIP)-mediated gene disruption was used to generate poi-2 mutants, and the mutated sequences showed either one of two distinct patterns: typical RIPs (GC-to-AT transitions) or insertion-deletion (indel) mutations. Although the poi-2 strains contained numerous mutations, all retained intact open reading frames (ORFs) of various lengths. They showed greatly reduced vegetative growth and protoperithecial formation and low viability of their sexual progeny. All poi-2 mutants had similar defects in male fertility and the mating response, but the nature of female fertility defects varied and corresponded to the length of the residual poi-2 ORF. Mutants with ORFs of approximately normal length occasionally completed sexual development and produced viable ascospores, while a mutant with a severely truncated ORF was female sterile due to its inability to form protoperithecia. Thus, poi-2 is essential for differentiation of female reproductive structures and perithecial development as well as for normal vegetative growth. The POI2 protein is involved in the mating response, probably as a component in the pathway rather than as a pheromone.
24
Deduke, C., and M. D. Piercey-Normore. "A potential trade-off with stictic acid improves ascospore viability inXanthoparmelia cumberlandia." Bryologist 117, no. 3 (July 2014): 290–96. http://dx.doi.org/10.1639/0007-2745-117.3.290.
Full text
25
Vági, Pál, Tito Caffi, Kálmán Zoltán Váczy, Márk Z. Németh, and Levente Kiss. "Refining a method for ascospore viability testing in overwintering chasmothecia of Erysiphe necator." European Journal of Plant Pathology 144, no. 4 (October 20, 2015): 799–802. http://dx.doi.org/10.1007/s10658-015-0797-2.
Full text
26
de Medina-Redondo, María, Yolanda Arnáiz-Pita, Thierry Fontaine, Francisco del Rey, Jean Paul Latgé, and Carlos R. Vázquez de Aldana. "The β-1,3-glucanosyltransferase gas4p is essential for ascospore wall maturation and spore viability in Schizosaccharomyces pombe." Molecular Microbiology 68, no. 5 (June 2008): 1283–99. http://dx.doi.org/10.1111/j.1365-2958.2008.06233.x.
Full text
27
Kawchuk, L. M., R. J. Howard, M. L. Kalischuk, P. R. Northover, M. Desjardins, and R. C. J. Spencer. "First Report of Bronze Leaf Disease on Poplar in Alberta, Canada and Sequence of Apioplagiostoma populi." Plant Disease 94, no. 3 (March 2010): 377. http://dx.doi.org/10.1094/pdis-94-3-0377a.
Full textAbstract:
Poplar (Populus spp.) is an important ornamental, windbreak, and pulp and wood product tree in Alberta and across western Canada because of its rapid growth, architecture, and hardiness. It is also a major component of native tree stands in the parkland area of the Canadian Prairies. Until recently in North America, infections of Apioplagiostoma populi (Cash & A.M. Waterman) Barr have only been documented in central Canada and the eastern and midwestern United States. Symptoms resembling bronze leaf disease (3) were observed in Alberta as early as 2003 and have been seen each subsequent year on an increasing number of Populus × canescens Smith, P. tremula L., and P. tremuloides Michx. trees from urban areas, shelterbelts, and nurseries. Foliar symptoms were observed in 10 to 50% of the tree canopy, and diseased leaves were bronze-colored with green and yellow petioles and veins. Disease symptoms became pronounced in mid-to-late summer with bronze to dark reddish brown leaves, while the petiole and the midrib remained green. Some symptomatic leaves remained attached to diseased trees throughout the fall and winter and continued the infectious disease cycle in the spring. As the disease advanced, A. populi colonized stem and branch tissues causing the leaves to wilt, discolor, and die shortly afterward. Diseased branches often died within the current season. Continued branch dieback resulted in significantly reduced aesthetic and commercial value. Survival of poplar arising from diseased clones was often less than 5 years. Bronze leaf disease symptoms have been reported on several Populus spp., and premature tree mortality represents a serious impediment to the continued use of this tree species (1). Attempts to isolate the causal agent of bronze leaf disease on artificial media have been unsuccessful (4). In the fall of 2008, leaves from symptomatic trees were collected and suspended outdoors in mesh bags to overwinter. Dark brown perithecia (150 to 200 × 100 to 150 μm) emerged the following spring from the lower and upper leaf surfaces. Asci were fusoid clavate, 30 to 40 × 10 to 14 μm with a conspicuous apical ring and contained hyaline two-celled ascospores 10 to 14 × 3 to 6 μm that were ellipsoid clavate with a relatively short basal cell. Nucleic acid was extracted from isolated perithecia and amplified by the polymerase chain reaction and oligonucleotides 5′GCATCGATGAAGAACGCAGC3′ and 5′TCCTCCGCTTATTGATATGC3′ specific for rDNA internal transcribed spacer (ITS) sequence (2). The cloned amplified sequence of the A. populi rDNA ITS region (GenBank Accession No. GU205341) showed considerable homology (>90% identity) to other Apioplagiostoma spp. In total, 33 independent leaf samples from nine trees exhibiting disease symptoms were positive for A. populi, producing an approximately 300-bp sequence not observed in any of the symptomless samples. Poplar and aspen have been extensively planted in rural and urban landscapes in western Canada over the past 100 years and continued spread of the bronze leaf disease pathogen threatens the viability of the shelterbelt, nursery, and processed wood industries. References: (1) E. K. Cash and A. M. Waterman. Mycologia 49:756, 1957. (2) A. H. Khadhair et al. Can. J. Plant Pathol. 20:55, 1998. (3) P. R. Northover and M. Desjardins. Plant Dis. 87:1538, 2003. (4) J. A. Smith et al. Plant Dis. 86:462, 2002.
28
Meilus, M., and MAA Castro-Prado. "Gene inactivation system extension into a unique sequence outside of the II →> I insertional duplication in Aspergillus nidulans." Canadian Journal of Microbiology 44, no. 11 (November 1, 1998): 1037–44. http://dx.doi.org/10.1139/w98-099.
Full textAbstract:
The first report of the gene inactivation system (GIS) in Aspergillus nidulans came from crosses involving a II Gene inactivation system extension into a unique sequence outside of the II →> I insertional duplication. Duplicated segments trigger the GIS that acts through the methylation of cytosines present within repeats. Duplicated genes are probably inactivated during the premeiotic period between fertilization and karyogamy, but reactivation may occur spontaneously or after 5-azacytidine treatment. The aim of the present study was to determine the action of GIS on a single copy gene located near a duplicated segment. Aspergillus nidulans strains bearing the Dp(II,I) duplication were used in meiotic crosses homozygous for the y+ gene and yellow (y) segregants were recovered among the progenies. Data show that the GIS can act on a closely linked gene outside the duplicated segment, promoting reversible inactivation. Reduction of ascospore numbers and viability were observed in crosses parented by duplication strains. Inactivation of the w+ gene in a w/w+ duplication strain is also shown.Key words: Aspergillus nidulans, gene inactivation, DNA methylation, chromosomal duplication.
29
Holb, I. J., B. Heijne, and M. J. Jeger. "Overwintering of Conidia of Venturia inaequalis and the Contribution to Early Epidemics of Apple Scab." Plant Disease 88, no. 7 (July 2004): 751–57. http://dx.doi.org/10.1094/pdis.2004.88.7.751.
Full textAbstract:
Overwintering of conidia of Venturia inaequalis associated with shoots and buds was determined, and the contribution to early spring epidemics of apple scab was evaluated during three consecutive seasons (1999 to 2001) in the Netherlands. Examinations of shoot samples collected before bud break showed that the percentage of shoots with superficial black fungal mycelia or conidia was above 65%, and the mean number of conidia on a 1-cm piece of shoot length ranged from 581 to 1,033. However, germination tests showed that the viability of conidia on shoots was less than 1.5%. No macroscopic scab lesions were detected on the scales of dormant buds. However, microscopic examinations of individual bud tissues demonstrated that the number of conidia was >3,000 per 100 buds in each year. The mean viability of conidia associated with buds ranged from 0.7 to 1.9% and from 3.7 to 10.5% for the outer and inner bud tissues, respectively. Results of field assessments at tight-cluster phenological stage showed that the percentage of infection caused by the viable overwintered conidia ranged from 0.3 to 3.8% in the various treatments. Our results indicated that conidia were unlikely to overwinter on the surface of shoots or outer bud tissues, where they were exposed to fluctuating environmental conditions, and, consequently, were unlikely to play a role in initiating an early epidemic of apple scab in the spring. However, our results indicated a risk from overwintered conidia in the inner bud tissues arising from a high level of scab the previous autumn. Therefore, orchards with high levels of apple scab, where ascosporic inoculum is much reduced, e.g., by sanitation, should be protected in early spring by means of fungicide treatment at green tip.
30
Redl, M., S. Möth, E. Koschier, B. Spangl, and S. Steinkellner. "Survival and viability of ascospores of Erysiphe necator in Austrian vineyards." European Journal of Plant Pathology, January 7, 2021. http://dx.doi.org/10.1007/s10658-020-02192-6.
Full textAbstract:
AbstractGrape powdery mildew caused by Erysiphe necator is a limiting factor in grape production. In order to develop effective management strategies, the factors influencing the survival of the fungus need to be identified and characterized accordingly. For this purpose, we focused on the effect of weather conditions during overwintering on the survival and viability of ascospores. In spring 2017 and 2018, grape leaf litter and bark samples were collected and examined to determine the density of chasmothecia and the viability of ascospores in various Austrian vine growing regions. There were obvious differences in the amounts of chasmothecia between both years and all examined vineyards. Lower quantities of chasmothecia were detected on the exfoliating bark compared to leaf litter, with up to 37% of chasmothecia containing viable ascospores. In comparison, chasmothecia from leaf litter showed a lower viability (up to 5%). The number of viable ascospores per head of vine ranged from 0 to 351 and from 0 to 251 in 2017 and 2018, respectively, and showed partly a strong variation within one location in both years. The infectivity of ascospores on detached leaves was confirmed. In a survival experiment, chasmothecia, when incubated at 7 °C, released more viable ascospores than chasmothecia incubated at 17 °C. After an incubation period of 30 weeks, only chasmothecia stored at the lower temperature contained viable ascospores. However, the mean temperature differences of 0.1 to 1.2 °C during the period of formation of chasmothecia to bud break in both years and six investigated areas did not explain differences in the viability of the ascospores. Differences in vineyard management seem to be of particular importance here.
31
Alimad, Nujoud, Walid Naffaa, and Fawaz Azmeh. "Initiation and development of Erysiphe necator chasmothecia and their role in the epidemiology of grapevine powdery mildew in southern Syria." Acta Mycologica 51, no. 2 (December 28, 2016). http://dx.doi.org/10.5586/am.1088.
Full textAbstract:
Powdery mildew caused by <em>Erysiphe necator</em> is the most important fungal disease of grapevine in southern Syria. The purpose of this study was to determine the development of chasmothecia and their role as a primary inoculum in spring. Leaves and/or branches were examined by a stereo binocular from July to December 2014 and 2015. The number of chasmothecia was estimated on both surfaces of the leaves, and their viability was estimated by microscopic examination. During 2 years of survey chasmothecia were detected in 45.5% of vineyards. The initial development of chasmothecia on infected leaves was observed in the second half of July. Their numbers increased from July to October, and the sudden reduction at the beginning of November was noted. Chasmothecia were formed on 38.7% of infected leaves, with 12.5%, 18.4%, and 7.5% on the upper, under and on both surfaces of infected leaves respectively. Chasmothecia were more frequent on the leaf under side (0.6 / leaf) than on the leaf upper side (0.4 / leaf), but their occurrence on both sides together was relatively low (0.2 / leaf), and their numbers were highly variable between vineyards and years. Microscopic examination showed that chasmothecia contained 1–5 (usually three) asci with 1–4 (usually three) ascospores in each asci, and 65.6% of chasmothecia were empty. Their viability decreased between December and February, with an average viability of 1.2% and 0.2% in March and April, respectively. Chasmothecia were not detected on bark and ascospores were not trapped at the beginning of the season. These results indicate that the ascospores have no or little role in the initiation of spring infection. To the best of our knowledge, this is the first report of <em>E. necator</em> chasmothecia development and their role in the initiating infection on grapevine in Syria.
32
Sugui, Janyce A., Liliana Losada, Wei Wang, John Varga, Popchai Ngamskulrungroj, Mones Abu-Asab, Yun C. Chang, et al. "Identification and Characterization of an Aspergillus fumigatus “Supermater” Pair." mBio 2, no. 6 (November 22, 2011). http://dx.doi.org/10.1128/mbio.00234-11.
Full textAbstract:
ABSTRACTThe mating efficiency of 50Aspergillus fumigatusisolates from both clinical and environmental sources was analyzed. Forty isolates completed the sexual cycle in 4 weeks with variable levels of fertility designated high, medium, or low. Two opposite-mating-type strains exhibiting the highest fertility, AFB62 (MAT1-1), isolated from a case of invasive aspergillosis, and AFIR928 (MAT1-2), isolated from the environment, were chosen as the supermater pair. Single cleistothecia obtained from a cross of the two strains harbored a minimum of 1 × 104ascospores. The viability of ascospores increased with the age of the fruiting body, 17% at 4 weeks and reaching 95% at 20 weeks. AFB62 and AFIR928 were equally virulent in two different murine models, despite differences in their sources. High recombination frequencies were observed when the closely linked genesalb1(AFUA_2G17600) andabr2(AFUA_2G17530) were used as genetic markers. Comparative genome hybridization analyses revealed that only 86 genes (ca. 0.86% of the genome) are significantly diverged between AFB62 and AFIR928. The high fertility in a relatively short period, combined with a high degree of virulence and a high recombination frequency, demonstrates that the mating pair AFB62 and AFIR928 provides an excellent tool for genetic studies ofA. fumigatus.IMPORTANCEAspergillus fumigatusis a heterothallic fungal pathogen that causes life-threatening infections in immunocompromised hosts. Although heterothallism facilitates genetic study via recombinational analysis, previous work showed that a 6-month incubation period is required for the completion of sexual reproduction in this species. Such a long incubation period impedes progress in genetic research. To discover a highly fertile (supermater) pair that can complete the sexual cycle in a considerably shorter period, we screened 50 strains collected from various geographic regions for mating efficiency. We identified a highly virulent pair of supermaters that can be an invaluable tool for genetic study.