Log in

Relevant bibliographies by topics / Washington (N.H.) / Journal articles

To see the other types of publications on this topic, follow the link: Washington (N.H.).

Journal articles on the topic 'Washington (N.H.)'

Author: Grafiati

Published: 29 July 2024

Last updated: 31 July 2025

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic 'Washington (N.H.).'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Beutel, Marc W., Lanka DeSilva, and Louis Amegbletor. "Direct Measurement of Mercury Deposition at Rural and Suburban Sites in Washington State, USA." Atmosphere 12, no. 1 (2020): 35. http://dx.doi.org/10.3390/atmos12010035.

Full text

Abstract:

Because of mercury’s (Hg) capacity for long-range transport in the atmosphere, and its tendency to bioaccumulate in aquatic biota, there is a critical need to measure spatial and temporal patterns of Hg atmospheric deposition. Dry deposition of Hg is commonly calculated as the product of a measured atmospheric concentration and an assumed deposition velocity. An alternative is to directly assess Hg deposition via accumulation on surrogate surfaces. Using a direct measurement approach, this study quantified Hg deposition at a rural site (Pullman) and suburban site (Puyallup) in Washington State

APA, Harvard, Vancouver, ISO, and other styles

2

Molinari, Mark P., Carla R. Woodworth, Cody R. Gibson, and Michelle Deng. "Empirical Analysis of Landslide Runout in Late Pleistocene Glacial Strata in the Eastern Salish Lowland, Washington." Environmental & Engineering Geoscience 31, no. 1 (2025): 51–65. https://doi.org/10.21663/eeg-d-24-00046.

Full text

Abstract:

ABSTRACT Empirical relationships were developed to estimate potential landslide runout length and deposit area for slopes in the eastern Salish (Puget) Lowland in northwestern Washington. Published empirical equations use landslide parameters of runout length (L), height (H), reach angle (α), deposit area (A), and volume (V) and linear or log-based regressions. Most data sets include varying landslide types and sizes, geology, and geographic locations, and many are for long-runout debris flows, lahars, and rock avalanches. The Salish Lowland is well suited for a regional study because of the a

APA, Harvard, Vancouver, ISO, and other styles

3

Nitis, Chandra Saha, Seal Alpana, J. Butcher Ray, and Saha Nityananda. "Synthesis and spectroscopic identification of cobalt(III) complexes with 5-methyl-3-formylpyrazole-N( 4)-dipropylthiosemicarbazone (HMPzNPr2) : X-ray crystal structure of [Co(MPzNPr2h]N03.H20." Journal of Indian Chemistry Society Vol. 78, October-December 200 I (2001): 601–5. https://doi.org/10.5281/zenodo.5892034.

Full text

Abstract:

Department of Chemistry University of Calcutta, 92, A. P. C. Road, Kolkata-700 009, India l.U.C., Kolkata-700 098, India Department of Chemistry, Howard University, 2400 Sixth Street N. W., Washington, DC 20059, U.S.A. <em>Manuscript received 7 January 2001</em> The coordination mode of the title ligand, IIMIzNPr<sub>2</sub> (synthesized for the first time and characterized by elemental analysis, mass, IR and <sup>1</sup>H NMR spectral parameters), is reported by solid state isolation and physicochemical identification of cobalt(III) complexes, [CoMPzNPr<sub>2</sub>)<sub>2</sub> ] X.II<su

APA, Harvard, Vancouver, ISO, and other styles

4

Gibson, Glenys D., and Fu-Shiang Chia. "Description of a new species of Haminoea, Haminoea callidegenita (Mollusca: Opisthobranchia), with a comparison with two other Haminoea species found in the northeast Pacific." Canadian Journal of Zoology 67, no. 4 (1989): 914–22. http://dx.doi.org/10.1139/z89-133.

Full text

Abstract:

A new species of Haminoea (Opisthobranchia: Cephalaspidea), Haminoea callidegenita, is described from Washington State, U.S.A. Diagnostic features are reddish brown colour, deeply bifurcate cephalic shield, reddish ovate shell with imperforate apex, tubular Hancock's organ, unarmed penis, unilobular prostate, and radula formula n.l.l.l.n (n from 12 to 21), with bicuspid first lateral uncini. The development of H. callidegenita is unusual among the Opisthobranchia in that the hatching stage includes both lecithotrophic veligers and juveniles from each egg mass. Diagnostic features were examined

APA, Harvard, Vancouver, ISO, and other styles

5

Kim, Sangmi, Eun-Ok Im, Jianghong Liu, and Connie Ulrich. "Maternal Age Patterns of Preterm Birth: Exploring the Moderating Roles of Chronic Stress and Race/Ethnicity." Annals of Behavioral Medicine 54, no. 9 (2020): 653–64. http://dx.doi.org/10.1093/abm/kaaa008.

Full text

Abstract:

Abstract Background Despite the suggested contribution of cumulative chronic stress to the racial/ethnic disparities in preterm birth (PTB), it is unclear how chronic stress, maternal age, and race/ethnicity are linked underlying PTB. Purpose We investigated the moderating effect of chronic stress on the maternal age–PTB association among non-Hispanic (N-H) White, N-H Black, Hispanic, and Asian women. Methods We analyzed the Washington State’s Pregnancy Risk Assessment Monitoring System data linked with birth certificates. The sample included women aged 18 years or older who birthed the first,

APA, Harvard, Vancouver, ISO, and other styles

6

Kim, Sangmi, Eun-Ok Im, Jianghong Liu, and Connie Ulrich. "Factor Structure for Chronic Stress Before and During Pregnancy by Racial/Ethnic Group." Western Journal of Nursing Research 41, no. 5 (2018): 704–27. http://dx.doi.org/10.1177/0193945918788852.

Full text

Abstract:

This study aimed to explore race/ethnicity-specific dimensionalities of chronic stress before and during pregnancy for non-Hispanic (N-H) White, N-H Black, Hispanic, and Asian women in the United States. This study analyzed the data among 6,850 women from the New York City and Washington State Pregnancy Risk Assessment Monitoring System (2004-2007) linked with birth certificates. Separate exploratory factor analysis was conducted by race/ethnicity using a maximum-likelihood extraction method with 26 chronic stress items before and during pregnancy. Correlations and internal consistency reliabi

APA, Harvard, Vancouver, ISO, and other styles

7

Shelley, Rowland M. "The milliped order Callipodida in western North America (Schizopetalidae: Tynommatinae), and a summary of the New World fauna." Insect Systematics & Evolution 27, no. 1 (1996): 25–64. http://dx.doi.org/10.1163/187631296x00197.

Full text

Abstract:

AbstractIn western North America, the milliped order Callipodida is represented by the Colactidini, Tynommatini stat. n., and Diactidini tribus n., in the subfamily Tynommatinae, family Schizopetalidae; a coordinate tribe, the Texophonini, occurs on the Gulf Coast of south Texas. The Tynommatini consists of two genera and four species: Tynomma mutans (Chamberlin), T. magnum Buckett & Gardner, and T. gardneri sp. n., occurring around Monterey and San Pablo/San Francisco Bays, California, and Idrionaria dineh gen. n. & sp. n., in Washington County, Utah. The Colactidini ranges from Duran

APA, Harvard, Vancouver, ISO, and other styles

8

Hawkins, Melissa, Sarah Irvine Belson, Robin McClave, Lauren Kohls, Sarah Little, and Anastasia Snelling. "Healthy Schoolhouse 2.0 Health Promotion Intervention to Reduce Childhood Obesity in Washington, DC: A Feasibility Study." Nutrients 13, no. 9 (2021): 2935. http://dx.doi.org/10.3390/nu13092935.

Full text

Abstract:

Childhood obesity prevalence trends involve complex societal and environmental factors as well as individual behaviors. The Healthy Schoolhouse 2.0 program seeks to improve nutrition literacy among elementary school students through an equity-focused intervention that supports the health of students, teachers, and the community. This five-year quasi-experimental study follows a baseline–post-test design. Research activities examine the feasibility and effectiveness of a professional development series in the first program year to improve teachers’ self-efficacy and students’ nutrition literacy

APA, Harvard, Vancouver, ISO, and other styles

9

Clark, Harry F. "Zionism lobbies the empires." Journal of Contemporary Iraq & the Arab World 14, no. 3 (2020): 266–86. http://dx.doi.org/10.1386/jciaw_00034_5.

Full text

Abstract:

Review of: A Broken Trust: Sir Herbert Samuel, Zionism and the Palestinians, Sahar Huneidi, foreword by Walid Khalidi (2001)London: I. B. Tauris, 340 pp.,ISBN 978-1-86064-172-5, h/bk, out-of-printThe Palestine Deception, 1915‐1923: The McMahon-Hussein Correspondence, the Balfour Declaration, and the Jewish National Home, J. M. N. Jeffries, edited and with an introduction by William M. Mathew (2014)Washington, DC: Institute for Palestine Studies-USA, 175 pp.,ISBN 978-0-88728-320-8, p/bk, $16.00Palestine. The Reality. The Inside Story of the Balfour Declaration 1917‐1938, J. M. N. Jeffries, with

APA, Harvard, Vancouver, ISO, and other styles

10

Nitis, Chandra Saha, Seal Alpana, J. Butcher Ray, and Saha Nityananda. "Synthesis and spectroscopic identification of cobalt(III) complexes with 5-methyl-3-formylpyrazole-N(4)-dipropylthiosemicarbazone (HMPzNPr2) : X-ray crystal structure of [Co(MPzNPr2)2]NO3.H2O." Journal of Indian Chemical Society Vol. 78, Oct-Dec 2001 (2001): 601–5. https://doi.org/10.5281/zenodo.5910248.

Full text

Abstract:

Department of Chemistry University of Calcutta, 92, A. P. C. Road, Kolkata-700 009, India l.U.C., Kolkata-700 098, India Department of Chemistry, Howard University, 2400 Sixth Street N. W., Washington, DC 20059, U.S.A. <em>Manuscript received 7 January 2001</em> The coordination mode of the title ligand, HMPzNPr<sub>2</sub> (synthesized for the first time and characterized by elemental analysis, mass, IR and <sup>1</sup>H NMR spectral parameters), is reported by solid state isolation and physicochemical identification of cobalt(III) complexes, [Co(MPzNPr<sub>2</sub>)<sub>2</sub>]X.H<sub>2</sub

APA, Harvard, Vancouver, ISO, and other styles

11

Reid, Neill, and Gary Wegner. "H-Alpha Emission in Hot Degenerates and OB Subdwarfs." International Astronomical Union Colloquium 114 (1989): 396–400. http://dx.doi.org/10.1017/s0252921100099954.

Full text

Abstract:

Based on observations obtained using the 60-inch telescope at Palomar Observatory which is jointly owned by the California Institute of Technology and the Carnegie Institution of Washington and on observations obtained with the 200-inch Hale telescope which is owned by the California Institute of Technology.The intial observations of white dwarf stars and their immediate precursors, the hot subdwarfs, suggested that these stars possess the simplest (and, aesthetically, the most pleasing) spectra of any astronomical object. The high gravity leads to the spectrum being dominated, in the most sta

APA, Harvard, Vancouver, ISO, and other styles

12

Crosslin, J. M. "First Report of Potato mop-top virus on Potatoes in Washington State." Plant Disease 95, no. 11 (2011): 1483. http://dx.doi.org/10.1094/pdis-06-11-0536.

Full text

Abstract:

In April of 2011, approximately 10% of the tubers of potato (Solanum tuberosum L.) cv. Alturas, grown in central Washington State and collected from a commercial potato storage facility, were observed to have internal brown spots and arcs typical of infection by either Tobacco rattle virus (TRV) or Potato mop-top virus (PMTV). Ten tubers showing symptoms ranging from a few brown spots to large (2 cm) concentric arcs were tested by reverse transcription (RT)-PCR with primers specific for TRV (3) or PMTV (PMTV2 forward, AGAGCAGCCGTCGAGAATAG; PMTV3 reverse, TCGTCCACCTCTGCGAGTTG). Two symptomless

APA, Harvard, Vancouver, ISO, and other styles

13

Boardman, Pete. "Twenty-one new species of craneflies (Diptera: Tipulidae and Limoniidae), and a new fold-wing cranefly (Diptera: Ptychopteridae) from Mount Kupe, Cameroon, with notes on eighteen other species new to the country from the same location." Entomologist's Monthly Magazine 156, no. 3 (2020): 163–206. http://dx.doi.org/10.31184/m00138908.1563.4042.

Full text

Abstract:

Following the award of a Winston Churchill Memorial Trust (WCMT) Fellowship the author was able to visit the Charles P. Alexander (1889–1981) collection at the Smithsonian Institution, Washington D. C. to study craneflies gifted to him from fieldwork in Cameroon. They were collected by Malaise trap in forest clearings near streams on Mount Kupe, near Nyasoso, Cameroon. 21 new species of cranefly (Diptera: Tipulidae and Limoniidae): Dolichopeza (Dolichopeza) vicki sp. n., Nephrotoma mawdsleyi sp. n., Baeoura nyasosoensis sp. n.,Ellipteroides (Ellipteroides) nigromaculatus sp. n., Hovamyia gelha

APA, Harvard, Vancouver, ISO, and other styles

14

Coblentz, Bruce E. "Invasive Species in the Pacific Northwest P Dee Boersma, Sarah H Reichard, Amy N Van Buren . Editors. 2006. University of Washington Press. Seattle, Washington. Softcover, XXVI +. 285ISBN: 0-295-98596-8. US $29.95." Northwestern Naturalist 89, no. 2 (2008): 119–20. http://dx.doi.org/10.1898/1051-1733(2008)89[119:isitpn]2.0.co;2.

Full text

APA, Harvard, Vancouver, ISO, and other styles

15

Rocha Júnior, Fernando Soares, Vânia Meneghini da Rocha, and Marcelo Macedo. "COMPARTILHAMENTO DE CONHECIMENTO EM UMA PEQUENA EMPRESA DE PRODUTOS ORTOPÉDICOS: ANÁLISE DAS PERCEPÇÕES DOS COLABORADORES." International Journal of Knowledge Engineering and Management 9, no. 25 (2021): 127–43. http://dx.doi.org/10.47916/ijkem-vol9n25-2020-81913.

Full text

Abstract:

O objetivo central deste artigo é tentar compreender por meio da visão dos colaboradores de uma pequena empresa de produtos ortopédicos, as suas principais percepções, relacionadas ao compartilhamento de conhecimento organizacional. O método escolhido para a pesquisa é qualitativo com a tipologia qualitativa básica. Para a análise de resultados, foi utilizada a técnica de análise temática de Braun e Clarke. Os principais resultados encontrados demonstram que o compartilhamento de conhecimento na organização é realizado por intermédio da utilização das tecnologias de comunicações comuns ao públ

APA, Harvard, Vancouver, ISO, and other styles

16

Köhler, W. "N. R. Rose and H. Friedman (Editors), Manual of Clinical Immunology. 932 S., 192 Abb., 151 Tab. Washington 1976: American Society for Microbiology. $ 20.00." Zeitschrift für allgemeine Mikrobiologie 17, no. 7 (2007): 578. http://dx.doi.org/10.1002/jobm.19770170720.

Full text

APA, Harvard, Vancouver, ISO, and other styles

17

C.B.Tiwary1, S. Pandey2 V., and Ali3 Fajle. "Effect of pH on growth performance and survival rate of grass Carp." Biolife 1, no. 4 (2022): 172–75. https://doi.org/10.5281/zenodo.7193126.

Full text

Abstract:

  <strong>ABSTRACT</strong> Grass Carp fingerlings averaging 19.0 ±1.0 g in weight were stocked for 60 days at different P<sup>H</sup> levels. The experimented Carp were fed with diet containing 26.58% crude protein. The total water was changed twice daily. Growth and survival of common carp was recorded at 15 days interval. Results showed that growth performance was significantly decreased at P<sup>H </sup>6 and 9, while the difference between P<sup>H </sup>7 and 8 were not significant (P>= 0.05). No mortality occurred during the experiment. Feed conversion ratio (FCR) increase

APA, Harvard, Vancouver, ISO, and other styles

18

Pozdeyev, Nikita, Arpit Patel, Paul S. Pottinger, Michael Leu, and Thomas H. Payne. "Adherence to Recommended Post-Splenectomy Immunizations to Reduce the Risk of Sepsis: The University of Washington Experience." American Journal of Medical Quality 35, no. 5 (2020): 405–10. http://dx.doi.org/10.1177/1062860619897289.

Full text

Abstract:

Immunizations against Streptococcus pneumoniae, Neisseria meningitidis, and Haemophilus influenzae type b are recommended for patients undergoing splenectomy to decrease the risk of developing overwhelming infections. The authors sought to determine adherence to these recommendations by providers at UW Medicine. Regional immunization records for patients who underwent splenectomy between October 2015 and January 2019 were analyzed to measure compliance with immunization guidelines from the US Centers for Disease Control and Prevention (CDC). Among 253 patients who underwent splenectomy, 38 (15

APA, Harvard, Vancouver, ISO, and other styles

19

Chen, Allen M., Carol Felix, and Sophia Hsu. "Patient- versus physician-reported toxicities among survivors of head and neck cancer after chemoradiation: Prospective evaluation of screening methodologies." Journal of Clinical Oncology 34, no. 3_suppl (2016): 150. http://dx.doi.org/10.1200/jco.2016.34.3_suppl.150.

Full text

Abstract:

150 Background: This study sought to compare the incidence of late toxicities among survivors of head and neck cancer treated by definitive chemoradiation using patient-reported versus physician-reported methodologies. Methods: Two validated quality of life instruments, the University of Washington Quality of Life questionnaire (UW-QOL) and the Functional Assessment of Cancer Therapy for Head and Neck questionnaire (FACT-H&N) were administered to patients returning for follow-up after chemoradiation for head and neck cancer. Only patients who had been clinically without evidence of disease

APA, Harvard, Vancouver, ISO, and other styles

20

Jungerman, Ivy, Julia Toyota, Neyller Patriota Montoni, et al. "Patient Concerns Inventory for head and neck cancer: Brazilian cultural adaptation." Revista da Associação Médica Brasileira 63, no. 4 (2017): 311–19. http://dx.doi.org/10.1590/1806-9282.63.04.311.

Full text

Abstract:

Summary Objective: The purpose of this study was to translate, culturally validate and evaluate the Patients Concerns Inventory - Head and Neck (PCI-H&N) in a consecutive series of Brazilian patients. Method: This study included adult patients treated for upper aerodigestive tract (UADT) cancer. The translation and cultural adaptation of the PCI-H&N followed internationally accepted guidelines and included a pretest sample of patients that completed the first Brazilian Portuguese version of the PCI. Use, feasibility and acceptability of the PCI were tested subsequently in a consecutive

APA, Harvard, Vancouver, ISO, and other styles

21

Lavigne, Marie. "RICHARDSON, Richard W. Jonas H. HARALZ. Moving to the Market : The World Bank in Transition. Washington, DC, Overseas Development Council, Policy Essay n°17, 1995, 106p." Études internationales 27, no. 2 (1996): 446. http://dx.doi.org/10.7202/703613ar.

Full text

APA, Harvard, Vancouver, ISO, and other styles

22

Greybush, Steven J., Sue Ellen Haupt, and George S. Young. "The Regime Dependence of Optimally Weighted Ensemble Model Consensus Forecasts of Surface Temperature." Weather and Forecasting 23, no. 6 (2008): 1146–61. http://dx.doi.org/10.1175/2008waf2007078.1.

Full text

Abstract:

Abstract Previous methods for creating consensus forecasts weight individual ensemble members based upon their relative performance over the previous N days, implicitly making a short-term persistence assumption about the underlying flow regime. A postprocessing scheme in which model performance is linked to underlying weather regimes could improve the skill of deterministic ensemble model consensus forecasts. Here, principal component analysis of several synoptic- and mesoscale fields from the North American Regional Reanalysis dataset provides an objective means for characterizing atmospheri

APA, Harvard, Vancouver, ISO, and other styles

23

Alzeer, Abdulaziz, Abdullah Al Arifi, Mohsen El-Hazmi, Arjumand S. Warsy, and Eric S. Nylen. "Thermal regulatory dysfunction of growth hormone in classical heat stroke?" European Journal of Endocrinology 134, no. 6 (1996): 727–30. http://dx.doi.org/10.1530/eje.0.1340727.

Full text

Abstract:

Alzeer A, Al Arifi A, El-Hazmi M, Warsy AS, Nylen ES. Thermal regulatory dysfunction of growth hormone in classical heat stroke? Eur J Endocrinol 1996;134:727–30. ISSN 0804–4643 Growth hormone (GH) secretion associated with classical (non-exertional) heat stroke (HS) was evaluated in 26 HS victims and 10 control (non heat-exhausted) subjects during the annual Hajj in Makkah, Saudi Arabia. On admission to the HS treatment unit, the GH level was 1.54 ± 0.14 ng/ml (approximately 3.5-fold higher in the HS victims compared to controls; p = 0.005). The GH levels subsequently declined by 78% by 24 h.

APA, Harvard, Vancouver, ISO, and other styles

24

Cramer, C. S., S. Bag, H. F. Schwartz, and H. R. Pappu. "Susceptibility of Onion Relatives (Allium spp.) to Iris yellow spot virus." Plant Disease 95, no. 10 (2011): 1319. http://dx.doi.org/10.1094/pdis-11-10-0819.

Full text

Abstract:

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) is becoming an increasingly important constraint to the production of bulb and seed onions (Allium cepa L.) in many onion-growing regions of the continental United States and the world (4). During an evaluation of onion germplasm for susceptibility to IYSV, six other Allium species (A. altaicum, A. galanthum, A. roylei, A. schoenoprasum, A. tuberosum, and A. vavilovii) were also evaluated under natural field conditions. In July 2010, symptoms suggestive of IYSV infection (straw-colored necrotic lesions) were observed on leave

APA, Harvard, Vancouver, ISO, and other styles

25

Echelmeyer, Keith A., Barclay Kamb, and Barclay Kamb. "Stress-Gradient Coupling in Glacier Flow: II. Longitudinal Averaging in the Flow Response to Small Perturbations in Ice Thickness and Surface Slope." Journal of Glaciology 32, no. 111 (1986): 285–98. http://dx.doi.org/10.3189/s0022143000015616.

Full text

Abstract:

AbstractAs a result of the coupling effects of longitudinal stress gradients, the perturbations ∆u in glacier-flow velocity that result from longitudinally varying perturbations in ice thickness ∆h and surface slope ∆α are determined by a weighted longitudinal average of ϕh∆h and ϕα∆α, where ϕh and ϕα are “influence coefficients” that control the size of the contributions made by local ∆h and ∆α to the flow increment in the longitudinal average. The values of ϕh and ϕα depend on effects of longitudinal stress and velocity gradients in the unperturbed datum state. If the datum state is an incli

APA, Harvard, Vancouver, ISO, and other styles

26

Morriss, Matthew C., Leif Karlstrom, Morgan W. M. Nasholds, and John A. Wolff. "The Chief Joseph dike swarm of the Columbia River flood basalts, and the legacy data set of William H. Taubeneck." Geosphere 16, no. 4 (2020): 1082–106. http://dx.doi.org/10.1130/ges02173.1.

Full text

Abstract:

Abstract The Miocene Columbia River Basalt Group (CRBG) is the youngest and best studied continental flood basalt province on Earth. The 210,000 km3 of basaltic lava flows in this province were fed by a series of dike swarms, the largest of which is the Chief Joseph dike swarm (CJDS) exposed in northeastern Oregon and southwestern Washington. We present and augment an extensive data set of field observations, collected by Dr. William H. Taubeneck (1923–2016; Oregon State University, 1955–1983); this data set elucidates the structure of the CJDS in new detail. The large-scale structure of the C

APA, Harvard, Vancouver, ISO, and other styles

27

Gelles, Richard J. "Reason to Hope: A Psychosocial Perspective On Violence and Youth, edited by Leonard D. Eron, Jacqueline H. Gentry, and Peggy Schlegel. Washington DC, American Psychological Association." Aggressive Behavior 22, no. 4 (1996): 311–13. http://dx.doi.org/10.1002/(sici)1098-2337(1996)22:4<311::aid-ab7>3.0.co;2-n.

Full text

APA, Harvard, Vancouver, ISO, and other styles

28

Rashidi, Armin, Kiran R. Vij, Richard S. Buller, Kristine M. Wylie, Gregory A. Storch, and John F. DiPersio. "The Value of Tissue Polymerase Chain Reaction Testing for the Diagnosis of Tissue-Invasive Cytomegalovirus Disease Following Allogeneic Hematopoietic Cell Transplantation." Blood 128, no. 22 (2016): 3420. http://dx.doi.org/10.1182/blood.v128.22.3420.3420.

Full text

Abstract:

Abstract Background: CMV disease is a major complication of allogeneic hematopoietic cell transplantation (HCT). Our widely used diagnostic modalities (H&E-based morphology and CMV IHC) are suboptimal in accuracy and frequently equivocal. Furthermore, current therapies for CMV disease are toxic and can cause serious complications such as prolonged neutropenia or progressive renal insufficiency. As a result, more accurate diagnosis that would help avoid potentially toxic treatments in patients who are truly negative for disease is highly desirable. The purpose of this study was to evaluate

APA, Harvard, Vancouver, ISO, and other styles

29

Hakkı, ÇİFTÇİ, and Salih Oglakkaya Mehmet. "ABD ENDÜSTRİYEL ÜRETİMİ VE ÇİN TİCARET DENGESİ ARASINDA ENGLE GRENGER EŞBÜTÜNLEŞME VE GRENGER NEDENSELLİK ANALİZİ." Socrates Journal of Interdisciplinary Social Studies 9, no. 31 (2023): 188–200. https://doi.org/10.5281/zenodo.8341034.

Full text

Abstract:

Washington ve Pekin arasında ticaret, insan hakları, pazar ve teknoloji rekabeti gibi konulardaki anlaşmazlıklardan kaynaklanan ve giderek büyüyen çatlak, ülkeler arasında güçlenen ticari bağlar için bir tehdit oluşturup hükümetleri çeşitli ekonomik ve siyasi sorunlar konusunda anlaşmazlığa düşse de, ABD ve Çin'in ürün ticareti 2022'de yeni bir seviyeye çıkarak dünyanın en büyük iki ekonomisindeki tüketicilerin ve işletmelerin ne kadar yakından bağlı olduğunu hatırlattı. 2022 yılı

APA, Harvard, Vancouver, ISO, and other styles

30

Mock, Amy. "Book Review : Teaching About Job Hazards: A Guide for Workers and Their Health Providers, N. Wallerstein and H. Rubinstein, American Public Health Association, Washington, D.C., 1993, 170 pp." Health Education Quarterly 21, no. 1 (1994): 127–29. http://dx.doi.org/10.1177/109019819402100112.

Full text

APA, Harvard, Vancouver, ISO, and other styles

31

Rawlings, Meredith. "Nobody’s Perfect Living and Growing with Children who have Special Needs. N. Miller (1994). Baltimore, Washington, D.C.: Paul H Brookes Publishers Australian Distributors: Maclennan and Petty Price: $49.00." Australasian Journal of Special Education 19, no. 1 (1995): 65. http://dx.doi.org/10.1017/s1030011200023344.

Full text

APA, Harvard, Vancouver, ISO, and other styles

32

Dung, J. K. S., L. M. Carris, and P. B. Hamm. "First Report of Ustilago cynodontis Causing Smut of Cynodon dactylon in Washington State, United States." Plant Disease 98, no. 2 (2014): 280. http://dx.doi.org/10.1094/pdis-05-13-0560-pdn.

Full text

Abstract:

Bermudagrass (Cynodon dactylon) is an important warm-season perennial turf and forage grass that is typically grown in warm, tropical and subtropical climates. Smutted inflorescences of bermudagrass were observed and collected in Benton County, Washington, United States, in October of 2012 in an unmanaged, naturalized area located near the banks of the Columbia River and adjacent to large expanses of managed turf containing bermudagrass. The climate in this area is favorable to bermudagrass due to the relatively mild winters and hot, dry summers that usually occur in this region. The infected

APA, Harvard, Vancouver, ISO, and other styles

33

Smiley, R. W., G. P. Yan, and Z. A. Handoo. "First Record of the Cyst Nematode Heterodera filipjevi on Wheat in Oregon." Plant Disease 92, no. 7 (2008): 1136. http://dx.doi.org/10.1094/pdis-92-7-1136b.

Full text

Abstract:

Plant and soil samples from an irrigated winter wheat (Triticum aestivum) field near Imbler (Union County), OR were evaluated for root diseases during April 2007. The field exhibited patches with as much as 90% plant mortality. Previous crops were winter wheat (2004), chickpea (Cicer arietinum, 2005), and spring wheat (cv. Jefferson, 2006). Stubble was baled and removed, and the field was cultivated before replanting to winter wheat cv. Chukar in October. Patches of stunted seedlings (three- to five-leaf stage) appeared in March 2007. Stunted seedlings exhibited chlorotic or necrotic lower lea

APA, Harvard, Vancouver, ISO, and other styles

34

Goodyear, Albert C. "Lindenmeier, 1934—1974: Concluding Report on Investigations. Edwin N. Wilmsen and Frank H. H. RobertsJr. , Smithsonian Contributions to Anthropology, No. 24, Smithsonian Institution Press, Washington, D.C., 1984. xvi + 187 pp., figures, maps, tables, appendix, literature cited. $27.50 (paper)." American Antiquity 51, no. 1 (1986): 205. http://dx.doi.org/10.2307/280434.

Full text

APA, Harvard, Vancouver, ISO, and other styles

35

Dung, J. K. S., D. A. Johnson, and B. K. Schroeder. "First Report of Pectobacterium wasabiae Causing Aerial Stem Rot of Potato in Washington State." Plant Disease 96, no. 12 (2012): 1819. http://dx.doi.org/10.1094/pdis-05-12-0444-pdn.

Full text

Abstract:

Aerial stem rot of potato (Solanum tuberosum), also known as bacterial stem rot, is often caused by the pectolytic bacteria Pectobacterium (Erwinia) carotovorum subsp. carotovorum, P. atrosepticum, or Dickeya spp. (3). A survey was carried out in August 2008 in ‘Russet Burbank’ potato fields exhibiting aerial stem rot symptoms in the Columbia Basin of Washington State. One bacterial strain isolated during the survey, PwO405, exhibited pectolytic ability on crystal violet pectate (CVP) agar and potato slices and failed to grow at 37°C, but physiological tests did not conclusively distinguish th

APA, Harvard, Vancouver, ISO, and other styles

36

Finlay, M., M. Wilson, J. A. Erwin, et al. "0730 Individuals Receiving Methadone For Medication-Assisted Treatment Of Opioid Use Disorder Show Evidence Of Respiratory Depression." Sleep 43, Supplement_1 (2020): A278. http://dx.doi.org/10.1093/sleep/zsaa056.726.

Full text

Abstract:

Abstract Introduction A well-established consequence of opiate use is respiratory depression during sleep, with a high prevalence of central sleep apneas. Medication-assisted treatment (MAT) is a widely used therapy for opioid use disorder (OUD) designed to reduce withdrawal symptoms and drug cravings. We investigated the presence of respiratory depression during sleep in patients receiving methadone-based opioid replacement treatment as part of a MAT program for OUD. Methods N=6 individuals (5 females, ages 43.8±12.8y, BMI 27.2±4.1kg/m2), who were within 90 days of methadone initiation, under

APA, Harvard, Vancouver, ISO, and other styles

37

D., L. Bharamal, and D. S. Korgaonkar. "STUDY OF PHYSICO-CHEMICAL STATUS OF DHAMAPUR LAKE IN MALVAN TALUKA, DISTRICT SINDHUDURG, MAHARASHTRA." Biolife 2, no. 4 (2022): 1274–78. https://doi.org/10.5281/zenodo.7238569.

Full text

Abstract:

<strong>ABSTRACT</strong> Dhamapur Lake is a man-made lake constructed by the King Nagesh Desai in 1530. It is one of the biggest lakes of the Sindhudurg district. The lake covers an area of about 22 hectares with depth of about 12 meters. The lake receives water during rainy season and remains full throughout the year. The water is utilized for drinking, irrigation and to some extend fishing is also carried out by local people. Maharashtra Tourism Development Cooperation (M.T.D.C) has developed this lake as a tourism spot. The studywas undertaken to check the physico-chemical status of Dhamap

APA, Harvard, Vancouver, ISO, and other styles

38

Ch., Shivakanth, and Rao Manohar. "Elemental Analysis of Tridax procumbens shoot extract and its significance." Biolife 3, no. 4 (2022): 811–13. https://doi.org/10.5281/zenodo.7306485.

Full text

Abstract:

  <strong>ABSTRACT</strong> <em>Tridax procumbens</em> is known to be used since ages for the treatment of several diseases as described in the texts of ancient Indian Medicine. It is a semi prostate annual herb whose leaves are used for the treatment of bronchial catarrh, dysentery, diarrhoea and to prevent hairfall. Its flowers and leaves possess antiseptic, insecticidal, parasiticidal properties and are also used to check haemorrhage from cuts, bruises and wounds. The present study explores the metal composition of Tridax procumbens shoot extract for the selected metals. <strong>Keywor

APA, Harvard, Vancouver, ISO, and other styles

39

Alpert, Peter. "Invasive Species in the Pacific Northwest. Edited by P D Boersma, , S H Reichard, and , A N Van Buren; photographs edited by Rebecca L Gamboa. Seattle (Washington): University of Washington Press. $29.95 (paper). xxvi + 285 p; ill.; no index. ISBN: 0‐295‐98596‐8. 2006." Quarterly Review of Biology 82, no. 3 (2007): 302–3. http://dx.doi.org/10.1086/523200.

Full text

APA, Harvard, Vancouver, ISO, and other styles

40

Repasky, Kevin S., John A. Reagan, Amin R. Nehrir, et al. "Observational Studies of Atmospheric Aerosols over Bozeman, Montana, Using a Two-Color Lidar, a Water Vapor DIAL, a Solar Radiometer, and a Ground-Based Nephelometer over a 24-h Period." Journal of Atmospheric and Oceanic Technology 28, no. 3 (2011): 320–36. http://dx.doi.org/10.1175/2010jtecha1463.1.

Full text

Abstract:

Abstract Coordinated observational data of atmospheric aerosols were collected over a 24-h period between 2300 mountain daylight time (MDT) on 27 August 2009 and 2300 MDT on 28 August 2009 at Bozeman, Montana (45.66°N, 111.04°W, elevation 1530 m) using a collocated two-color lidar, a diode-laser-based water vapor differential absorption lidar (DIAL), a solar radiometer, and a ground-based nephelometer. The optical properties and spatial distribution of the atmospheric aerosols were inferred from the observational data collected using the collocated instruments as part of a closure experiment u

APA, Harvard, Vancouver, ISO, and other styles

41

Shahzad, Moazzam, Muhammad Arslan, Zehra Naseem, et al. "Top 100 Cited Articles on Hematopoietic Stem Cell Transplantation: A Bibliometric Analysis." Blood 138, Supplement 1 (2021): 4790. http://dx.doi.org/10.1182/blood-2021-145500.

Full text

Abstract:

Abstract Background: Research performance is evaluated by bibliometric analysis of citations, and this can help to identify the most impactful articles in the field of hematopoietic stem cell transplantation (HSCT). We conducted a bibliometric analysis to identify scholarly impact and factors associated with the top 100 cited articles on HSCT. Methods: Thomas Reuters Web of Science core collection (WoS) was accessed in January 2021 and a title-specific search was conducted using the keywords "hematopoietic stem-cell transplantation ", "transplantation, hematopoietic stem cell," "stem cell tran

APA, Harvard, Vancouver, ISO, and other styles

42

D., L. Bharamal, and D. S. Korgaonkar. "Temperature variation and its influence on pH, dissolved oxygen (DO) and free carbondioxide (CO2) of Nissan pond at Vengurla, Sindhudurg District, (MS)." Biolife 3, no. 1 (2022): 243–48. https://doi.org/10.5281/zenodo.7260831.

Full text

Abstract:

<strong>ABSTRACT</strong> Temperature is an important factor that affects the chemical and biological reactions in water. Temperature regulates self-purification capacity of water (Shaikh and Yeragi, 2003)<strong>.</strong>A rise in water temperature accelerates chemical reactions which in turn reduces solubility of gases and also elevates metabolism of aquatic organisms, leading to decrease in dissolved oxygen and increase in free carbon dioxide. The present study was carried out on Nissan Pond in Vengurla taluka of Sindhudurg district in Maharashtra. In this study effect of varying temperatu

APA, Harvard, Vancouver, ISO, and other styles

43

Yunita Murdiyaningrum and Novrian Satria Perdana. "Operational Cost Requirements Analysis in Early Childhood Education." JPUD - Jurnal Pendidikan Usia Dini 14, no. 1 (2020): 58–70. http://dx.doi.org/10.21009/jpud.141.05.

Full text

Abstract:

   The government is attempting to obtain the access of Early Childhood Education pro- grams providing educational assistance. Unfortunately, the government has spent funds to calculate the unit costs that should not occur in the real world of education. In consequence, the aims of this study are to (1) calculate the amount of operational unit costs for Early Childhood Education pro- grams, and (2) enumerate variations and projections of the amount of the operational unit costs in Early Childhood Education programs by region category. This study uses quantitative data with po

APA, Harvard, Vancouver, ISO, and other styles

44

Mathiasen, R. L., J. R. Allison, and B. W. Geils. "Western Dwarf Mistletoe Parasitizing Colorado Blue Spruce and Norway Spruce in California." Plant Disease 82, no. 3 (1998): 351. http://dx.doi.org/10.1094/pdis.1998.82.3.351e.

Full text

Abstract:

Western dwarf mistletoe (Arceuthobium campylopodum Engelm.), a common parasite of ponderosa pine (Pinus ponderosa Dougl. ex Laws.) and Jeffrey pine (Pinus jeffreyi Grev. & Balf.), was found parasitizing planted Colorado blue spruce (Picea pungens Engelm.) and Norway spruce (Picea abies (L.) H. Karsten) in Upper Cuddy Valley, CA (Kern County, T. 9 N., R. 21 W., Sec. 25). One tree greater than 6 m in height of each spruce species was infected and both trees were within 12 m of a Jeffrey pine severely infected with western dwarf mistletoe. Five to 10 branches were infected on each tree and a

APA, Harvard, Vancouver, ISO, and other styles

45

Powell, M., B. Gundersen, C. Miles, K. Coats, and D. A. Inglis. "First Report of Verticillium Wilt on Lettuce (Lactuca sativa) in Washington Caused by Verticillium tricorpus." Plant Disease 97, no. 7 (2013): 996. http://dx.doi.org/10.1094/pdis-12-12-1166-pdn.

Full text

Abstract:

Symptoms of Verticillium wilt were observed on lettuce (Lactuca sativa L.) harvested from high tunnel and open field experimental plots in annual, consecutive spring plantings in western Washington from 2010 to 2012. Leaves had v-shaped, chlorotic lesions, and yellow or brown vascular tissue was noted in the crowns. Total disease incidence increased from 0.2% in 2010 to 1.9% in 2011 and to 14.4% in 2012. Verticillium spp. obtained from infected crown tissues and cultured on half-strength potato dextrose agar medium produced yellow pigment, black microsclerotia, white mycelia, tan chlamydospore

APA, Harvard, Vancouver, ISO, and other styles

46

Mabe, Nathaniel W., Min Huang, Daniel A. Schaefer, et al. "Abstract PR003: Lineage plasticity dictates responsiveness to anti-GD2 therapy in neuroblastoma." Cancer Research 82, no. 23_Supplement_2 (2022): PR003. http://dx.doi.org/10.1158/1538-7445.cancepi22-pr003.

Full text

Abstract:

Abstract Epigenetic dysregulation is frequently observed in the disease pathology of pediatric cancers, including neuroblastoma, the most common extracranial solid tumor in pediatric patients. Neuroblastoma tumors co-opt developmentally linked adrenergic or mesenchymal super-enhancer landscapes that rewire their transcriptional programs. Here, we describe that the lineage commitment to a mesenchymal epigenetic state is an important mechanism of resistance to anti-GD2 therapy through loss of GD2 antigen, a ganglioside glycolipid expressed on the cell surface. Low GD2 expression was significantl

APA, Harvard, Vancouver, ISO, and other styles

47

Täufel, A. "Enzymatic Degradation of Insoluble Carbohydrates. ACS Symposium Series 618. Edited by J. N. Saddler and M. H. Penner. IX and 374 pages, numerous figures and tables. American Chemical Society, Washington, DC, 1995. Price 91.95 $." Food / Nahrung 41, no. 4 (1997): 246. http://dx.doi.org/10.1002/food.19970410419.

Full text

APA, Harvard, Vancouver, ISO, and other styles

48

Sudhakar, N., D. Nagendra-Prasad, N. Mohan, and K. Murugesan. "First Report of Cucumber mosaic virus Subgroup II Infecting Lycopersicon esculentum in India." Plant Disease 90, no. 11 (2006): 1457. http://dx.doi.org/10.1094/pd-90-1457b.

Full text

Abstract:

During a survey in January 2006 near Salem in Tamil Nadu (south India), Cucumber mosaic virus was observed infecting tomatoes with an incidence of more than 70%. Plants exhibiting severe mosaic, leaf puckering, and stunted growth were collected, and the virus was identified using diagnostic hosts, evaluation of physical properties of the virus, compound enzyme-linked immunosorbent assay (ELISA) (ELISA Lab, Washington State University, Prosser), reverse-transcription polymerase chain reaction (RT-PCR), and restriction fragment length polymorphism analysis (DSMZ, S. Winter, Germany). To determin

APA, Harvard, Vancouver, ISO, and other styles

49

Sabelli, C., P. Orlandi, and G. Vezzalini. "Coquandite, Sb6O8(SO4).H2O, a new mineral from Pereta, Tuscany, Italy, and two other localities." Mineralogical Magazine 56, no. 385 (1992): 599–603. http://dx.doi.org/10.1180/minmag.1992.056.385.16.

Full text

Abstract:

AbstractCoaquandite, a new antimony oxy-sulphate hydrate, occurs as spheroidal knobs of silky fibres or, rarely, as tiny transparent colourless lamellar crystals on stibnite at the Pereta mine, Tuscany, Italy; it is associated with klebelsbergite, peretaite, valentinite, sulfur, gypsum, stibiconite, and senarmontite. Coquandite is triclinic P1, with a 11.434(7), b 29.77(4), c 11.314(4) Å, α 91.07(7)°, β 119.24(3)° γ 92.82(1)° . It has a cell volume of 3352(5)Å3 with Z = 12 and a calculated density of 5.78 g cm−3. The crystals, elongated along [001] and flattened on {010}, display polysynthetic

APA, Harvard, Vancouver, ISO, and other styles

50

Kruk, Michael C., Kyle Hilburn, and John J. Marra. "Using Microwave Satellite Data to Assess Changes in Storminess over the Pacific Ocean." Monthly Weather Review 143, no. 8 (2015): 3214–29. http://dx.doi.org/10.1175/mwr-d-14-00280.1.

Full text

Abstract:

Abstract This study analyzes 25 years of Special Sensor Microwave Imager (SSM/I) retrievals of rain rate and wind speed to assess changes in storminess over the open water of the Pacific Ocean. Changes in storminess are characterized by combining trends in both the statistically derived 95th percentile exceedance frequencies of rain rate and wind speed (i.e., extremes). Storminess is computed annually and seasonally, with further partitioning done by phase of the El Niño–Southern Oscillation (ENSO) index and the Pacific decadal oscillation (PDO) index. Overall, rain-rate exceedance frequencies

APA, Harvard, Vancouver, ISO, and other styles

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!