Academic literature on the topic 'Washington State Patrol'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Washington State Patrol.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Journal articles on the topic "Washington State Patrol"
1
Mosher, Clayton, J. Mitch Pickerill, Travis Pratt, and Nicholas Lovrich. "The importance of context in understanding biased policing: state patrol traffic citations in Washington State." Police Practice and Research 9, no. 1 (March 2008): 43–57. http://dx.doi.org/10.1080/15614260801969920.
Full text
2
Mc Adam, T. "Uses Of Microscopy In The Crime Lab." Microscopy and Microanalysis 5, S2 (August 1999): 1350–51. http://dx.doi.org/10.1017/s1431927600020079.
Full textAbstract:
Recent celebrated criminal cases have raised the public's awareness of forensic science. The advent of DNA technology, in particular, has led to a perception of instrumental techniques that lead to a mathematical probability of guilt that approaches certainty. Mostly passed over in press accounts of forensic operations is the use of the microscope in the examination of physical evidence. By the use of an example from an adjudicated criminal case it is hoped that a greater appreciation is gained of the microscope, that in its various forms, is by far the most widely used instrument in a crime laboratory today.A middle-aged woman was reported missing by her son after the Memorial Day weekend in 1997. An examination of her apartment by members of the Washington State Patrol Crime Scene Response Team revealed a small amount of blood on her bedding. This bedding, together with other items, was taken into evidence.
3
Jarugula, S., M. J. Soule, A. Rowhani, and R. A. Naidu. "First Report of Grapevine leafroll-associated virus-9 in Washington State Vineyards." Plant Disease 92, no. 3 (March 2008): 485. http://dx.doi.org/10.1094/pdis-92-3-0485c.
Full textAbstract:
Grapevine leafroll disease (GLD) has been recognized as one of the major constraints to the production of wine grapes in Washington State. At least nine distinct Grapevine leafroll-associated viruses (GLRaV-1 to -9) have been detected in grapevines showing GLD symptoms in grape-growing areas of several countries. Previous studies documented the presence of GLRaV-1, -2, and -3 in Washington State (3). We initiated a program to test grapevine cultivars with GLD symptoms for the occurrence of the other GLRaVs. Leaf samples were collected from individual grapevines of red-berried grapevine cultivars showing typical GLD symptoms and tested by single-tube reverse transcription (RT)-PCR. Of nearly 300 samples from 13 cultivars in 19 vineyards, 14 samples from 5 cultivars (Cabernet Sauvignon, Merlot, Pinot Noir, Mourvedre, and Lagrein) in different vineyards tested positive for GLRaV-9 using primers LR9 F/F (5′-CGG CAT AAG AAA AGA TGG CAC-3′) and LR9 R/R (5′-TCA TTC ACC ACT GCT TGA AC-3′), specific for the HSP-70h gene of GLRaV-9 (1). To confirm the identity of the RT-PCR products, the 393-bp amplicons obtained from each of these five cultivars were cloned individually into the pCR2.1 plasmid (Invitrogen Corp., Carlsbad, CA). Two independent clones per amplicon were sequenced from both orientations. Pairwise comparisons of these sequences (GenBank Accession Nos. EF101737, EF101738, EF101739, EF101740, and EU252530) with corresponding sequences of other GLRaVs in GenBank showed 94 to 100 and 96 to 100% identity at the nucleotide and amino acid level, respectively, with the sequence of HSP-70h gene of GLRaV-9 (GenBank Accession No. AY297819). Antiserum specific to GLRaV-9 was not accessible, therefore, an additional 540-nucleotide fragment specific to the coat protein (CP) gene of GLRaV-9 was amplified from cv. Lagrein using primers LR9-CP-F (5′ TAC CGT CGA CAC TTT CGA AGC ACT 3′) and LR9-CP-R (5′ TGA GGC GTC GTA ACC GAA CAA TCT 3′). PCR amplified fragments were cloned and sequenced. A comparison of this sequence (GenBank Accession No. EU251512) with corresponding nucleotide sequences of other GLRaVs in GenBank showed 96% identity with CP of GLRaV-9 (GenBank Accession No. AY297819), further confirming the presence of GLRaV-9. Previously, GLRaV-9 was reported in grapevines in California (1), Tunisia (2), and Western Australia (4). To our knowledge, our results are the first evidence for the occurrence of GLRaV-9 in Washington State vineyards. Results from our study and previous reports (1,2,4) indicate the wide distribution of GLRaV-9 in several Vitis vinifera cultivars. The economic impact of GLRaV-9 on wine grape cultivars, however, remains to be determined. References: (1) R. Alkowni et al. J. Plant Pathol. 86:123, 2004. (2) N. Mahfoudhi et al. Plant Dis. 91:1359, 2007. (3) R. R. Martin et al. Plant Dis. 89:763, 2005. (4) B. K. Peake et al. Aust. Plant Pathol. 33:445, 2004.
4
Scales, B. Jane, Lipi Turner-Rahman, and Feng Hao. "A Holistic Look at Reference Statistics: Whither Librarians?" Evidence Based Library and Information Practice 10, no. 4 (December 13, 2015): 173. http://dx.doi.org/10.18438/b8x01h.
Full textAbstract:
Abstract
Objective – Washington State University (WSU) Pullman campus librarians track a diverse set of reference statistics to gain a “holistic” look at local reference transaction trends. Our aim was to aggregate virtual, reference desk and office transaction data over the course of three years to determine staffing levels. Specifically, we asked “Where should reference librarians be to answer questions?”
Methods – Using Springshare’s LibAnalytics, we generated longitudinal (2012-2014) statistics and data, to help us assess the patterns and trends of patron question numbers, types, communication modes, and locations in the Terrell Library. With this data, we considered current staffing patterns and how we could best address patron needs.
Results – Researchers found that compiling data across modalities of location, communication, question type, and the READ Scale led to a better understanding of user behavior trends.
Conclusion – Examining and interpreting a more inclusive and richer set of transaction statistics gives reference managers a better picture of how patrons are seeking help, and can serve as a basis for making staffing decisions.
5
Eastwell, K. C., and W. E. Howell. "Characterization of Cherry leafroll virus in Sweet Cherry in Washington State." Plant Disease 94, no. 8 (August 2010): 1067. http://dx.doi.org/10.1094/pdis-94-8-1067b.
Full textAbstract:
A visual survey in 1998 of a commercial block of 594 sweet cherry trees (Prunus avium) in Yakima County, WA, revealed three trees of cv. Bing growing on Mazzard rootstock that exhibited a progressive decline characterized by a premature drop of yellowed leaves prior to fruit maturity and small, late ripening cherries that were unsuitable for the fresh market. Many young branches of these trees died during the winter, resulting in a sparse, open canopy depleted of fruiting shoots. The budded variety of a fourth tree had died, allowing the F12/1 rootstock to grow leaves that showed intense line patterns. Prunus necrotic ringspot virus or Prune dwarf virus are common ilarviruses of cherry trees but were only detected by ELISA (Agdia, Elkhart, IN) in two of the Bing trees. A virus was readily transmitted mechanically from young leaves of each of the two ilarvirus-negative trees to Chenopodium quinoa and Nicotiana occidentalis strain ‘37B’, which within 5 days, developed systemic mottle and necrotic flecking, respectively. Gel analysis of double-stranded RNA (dsRNA) isolated from C. quinoa revealed two abundant bands of approximately 6.5 and 8.0 kbp. The C. quinoa plants and the four symptomatic orchard trees were free of Arabis mosaic virus, Blueberry leaf mottle virus, Peach rosette mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tobacco ringspot virus, Tomato black ring virus, and Tomato ringspot virus when tested by ELISA. However, C. quinoa leaf extracts reacted positively in gel double diffusion assays with antiserum prepared to the cherry isolate of Cherry leafroll virus (CLRV) (2). A CLRV-specific primer (3) was used for first strand synthesis followed by self-primed second strand synthesis to generate cDNAs from the dsRNA. A consensus sequence of 1,094 bp generated from three clones of the 3′-untranslated region (3′-UTR) of CLRV (GenBank Accession No. GU362644) was 98% identical to the 3′-UTR of CLRV isolates from European white birch (GenBank Accession Nos. 87239819 and 87239633) and 96% identical to European CLRV isolates from sweet cherry (GenBank Accession Nos. 87239639 and 8729640) (1). Reverse transcription (RT)-PCR using primers specific for the 3′-UTR (CGACCGTGTAACGGCAACAG, modified from Werner et al. [3] and CACTGCTTGAGTCCGACACT, this study), amplified the expected 344-bp fragment from the original four symptomatic trees and two additional symptomatic trees in the same orchard. Seventy-two nonsymptomatic trees were negative by the RT-PCR for CLRV. In 1999, CLRV was detected by RT-PCR in six of eight samples and seven of eight samples from declining trees in two additional orchards located 2.5 km and 23.3 km from the original site, respectively. Sequences of the 344-bp amplicons from these sites were 99.7% identical to those obtained from the first site. To our knowledge, this is the first report of the natural occurrence of CLRV in sweet cherry in the United States. Unlike other nepoviruses, CLRV appears not to be nematode transmitted; however, since this virus can be seed and pollen borne in some natural and experimental systems, its presence in independent orchards of a major production region raises concern about its long term impact on sweet cherry production. References: (1) K. Rebenstorf et al. J. Virol. 80:2453, 2006. (2) D. G. A. Walkey et al. Phytopathology 63:566, 1973. (3) R. Werner et al. Eur. J. For. Pathol. 27:309, 1997.
6
Mekuria, T., R. R. Martin, and R. A. Naidu. "First Report of the Occurrence of Grapevine fanleaf virus in Washington State Vineyards." Plant Disease 92, no. 8 (August 2008): 1250. http://dx.doi.org/10.1094/pdis-92-8-1250a.
Full textAbstract:
Grapevine fanleaf virus (GFLV; genus Nepovirus, family Comoviridae), responsible for fanleaf degeneration disease, is one of the most important viruses of grapevines worldwide (1). During our reconnaissance studies during 2007, dormant wood cuttings from individual grapevines of wine grape cv. Chardonnay were collected randomly from two geographically separate vineyards in eastern Washington State. Extracts made from cambial scrapings of these cuttings were tested separately for different viruses by single-tube reverse transcription (RT)-PCR using virus-specific primers. Two of the thirty-one grapevines in one vineyard tested positive for GLFV as mixed infection with Grapevine leafroll-associated virus (GLRaV)-3. In another vineyard, six of the twenty-six grapevines tested positive for GFLV as mixed infection with GLRaV-1, GLRaV-3, and Grapevine virus A (GVA) A forward primer (5′-ACCGGATTGACGTGGGTGAT, corresponding to nucleotides [nt] 2231–2250) and reverse primer (5′-CCAAAGTTGGTTTCCCAAGA, complementary to nt 2533–2552) specific to RNA-2 of GFLV-F13 isolate (GenBank Accession No. X16907) were used in RT-PCR assays for the detection of GFLV (4). Primers used for RT-PCR detection of GLRaV-1, GLRaV-2, and GVA were described in Martin et al (2) and Minafra et al (3). The RT-PCR results indicated mixed infection of GFLV with GLRaV-1, GLRaV-3, and GVA. To confirm the presence of GFLV, the 322-bp sequence representing a portion of the coat protein encoded by RNA-2 genomic segment was cloned into pCR2.1 (Invitrogen Corp., Carlsbad, CA). Amplicons obtained from six individual grapevines in the two vineyards were used for cloning. Three independent clones per amplicon were sequenced from both orientations. Pairwise comparison of these sequences showed 99 to 100% nucleotide sequence identity among themselves, indicating that GFLV isolates from the two vineyards may be identical. A comparison of the consensus sequence (GenBank Accession No. EU573307) with corresponding sequences of other GFLVs deposited in GenBank showed 89 to 91% identity at the nucleotide level and 95 to 99% identity at the amino acid level. However, mixed infection of GFLV with different viruses in the two vineyards suggests separate introduction of the planting material. ELISA with GFLV-specific antibodies further confirmed the presence of the virus in samples that were positive in RT-PCR. To our knowledge, this is the first report of GFLV in grapevines grown in the Pacific Northwest states of the United States. Further investigations are being carried out on the distribution, symptoms, molecular variability, and nematode vector transmission of GFLV. References: (1) P. Andret-Link et al. J. Plant Pathol. 86:183, 2004. (2) R. R. Martin et al. Plant Dis. 89:763, 2005. (3) A. Minafra et al. Arch. Virol. 142:417, 1997 (4) A. Rowhani et al. Phytopathology 83:749, 1993.
7
Schroeder, K. L., and T. C. Paulitz. "First Report of Root Rot Caused by Rhizoctonia solani AG-10 on Canola in Washington State." Plant Disease 96, no. 4 (April 2012): 584. http://dx.doi.org/10.1094/pdis-09-11-0809-pdn.
Full textAbstract:
Canola (Brassica napus L) production has gained renewed interest in Washington State over the past few years, primarily for the purpose of producing biofuel. Plants were observed to be showing symptoms of Rhizoctonia root rot and postemergence damping-off. In many cases, this was due to Rhizoctonia solani AG-2-1, which was previously documented (4). However, additional plants were occasionally observed that were stunted and had reduced vigor, but lacked the distinctive severe stem damage and postemergence damping-off, which are both symptoms of infection with R. solani AG-2-1. Isolates of R. solani AG-10 were collected from symptomatic plants or baited from root zone soil at various dryland production locations in eastern Washington, including sites near Colfax, Pullman, and Walla Walla. Initial identification was determined by quantitative (Q)-PCR using R. solani AG-10 specific primers (3). The identity was verified by sequencing random isolates identified by Q-PCR (GenBank Accessions Nos. JQ068147, JQ068148 and JQ068149). All sequenced isolates had 99% identity to previously reported isolates of R. solani AG-10. Six isolates were chosen to test pathogenicity on canola plants in the greenhouse. Sterilized oats were inoculated with each of six isolates of R. solani AG-10 and grown for 4 weeks. The soil was infested with ground oat inoculum (1% wt/wt) and spring canola cv. Sunrise was seeded into 3.8 × 21-cm containers. After 3 weeks of incubation at 15°C, plants were harvested and assessed. Emergence was reduced in the infested soil with 73 to 93% (average 81%) emergence compared with 100% emergence in the noninfested soil. There was no evidence of postemergence damping-off. However, all six isolates of R. solani AG-10 significantly reduced the plant height and top dry weights compared with the noninfested controls. The plant height in infested soil was 28 to 42% (average 34%) shorter and top dry weights were 37 to 70% (average 54%) lower than in noninfested soil. Roots of infected plants had a light brown discoloration along with reduced length and fewer lateral roots. Additional host plants were tested, including wheat (Triticum aestivum L.), barley (Hordeum vulgare L.), pea (Pisum sativum L.), chickpea (Cicer arietinum L.), and lentil (Lens culinaris Medik.). There was no significant reduction in plant height or plant dry weight for any of these hosts. R. solani AG-10 was previously found to be weakly virulent on canola and other cruciferous hosts in Australia (1,2). To our knowledge, this is the first report of R. solani AG-10 causing disease on canola in Washington State. Reference: (1) R. K. Khangura et al. Plant Dis. 83:714, 1999. (2) G. C. MacNish et al. Australas. Plant Pathol. 24:252, 1995. (3) P. A. Okubara et al. Phytopathology 98:837, 2008. (4) T. C. Paulitz et al. Plant Dis. 90:829, 2006.
8
Kulick, Orysia. "Dnipropetrovsk Oligarchs: Lynchpins of Sovereignty or Sources of Instability?" Soviet and Post-Soviet Review 46, no. 3 (August 12, 2019): 352–86. http://dx.doi.org/10.1163/18763324-04603007.
Full textAbstract:
The choices made by oligarchs and citizens in Dnipropetrovsk during and after the Euromaidan rebellion of 2013–14 were not just event-driven manifestations in response to domestic and internal pressures. They were responses shaped by historically-composed social structures and interrelationships forged over decades within the region, across southeastern Ukraine, and in relation to competing centers of power—in Kyiv, Moscow, Washington, Brussels and beyond. This paper argues that Dnipropetrovsk—and its leaders—played a crucial intermediary role in not only deescalating tensions in southeastern Ukraine more broadly, but also by buttressing the Ukrainian state in a time of existential crisis. In this analysis, oligarchic self-interest is taken as a given and one factor among many, including the signaling of interventionist intent from an external patron and also deeper, regionally specific, economic and structural forces. This piece brings into the analysis a historian’s understanding of contingency, arguing that analyses of developments in southeastern Ukraine (in the past and present) should strive to better situate regional actors not only in space but also time, so as to better understand the complex set of forces and heterogenous social temporalities shaping their choices.
9
Dung, J. K. S., D. A. Johnson, and B. K. Schroeder. "First Report of Pectobacterium wasabiae Causing Aerial Stem Rot of Potato in Washington State." Plant Disease 96, no. 12 (December 2012): 1819. http://dx.doi.org/10.1094/pdis-05-12-0444-pdn.
Full textAbstract:
Aerial stem rot of potato (Solanum tuberosum), also known as bacterial stem rot, is often caused by the pectolytic bacteria Pectobacterium (Erwinia) carotovorum subsp. carotovorum, P. atrosepticum, or Dickeya spp. (3). A survey was carried out in August 2008 in ‘Russet Burbank’ potato fields exhibiting aerial stem rot symptoms in the Columbia Basin of Washington State. One bacterial strain isolated during the survey, PwO405, exhibited pectolytic ability on crystal violet pectate (CVP) agar and potato slices and failed to grow at 37°C, but physiological tests did not conclusively distinguish the bacterium as P. atrosepticum (1). The bacterium was positive for ONPG, N-acetylglucosaminyl transferase, gelatin liquefaction, and acid production from D-galactose, lactose, melibiose, raffinose, citrate, and trehalose. The bacterium was negative for indole production and acid production from maltose, α-methyl-D-glucoside, sorbitol, D-arabitol, inositol, inulin, and melezitose. Molecular identification of the bacterium was performed with 16S rRNA, aconitase (acnA), and malate dehydrogenase (mdh) coding sequences as previously described (2,4). Partial sequences of 16S rRNA (1,408 bp) and acnA (412 bp) genes (GenBank Accession Nos. JQ723958 and JQ723959, respectively) exhibited 99% shared identities with P. wasabiae strain WPP163, while the mdh sequence (435 bp) (GenBank Accession No. JQ723960) exhibited 100% shared identity with mdh sequences from three P. wasabiae strains (NZEC9, NZEC10, and NZEC8974). Maximum parsimony analysis using concatenated acnA and mdh sequences from this study and Pectobacterium sequences previously deposited in GenBank (2,4) clustered strain PwO405 with other P. wasabiae strains. Three 7-week-old ‘Russet Norkotah’ potato plants were wound-inoculated by inserting a sterile 23 gauge needle just above a central leaf axil at a depth of 1 mm. A 10-μl drop of inoculum (104 CFU) was placed on the wound. Plants were exposed to a 24-h leaf wetness period (90 to 100% RH in a mist chamber) and lesions were measured. All three inoculated plants exhibited aerial stem rot symptoms similar to those observed in the field, including brown water-soaked lesions that spread acropetally and basipetally. Upon drying, the lesions became shriveled and turned dark brown to black. Some plants exhibited hollowing of the stems and unilateral wilt on the side of the lesion. Symptoms were not observed on water-inoculated controls. The bacteria that were reisolated into pure culture from all three inoculated stems caused pitting on CVP and exhibited the same morphology as the original culture and were confirmed as P. wasabiae using 16S rRNA, acnA, and mdh coding sequences, fulfilling Koch's postulates. Stem rot ability of the bacterium was also confirmed on four potato cultivars: ‘Ranger Russet,’ ‘Russet Burbank,’ ‘Russet Norkotah,’ and ‘Umatilla Russet’ by wound-inoculating six single-stem plants of each cultivar as described above. To our knowledge, this is the first report of aerial stem rot of potato caused by P. wasabiae in Washington State. References: (1) S. De Boer and A. Kelman. Page 56 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd ed. N. Schaad et al., ed. APS Press, St. Paul, 2001. (2) A. Pitman et al. Eur. J. Plant Pathol. 32:211, 2010. (3) M. Powelson and G. Franc. Page 10 in: Compendium of Potato Diseases. W. Stevenson et al., ed. APS Press, St. Paul, 2002. (4) M. Yap et al. Appl. Environ. Microbiol. 70:3013, 2004.
10
Dahya, Negin, W. E. King, Kung Jin Lee, and Jin Ha Lee. "Perceptions and experiences of virtual reality in public libraries." Journal of Documentation 77, no. 3 (February 11, 2021): 617–37. http://dx.doi.org/10.1108/jd-04-2020-0051.
Full textAbstract:
PurposeVirtual reality (VR) is becoming a more available technology including in public spaces like libraries. The value and role of VR as a tool for learning and social engagement are unclear. The purpose of this paper is to explore the ways in which library patrons and librarians perceive VR and experience VR through library drop-in programs.Design/methodology/approachThis paper is based on research conducted in seven Washington State Libraries where VR was adopted for drop-in programming for the first time. Data was collected between March and June 2018 and involved interviews with librarians and patrons, a patron user experience survey, and observational field notes from researchers on site during library programs.FindingsFindings are presented in relation to user perceptions of VR compared to their actual VR experiences, and in relation to informal learning and social engagements. The authors frame the analysis and discussion in relation to sociotechnical imaginaries – culturally situated ideas about the relationship between society and technology, and considering the larger cultural landscape that informs collective views about the present and future.Social implicationsThe paper discusses pending and potential inequalities related to gender, race and class in conversation with technology industry and VR. Issues discussed include unequal access to technology in public libraries and representation of minoritized groups in VR.Originality/valueThis work takes a critical perspective considering the inequities in relation to mainstreaming VR through public spaces like libraries.
Books on the topic "Washington State Patrol"
1
Washington (State). Legislature. Joint Legislative Audit and Review Committee. Washington State Patrol performance audit. Olympia (506 16th Ave SE., Olympia 98501-2323): State of Washington, Joint Legislative Audit and Review Committee, 1999.
Find full text
2
Patrol, Washington State. Washington State Patrol 2010: An award winning agency. Evansville, IN: Washington State Patrol Memorial Foundation, 2010.
Find full text
3
Services, Washington (State) Dept of Social and Health. [DSHS response to Washington State Patrol report on OK Boys Ranch]. Olympia, Wash: State of Washington, Department of Social and Health Services, 1996.
Find full text
4
Patrol, Washington State. WSP 2005 organizational chart: Effective May 16, 2005. [Olympia, Wash.]: The Patrol, 2005.
Find full text
5
Washington (State). Legislature. Legislative Budget Committee. Program and fiscal review of vehicle inspection program (Washington State Patrol): A report to the Washington State Legislature. Olympia (506 E. 16th Ave., Olympia 98504): State of Washington, Legislative Budget Committee, 1985.
Find full text
6
Dizon, Jesus. Washington State Patrol Multi-Jurisdictional Regional Narcotics Task Force Participation and Support Program: Program evaluation. Olympia, Wash. (906 Columbia St. SW, Olympia 98504-8300): Washington State Community, Trade and Economic Development, 1996.
Find full text
7
Washington (State). Legislature. Legislative Transportation Committee. Budget and policy recommendations for transportation agencies' budgets, 1991-93 biennium. [Olympia, Wash.]: The Committee, 1991.
Find full text
8
Gould, Hauberg Anne, ed. Anne Gould Hauberg: Fired by beauty. Seattle: University of Washington Press, 2005.
Find full text
9
Bonn, Moritz J. Defense, maritime patrol aircraft: Memorandum of understanding between the United States of America and the Federal Republic of Germany, signed at Bonn and Washington, February 17 and April 1989 with annexes. Washington, D.C: Dept. of State, 1998.
Find full text
10
Lawton, Thomas. Freer: A legacy of art. Washington, D.C: Freer Gallery of Art, Smithsonian Institution, 1993.
Find full textBook chapters on the topic "Washington State Patrol"
1
Symonds, Craig L. "1. An Ad Hoc Navy." In American Naval History: A Very Short Introduction, 1–11. Oxford University Press, 2018. http://dx.doi.org/10.1093/actrade/9780199394760.003.0001.
Full textAbstract:
‘An ad hoc navy: the Revolutionary War (1775–1783)’ describes the Patriots’ response to the British Royal Navy strongholds in Boston and New York and the role of armed vessels during the Revolutionary War. It begins with George Washington’s attempts to threaten the British supply line using boats. The Continental Navy was founded on October 13, 1775, but the new program could hardly challenge the Royal Navy. With the exception of John Paul Jones, the Continental Navy proved mostly disappointing. The United States won its independence largely because the determination of the Patriot forces outlasted the British willingness to fight—and to pay for—a war three thousand miles away.
2
Shnookal, Deborah. "Conclusion." In Operation Pedro Pan and the Exodus of Cuba's Children, 213–22. University Press of Florida, 2020. http://dx.doi.org/10.5744/florida/9781683401551.003.0008.
Full textAbstract:
This book concludes that by the time the Cuban Missile Crisis occurred in October 1962, Operation Pedro Pan had largely served its purpose in the U.S. covert action program and propaganda war against the Cuban revolution. The cancellation of direct flights between the United States and Cuba and Washington’s policy to keep Cuba isolated meant that the children’s reunification with their families was made very difficult and delayed. While Cuban parents may have had many motives in sending their children as unaccompanied minors to Miami, the author argues that, in general, U.S. government political objectives overrode humanitarian concerns for the children’s welfare and Cuban family reunification. She concludes that Operation Pedro Pan was largely unjustified and based on a fabricated Cold War scare about patria potestad that manipulated Cuban parents’ fears and resulted in the unnecessary separation of thousands of Cuban children from their families—in many cases for several years and, in some cases, with tragic consequences.
3
Zukin, Sharon. "Union Square and the Paradox of Public Space." In Naked City. Oxford University Press, 2010. http://dx.doi.org/10.1093/oso/9780195382853.003.0011.
Full textAbstract:
At 6 o’clock on a weekday evening in early July, Union Square is most alive. The small, oval park at its center, three acres of green nestled between four broad streets, throbs with music and conversation, with voices rising and swelling to join the steady drone of traffic on all sides. You see children swinging under their parents’ eye in small playgrounds on the park’s northern edge; at the southern end you pick your way carefully through a swarm of a couple hundred young men and women who are milling around the wide, shallow stone steps leading up to the park’s main entrance. Tourists browse the T-shirt and art vendors’ tables while other shoppers stop at the Greenmarket on their way home, and every fifth person in the crowd is making a call or reading a text message on their cell phone. The crowd skews young, mostly under thirty-five, their faces are mainly white but also black and brown and several shades of tan, and you hear a girl ask, “Where are you? Are you in front?” in Japanese on her phone. Next to the subway entrance a lone political demonstrator uses a portable loudspeaker to make a speech against the U.S. president; nearby, under a statue of George Washington on horseback, two New York City police officers, also on horseback, interrupt their early evening patrol to chat with a park cleaner in a bright red uniform and a private security guard in navy pants and a matching cap. So many people are sitting on green wooden benches under the trees that you can hardly find two seats together. Most of the occupants are watching the parade of passersby; some are listening through earbuds to portable music players, others read a book, and one or two doze. In the fenced-in dog run, pets frisk about while their owners laugh and talk. A trio of young musicians sits on benches in the middle of the park, setting up a cello and two violins for an informal outdoor rehearsal.
Conference papers on the topic "Washington State Patrol"
1
"Ethos, Pathos and Logos: Rhetorical Fixes for an Old Problem: Fake News." In InSITE 2019: Informing Science + IT Education Conferences: Jerusalem. Informing Science Institute, 2019. http://dx.doi.org/10.28945/4154.
Full textAbstract:
Aim/Purpose: The proliferation of fake news through social media threatens to undercut the possibility of ascertaining facts and truth. This paper explores the use of ancient rhetorical tools to identify fake news generally and to see through the misinformation juggernaut of President Donald Trump. Background: The ancient rhetorical appeals described in Aristotle’s Rhetoric—ethos (character of the speaker), pathos (nature of the audience) and logos (message itself)—might be a simple, yet profound fix for the era of fake news. Also known as the rhetorical triangle and used as an aid for effective public speaking by the ancient Greeks, the three appeals can also be utilized for analyzing the main components of discourse. Methodology: Discourse analysis utilizes insights from rhetoric, linguistics, philosophy and anthropology in in order to interpret written and spoken texts. Contribution This paper analyzes Donald Trump’s effective use of Twitter and campaign rallies to create and sustain fake news. Findings: At the point of the writing of this paper, the Washington Post Trump Fact Checker has identified over 10,000 untruths uttered by the president in his first two years of office, for an average of eight untruths per day. In addition, analysis demonstrates that Trump leans heavily on ethos and pathos, almost to the exclusion of logos in his tweets and campaign rallies, making spectacular claims, which seem calculated to arouse emotions and move his base to action. Further, Trump relies heavily on epideictic rhetoric (praising and blaming), excluding forensic (legal) and deliberative rhetoric, which the ancients used for sustained arguments about the past or deliberations about the future of the state. In short, the analysis uncovers how and ostensibly why Trump creates and sustains fake news while claiming that other traditional news outlets, except for FOX news, are the actual purveyors of fake news. Recommendations for Practitioners: Information systems and communication practitioners need to be aware of the ways in which the systems they create and monitor are vulnerable to targeted attacks of the purveyors of fake news. Recommendation for Researchers: Further research on the identification and proliferation of fake news from a variety of disciplines is needed, in order to stem the flow of misinformation and untruths through social media. Impact on Society: The impact of fake news is largely unknown and needs to be better understood, especially during election cycles. Some researchers believe that social media constitute a fifth estate in the United States, challenging the authority of the three branches of government and the traditional press. Future Research: As noted above, further research on the identification and proliferation of fake news from a variety of disciplines is needed, in order to stem the flow of misinformation and untruths through social media.
Reports on the topic "Washington State Patrol"
1
Arhin, Stephen, Babin Manandhar, Hamdiat Baba Adam, and Adam Gatiba. Predicting Bus Travel Times in Washington, DC Using Artificial Neural Networks (ANNs). Mineta Transportation Institute, April 2021. http://dx.doi.org/10.31979/mti.2021.1943.
Full textAbstract:
Washington, DC is ranked second among cities in terms of highest public transit commuters in the United States, with approximately 9% of the working population using the Washington Metropolitan Area Transit Authority (WMATA) Metrobuses to commute. Deducing accurate travel times of these metrobuses is an important task for transit authorities to provide reliable service to its patrons. This study, using Artificial Neural Networks (ANN), developed prediction models for transit buses to assist decision-makers to improve service quality and patronage. For this study, we used six months of Automatic Vehicle Location (AVL) and Automatic Passenger Counting (APC) data for six Washington Metropolitan Area Transit Authority (WMATA) bus routes operating in Washington, DC. We developed regression models and Artificial Neural Network (ANN) models for predicting travel times of buses for different peak periods (AM, Mid-Day and PM). Our analysis included variables such as number of served bus stops, length of route between bus stops, average number of passengers in the bus, average dwell time of buses, and number of intersections between bus stops. We obtained ANN models for travel times by using approximation technique incorporating two separate algorithms: Quasi-Newton and Levenberg-Marquardt. The training strategy for neural network models involved feed forward and errorback processes that minimized the generated errors. We also evaluated the models with a Comparison of the Normalized Squared Errors (NSE). From the results, we observed that the travel times of buses and the dwell times at bus stops generally increased over time of the day. We gathered travel time equations for buses for the AM, Mid-Day and PM Peaks. The lowest NSE for the AM, Mid-Day and PM Peak periods corresponded to training processes using Quasi-Newton algorithm, which had 3, 2 and 5 perceptron layers, respectively. These prediction models could be adapted by transit agencies to provide the patrons with accurate travel time information at bus stops or online.